#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ESPNP	284729	broad.mit.edu	37	1	17034125	17034126	+	RNA	INS	-	-	AGCT	rs141324796|rs79472512	byFrequency	TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:17034125_17034126insAGCT	ENST00000492551.1	-	0	477_478					NR_026567.1				espin pseudogene																		CAGCAGCAGCCAGCTGAGCACC	0.718														1500	0.299521	0.1188	0.3444	5008	,	,		24180	0.4177		0.3101	False		,,,				2504	0.3793				.													.	.			0			.																																											0	.			AGCAGCCAGCTGA	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17034126_17034129dupAGCT			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	13	0.77	10	.	0		0		RNA	INS	ENST00000492551.1	37																																																																																						0.718	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000326311.1			
NBL1	4681	broad.mit.edu	37	1	19981664	19981664	+	Silent	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:19981664C>T	ENST00000375136.3	+	2	444	c.141C>T	c.(139-141)agC>agT	p.S47S	NBL1_ENST00000548815.1_Silent_p.S46S|NBL1_ENST00000289749.2_Silent_p.S82S|MINOS1-NBL1_ENST00000602662.1_Silent_p.S47S	NM_001204085.1|NM_001204089.1|NM_001278164.1|NM_001278166.1	NP_001191014.1|NP_001191018.1|NP_001265093.1|NP_001265095.1	P41271	NBL1_HUMAN	neuroblastoma 1, DAN family BMP antagonist	47	CTCK.				determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of monocyte chemotaxis (GO:0090027)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)|positive regulation of neuron differentiation (GO:0045666)|sequestering of BMP from receptor via BMP binding (GO:0038098)|sequestering of BMP in extracellular matrix (GO:0035582)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)	p.S46S(1)		lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TGGGCCACAGCGGCTGTGAGG	0.627																																					p.S82S													NBL1,NS,carcinoma,0,1	NBL1	21	1	1	Substitution - coding silent(1)	prostate(1)	c.C246T												33.0	27.0	29.0					1																	19981664		2202	4300	6502	SO:0001819	synonymous_variant	4681	exon2			CCACAGCGGCTGT		CCDS196.1, CCDS41278.1, CCDS196.2, CCDS72720.1	1p36.3-p36.2	2013-02-26	2013-02-26		ENSG00000158747	ENSG00000158747			7650	protein-coding gene	gene with protein product	"""neuroblastoma candidate region, suppression of tumorigenicity 1"", ""neuroblastoma suppressor of tumorigenicity 1"", ""differential screening-selected gene aberrant in neuroblastoma"""	600613	"""neuroblastoma, suppression of tumorigenicity 1"""			7633401	Standard	NM_182744		Approved	D1S1733E, NB, DAN, NO3, DAND1	uc001bcj.2	P41271	OTTHUMG00000002700	ENST00000375136.3:c.141C>T	1.37:g.19981664C>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	98	0.03	3	NM_182744	216	0.00	0	A3KFI7|Q5TGZ2|Q5U0N4|Q96L68	Silent	SNP	ENST00000375136.3	37	CCDS196.2																																																																																					0.627	NBL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000007681.4		NM_005380	
WNT4	54361	mdanderson.org	37	1	22446566	22446566	+	Missense_Mutation	SNP	C	C	T	rs201176310		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:22446566C>T	ENST00000290167.6	-	5	1076	c.1033G>A	c.(1033-1035)Gtg>Atg	p.V345M	WNT4_ENST00000542383.1_Missense_Mutation_p.V290M	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4	345					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		TGCAACTCCACGAGCCGCTGG	0.637																																					p.V345M													WNT4,caecum,carcinoma,+1,1	WNT4	1	1	0			c.G1033A												24.0	24.0	24.0					1																	22446566		2203	4298	6501	SO:0001583	missense	54361	exon5			ACTCCACGAGCCG	AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.1033G>A	1.37:g.22446566C>T	ENSP00000290167:p.Val345Met		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	44	0.09	4	NM_030761	0		0	B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Missense_Mutation	SNP	ENST00000290167.6	37	CCDS223.1	.	.	.	.	.	.	.	.	.	.	c	22.3	4.272523	0.80580	.	.	ENSG00000162552	ENST00000290167;ENST00000542383	T;T	0.76839	-1.05;-1.05	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	D	0.88262	0.6389	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.90327	0.4349	10	0.87932	D	0	.	15.5591	0.76223	0.0:1.0:0.0:0.0	.	345	P56705	WNT4_HUMAN	M	345;290	ENSP00000290167:V345M;ENSP00000441033:V290M	ENSP00000290167:V345M	V	-	1	0	WNT4	22319153	0.992000	0.36948	0.994000	0.49952	0.938000	0.57974	3.010000	0.49559	2.312000	0.78011	0.450000	0.29827	GTG			0.637	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008088.2			
LEPRE1	64175	mdanderson.org	37	1	43213951	43213951	+	Silent	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:43213951G>T	ENST00000296388.5	-	12	1809	c.1758C>A	c.(1756-1758)gtC>gtA	p.V586V	LEPRE1_ENST00000397054.3_Silent_p.V586V|LEPRE1_ENST00000462474.1_5'Flank|LEPRE1_ENST00000236040.4_Silent_p.V586V			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	586	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TGTCCACGTGGACTGGATGAC	0.577																																					p.V586V													.	.			0			c.C1758A												136.0	111.0	119.0					1																	43213951		2203	4300	6503	SO:0001819	synonymous_variant	64175	exon12			CACGTGGACTGGA	AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1758C>A	1.37:g.43213951G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_022356	57	0.00	0	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Silent	SNP	ENST00000296388.5	37	CCDS472.2																																																																																					0.577	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000019790.2		NM_022356	
FAF1	11124	broad.mit.edu	37	1	50907170	50907170	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:50907170G>T	ENST00000396153.2	-	19	2346	c.1895C>A	c.(1894-1896)tCa>tAa	p.S632*	FAF1_ENST00000371778.4_Nonsense_Mutation_p.S632*|FAF1_ENST00000545823.1_Nonsense_Mutation_p.S390*	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	632	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		CTCCAATAATGATTTATTTGG	0.398																																					p.S632X													.	FAF1	64		0			c.C1895A												39.0	37.0	38.0					1																	50907170		2133	4161	6294	SO:0001587	stop_gained	11124	exon19			AATAATGATTTAT	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.1895C>A	1.37:g.50907170G>T	ENSP00000379457:p.Ser632*		Somatic	121	0.0082644628	1		WXS	Illumina HiSeq	Phase_I	131	0.03	4	NM_007051	152	0.00	0	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Nonsense_Mutation	SNP	ENST00000396153.2	37	CCDS554.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712274	0.89112	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000545823;ENST00000371780;ENST00000543607	.	.	.	6.03	6.03	0.97812	.	0.132273	0.51477	D	0.000083	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-0.3918	18.7374	0.91761	0.0:0.0:1.0:0.0	.	.	.	.	X	632;632;390;472;480	.	ENSP00000360843:S632X	S	-	2	0	FAF1	50679758	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.163000	0.77524	2.861000	0.98227	0.655000	0.94253	TCA			0.398	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021807.1		NM_007051	
NEXN	91624	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	78407806	78407808	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:78407806_78407808delAGA	ENST00000334785.7	+	12	1756_1758	c.1572_1574delAGA	c.(1570-1575)agagaa>aga	p.E528del	NEXN_ENST00000480732.2_3'UTR|NEXN_ENST00000330010.8_In_Frame_Del_p.E464del|NEXN_ENST00000457030.1_In_Frame_Del_p.E514del|FUBP1_ENST00000489495.1_5'Flank	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		CTAAGGCAAGAGAAGAAGAAGAA	0.384																																					p.524_525del													.	NEXN	77		0			c.1571_1573del								,	24,3528		10,4,1762					,	5.7	1.0			68	55,7803		25,5,3899	no	coding,coding	NEXN	NM_144573.3,NM_001172309.1	,	35,9,5661	A1A1,A1R,RR		0.6999,0.6757,0.6924	,	,		79,11331				SO:0001651	inframe_deletion	91624	exon12			GGCAAGAGAAGAA	AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.1572_1574delAGA	1.37:g.78407815_78407817delAGA	ENSP00000333938:p.Glu528del		Somatic	164	0	0		WXS	Illumina HiSeq	.	158	0.16	26	NM_144573	28	0.00	0		In_Frame_Del	DEL	ENST00000334785.7	37	CCDS41351.1																																																																																					0.384	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097549.1		NM_144573	
SEC22B	9554	broad.mit.edu	37	1	145109975	145109976	+	RNA	INS	-	-	C	rs376446977|rs11458983		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:145109975_145109976insC	ENST00000453618.1	+	0	673							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CAGGAACTTTGCTAAAGATCTA	0.386																																					.													.	.			0			.																																											9554	.			AACTTTGCTAAAG	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109976_145109976dupC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.386	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
NBPF10	100132406	hgsc.bcm.edu	37	1	145293535	145293535	+	Missense_Mutation	SNP	C	C	G	rs55936365		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:145293535C>G	ENST00000369339.3	+	3	383	c.130C>G	c.(130-132)Cta>Gta	p.L44V	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000342960.5_Missense_Mutation_p.L44V			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	315						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L44V(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAAATGTTTTCTAACTCAACT	0.443																																					p.L44V													NBPF10,NS,carcinoma,0,2	NBPF10	0	2	2	Substitution - Missense(2)	kidney(2)	c.C130G																																									SO:0001583	missense	100132406	exon1			TGTTTTCTAACTC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.130C>G	1.37:g.145293535C>G	ENSP00000358345:p.Leu44Val		Somatic	67	0.0149253731	1		WXS	Illumina HiSeq	.	92	0.10	9	NM_001039703	19	0.00	0	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.360141|-1.360141	0.01245|0.01245	.|.	.|.	ENSG00000163386|ENSG00000163386	ENST00000369339;ENST00000342960|ENST00000448873	T|.	0.02837|.	4.14|.	0.687|0.687	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.01765|0.01765	0.0056|0.0056	N|N	0.01122|0.01122	-1.005|-1.005	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33007|0.33007	-0.9885|-0.9885	9|6	0.02654|0.33141	T|T	1|0.24	.|.	3.2142|3.2142	0.06692|0.06692	0.3787:0.2355:0.3858:0.0|0.3787:0.2355:0.3858:0.0	rs55936365|rs55936365	44|.	A8MQ30|.	.|.	V|C	44|3	ENSP00000345684:L44V|.	ENSP00000345684:L44V|ENSP00000414194:S3C	L|S	+|+	1|2	2|0	NBPF10|NBPF10	144004892|144004892	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.451000|-3.451000	0.00466|0.00466	-3.626000|-3.626000	0.00130|0.00130	-3.729000|-3.729000	0.00022|0.00022	CTA|TCT			0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding		OTTHUMT00000038550.3		NM_001039703	
APH1A	51107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150238547	150238547	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:150238547T>C	ENST00000369109.3	-	7	969	c.781A>G	c.(781-783)Atc>Gtc	p.I261V	APH1A_ENST00000414276.2_Missense_Mutation_p.I191V|APH1A_ENST00000360244.4_3'UTR|C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000461320.1_5'Flank	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit	261					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCGGGTGGGATGCGCAGGGCA	0.632																																					p.I261V													.	.			0			c.A781G												26.0	30.0	29.0					1																	150238547		1957	4125	6082	SO:0001583	missense	51107	exon7			GTGGGATGCGCAG	AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.781A>G	1.37:g.150238547T>C	ENSP00000358105:p.Ile261Val		Somatic	323	0	0		WXS	Illumina HiSeq	.	411	0.30	124	NM_001077628	198	0.24	47	B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	Missense_Mutation	SNP	ENST00000369109.3	37	CCDS41390.1	.	.	.	.	.	.	.	.	.	.	T	6.287	0.421018	0.11928	.	.	ENSG00000117362	ENST00000369109;ENST00000414276	T;T	0.41758	1.0;0.99	6.16	2.4	0.29515	.	0.233808	0.37261	N	0.002174	T	0.05502	0.0145	N	0.08118	0	0.23620	N	0.997272	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.0	T	0.31806	-0.9930	10	0.23302	T	0.38	-5.8527	1.2774	0.02033	0.1471:0.1551:0.1538:0.544	.	191;261	B4DQK0;Q96BI3	.;APH1A_HUMAN	V	261;191	ENSP00000358105:I261V;ENSP00000397473:I191V	ENSP00000358105:I261V	I	-	1	0	APH1A	148505171	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	1.367000	0.34204	0.550000	0.28991	-0.323000	0.08544	ATC			0.632	APH1A-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000035048.1		NM_016022	
SLAMF6	114836	broad.mit.edu	37	1	160465888	160465888	+	Silent	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr1:160465888G>T	ENST00000368057.3	-	2	405	c.345C>A	c.(343-345)acC>acA	p.T115T	SLAMF6_ENST00000368055.1_Intron|SLAMF6_ENST00000368059.3_Silent_p.T115T			Q96DU3	SLAF6_HUMAN	SLAM family member 6	115	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.T115T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			GCTTTGCAGAGGTCTTTGTGG	0.428																																					p.T115T													SLAMF6,NS,carcinoma,0,1	SLAMF6	46	1	1	Substitution - coding silent(1)	lung(1)	c.C345A												151.0	145.0	147.0					1																	160465888		2203	4300	6503	SO:0001819	synonymous_variant	114836	exon2			TGCAGAGGTCTTT	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.345C>A	1.37:g.160465888G>T			Somatic	262	0	0		WXS	Illumina HiSeq	Phase_I	315	0.02	5	NM_052931	22	0.00	0	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Silent	SNP	ENST00000368057.3	37	CCDS53394.1																																																																																					0.428	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000059010.1		NM_052931	
BNIP3	664	mdanderson.org	37	10	133784438	133784438	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr10:133784438C>A	ENST00000368636.4	-	4	443	c.319G>T	c.(319-321)Gaa>Taa	p.E107*	BNIP3_ENST00000540159.1_Nonsense_Mutation_p.E107*	NM_004052.2	NP_004043.2	Q12983	BNIP3_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3	107					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|brown fat cell differentiation (GO:0050873)|cell death (GO:0008219)|cellular response to cobalt ion (GO:0071279)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|intrinsic apoptotic signaling pathway in response to hypoxia (GO:1990144)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|negative regulation of membrane potential (GO:0045837)|negative regulation of mitochondrial fusion (GO:0010637)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane permeability (GO:0046902)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase binding (GO:0051020)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(35;4e-11)|all_epithelial(44;5.07e-08)|Ovarian(717;2.61e-05)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Breast(234;0.023)|all_neural(114;0.0299)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)		Epithelial(32;1.59e-12)|all cancers(32;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(35;2.57e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AAGATGCTTTCAACTTCTTTC	0.453																																					p.E107X													.	.			0			c.G319T												88.0	86.0	86.0					10																	133784438		2203	4300	6503	SO:0001587	stop_gained	664	exon4			TGCTTTCAACTTC	U15174	CCDS7663.1	10q26.3	2003-11-05	2002-08-29		ENSG00000176171	ENSG00000176171			1084	protein-coding gene	gene with protein product		603293	"""BCL2/adenovirus E1B 19kD-interacting protein 3"""			7954800	Standard	NM_004052		Approved	Nip3	uc001lkv.1	Q12983	OTTHUMG00000019278	ENST00000368636.4:c.319G>T	10.37:g.133784438C>A	ENSP00000357625:p.Glu107*		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_004052	438	0.00	0	O14620|Q96GP0	Nonsense_Mutation	SNP	ENST00000368636.4	37	CCDS7663.1	.	.	.	.	.	.	.	.	.	.	C	35	5.440668	0.96168	.	.	ENSG00000176171	ENST00000368636;ENST00000540159	.	.	.	3.96	3.96	0.45880	.	0.049104	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-10.391	17.3272	0.87252	0.0:1.0:0.0:0.0	.	.	.	.	X	107	.	ENSP00000357625:E107X	E	-	1	0	BNIP3	133634428	1.000000	0.71417	0.833000	0.33012	0.916000	0.54674	6.576000	0.74023	2.506000	0.84524	0.655000	0.94253	GAA			0.453	BNIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051039.1			
MUC2	4583	hgsc.bcm.edu	37	11	1092884	1092884	+	Missense_Mutation	SNP	C	C	T	rs201415503		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr11:1092884C>T	ENST00000441003.2	+	30	4730	c.4703C>T	c.(4702-4704)aCg>aTg	p.T1568M	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1569M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1569M(2)|p.T1568M(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACCACCACGGTGacccca	0.637																																					p.T1568M													MUC2_ENST00000441003,NS,carcinoma,0,8	MUC2_ENST00000441003	0	8	4	Substitution - Missense(4)	large_intestine(2)|skin(2)	c.C4703T												129.0	172.0	157.0					11																	1092884		1964	3669	5633	SO:0001583	missense	4583	exon30			CCACCACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4703C>T	11.37:g.1092884C>T	ENSP00000415183:p.Thr1568Met		Somatic	44	0.0227272727	1		WXS	Illumina HiSeq	.	57	0.09	5	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.409	-0.335727	0.05278	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14893	2.5;2.47	1.63	0.367	0.16140	.	25.055600	0.00797	U	0.001394	T	0.21841	0.0526	.	.	.	0.09310	N	1	D	0.76494	0.999	P	0.48425	0.577	T	0.35301	-0.9794	9	0.45353	T	0.12	.	8.9064	0.35526	0.0:0.7681:0.2319:0.0	.	1568	E7EUV1	.	M	1568;1569	ENSP00000415183:T1568M;ENSP00000351956:T1569M	ENSP00000351956:T1569M	T	+	2	0	MUC2	1082884	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.878000	0.28126	0.945000	0.37605	0.121000	0.15741	ACG			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
LTBP3	4054	broad.mit.edu	37	11	65325326	65325328	+	In_Frame_Del	DEL	CAG	CAG	-	rs577530923	byFrequency	TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr11:65325326_65325328delCAG	ENST00000301873.5	-	1	371_373	c.103_105delCTG	c.(103-105)ctgdel	p.L35del	LTBP3_ENST00000322147.4_In_Frame_Del_p.L35del|LTBP3_ENST00000536982.1_5'Flank	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	35	Gly-rich.			Missing (in Ref. 2; BAB15767). {ECO:0000305}.	bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						cgcccaggcccagcagcagcagc	0.818																																					p.35_35del													.	LTBP3	55		0			c.103_105del								,,	2,10,52		1,0,0,5,0,26					,,	2.7	1.0			1	37,32,177		18,0,1,14,4,86	no	codingComplex,utr-5,codingComplex	LTBP3	NM_021070.4,NM_001164266.1,NM_001130144.2	,,	19,0,1,19,4,112	A1A1,A1A2,A1R,A2A2,A2R,RR		28.0488,18.75,26.129	,,	,,		39,42,229				SO:0001651	inframe_deletion	4054	exon1			CAGGCCCAGCAGC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.103_105delCTG	11.37:g.65325335_65325337delCAG	ENSP00000301873:p.Leu35del		Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	10	0.40	4	NM_001130144	0		0	O15107|Q96HB9|Q9H7K2|Q9UFN4	In_Frame_Del	DEL	ENST00000301873.5	37	CCDS44647.1																																																																																					0.818	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390538.1		NM_021070	
TMEM151A	256472	mdanderson.org	37	11	66062288	66062288	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr11:66062288G>A	ENST00000327259.4	+	2	715	c.571G>A	c.(571-573)Ggc>Agc	p.G191S		NM_153266.3	NP_694998.1	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	191						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(4)|lung(6)	11						CACGGCCCGCGGCGAGTTTGA	0.697																																					p.G191S													.	.			0			c.G571A												4.0	4.0	4.0					11																	66062288		1928	3811	5739	SO:0001583	missense	256472	exon2			GCCCGCGGCGAGT	BC033898	CCDS8133.1	11q13.2	2007-10-25	2007-10-25	2007-10-25	ENSG00000179292	ENSG00000179292			28497	protein-coding gene	gene with protein product			"""transmembrane protein 151"""	TMEM151		12477932	Standard	NM_153266		Approved	MGC33486	uc001ohl.3	Q8N4L1	OTTHUMG00000166920	ENST00000327259.4:c.571G>A	11.37:g.66062288G>A	ENSP00000326244:p.Gly191Ser		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_153266	0		0	Q8ND14	Missense_Mutation	SNP	ENST00000327259.4	37	CCDS8133.1	.	.	.	.	.	.	.	.	.	.	G	5.215	0.225264	0.09916	.	.	ENSG00000179292	ENST00000327259	.	.	.	4.57	4.57	0.56435	.	0.385122	0.25040	N	0.033615	T	0.07548	0.0190	N	0.00841	-1.15	0.27909	N	0.938704	B	0.24483	0.104	B	0.13407	0.009	T	0.29119	-1.0022	9	0.09590	T	0.72	.	5.7332	0.18051	0.0976:0.0:0.7073:0.1951	.	191	Q8N4L1	T151A_HUMAN	S	191	.	ENSP00000326244:G191S	G	+	1	0	TMEM151A	65818864	0.990000	0.36364	0.173000	0.22940	0.224000	0.24922	2.055000	0.41345	2.366000	0.80165	0.561000	0.74099	GGC			0.697	TMEM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391897.1		NM_153266	
POLD3	10714	broad.mit.edu;mdanderson.org	37	11	74351712	74351712	+	Silent	SNP	A	A	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr11:74351712A>G	ENST00000263681.2	+	12	1431	c.1302A>G	c.(1300-1302)aaA>aaG	p.K434K	POLD3_ENST00000532497.1_Silent_p.K328K|POLD3_ENST00000527458.1_Silent_p.K395K	NM_006591.2	NP_006582.1	Q15054	DPOD3_HUMAN	polymerase (DNA-directed), delta 3, accessory subunit	434					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|stomach(1)	18	Breast(11;3.21e-06)					CTGTGAAAAAAGAACCCAGAG	0.483																																					p.K434K													.	POLD3	87		0			c.A1302G												111.0	114.0	113.0					11																	74351712		2200	4293	6493	SO:0001819	synonymous_variant	10714	exon12			GAAAAAAGAACCC	D26018	CCDS8233.1	11q14	2014-06-13			ENSG00000077514	ENSG00000077514		"""DNA polymerases"""	20932	protein-coding gene	gene with protein product	"""DNA polymerase delta subunit p66"", ""Pol delta C subunit (p66)"", ""protein phosphatase 1, regulatory subunit 128"""	611415				10219083	Standard	NM_006591		Approved	P66, KIAA0039, P68, PPP1R128	uc001ovf.2	Q15054	OTTHUMG00000165621	ENST00000263681.2:c.1302A>G	11.37:g.74351712A>G			Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	101	0.04	4	NM_006591	40	0.00	0	B7ZAI6|Q32MZ9|Q32N00	Silent	SNP	ENST00000263681.2	37	CCDS8233.1	.	.	.	.	.	.	.	.	.	.	A	10.07	1.250630	0.22880	.	.	ENSG00000077514	ENST00000532954	.	.	.	5.94	-0.437	0.12272	.	.	.	.	.	T	0.53722	0.1814	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45293	-0.9271	4	.	.	.	-42.5479	7.5286	0.27671	0.2723:0.167:0.5607:0.0	.	.	.	.	G	57	.	.	R	+	1	2	POLD3	74029360	0.976000	0.34144	0.996000	0.52242	0.996000	0.88848	0.021000	0.13489	-0.044000	0.13491	0.528000	0.53228	AGA			0.483	POLD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385376.1		NM_006591	
APOA4	337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	116692311	116692311	+	Missense_Mutation	SNP	G	G	A	rs558629714		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr11:116692311G>A	ENST00000357780.3	-	3	577	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	155	13 X 22 AA approximate tandem repeats.				cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		GTCAGCTGGCGCCGCAGCTGC	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		17787	0.0		0.0	False		,,,				2504	0.001				p.R155C													.	.			0			c.C463T												50.0	48.0	49.0					11																	116692311		2200	4295	6495	SO:0001583	missense	337	exon3			GCTGGCGCCGCAG		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.463C>T	11.37:g.116692311G>A	ENSP00000350425:p.Arg155Cys		Somatic	38	0	0		WXS	Illumina HiSeq	.	43	0.26	11	NM_000482	0		0	A8MSL6|Q14CW8|Q6Q787	Missense_Mutation	SNP	ENST00000357780.3	37	CCDS31681.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930183	0.52866	.	.	ENSG00000110244	ENST00000357780	T	0.75050	-0.9	4.49	-0.0539	0.13816	Apolipoprotein/apolipophorin (1);	1.591660	0.03202	N	0.174891	D	0.86222	0.5881	M	0.84326	2.69	0.09310	N	1	D	0.89917	1.0	D	0.65874	0.939	T	0.68047	-0.5512	10	0.66056	D	0.02	-0.9315	9.7419	0.40424	0.0:0.1237:0.4412:0.4351	.	155	P06727	APOA4_HUMAN	C	155	ENSP00000350425:R155C	ENSP00000350425:R155C	R	-	1	0	APOA4	116197521	0.000000	0.05858	0.003000	0.11579	0.749000	0.42624	-0.028000	0.12350	-0.164000	0.10927	0.462000	0.41574	CGC			0.697	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106279.2		NM_000482	
IFFO1	25900	bcgsc.ca;mdanderson.org	37	12	6650731	6650731	+	Silent	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr12:6650731G>T	ENST00000396840.2	-	8	1562	c.1521C>A	c.(1519-1521)ggC>ggA	p.G507G	RP5-940J5.8_ENST00000499202.2_RNA|IFFO1_ENST00000465801.1_Silent_p.G203G|IFFO1_ENST00000336604.4_Silent_p.G510G|IFFO1_ENST00000356896.4_Silent_p.G511G|IFFO1_ENST00000436152.2_Silent_p.G204G			Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan 1	507						intermediate filament (GO:0005882)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	20						GCACGTCCAGGCCGCGCTTCA	0.667																																					p.G519G													.	IFFO1	55		0			c.C1557A												102.0	90.0	94.0					12																	6650731		2203	4300	6503	SO:0001819	synonymous_variant	25900	exon9			GTCCAGGCCGCGC	AF124432	CCDS8550.1, CCDS41741.1, CCDS8550.2, CCDS73425.1	12p13.31	2013-01-16	2008-09-11	2008-09-11	ENSG00000010295	ENSG00000010295		"""Intermediate filament family orphans"""	24970	protein-coding gene	gene with protein product		610495	"""intermediate filament family orphan"""	IFFO		8771189, 3052284	Standard	NM_001193457		Approved	HOM-TES-103	uc010sfe.2	Q0D2I5	OTTHUMG00000141264	ENST00000396840.2:c.1521C>A	12.37:g.6650731G>T			Somatic	84	0	0		WXS	Illumina HiSeq	Phase_1	103	0.05	5	NM_001193457	40	0.00	0	Q24JT6|Q7L5J9|Q7Z5X4|Q9BQ46	Silent	SNP	ENST00000396840.2	37		.	.	.	.	.	.	.	.	.	.	G	10.48	1.361951	0.24684	.	.	ENSG00000010295	ENST00000416019	.	.	.	5.02	0.665	0.17896	.	.	.	.	.	T	0.54775	0.1879	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48364	-0.9042	4	.	.	.	-18.864	7.8371	0.29376	0.2121:0.3867:0.4011:0.0	.	.	.	.	D	241	.	.	A	-	2	0	IFFO1	6520992	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	0.564000	0.23563	0.484000	0.27630	0.561000	0.74099	GCC			0.667	IFFO1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000280428.1		NM_080730	
BCL2L14	79370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	12232368	12232368	+	Silent	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr12:12232368C>T	ENST00000308721.5	+	2	335	c.129C>T	c.(127-129)ttC>ttT	p.F43F	BCL2L14_ENST00000396367.1_Silent_p.F43F|BCL2L14_ENST00000586576.1_Silent_p.F76F|BCL2L14_ENST00000589718.1_Silent_p.F43F|BCL2L14_ENST00000266434.4_Silent_p.F43F|BCL2L14_ENST00000396369.1_Silent_p.F43F	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	43					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		CTGCTCTCTTCTCACCAAAGC	0.468																																					p.F43F													.	.			0			c.C129T												78.0	74.0	75.0					12																	12232368		2203	4300	6503	SO:0001819	synonymous_variant	79370	exon2			TCTCTTCTCACCA	AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.129C>T	12.37:g.12232368C>T			Somatic	122	0	0		WXS	Illumina HiSeq	.	156	0.19	29	NM_138723	4	0.00	0	A8KAD0|Q96QR5|Q9BZR7	Silent	SNP	ENST00000308721.5	37	CCDS8645.1																																																																																					0.468	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355994.3		NM_030766	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	G	rs121913529		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr12:25398284C>G	ENST00000256078.4	-	2	98	c.35G>C	c.(34-36)gGt>gCt	p.G12A	KRAS_ENST00000556131.1_Missense_Mutation_p.G12A|KRAS_ENST00000311936.3_Missense_Mutation_p.G12A|KRAS_ENST00000557334.1_Missense_Mutation_p.G12A	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12A	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,25136	KRAS_ENST00000256078	0	25136	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35C												91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>C	12.37:g.25398284C>G	ENSP00000256078:p.Gly12Ala		Somatic	197	0	0		WXS	Illumina HiSeq	.	285	0.17	48	NM_004985	16	0.19	3	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996285	0.93167	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	M	0.74546	2.27	0.80722	D	1	P;P	0.52842	0.898;0.956	P;P	0.55303	0.658;0.773	D	0.87064	0.2155	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	A	12	ENSP00000308495:G12A;ENSP00000452512:G12A;ENSP00000256078:G12A;ENSP00000451856:G12A	ENSP00000256078:G12A	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
KIAA1551	55196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	32134098	32134098	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr12:32134098C>T	ENST00000312561.4	+	4	623	c.209C>T	c.(208-210)cCt>cTt	p.P70L	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	70																	CAAAATTATCCTCAACAAATT	0.383																																					p.P70L													.	.			0			c.C209T												78.0	77.0	77.0					12																	32134098		2203	4300	6503	SO:0001583	missense	55196	exon4			ATTATCCTCAACA	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.209C>T	12.37:g.32134098C>T	ENSP00000310338:p.Pro70Leu		Somatic	114	0	0		WXS	Illumina HiSeq	.	163	0.17	28	NM_018169	81	0.15	12	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	C	13.20	2.165946	0.38217	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.08896	3.04;3.04	5.04	0.909	0.19332	.	0.306176	0.23307	N	0.049608	T	0.04182	0.0116	L	0.32530	0.975	0.09310	N	0.999991	B	0.33318	0.408	B	0.24269	0.052	T	0.36915	-0.9728	9	.	.	.	.	2.1437	0.03781	0.1561:0.5134:0.1518:0.1787	.	70	Q9HCM1	CL035_HUMAN	L	70	ENSP00000310338:P70L;ENSP00000370442:P70L	.	P	+	2	0	C12orf35	32025365	0.001000	0.12720	0.053000	0.19242	0.328000	0.28507	0.204000	0.17335	0.122000	0.18314	-0.145000	0.13849	CCT			0.383	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250307.2		NM_018169	
TPTE2	93492	bcgsc.ca	37	13	20056686	20056686	+	Splice_Site	SNP	T	T	C	rs201542496		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr13:20056686T>C	ENST00000400230.2	-	4	165	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	TPTE2_ENST00000382977.4_Splice_Site_p.M41V|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382978.1_Splice_Site_p.M41V|TPTE2_ENST00000457266.2_Splice_Site_p.M41V|TPTE2_ENST00000400103.2_Splice_Site_p.M41V|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382975.4_Splice_Site_p.M41V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	41					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTTCTAACATACTTTAGCCA	0.313																																					p.M41V													.	TPTE2	225		0			c.A121G												47.0	46.0	47.0					13																	20056686		2202	4298	6500	SO:0001630	splice_region_variant	93492	exon5			CTAACATACTTTA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.120-1A>G	13.37:g.20056686T>C			Somatic	572	0.0052447552	3		WXS	Illumina HiSeq	Phase_1	586	0.02	13	NM_199254	0		0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.805163	0.00075	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94376	-3.41;-3.33;-3.28;-3.28;-3.41;-3.33	2.06	0.838	0.18902	.	0.589765	0.15086	U	0.281346	D	0.83399	0.5246	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68424	-0.5412	9	.	.	.	0.2742	3.9369	0.09310	0.0:0.1886:0.0:0.8114	.	41;41	A8MX64;Q6XPS3	.;TPTE2_HUMAN	V	41	ENSP00000372438:M41V;ENSP00000382974:M41V;ENSP00000383089:M41V;ENSP00000372437:M41V;ENSP00000372435:M41V;ENSP00000442218:M41V	.	M	-	1	0	TPTE2	18954686	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	0.235000	0.21160	0.383000	0.25322	ATG			0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_199254	Missense_Mutation
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr13:50235160G>C	ENST00000242827.6	-	4	615	c.565C>G	c.(565-567)Cta>Gta	p.L189V	EBPL_ENST00000378270.5_3'UTR|EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378272.5_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	189					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.L189V(9)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418																																					p.L189V	NSCLC(39;857 1083 36109 42364 51411)												EBPL,NS,carcinoma,0,9	EBPL	44	9	9	Substitution - Missense(9)	endometrium(6)|kidney(3)	c.C565G												67.0	67.0	67.0					13																	50235160		2203	4300	6503	SO:0001583	missense	84650	exon4			GTTCTAGCCATGA	AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.565C>G	13.37:g.50235160G>C	ENSP00000242827:p.Leu189Val		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	162	0.02	3	NM_032565	127	0.00	0	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	C	3.076	-0.189988	0.06299	.	.	ENSG00000123179	ENST00000242827	D	0.97850	-4.57	5.61	2.84	0.33178	.	0.689671	0.14945	N	0.289287	D	0.88179	0.6367	N	0.00621	-1.32	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.79482	-0.1785	10	0.25751	T	0.34	-0.2032	8.3049	0.32036	0.0:0.4998:0.3595:0.1406	.	189	Q9BY08	EBPL_HUMAN	V	189	ENSP00000242827:L189V	ENSP00000242827:L189V	L	-	1	2	EBPL	49133161	0.000000	0.05858	0.303000	0.25071	0.899000	0.52679	-1.071000	0.03437	0.397000	0.25310	-0.127000	0.14921	CTA			0.418	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044932.2		NM_032565	
TPP2	7174	mdanderson.org	37	13	103290652	103290652	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr13:103290652G>T	ENST00000376065.4	+	15	1936	c.1900G>T	c.(1900-1902)Gtt>Ttt	p.V634F	TPP2_ENST00000376052.3_Missense_Mutation_p.V634F	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	634					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GATCACTGCAGTTATAGCAGC	0.388																																					p.V634F													.	.			0			c.G1900T												119.0	110.0	113.0					13																	103290652		2203	4300	6503	SO:0001583	missense	7174	exon15			ACTGCAGTTATAG	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.1900G>T	13.37:g.103290652G>T	ENSP00000365233:p.Val634Phe		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_003291	49	0.00	0	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874488	0.51695	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.32988	1.43;1.43	5.92	4.91	0.64330	.	0.121633	0.64402	D	0.000014	T	0.33323	0.0859	L	0.58510	1.815	0.48341	D	0.999635	B	0.31227	0.314	B	0.33799	0.17	T	0.19745	-1.0296	10	0.87932	D	0	-25.8458	13.2504	0.60048	0.0857:0.0:0.9143:0.0	.	634	P29144	TPP2_HUMAN	F	634	ENSP00000365233:V634F;ENSP00000365220:V634F	ENSP00000365220:V634F	V	+	1	0	TPP2	102088653	1.000000	0.71417	0.970000	0.41538	0.875000	0.50365	3.507000	0.53371	2.810000	0.96702	0.585000	0.79938	GTT			0.388	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045683.2			
CLEC14A	161198	mdanderson.org	37	14	38725067	38725067	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr14:38725067C>T	ENST00000342213.2	-	1	507	c.161G>A	c.(160-162)tGc>tAc	p.C54Y		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	54	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TCGCAGGATGCAGGCCTCCTC	0.756																																					p.C54Y													.	.			0			c.G161A												4.0	6.0	5.0					14																	38725067		2033	4040	6073	SO:0001583	missense	161198	exon1			AGGATGCAGGCCT		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.161G>A	14.37:g.38725067C>T	ENSP00000353013:p.Cys54Tyr		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_175060	1	0.00	0	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	37	CCDS9667.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933307	0.73442	.	.	ENSG00000176435	ENST00000342213	D	0.97575	-4.44	3.96	3.96	0.45880	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.53938	D	0.000056	D	0.97757	0.9264	L	0.61036	1.89	0.41825	D	0.990046	D	0.89917	1.0	D	0.85130	0.997	D	0.98045	1.0384	10	0.87932	D	0	-13.2967	13.8138	0.63278	0.0:1.0:0.0:0.0	.	54	Q86T13	CLC14_HUMAN	Y	54	ENSP00000353013:C54Y	ENSP00000353013:C54Y	C	-	2	0	CLEC14A	37794818	1.000000	0.71417	0.982000	0.44146	0.913000	0.54294	3.834000	0.55798	2.512000	0.84698	0.591000	0.81541	TGC			0.756	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276729.1		NM_175060	
PNN	5411	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	39651005	39651005	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr14:39651005G>T	ENST00000216832.4	+	9	2159	c.2092G>T	c.(2092-2094)Ggc>Tgc	p.G698C	PNN_ENST00000557680.1_Intron	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	698	Arg-rich.|Necessary for interaction with PPIG.|Ser-rich.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		TAGTCGATCAGGCAAAAGATC	0.413																																					p.G698C													.	.			0			c.G2092T												81.0	81.0	81.0					14																	39651005		2203	4300	6503	SO:0001583	missense	5411	exon9			CGATCAGGCAAAA	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.2092G>T	14.37:g.39651005G>T	ENSP00000216832:p.Gly698Cys		Somatic	39	0	0		WXS	Illumina HiSeq	.	58	0.07	4	NM_002687	370	0.00	0	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	37	CCDS9671.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207899	0.39003	.	.	ENSG00000100941	ENST00000216832	T	0.14144	2.53	6.13	6.13	0.99165	.	0.051702	0.85682	D	0.000000	T	0.29458	0.0734	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01090	-1.1455	10	0.72032	D	0.01	-8.686	20.8401	0.99726	0.0:0.0:1.0:0.0	.	698	Q9H307	PININ_HUMAN	C	698	ENSP00000216832:G698C	ENSP00000216832:G698C	G	+	1	0	PNN	38720756	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.126000	0.77201	2.932000	0.99384	0.644000	0.83932	GGC			0.413	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276776.2		NM_002687	
MTHFD1	4522	broad.mit.edu	37	14	64914955	64914955	+	Silent	SNP	A	A	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr14:64914955A>G	ENST00000545908.1	+	23	2596	c.2367A>G	c.(2365-2367)aaA>aaG	p.K789K	MTHFD1_ENST00000216605.8_Silent_p.K733K|CTD-2555O16.2_ENST00000556640.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	733	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	TGGTTGAAAAAGGCTTCAGTA	0.408																																					p.K733K	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)												.	MTHFD1	61		0			c.A2199G												66.0	64.0	65.0					14																	64914955		2203	4300	6503	SO:0001819	synonymous_variant	4522	exon23			TGAAAAAGGCTTC	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2367A>G	14.37:g.64914955A>G			Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	116	0.03	4	NM_005956	251	0.00	0	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Silent	SNP	ENST00000545908.1	37																																																																																						0.408	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000412167.1			
ELMSAN1	91748	broad.mit.edu	37	14	74194213	74194213	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr14:74194213T>G	ENST00000286523.5	-	5	2892	c.2110A>C	c.(2110-2112)Acc>Ccc	p.T704P	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.T704P	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	704					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										ACAGGCGGGGTTACTTCAGCA	0.597																																					p.T704P													.	.			0			c.A2110C												73.0	65.0	68.0					14																	74194213		2203	4300	6503	SO:0001583	missense	91748	exon5			GCGGGGTTACTTC	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.2110A>C	14.37:g.74194213T>G	ENSP00000286523:p.Thr704Pro		Somatic	45	0.2222222222	10		WXS	Illumina HiSeq	Phase_I	84	0.26	22	NM_194278	35	0.09	3	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.378943	0.82682	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.17054	2.31;2.31;2.31;2.3	5.29	5.29	0.74685	.	0.086232	0.50627	D	0.000119	T	0.35711	0.0941	L	0.51422	1.61	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.963	T	0.04650	-1.0936	10	0.52906	T	0.07	-25.424	15.2644	0.73649	0.0:0.0:0.0:1.0	.	704;704	A0PJD3;Q6PJG2	.;CN043_HUMAN	P	704	ENSP00000377634:T704P;ENSP00000286523:T704P;ENSP00000407767:T704P;ENSP00000402380:T704P	ENSP00000286523:T704P	T	-	1	0	C14orf43	73263966	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	7.499000	0.81566	2.003000	0.58678	0.533000	0.62120	ACC			0.597	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317793.1		NM_194278	
IRF2BPL	64207	mdanderson.org	37	14	77493340	77493340	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr14:77493340C>T	ENST00000238647.3	-	1	1694	c.796G>A	c.(796-798)Gcc>Acc	p.A266T		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	266	Gly/Pro-rich.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GCAGCGCTGGCCGGGCCGTTA	0.766																																					p.A266T													.	.			0			c.G796A												2.0	3.0	2.0					14																	77493340		1656	3454	5110	SO:0001583	missense	64207	exon1			CGCTGGCCGGGCC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.796G>A	14.37:g.77493340C>T	ENSP00000238647:p.Ala266Thr		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_024496	85	0.00	0	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	ENST00000238647.3	37	CCDS9854.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.191845	0.38707	.	.	ENSG00000119669	ENST00000238647	T	0.68025	-0.3	4.13	3.22	0.36961	.	0.129222	0.28772	U	0.014198	T	0.41213	0.1149	N	0.08118	0	0.27879	N	0.939769	B	0.06786	0.001	B	0.01281	0.0	T	0.21177	-1.0253	10	0.17832	T	0.49	0.2127	9.2406	0.37493	0.0:0.895:0.0:0.105	.	266	Q9H1B7	I2BPL_HUMAN	T	266	ENSP00000238647:A266T	ENSP00000238647:A266T	A	-	1	0	IRF2BPL	76563093	0.007000	0.16637	0.982000	0.44146	0.406000	0.30931	-0.152000	0.10159	0.911000	0.36747	0.462000	0.41574	GCC			0.766	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414298.1		NM_024496	
CEP170B	283638	mdanderson.org	37	14	105352414	105352414	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr14:105352414G>T	ENST00000414716.3	+	11	2210	c.1982G>T	c.(1981-1983)tGg>tTg	p.W661L	CEP170B_ENST00000453495.1_Missense_Mutation_p.W662L|CEP170B_ENST00000556508.1_Missense_Mutation_p.W591L|CEP170B_ENST00000418279.1_Missense_Mutation_p.W591L	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	661						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GGTCAGAAGTGGGTGTCCCGC	0.711																																					p.W661L													.	.			0			c.G1982T												13.0	19.0	17.0					14																	105352414		1868	3946	5814	SO:0001583	missense	283638	exon11			AGAAGTGGGTGTC	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.1982G>T	14.37:g.105352414G>T	ENSP00000404151:p.Trp661Leu		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001112726	15	0.00	0	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.823910	0.90873	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	4.51	4.51	0.55191	.	0.000000	0.64402	D	0.000001	T	0.48554	0.1506	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.994;0.998	T	0.55496	-0.8132	10	0.72032	D	0.01	-24.5039	16.1897	0.81977	0.0:0.0:1.0:0.0	.	661;661;591	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	L	591;661;662;591	ENSP00000451249:W591L;ENSP00000404151:W661L;ENSP00000407238:W662L;ENSP00000415006:W591L	ENSP00000404151:W661L	W	+	2	0	KIAA0284	104423459	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.270000	0.95690	2.043000	0.60533	0.561000	0.74099	TGG			0.711	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000410289.2		NM_001112726	
LOXL1	4016	mdanderson.org	37	15	74219685	74219685	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr15:74219685G>T	ENST00000261921.7	+	1	887	c.561G>T	c.(559-561)caG>caT	p.Q187H	LOXL1-AS1_ENST00000562965.1_RNA|LOXL1-AS1_ENST00000565416.1_RNA|LOXL1-AS1_ENST00000562130.1_RNA|LOXL1-AS1_ENST00000564194.1_RNA|LOXL1-AS1_ENST00000564963.1_RNA|LOXL1-AS1_ENST00000566675.1_RNA|LOXL1-AS1_ENST00000567644.1_RNA|LOXL1-AS1_ENST00000568087.1_RNA|LOXL1-AS1_ENST00000565756.1_RNA|LOXL1-AS1_ENST00000562739.1_RNA|LOXL1-AS1_ENST00000568229.1_RNA|LOXL1-AS1_ENST00000567257.1_RNA	NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1	187					extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						TCGTCAGCCAGTACGAGAACT	0.731																																					p.Q187H													.	.			0			c.G561T												31.0	37.0	35.0					15																	74219685		2154	4217	6371	SO:0001583	missense	4016	exon1			CAGCCAGTACGAG	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.561G>T	15.37:g.74219685G>T	ENSP00000261921:p.Gln187His		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_005576	7	0.00	0	Q6NUL3|Q96BW7	Missense_Mutation	SNP	ENST00000261921.7	37	CCDS10253.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098684	0.56183	.	.	ENSG00000129038	ENST00000261921;ENST00000395162	T	0.32272	1.46	3.87	0.804	0.18697	.	0.817355	0.11011	N	0.609425	T	0.44623	0.1302	L	0.50333	1.59	0.31281	N	0.690615	D	0.61697	0.99	D	0.70487	0.969	T	0.47114	-0.9142	10	0.59425	D	0.04	.	7.8367	0.29374	0.3007:0.0:0.6993:0.0	.	187	Q08397	LOXL1_HUMAN	H	187;49	ENSP00000261921:Q187H	ENSP00000261921:Q187H	Q	+	3	2	LOXL1	72006738	1.000000	0.71417	0.997000	0.53966	0.947000	0.59692	2.626000	0.46460	-0.145000	0.11294	-0.742000	0.03525	CAG			0.731	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268995.2		NM_005576	
SCAMP2	10066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75143705	75143705	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr15:75143705T>G	ENST00000268099.9	-	5	570	c.461A>C	c.(460-462)tAt>tCt	p.Y154S		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	154					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						CATCCACAGATAGTAGAGCAT	0.572																																					p.Y154S													.	.			0			c.A461C												89.0	78.0	82.0					15																	75143705		2197	4295	6492	SO:0001583	missense	10066	exon5			CACAGATAGTAGA	AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.461A>C	15.37:g.75143705T>G	ENSP00000268099:p.Tyr154Ser		Somatic	49	0	0		WXS	Illumina HiSeq	.	73	0.10	7	NM_005697	192	0.18	35	B2RDF0|Q9BQE8	Missense_Mutation	SNP	ENST00000268099.9	37	CCDS10271.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.541239	0.85917	.	.	ENSG00000140497	ENST00000268099;ENST00000543345	T	0.18657	2.2	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.42314	0.1197	M	0.78637	2.42	0.80722	D	1	D;P	0.56287	0.975;0.767	P;P	0.57548	0.823;0.673	T	0.30179	-0.9987	10	0.37606	T	0.19	-37.0366	14.8174	0.70045	0.0:0.0:0.0:1.0	.	154;123	O15127;B3KU14	SCAM2_HUMAN;.	S	154;123	ENSP00000268099:Y154S	ENSP00000268099:Y154S	Y	-	2	0	SCAMP2	72930758	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.090000	0.63153	0.460000	0.39030	TAT			0.572	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286403.3		NM_005697	
NETO2	81831	mdanderson.org	37	16	47163244	47163244	+	Silent	SNP	A	A	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr16:47163244A>G	ENST00000562435.1	-	3	507	c.123T>C	c.(121-123)ccT>ccC	p.P41P	NETO2_ENST00000303155.5_Silent_p.P41P	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	41					regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)				breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				ACTGGGTTGCAGGAATATGCT	0.413										HNSCC(25;0.065)																											p.P41P													.	.			0			c.T123C												156.0	147.0	150.0					16																	47163244		2202	4300	6502	SO:0001819	synonymous_variant	81831	exon3			GGTTGCAGGAATA	AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.123T>C	16.37:g.47163244A>G			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001201477	58	0.00	0	J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Silent	SNP	ENST00000562435.1	37	CCDS10727.1																																																																																					0.413	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256766.2		NM_018092	
PHKB	5257	mdanderson.org	37	16	47531334	47531334	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr16:47531334G>T	ENST00000323584.5	+	2	125	c.101G>T	c.(100-102)aGc>aTc	p.S34I	PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000566044.1_Missense_Mutation_p.S27I|PHKB_ENST00000299167.8_Missense_Mutation_p.S34I|PHKB_ENST00000455779.1_Missense_Mutation_p.S27I	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	34					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CCTCTTAAAAGCATTAATCTT	0.323																																					p.S34I													.	.			0			c.G101T												67.0	68.0	68.0					16																	47531334		2201	4300	6501	SO:0001583	missense	5257	exon2			TTAAAAGCATTAA		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.101G>T	16.37:g.47531334G>T	ENSP00000313504:p.Ser34Ile		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_000293	35	0.00	0	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285185	0.59867	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D;D	0.91631	-2.88;-2.76;-2.77	5.9	5.9	0.94986	.	0.102545	0.64402	D	0.000002	D	0.86188	0.5873	N	0.08118	0	0.44754	D	0.997758	B;B;B	0.31548	0.012;0.259;0.328	B;B;B	0.34242	0.023;0.081;0.178	D	0.84146	0.0420	10	0.46703	T	0.11	-17.5941	20.2704	0.98474	0.0:0.0:1.0:0.0	.	27;34;27	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	I	27;27;34	ENSP00000299167:S27I;ENSP00000414345:S27I;ENSP00000313504:S34I	ENSP00000299167:S27I	S	+	2	0	PHKB	46088835	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.827000	0.69300	2.793000	0.96121	0.591000	0.81541	AGC			0.323	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000430413.1			
HSF4	3299	mdanderson.org	37	16	67200242	67200242	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr16:67200242C>T	ENST00000521374.1	+	5	505	c.505C>T	c.(505-507)Cgg>Tgg	p.R169W	HSF4_ENST00000264009.8_Missense_Mutation_p.R169W|HSF4_ENST00000584272.1_Missense_Mutation_p.R169W|HSF4_ENST00000421453.1_Missense_Mutation_p.R169W|HSF4_ENST00000517867.1_3'UTR			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	169	Hydrophobic repeat HR-A/B.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GATCTTGTGGCGGGAGGTGGT	0.637																																					p.R169W													.	.			0			c.C505T												27.0	36.0	33.0					16																	67200242		2104	4208	6312	SO:0001583	missense	3299	exon7			TTGTGGCGGGAGG	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.505C>T	16.37:g.67200242C>T	ENSP00000430947:p.Arg169Trp		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	104	0.05	5	NM_001538	4	0.00	0	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.02|13.02	2.110982|2.110982	0.37242|0.37242	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000517750|ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374;ENST00000517729	.|.	.|.	.|.	4.75|4.75	2.73|2.73	0.32206|0.32206	.|.	.|0.056567	.|0.64402	.|D	.|0.000002	T|T	0.77837|0.77837	0.4190|0.4190	M|M	0.78285|0.78285	2.405|2.405	0.48236|0.48236	D|D	0.999618|0.999618	.|D;D	.|0.89917	.|1.0;0.998	.|D;P	.|0.77004	.|0.989;0.609	T|T	0.78843|0.78843	-0.2044|-0.2044	5|9	.|0.87932	.|D	.|0	-19.0782|-19.0782	13.713|13.713	0.62680|0.62680	0.4497:0.5503:0.0:0.0|0.4497:0.5503:0.0:0.0	.|.	.|169;169	.|Q9ULV5-2;Q9ULV5	.|.;HSF4_HUMAN	V|W	15|169;169;169;169;106	.|.	.|ENSP00000264009:R169W	A|R	+|+	2|1	0|2	HSF4|HSF4	65757743|65757743	0.997000|0.997000	0.39634|0.39634	0.999000|0.999000	0.59377|0.59377	0.739000|0.739000	0.42172|0.42172	0.454000|0.454000	0.21827|0.21827	0.158000|0.158000	0.19367|0.19367	-1.367000|-1.367000	0.01198|0.01198	GCG|CGG			0.637	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375080.1		NM_001538	
ANKRD11	29123	broad.mit.edu	37	16	89351844	89351844	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr16:89351844T>C	ENST00000301030.4	-	9	1566	c.1106A>G	c.(1105-1107)aAg>aGg	p.K369R	ANKRD11_ENST00000378330.2_Missense_Mutation_p.K369R	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	369					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCTGTAGTCCTTTTTCAATAG	0.453																																					p.K369R													.	ANKRD11	195		0			c.A1106G												158.0	162.0	160.0					16																	89351844		2198	4300	6498	SO:0001583	missense	29123	exon9			TAGTCCTTTTTCA	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1106A>G	16.37:g.89351844T>C	ENSP00000301030:p.Lys369Arg		Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	172	0.02	4	NM_001256183	79	0.00	0	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.112102	0.56398	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000378332	T;T	0.46063	0.88;0.88	5.4	5.4	0.78164	.	0.046390	0.85682	N	0.000000	T	0.63189	0.2490	M	0.71581	2.175	0.80722	D	1	D	0.59767	0.986	D	0.69654	0.965	T	0.66666	-0.5866	10	0.62326	D	0.03	.	15.4164	0.74974	0.0:0.0:0.0:1.0	.	369	Q6UB99	ANR11_HUMAN	R	369;369;383	ENSP00000301030:K369R;ENSP00000367581:K369R	ENSP00000301030:K369R	K	-	2	0	ANKRD11	87879345	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	7.836000	0.86788	2.052000	0.61016	0.460000	0.39030	AAG			0.453	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430462.3		NM_013275	
PHF23	79142	mdanderson.org	37	17	7140047	7140047	+	Silent	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr17:7140047G>T	ENST00000320316.3	-	4	425	c.199C>A	c.(199-201)Cga>Aga	p.R67R	PHF23_ENST00000571362.1_Intron|PHF23_ENST00000570753.1_5'UTR|PHF23_ENST00000454255.2_Silent_p.R63R|PHF23_ENST00000576955.1_5'UTR|DVL2_ENST00000005340.5_5'Flank|DVL2_ENST00000575458.1_5'Flank	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	67							zinc ion binding (GO:0008270)			breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						CTCTCTCCTCGCAATGGAGAG	0.552																																					p.R67R													.	.			0			c.C199A												59.0	65.0	63.0					17																	7140047		1918	4143	6061	SO:0001819	synonymous_variant	79142	exon4			CTCCTCGCAATGG	AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.199C>A	17.37:g.7140047G>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_024297	163	0.00	0	A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Silent	SNP	ENST00000320316.3	37	CCDS42250.1																																																																																					0.552	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440047.1		NM_024297	
MYOCD	93649	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12656145	12656145	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr17:12656145G>A	ENST00000343344.4	+	10	1540	c.1540G>A	c.(1540-1542)Gac>Aac	p.D514N	MYOCD_ENST00000425538.1_Missense_Mutation_p.D514N|AC005358.1_ENST00000609971.1_Missense_Mutation_p.D418N|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	514					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GGATGGGCTGGACTCCGAGAA	0.577																																					p.D514N													.	MYOCD	291		0			c.G1540A												46.0	44.0	44.0					17																	12656145		2203	4300	6503	SO:0001583	missense	93649	exon10			GGGCTGGACTCCG	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1540G>A	17.37:g.12656145G>A	ENSP00000341835:p.Asp514Asn		Somatic	137	0.0072992701	1		WXS	Illumina HiSeq	Phase_I	129	0.18	23	NM_001146312	0		0	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.767993	0.90020	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.47869	0.85;0.83	5.86	5.86	0.93980	.	0.097175	0.64402	D	0.000002	T	0.68192	0.2974	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.74348	0.972;0.983;0.983;0.972	T	0.62803	-0.6777	10	0.30854	T	0.27	-25.0202	18.9569	0.92662	0.0:0.0:1.0:0.0	.	233;418;514;514	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	N	233;514;514;418;219	ENSP00000341835:D514N;ENSP00000400148:D219N	ENSP00000341835:D514N	D	+	1	0	MYOCD	12596870	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	9.264000	0.95635	2.766000	0.95052	0.591000	0.81541	GAC			0.577	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000129950.1		NM_153604	
MYO1D	4642	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	31094740	31094740	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr17:31094740C>T	ENST00000318217.5	-	7	1049	c.745G>A	c.(745-747)Gtt>Att	p.V249I	MYO1D_ENST00000579584.1_Missense_Mutation_p.V249I|MYO1D_ENST00000394649.4_Missense_Mutation_p.V161I|MYO1D_ENST00000583621.1_Missense_Mutation_p.V249I	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	249	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TCAGCAACAACTCTGAATTCG	0.378																																					p.V249I													.	MYO1D	93		0			c.G745A												97.0	83.0	88.0					17																	31094740		2203	4300	6503	SO:0001583	missense	4642	exon7			CAACAACTCTGAA	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.745G>A	17.37:g.31094740C>T	ENSP00000324527:p.Val249Ile		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	49	0.10	5	NM_015194	16	0.44	7	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993264	0.74703	.	.	ENSG00000176658	ENST00000318217	D	0.86956	-2.19	6.0	6.0	0.97389	Myosin head, motor domain (2);	0.468881	0.15324	U	0.268393	T	0.82235	0.4993	N	0.16307	0.4	0.38583	D	0.95023	B;B	0.12630	0.006;0.003	B;B	0.28305	0.088;0.063	T	0.77120	-0.2705	10	0.56958	D	0.05	.	17.9887	0.89162	0.0:1.0:0.0:0.0	.	160;249	Q7Z3N6;O94832	.;MYO1D_HUMAN	I	249	ENSP00000324527:V249I	ENSP00000324527:V249I	V	-	1	0	MYO1D	28118853	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.783000	0.68982	2.848000	0.98002	0.655000	0.94253	GTT			0.378	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447457.1			
KIF19	124602	mdanderson.org	37	17	72350311	72350311	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr17:72350311G>T	ENST00000389916.4	+	18	2457	c.2319G>T	c.(2317-2319)gaG>gaT	p.E773D	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	773					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGAGGAAGGAGATCCTGACTG	0.657																																					p.E773D													.	.			0			c.G2319T												60.0	72.0	68.0					17																	72350311		2049	4183	6232	SO:0001583	missense	124602	exon18			GAAGGAGATCCTG	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2319G>T	17.37:g.72350311G>T	ENSP00000374566:p.Glu773Asp		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_153209	0		0	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	G	15.96	2.987833	0.53934	.	.	ENSG00000196169	ENST00000389916	T	0.72615	-0.67	5.25	1.03	0.20045	.	.	.	.	.	T	0.61615	0.2361	L	0.59436	1.845	0.26918	N	0.966735	B	0.27559	0.181	B	0.21708	0.036	T	0.46735	-0.9170	9	0.23891	T	0.37	.	8.9713	0.35908	0.3746:0.0:0.6254:0.0	.	773	Q2TAC6	KIF19_HUMAN	D	773	ENSP00000374566:E773D	ENSP00000374566:E773D	E	+	3	2	KIF19	69861906	1.000000	0.71417	0.707000	0.30419	0.886000	0.51366	2.233000	0.43027	-0.004000	0.14419	0.556000	0.70494	GAG			0.657	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319644.2		NM_153209	
FBF1	85302	mdanderson.org	37	17	73909787	73909787	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr17:73909787C>A	ENST00000586717.1	-	27	3471	c.3198G>T	c.(3196-3198)caG>caT	p.Q1066H	FBF1_ENST00000389570.4_Missense_Mutation_p.Q1067H|RP11-552F3.12_ENST00000587556.1_Missense_Mutation_p.Q8H|FBF1_ENST00000319129.5_Missense_Mutation_p.Q1066H			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	1066					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						ACTCACCACTCTGGCTGGAGG	0.692																																					p.Q1066H													.	.			0			c.G3198T												12.0	14.0	14.0					17																	73909787		1921	4101	6022	SO:0001583	missense	85302	exon27			ACCACTCTGGCTG	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.3198G>T	17.37:g.73909787C>A	ENSP00000465132:p.Gln1066His		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_001080542	16	0.00	0	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000586717.1	37		.	.	.	.	.	.	.	.	.	.	C	7.182	0.589847	0.13812	.	.	ENSG00000188878	ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.18657	2.2;2.2	5.37	-0.191	0.13252	.	.	.	.	.	T	0.12518	0.0304	L	0.29908	0.895	0.09310	N	1	P;P	0.41041	0.699;0.736	B;B	0.38194	0.267;0.264	T	0.17806	-1.0357	9	0.34782	T	0.22	.	4.9472	0.13994	0.1369:0.5501:0.0:0.313	.	1081;1066	Q8TES7-6;A6NLR5	.;.	H	1067;1066;1080	ENSP00000374221:Q1067H;ENSP00000324292:Q1066H	ENSP00000324292:Q1066H	Q	-	3	2	FBF1	71421382	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.473000	0.06615	-0.230000	0.09840	0.557000	0.71058	CAG			0.692	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000448945.2		NM_001080542	
MED16	10025	mdanderson.org	37	19	886142	886142	+	Silent	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr19:886142C>T	ENST00000589119.1	-	4	506	c.507G>A	c.(505-507)acG>acA	p.T169T	MED16_ENST00000606828.1_Intron|MED16_ENST00000269814.4_Silent_p.T169T|MED16_ENST00000325464.1_Silent_p.T169T|MED16_ENST00000395808.3_Silent_p.T169T|MED16_ENST00000312090.6_Silent_p.T169T			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	169					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCGAACAGCGTGAGCGACG	0.677																																					p.T169T													.	.			0			c.G507A												19.0	16.0	17.0					19																	886142		2131	4167	6298	SO:0001819	synonymous_variant	10025	exon5			GAACAGCGTGAGC	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.507G>A	19.37:g.886142C>T			Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_005481	30	0.00	0	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Silent	SNP	ENST00000589119.1	37	CCDS12047.1																																																																																					0.677	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000457902.3		NM_005481	
LYL1	4066	broad.mit.edu	37	19	13211480	13211480	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr19:13211480G>T	ENST00000264824.4	-	3	778	c.418C>A	c.(418-420)Ctg>Atg	p.L140M		NM_005583.4	NP_005574.2	P12980	LYL1_HUMAN	lymphoblastic leukemia associated hematopoiesis regulator 1	140					B cell differentiation (GO:0030183)|blood vessel maturation (GO:0001955)|definitive hemopoiesis (GO:0060216)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)	7			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			CCCTCAGCCAGGTCCAGCTCA	0.577			T	TRB@	T-ALL																																p.L140M				Dom	yes		19	19p13.2-p13.1	4066	lymphoblastic leukemia derived sequence 1		L	.	LYL1	17		0			c.C418A												247.0	234.0	238.0					19																	13211480		2203	4300	6503	SO:0001583	missense	4066	exon3			CAGCCAGGTCCAG		CCDS12292.1	19p13.2	2014-01-20	2014-01-20			ENSG00000104903		"""Basic helix-loop-helix proteins"""	6734	protein-coding gene	gene with protein product		151440	"""lymphoblastic leukemia derived sequence 1"""			2752424	Standard	NM_005583		Approved	bHLHa18	uc002mwi.3	P12980		ENST00000264824.4:c.418C>A	19.37:g.13211480G>T	ENSP00000264824:p.Leu140Met		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	221	0.02	5	NM_005583	24	0.00	0	O76102	Missense_Mutation	SNP	ENST00000264824.4	37	CCDS12292.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234626	0.58886	.	.	ENSG00000104903	ENST00000264824	D	0.97791	-4.54	4.32	3.27	0.37495	.	0.140395	0.31210	N	0.008045	D	0.94145	0.8122	L	0.42245	1.32	0.27546	N	0.950633	P	0.45902	0.868	B	0.40940	0.344	D	0.89404	0.3698	10	0.42905	T	0.14	-14.7905	5.0474	0.14490	0.1137:0.0:0.68:0.2062	.	140	P12980	LYL1_HUMAN	M	140	ENSP00000264824:L140M	ENSP00000264824:L140M	L	-	1	2	LYL1	13072480	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.653000	0.24902	0.908000	0.36671	0.561000	0.74099	CTG			0.577	LYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452827.1		NM_005583	
PRX	57716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40901937	40901937	+	Silent	SNP	C	C	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr19:40901937C>A	ENST00000324001.7	-	7	2592	c.2322G>T	c.(2320-2322)gtG>gtT	p.V774V	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	774	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGGGCAGCTTCACCTCTGGTG	0.587																																					p.V774V													.	.			0			c.G2322T												107.0	98.0	101.0					19																	40901937		2203	4300	6503	SO:0001819	synonymous_variant	57716	exon7			CAGCTTCACCTCT	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2322G>T	19.37:g.40901937C>A			Somatic	64	0	0		WXS	Illumina HiSeq	.	88	0.38	33	NM_181882	6	0.67	4	Q9BXL9|Q9HCF2	Silent	SNP	ENST00000324001.7	37	CCDS33028.1																																																																																					0.587	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000462582.1		NM_020956	
ACPT	93650	bcgsc.ca	37	19	51293729	51293729	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr19:51293729C>G	ENST00000270593.1	+	1	58	c.58C>G	c.(58-60)Ctg>Gtg	p.L20V	ACPT_ENST00000270594.3_Missense_Mutation_p.L20V|CTD-2568A17.8_ENST00000594114.1_RNA	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	20						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		gctgctgctgctggtgctgcC	0.706																																					p.L20V													ACPT,NS,carcinoma,0,1	ACPT	43	1	0			c.C58G												14.0	13.0	14.0					19																	51293729		2179	4266	6445	SO:0001583	missense	93650	exon1			CTGCTGCTGGTGC	AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.58C>G	19.37:g.51293729C>G	ENSP00000270593:p.Leu20Val		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_1	34	0.12	4	NM_033068	0		0	C0H3P7|Q9BZG3|Q9BZG4	Missense_Mutation	SNP	ENST00000270593.1	37	CCDS12802.1	.	.	.	.	.	.	.	.	.	.	c	2.381	-0.342101	0.05243	.	.	ENSG00000142513	ENST00000270593;ENST00000270594	T;T	0.13089	2.79;2.62	4.41	0.74	0.18330	.	1.036450	0.07721	N	0.943623	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	10	0.32370	T	0.25	-8.5866	3.8343	0.08888	0.0:0.5162:0.2203:0.2635	.	20	Q9BZG2	PPAT_HUMAN	V	20	ENSP00000270593:L20V;ENSP00000270594:L20V	ENSP00000270593:L20V	L	+	1	2	ACPT	55985541	0.000000	0.05858	0.020000	0.16555	0.062000	0.15995	-1.802000	0.01741	0.117000	0.18138	-0.333000	0.08304	CTG			0.706	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464434.1		NM_033068	
INO80B	83444	mdanderson.org	37	2	74684838	74684838	+	Silent	SNP	G	G	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:74684838G>A	ENST00000233331.7	+	5	1012	c.918G>A	c.(916-918)ccG>ccA	p.P306P	WBP1_ENST00000393972.3_5'Flank|WBP1_ENST00000233615.2_5'Flank|WBP1_ENST00000409737.1_5'Flank	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	306					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						CAGGCCCGCCGCCGCGCTGCT	0.692																																					p.P306P													.	.			0			c.G918A												13.0	14.0	13.0					2																	74684838		2147	4230	6377	SO:0001819	synonymous_variant	83444	exon5			CCCGCCGCCGCGC	AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.918G>A	2.37:g.74684838G>A			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_031288	29	0.00	0		Silent	SNP	ENST00000233331.7	37	CCDS1942.2																																																																																					0.692	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252223.2		NM_031288	
SFTPB	6439	mdanderson.org	37	2	85890594	85890594	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:85890594G>T	ENST00000519937.2	-	8	896	c.877C>A	c.(877-879)Ctg>Atg	p.L293M	SFTPB_ENST00000393822.3_Missense_Mutation_p.L305M|SFTPB_ENST00000409383.1_Missense_Mutation_p.L305M|SFTPB_ENST00000342375.3_Missense_Mutation_p.L293M			P07988	PSPB_HUMAN	surfactant protein B	293					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						TCTCGCGGCAGCCATTCTCCT	0.602																																					p.L305M													.	.			0			c.C913A												32.0	31.0	31.0					2																	85890594		2203	4300	6503	SO:0001583	missense	6439	exon9			GCGGCAGCCATTC	J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.877C>A	2.37:g.85890594G>T	ENSP00000428719:p.Leu293Met		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_198843	2	0.00	0	Q96R04	Missense_Mutation	SNP	ENST00000519937.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.50|13.50	2.254347|2.254347	0.39896|0.39896	.|.	.|.	ENSG00000168878|ENSG00000168878	ENST00000428225|ENST00000519937;ENST00000393822;ENST00000342375;ENST00000409383;ENST00000441838	.|T;T;T;T	.|0.71579	.|0.46;-0.37;-0.58;-0.37	5.39|5.39	2.28|2.28	0.28536|0.28536	.|.	.|1.166040	.|0.06593	.|N	.|0.752428	T|T	0.75561|0.75561	0.3866|0.3866	L|L	0.52573|0.52573	1.65|1.65	0.09310|0.09310	N|N	0.999991|0.999991	.|D;D	.|0.89917	.|1.0;0.999	.|P;P	.|0.62740	.|0.906;0.906	T|T	0.58509|0.58509	-0.7624|-0.7624	5|10	.|0.27082	.|T	.|0.32	-0.0651|-0.0651	5.78|5.78	0.18301|0.18301	0.1844:0.0:0.649:0.1666|0.1844:0.0:0.649:0.1666	.|.	.|305;293	.|D6W5L6;P07988	.|.;PSPB_HUMAN	D|M	285|295;305;293;305;261	.|ENSP00000428719:L295M;ENSP00000377409:L305M;ENSP00000345161:L293M;ENSP00000386346:L305M	.|ENSP00000345161:L293M	A|L	-|-	2|1	0|2	SFTPB|SFTPB	85744105|85744105	0.930000|0.930000	0.31532|0.31532	0.279000|0.279000	0.24732|0.24732	0.323000|0.323000	0.28346|0.28346	1.288000|1.288000	0.33296|0.33296	0.659000|0.659000	0.30945|0.30945	0.561000|0.561000	0.74099|0.74099	GCT|CTG			0.602	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000252499.3		NM_198843	
ANKRD36C	400986	broad.mit.edu	37	2	96646519	96646519	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:96646519T>A	ENST00000456556.1	-	5	692	c.608A>T	c.(607-609)cAt>cTt	p.H203L				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	203							ion channel inhibitor activity (GO:0008200)	p.H203L(2)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						AGTAACAGCATGTATGAGGGC	0.313																																					.													ENSG00000174501,NS,carcinoma,0,2	.		2	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																									SO:0001583	missense	400986	.			ACAGCATGTATGA	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.608A>T	2.37:g.96646519T>A	ENSP00000403302:p.His203Leu		Somatic	202	0.004950495	1		WXS	Illumina HiSeq	Phase_I	294	0.02	5	.	0		0	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	t	0.018	-1.473154	0.01044	.	.	ENSG00000174501	ENST00000456556	T	0.60920	0.15	0.845	0.845	0.18950	.	0.746432	0.10173	N	0.706819	T	0.18257	0.0438	N	0.00771	-1.2	0.20489	N	0.999892	.	.	.	.	.	.	T	0.27938	-1.0059	8	0.02654	T	1	.	2.9617	0.05895	0.6006:0.0:0.0:0.3994	.	.	.	.	L	203	ENSP00000403302:H203L	ENSP00000403302:H203L	H	-	2	0	AC073995.2	96010246	0.995000	0.38212	0.906000	0.35671	0.376000	0.30014	0.366000	0.20365	-0.138000	0.11434	-1.957000	0.00481	CAT			0.313	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000338799.2		NM_001010914	
ANKRD36B	57730	mdanderson.org	37	2	98165905	98165905	+	RNA	SNP	T	T	C			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:98165905T>C	ENST00000443455.1	-	0	1564							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		TTCTCCATCCTTTTTTTCTCT	0.318																																					p.K485R													.	.			0			c.A1454G												40.0	16.0	24.0					2																	98165905		1756	3773	5529			57730	exon20			CCATCCTTTTTTT	AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98165905T>C			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	27	0.07	2	NM_025190	3	0.00	0	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	Missense_Mutation	SNP	ENST00000443455.1	37																																																																																						0.318	ANKRD36B-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000328967.2		NM_025190	
INPP4A	3631	broad.mit.edu	37	2	99185080	99185080	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:99185080G>T	ENST00000523221.1	+	21	2482	c.2482G>T	c.(2482-2484)Gtg>Ttg	p.V828L	INPP4A_ENST00000409540.3_Missense_Mutation_p.V789L|INPP4A_ENST00000545415.1_Missense_Mutation_p.V789L|INPP4A_ENST00000409016.4_Missense_Mutation_p.V789L|INPP4A_ENST00000409463.1_Missense_Mutation_p.V157L|INPP4A_ENST00000467042.1_3'UTR|INPP4A_ENST00000074304.5_Missense_Mutation_p.V828L|INPP4A_ENST00000409851.3_Missense_Mutation_p.V823L			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	828					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GGAGAGTTTGGTGCGGTTAAA	0.403																																					p.V828L													.	INPP4A	205		0			c.G2482T												138.0	130.0	133.0					2																	99185080		1904	4122	6026	SO:0001583	missense	3631	exon23			AGTTTGGTGCGGT	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2482G>T	2.37:g.99185080G>T	ENSP00000427722:p.Val828Leu		Somatic	304	0	0		WXS	Illumina HiSeq	Phase_I	427	0.01	6	NM_001134224	42	0.00	0	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	37	CCDS46369.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158161	0.57368	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000409463;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T;T	0.42900	1.96;2.28;0.96;2.28;1.96;1.95;2.28	4.79	4.79	0.61399	.	0.278277	0.35903	N	0.002908	T	0.25419	0.0618	N	0.05124	-0.11	0.45733	D	0.99863	B;B;B;B;B	0.30236	0.065;0.274;0.01;0.168;0.168	B;B;B;B;B	0.29785	0.036;0.05;0.01;0.107;0.107	T	0.10636	-1.0621	10	0.33940	T	0.23	-17.4857	16.992	0.86356	0.0:0.0:1.0:0.0	.	789;789;157;828;823	Q96PE3-2;Q96PE3-4;B8ZZB2;Q96PE3;Q96PE3-3	.;.;.;INP4A_HUMAN;.	L	789;823;157;828;789;789;828	ENSP00000386704:V789L;ENSP00000386777:V823L;ENSP00000386329:V157L;ENSP00000074304:V828L;ENSP00000442149:V789L;ENSP00000387294:V789L;ENSP00000427722:V828L	ENSP00000074304:V828L	V	+	1	0	INPP4A	98551512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.352000	0.73027	2.496000	0.84212	0.561000	0.74099	GTG			0.403	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000376095.1		NM_001566	
PPIG	9360	broad.mit.edu	37	2	170493804	170493804	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:170493804delA	ENST00000260970.3	+	14	2256	c.2036delA	c.(2035-2037)gaafs	p.E679fs	PPIG_ENST00000448752.2_Frame_Shift_Del_p.E679fs|PPIG_ENST00000409714.3_Frame_Shift_Del_p.E664fs	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	679					protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	AACAGCAGGGAAAAAAAGGCT	0.358																																					p.E679fs													.	PPIG	100		0			c.2036delA												61.0	65.0	64.0					2																	170493804		2203	4300	6503	SO:0001589	frameshift_variant	9360	exon14			GCAGGGAAAAAAA	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.2036delA	2.37:g.170493804delA	ENSP00000260970:p.Glu679fs		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	186	0.04	7	NM_004792	178	0.00	0	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Frame_Shift_Del	DEL	ENST00000260970.3	37	CCDS2235.1																																																																																					0.358	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255264.2			
OBSL1	23363	broad.mit.edu	37	2	220423154	220423154	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:220423154G>T	ENST00000404537.1	-	10	3310	c.3254C>A	c.(3253-3255)gCa>gAa	p.A1085E	OBSL1_ENST00000265318.4_Intron|OBSL1_ENST00000265317.5_Missense_Mutation_p.A76E|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000373876.1_Missense_Mutation_p.A1085E|OBSL1_ENST00000603926.1_Missense_Mutation_p.A1085E	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1085	Ig-like 9.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GGAGCGGGCTGCCGGGTGCAC	0.677																																					p.A1085E													.	OBSL1	120		0			c.C3254A												7.0	8.0	8.0					2																	220423154		1915	4081	5996	SO:0001583	missense	23363	exon10			CGGGCTGCCGGGT	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.3254C>A	2.37:g.220423154G>T	ENSP00000385636:p.Ala1085Glu		Somatic	35	0.0285714286	1		WXS	Illumina HiSeq	Phase_I	69	0.12	8	NM_001173431	8	0.13	1	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.018|0.018	-1.473882|-1.473882	0.01044|0.01044	.|.	.|.	ENSG00000124006|ENSG00000124006	ENST00000404537;ENST00000373876;ENST00000265317|ENST00000456147	T;T;T|.	0.56611|.	0.52;0.45;0.75|.	4.56|4.56	1.73|1.73	0.24493|0.24493	Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.22475|0.22475	0.0542|0.0542	N|N	0.21373|0.21373	0.66|0.66	0.09310|0.09310	N|N	0.999999|0.999999	B;P;P|.	0.46578|.	0.012;0.88;0.494|.	B;P;P|.	0.54060|.	0.016;0.741;0.512|.	T|T	0.23547|0.23547	-1.0185|-1.0185	9|5	0.02654|.	T|.	1|.	.|.	5.0207|5.0207	0.14360|0.14360	0.2359:0.0:0.6193:0.1448|0.2359:0.0:0.6193:0.1448	.|.	1086;1085;76|.	A4KVA4;O75147;E7ER99|.	.;OBSL1_HUMAN;.|.	E|K	1085;1085;76|79	ENSP00000385636:A1085E;ENSP00000362983:A1085E;ENSP00000265317:A76E|.	ENSP00000265317:A76E|.	A|Q	-|-	2|1	0|0	OBSL1|OBSL1	220131398|220131398	0.000000|0.000000	0.05858|0.05858	0.023000|0.023000	0.16930|0.16930	0.575000|0.575000	0.36095|0.36095	0.160000|0.160000	0.16462|0.16462	0.170000|0.170000	0.19704|0.19704	0.297000|0.297000	0.19635|0.19635	GCA|CAG			0.677	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322012.1			
ANO7	50636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242142853	242142853	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr2:242142853C>T	ENST00000274979.8	+	9	1094	c.991C>T	c.(991-993)Ccc>Tcc	p.P331S	ANO7_ENST00000402430.3_Missense_Mutation_p.P330S	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	331					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CAAGTACCAGCCCCTGGACCA	0.687																																					p.P331S													ANO7,NS,carcinoma,-1,1	ANO7	-1	1	0			c.C991T												34.0	28.0	30.0					2																	242142853		2189	4299	6488	SO:0001583	missense	50636	exon9			TACCAGCCCCTGG	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.991C>T	2.37:g.242142853C>T	ENSP00000274979:p.Pro331Ser		Somatic	375	0	0		WXS	Illumina HiSeq	.	498	0.15	77	NM_001001891	1	0.00	0	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.938583	0.52972	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.68025	-0.3;-0.3	3.11	3.11	0.35812	.	0.000000	0.64402	U	0.000001	D	0.85392	0.5686	H	0.94385	3.53	0.52501	D	0.999957	D	0.89917	1.0	D	0.97110	1.0	D	0.89397	0.3693	10	0.87932	D	0	.	13.2925	0.60278	0.0:1.0:0.0:0.0	.	331	Q6IWH7	ANO7_HUMAN	S	331;330	ENSP00000274979:P331S;ENSP00000385418:P330S	ENSP00000274979:P331S	P	+	1	0	ANO7	241791526	1.000000	0.71417	0.785000	0.31869	0.187000	0.23431	6.572000	0.74005	1.445000	0.47624	0.313000	0.20887	CCC			0.687	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323509.1		NM_001001891	
RALY	22913	broad.mit.edu	37	20	32664877	32664877	+	Silent	SNP	C	C	T	rs539352667	byFrequency	TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr20:32664877C>T	ENST00000246194.3	+	8	1204	c.702C>T	c.(700-702)ggC>ggT	p.G234G	RALY_ENST00000375114.3_Silent_p.G218G	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	234	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						gcggcggcggcggtggtggtg	0.667																																					p.G234G													.	RALY	44		0			c.C702T												5.0	7.0	7.0					20																	32664877		2080	4086	6166	SO:0001819	synonymous_variant	22913	exon8			CGGCGGCGGTGGT	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.702C>T	20.37:g.32664877C>T			Somatic	92	0.0108695652	1		WXS	Illumina HiSeq	Phase_I	150	0.03	4	NM_016732	140	0.01	2	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	ENST00000246194.3	37	CCDS13230.1																																																																																					0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078753.1			
PROCR	10544	broad.mit.edu	37	20	33762727	33762727	+	Missense_Mutation	SNP	G	G	T	rs200377875		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr20:33762727G>T	ENST00000216968.4	+	2	375	c.293G>T	c.(292-294)cGc>cTc	p.R98L	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	98					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.R98L(2)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	GGCCTCGTGCGCCTGGTGCAC	0.726																																					p.R98L													PROCR,NS,carcinoma,0,3	PROCR	26	3	2	Substitution - Missense(2)	prostate(1)|kidney(1)	c.G293T												20.0	17.0	18.0					20																	33762727		2194	4296	6490	SO:0001583	missense	10544	exon2			TCGTGCGCCTGGT	L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.293G>T	20.37:g.33762727G>T	ENSP00000216968:p.Arg98Leu		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	71	0.07	5	NM_006404	37	0.05	2	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	ENST00000216968.4	37	CCDS13248.1	.	.	.	.	.	.	.	.	.	.	g	26.5	4.741327	0.89573	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	D	0.82984	-1.67	5.22	-10.4	0.00318	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.402480	0.04770	N	0.427767	T	0.71837	0.3387	L	0.51422	1.61	0.09310	N	1	B	0.30179	0.271	B	0.28385	0.089	T	0.61227	-0.7105	10	0.56958	D	0.05	-6.7275	4.9914	0.14216	0.5133:0.0:0.1891:0.2976	.	98	Q9UNN8	EPCR_HUMAN	L	98	ENSP00000216968:R98L	ENSP00000216968:R98L	R	+	2	0	PROCR	33226388	0.000000	0.05858	0.002000	0.10522	0.952000	0.60782	-3.074000	0.00617	-2.082000	0.00868	0.556000	0.70494	CGC			0.726	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078843.3			
PTPRT	11122	broad.mit.edu	37	20	40790055	40790055	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr20:40790055G>T	ENST00000373187.1	-	17	2618	c.2619C>A	c.(2617-2619)gaC>gaA	p.D873E	PTPRT_ENST00000356100.2_Missense_Mutation_p.D882E|PTPRT_ENST00000373201.1_Missense_Mutation_p.D863E|PTPRT_ENST00000373190.1_Missense_Mutation_p.D872E|PTPRT_ENST00000373193.3_Missense_Mutation_p.D876E|PTPRT_ENST00000373198.4_Missense_Mutation_p.D892E|PTPRT_ENST00000373184.1_Missense_Mutation_p.D863E			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	873					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GCTGCAGCAAGTCAGCCACCC	0.587																																					p.D892E													PTPRT,bladder,carcinoma,-2,1	PTPRT	372	1	0			c.C2676A												74.0	79.0	78.0					20																	40790055		2114	4252	6366	SO:0001583	missense	11122	exon18			CAGCAAGTCAGCC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2619C>A	20.37:g.40790055G>T	ENSP00000362283:p.Asp873Glu		Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	207	0.02	5	NM_133170	2	0.00	0	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139960	0.77775	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47	5.35	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.52419	0.1733	M	0.75615	2.305	0.58432	D	0.999999	D;D	0.63880	0.993;0.987	P;P	0.62089	0.898;0.85	T	0.58662	-0.7597	10	0.87932	D	0	.	14.0586	0.64786	0.0728:0.0:0.9272:0.0	.	895;873	O14522-1;O14522	.;PTPRT_HUMAN	E	872;873;876;882;895;863;863	ENSP00000362286:D872E;ENSP00000362283:D873E;ENSP00000362289:D876E;ENSP00000348408:D882E;ENSP00000362294:D895E;ENSP00000362280:D863E;ENSP00000362297:D863E	ENSP00000348408:D882E	D	-	3	2	PTPRT	40223469	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.983000	0.49345	1.250000	0.43966	0.650000	0.86243	GAC			0.587	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000080315.1			
UCKL1	54963	mdanderson.org	37	20	62572531	62572531	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr20:62572531G>T	ENST00000354216.6	-	9	996	c.954C>A	c.(952-954)caC>caA	p.H318Q	UCKL1_ENST00000369908.5_Missense_Mutation_p.H303Q|UCKL1_ENST00000358711.3_Missense_Mutation_p.P313T|UCKL1_ENST00000369892.3_Missense_Mutation_p.H318Q|MIR647_ENST00000384823.1_RNA|MIR1914_ENST00000607800.1_RNA	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	318					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGGGCAGCGGGTGGCACTGGT	0.692																																					p.H318Q													.	.			0			c.C954A												13.0	14.0	14.0					20																	62572531		2168	4275	6443	SO:0001583	missense	54963	exon9			CAGCGGGTGGCAC	AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.954C>A	20.37:g.62572531G>T	ENSP00000346155:p.His318Gln		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_017859	77	0.00	0	B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Missense_Mutation	SNP	ENST00000354216.6	37	CCDS13547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.751|0.751	-0.772899|-0.772899	0.02951|0.02951	.|.	.|.	ENSG00000198276|ENSG00000198276	ENST00000354216;ENST00000369892;ENST00000369908|ENST00000358711	.|.	.|.	.|.	5.07|5.07	2.03|2.03	0.26663|0.26663	.|.	0.182461|.	0.49916|.	D|.	0.000127|.	T|T	0.03871|0.03871	0.0109|0.0109	N|N	0.00043|0.00043	-2.465|-2.465	0.29111|0.29111	N|N	0.880881|0.880881	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.36163|0.36163	-0.9759|-0.9759	9|6	0.07325|0.13853	T|T	0.83|0.58	-36.0421|-36.0421	5.2593|5.2593	0.15563|0.15563	0.2464:0.1483:0.6053:0.0|0.2464:0.1483:0.6053:0.0	.|.	303;318|.	B7Z8N2;Q9NWZ5|.	.;UCKL1_HUMAN|.	Q|T	318;318;303|313	.|.	ENSP00000346155:H318Q|ENSP00000351546:P313T	H|P	-|-	3|1	2|0	UCKL1|UCKL1	62042975|62042975	0.890000|0.890000	0.30428|0.30428	1.000000|1.000000	0.80357|0.80357	0.299000|0.299000	0.27559|0.27559	0.013000|0.013000	0.13310|0.13310	0.518000|0.518000	0.28383|0.28383	-0.266000|-0.266000	0.10368|0.10368	CAC|CCC			0.692	UCKL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000080236.1		NM_017859	
KRTAP10-4	386672	mdanderson.org	37	21	45994676	45994676	+	Silent	SNP	A	A	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr21:45994676A>G	ENST00000400374.3	+	1	1071	c.1041A>G	c.(1039-1041)ccA>ccG	p.P347P	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_5'Flank	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	347	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						GCTGCCAGCCAGCTTGCTGCA	0.662																																					p.P347P													.	.			0			c.A1041G												102.0	112.0	109.0					21																	45994676		2203	4300	6503	SO:0001819	synonymous_variant	386672	exon1			CCAGCCAGCTTGC	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.1041A>G	21.37:g.45994676A>G			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	52	0.10	5	NM_198687	0		0	Q08AS0	Silent	SNP	ENST00000400374.3	37	CCDS42957.1																																																																																					0.662	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128045.1		NM_198687	
LIF	3976	broad.mit.edu	37	22	30642576	30642576	+	Intron	SNP	T	T	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr22:30642576T>G	ENST00000249075.3	-	1	175				RP1-102K2.8_ENST00000593843.1_RNA|LIF_ENST00000403987.3_Intron|RP1-102K2.8_ENST00000608354.1_RNA	NM_002309.4	NP_002300.1	P15018	LIF_HUMAN	leukemia inhibitory factor						blood vessel remodeling (GO:0001974)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|immune response (GO:0006955)|leukemia inhibitory factor signaling pathway (GO:0048861)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|multicellular organismal development (GO:0007275)|muscle organ morphogenesis (GO:0048644)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|neuron development (GO:0048666)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cell proliferation (GO:0008284)|positive regulation of histone H3-K27 acetylation (GO:1901676)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|spongiotrophoblast differentiation (GO:0060708)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|leukemia inhibitory factor receptor binding (GO:0005146)|receptor binding (GO:0005102)|RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001135)			breast(1)|lung(3)|skin(3)	7			Epithelial(10;0.171)			CTGCGGCGGGTGGGCGTCCGG	0.761																																					.													.	LIF	18		0			.												4.0	4.0	4.0					22																	30642576		645	1434	2079	SO:0001627	intron_variant	0	.			GGCGGGTGGGCGT		CCDS13872.1, CCDS58799.1	22q12.2	2012-02-09	2012-02-09		ENSG00000128342	ENSG00000128342			6596	protein-coding gene	gene with protein product	"""differentiation inhibitory activity"", ""differentiation-inducing factor"", ""hepatocyte-stimulating factor III"", ""cholinergic differentiation factor"", ""human interleukin in DA cells"""	159540				1714745, 8058719	Standard	NM_002309		Approved	CDF, DIA, HILDA	uc003agz.3	P15018	OTTHUMG00000150910	ENST00000249075.3:c.19+89A>C	22.37:g.30642576T>G			Somatic	61	0.5737704918	35		WXS	Illumina HiSeq	Phase_I	53	0.66	35	.	0		0	B2RCW7|B5MC23|Q52LZ2	Missense_Mutation	SNP	ENST00000249075.3	37	CCDS13872.1																																																																																					0.761	LIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320508.1		NM_002309	
BRD1	23774	mdanderson.org	37	22	50192713	50192713	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr22:50192713G>A	ENST00000216267.8	-	3	2065	c.1579C>T	c.(1579-1581)Cgg>Tgg	p.R527W	BRD1_ENST00000404034.1_Missense_Mutation_p.R527W|BRD1_ENST00000404760.1_Missense_Mutation_p.R527W|BRD1_ENST00000457780.2_Missense_Mutation_p.R527W|BRD1_ENST00000342989.5_Missense_Mutation_p.R122W|BRD1_ENST00000542442.1_Missense_Mutation_p.R220W	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	527					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGCCGCAGCCGCTGCCAGTAC	0.602																																					p.R527W													.	.			0			c.C1579T												66.0	62.0	63.0					22																	50192713		2203	4300	6503	SO:0001583	missense	23774	exon3			GCAGCCGCTGCCA	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.1579C>T	22.37:g.50192713G>A	ENSP00000216267:p.Arg527Trp		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_014577	40	0.00	0	A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	37	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039074	0.55003	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780;ENST00000542442;ENST00000342989	T;T;T;T;T;T	0.42513	2.45;2.45;2.43;2.27;0.97;0.97	4.39	3.29	0.37713	.	0.000000	0.85682	D	0.000000	T	0.65471	0.2694	M	0.82193	2.58	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.998;0.991;0.998	T	0.72431	-0.4296	10	0.72032	D	0.01	.	13.7903	0.63135	0.0:0.0:0.7774:0.2226	.	527;122;527;527	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	W	527;527;527;527;220;122	ENSP00000216267:R527W;ENSP00000384076:R527W;ENSP00000385858:R527W;ENSP00000410042:R527W;ENSP00000437514:R220W;ENSP00000345886:R122W	ENSP00000216267:R527W	R	-	1	2	BRD1	48578717	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.932000	0.28884	2.171000	0.68590	0.655000	0.94253	CGG			0.602	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317402.1		NM_014577	
DHX30	22907	broad.mit.edu	37	3	47891431	47891431	+	Missense_Mutation	SNP	C	C	T	rs144869940		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr3:47891431C>T	ENST00000445061.1	+	22	3813	c.3406C>T	c.(3406-3408)Cgg>Tgg	p.R1136W	DHX30_ENST00000446256.2_Missense_Mutation_p.R1097W|DHX30_ENST00000348968.4_Missense_Mutation_p.R1108W|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000457607.1_Missense_Mutation_p.R1164W	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	1136				R -> W (in Ref. 3; AAH14237). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GCGTACCGTGCGGCTGCTGAA	0.687											OREG0015550	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1136W													.	DHX30	101		0			c.C3406T							C	TRP/ARG,TRP/ARG	2,4404	2.1+/-5.4	0,2,2201	28.0	29.0	29.0		3289,3406	5.0	1.0	3	dbSNP_134	29	0,8600		0,0,4300	no	missense,missense	DHX30	NM_014966.3,NM_138615.2	101,101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	1097/1156,1136/1195	47891431	2,13004	2203	4300	6503	SO:0001583	missense	22907	exon22			ACCGTGCGGCTGC	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.3406C>T	3.37:g.47891431C>T	ENSP00000405620:p.Arg1136Trp		Somatic	104	0	0	950	WXS	Illumina HiSeq	Phase_I	109	0.04	4	NM_138615	112	0.00	0	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.008093	0.54361	4.54E-4	0.0	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03386	3.97;3.96;3.96;3.95	5.0	5.0	0.66597	.	0.300998	0.33364	N	0.004981	T	0.05823	0.0152	N	0.14661	0.345	0.37660	D	0.922725	D;D	0.57257	0.979;0.976	B;P	0.54924	0.183;0.764	T	0.47328	-0.9126	10	0.72032	D	0.01	.	13.086	0.59140	0.0:0.8389:0.1611:0.0	.	1136;1097	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	W	1097;1136;1108;1164	ENSP00000392601:R1097W;ENSP00000405620:R1136W;ENSP00000343442:R1108W;ENSP00000394682:R1164W	ENSP00000343442:R1108W	R	+	1	2	DHX30	47866435	1.000000	0.71417	0.999000	0.59377	0.627000	0.37826	2.171000	0.42453	2.303000	0.77524	0.462000	0.41574	CGG			0.687	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257495.2		NM_138615	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599320	55599320	+	Missense_Mutation	SNP	G	G	C	rs121913506		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr4:55599320G>C	ENST00000288135.5	+	17	2543	c.2446G>C	c.(2446-2448)Gac>Cac	p.D816H		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816Y(46)|p.D816H(42)|p.D816F(6)|p.D816I(2)|p.D816N(1)|p.R815_D816insVI(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTAGCCAGAGACATCAAGAA	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816H			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,0,932	KIT	0	932	98	Substitution - Missense(97)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(68)|testis(15)|ovary(10)|soft_tissue(3)|genital_tract(1)|skin(1)	c.G2446C												144.0	146.0	145.0					4																	55599320		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GCCAGAGACATCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2446G>C	4.37:g.55599320G>C	ENSP00000288135:p.Asp816His		Somatic	96	0	0		WXS	Illumina HiSeq	.	98	0.24	24	NM_000222	181	0.67	121	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721319	0.68959	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83837	-1.77;-1.77	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.80732	0.4679	L	0.49699	1.58	0.80722	D	1	P;B	0.44734	0.842;0.353	B;B	0.38156	0.266;0.154	D	0.83488	0.0068	10	0.72032	D	0.01	.	19.6484	0.95791	0.0:0.0:1.0:0.0	rs28933969	812;816	P10721-2;P10721	.;KIT_HUMAN	H	816;812	ENSP00000288135:D816H;ENSP00000390987:D812H	ENSP00000288135:D816H	D	+	1	0	KIT	55294077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.659000	0.90383	0.585000	0.79938	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
AGA	175	broad.mit.edu	37	4	178355608	178355608	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr4:178355608G>T	ENST00000264595.2	-	7	861	c.734C>A	c.(733-735)gCc>gAc	p.A245D	AGA_ENST00000506853.1_5'UTR	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	245					protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)			endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		GTCAGCATAGGCTCCAGCTCC	0.463																																					p.A245D													.	AGA	39		0			c.C734A												115.0	108.0	110.0					4																	178355608		2203	4300	6503	SO:0001583	missense	175	exon7			GCATAGGCTCCAG	X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.734C>A	4.37:g.178355608G>T	ENSP00000264595:p.Ala245Asp		Somatic	243	0	0		WXS	Illumina HiSeq	Phase_I	260	0.02	5	NM_000027	80	0.01	1	B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Missense_Mutation	SNP	ENST00000264595.2	37	CCDS3829.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.0|24.0	4.487846|4.487846	0.84854|0.84854	.|.	.|.	ENSG00000038002|ENSG00000038002	ENST00000264595;ENST00000502310|ENST00000510635	D;D|.	0.87103|.	-2.21;-2.21|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.219867|.	0.46758|.	D|.	0.000276|.	D|D	0.86793|0.86793	0.6018|0.6018	M|M	0.92367|0.92367	3.3|3.3	0.80722|0.80722	D|D	1|1	D|.	0.62365|.	0.991|.	D|.	0.68039|.	0.955|.	D|D	0.89209|0.89209	0.3563|0.3563	10|5	0.87932|.	D|.	0|.	-33.7827|-33.7827	19.3909|19.3909	0.94583|0.94583	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	245|.	P20933|.	ASPG_HUMAN|.	D|T	245;102|134	ENSP00000264595:A245D;ENSP00000423798:A102D|.	ENSP00000264595:A245D|.	A|P	-|-	2|1	0|0	AGA|AGA	178592602|178592602	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.429000|0.429000	0.31625|0.31625	7.464000|7.464000	0.80887|0.80887	2.695000|2.695000	0.91970|0.91970	0.650000|0.650000	0.86243|0.86243	GCC|CCT			0.463	AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361916.1		NM_000027	
TENM3	55714	broad.mit.edu	37	4	183090235	183090236	+	RNA	INS	-	-	AT	rs35135947		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr4:183090235_183090236insAT	ENST00000505389.1	+	0	120				MIR1305_ENST00000408300.1_RNA																							catacacacacacacacacaca	0.376																																					.													.	.			0			.																																											0	.			CACACACACACAC																													4.37:g.183090235_183090236insAT			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	15	0.33	5	.	0		0		RNA	INS	ENST00000505389.1	37																																																																																						0.376	RP11-402C9.1-001	KNOWN	basic	sense_intronic	sense_intronic		OTTHUMT00000361751.1			
PIK3R1	5295	broad.mit.edu	37	5	67588169	67588169	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr5:67588169G>T	ENST00000521381.1	+	8	1615	c.999G>T	c.(997-999)tgG>tgT	p.W333C	PIK3R1_ENST00000336483.5_Missense_Mutation_p.W63C|PIK3R1_ENST00000521657.1_Missense_Mutation_p.W333C|PIK3R1_ENST00000320694.8_Missense_Mutation_p.W33C|PIK3R1_ENST00000523872.1_5'Flank|PIK3R1_ENST00000396611.1_Missense_Mutation_p.W333C|PIK3R1_ENST00000274335.5_Missense_Mutation_p.W333C	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	333	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	ATGCTGAATGGTACTGGGGAG	0.383			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.W333C				Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	PIK3R1,colon,carcinoma,+2,1	PIK3R1	869	1	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.G999T												160.0	149.0	153.0					5																	67588169		2203	4300	6503	SO:0001583	missense	5295	exon8			TGAATGGTACTGG	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.999G>T	5.37:g.67588169G>T	ENSP00000428056:p.Trp333Cys		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	108	0.04	4	NM_181523	35	0.00	0	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	ENST00000521381.1	37	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945636	0.73672	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000523807;ENST00000522084;ENST00000320694;ENST00000336483	D;D;D;D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49;-3.49;-3.49;-3.49	5.13	5.13	0.70059	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.98365	0.9457	H	0.97077	3.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	D	0.99177	1.0866	10	0.87932	D	0	-10.8887	19.115	0.93334	0.0:0.0:1.0:0.0	.	63;33;333	P27986-2;P27986-3;P27986	.;.;P85A_HUMAN	C	333;333;333;333;63;63;33;63	ENSP00000428056:W333C;ENSP00000429277:W333C;ENSP00000379855:W333C;ENSP00000274335:W333C;ENSP00000430126:W63C;ENSP00000429766:W63C;ENSP00000323512:W33C;ENSP00000338554:W63C	ENSP00000274335:W333C	W	+	3	0	PIK3R1	67623925	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.822000	0.97130	0.563000	0.77884	TGG			0.383	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254013.2		NM_181504	
FBN2	2201	mdanderson.org	37	5	127800526	127800526	+	Silent	SNP	G	G	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr5:127800526G>A	ENST00000508053.1	-	12	1691	c.717C>T	c.(715-717)tgC>tgT	p.C239C	FBN2_ENST00000508989.1_Silent_p.C206C|FBN2_ENST00000262464.4_Silent_p.C239C			P35556	FBN2_HUMAN	fibrillin 2	239	TB 1.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGGTGGCACAGCACAGAGTCT	0.597																																					p.C239C													.	.			0			c.C717T												90.0	84.0	86.0					5																	127800526		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon6			GGCACAGCACAGA	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.717C>T	5.37:g.127800526G>A			Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	93	0.04	4	NM_001999	0		0	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																					0.597	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371618.2		NM_001999	
SPRY4	81848	mdanderson.org	37	5	141694655	141694655	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr5:141694655G>T	ENST00000434127.2	-	2	262	c.19C>A	c.(19-21)Cag>Aag	p.Q7K	SPRY4_ENST00000503582.1_5'Flank|SPRY4_ENST00000344120.4_Missense_Mutation_p.Q30K	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	7					multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGCGCTCTGTGGGATCGGG	0.627									Testicular Cancer, Familial Clustering of																												p.Q30K													.	.			0			c.C88A												18.0	21.0	20.0					5																	141694655		2113	4158	6271	SO:0001583	missense	81848	exon3	Familial Cancer Database		CGCTCTGTGGGAT	AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.19C>A	5.37:g.141694655G>T	ENSP00000399468:p.Gln7Lys		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_030964	137	0.00	0	A4FVB2|A4FVB3|Q6QIX2|Q9C003	Missense_Mutation	SNP	ENST00000434127.2	37	CCDS47296.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238952	0.58995	.	.	ENSG00000187678	ENST00000344120;ENST00000434127;ENST00000359661;ENST00000511815	T;T	0.62232	0.04;0.04	5.5	5.5	0.81552	.	0.108319	0.64402	D	0.000007	T	0.46073	0.1374	N	0.08118	0	0.43467	D	0.995678	B;B	0.29301	0.241;0.039	B;B	0.27500	0.08;0.018	T	0.45323	-0.9269	10	0.45353	T	0.12	-16.3622	19.4011	0.94630	0.0:0.0:1.0:0.0	.	7;7	Q9C004-2;Q9C004	.;SPY4_HUMAN	K	30;7;7;7	ENSP00000344967:Q30K;ENSP00000399468:Q7K	ENSP00000344967:Q30K	Q	-	1	0	SPRY4	141674839	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.188000	0.94921	2.588000	0.87417	0.561000	0.74099	CAG			0.627	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370652.1			
FAM8A1	51439	hgsc.bcm.edu	37	6	17602826	17602826	+	Nonsense_Mutation	SNP	G	G	T	rs74444948	byFrequency	TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr6:17602826G>T	ENST00000259963.3	+	2	773	c.718G>T	c.(718-720)Gaa>Taa	p.E240*		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	240						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TACAGGCAGAGAATATGTTAT	0.328																																					p.E240X													FAM8A1,NS,carcinoma,-1,2	FAM8A1	-1	2	0			c.G718T												100.0	101.0	101.0					6																	17602826		2203	4299	6502	SO:0001587	stop_gained	51439	exon2			GGCAGAGAATATG	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.718G>T	6.37:g.17602826G>T	ENSP00000259963:p.Glu240*		Somatic	49	0.0204081633	1		WXS	Illumina HiSeq	.	68	0.12	8	NM_016255	10	0.00	0	B2R725	Nonsense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	37	6.420554	0.97555	.	.	ENSG00000137414	ENST00000259963	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.04	18.5673	0.91121	0.0:0.0:1.0:0.0	.	.	.	.	X	240	.	ENSP00000259963:E240X	E	+	1	0	FAM8A1	17710805	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.467000	0.97671	2.356000	0.79943	0.644000	0.83932	GAA	0.008		0.328	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039950.1			
BCKDHB	594	broad.mit.edu	37	6	80838937	80838937	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr6:80838937G>T	ENST00000320393.6	+	3	381	c.334G>T	c.(334-336)Gac>Tac	p.D112Y	BCKDHB_ENST00000486968.1_3'UTR|BCKDHB_ENST00000356489.5_Missense_Mutation_p.D112Y|BCKDHB_ENST00000369760.4_Missense_Mutation_p.D112Y|BCKDHB_ENST00000545529.1_Missense_Mutation_p.D112Y	NM_183050.2	NP_898871.1	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1, beta polypeptide	112					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(1)	15		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		TGGCTTGCGAGACAAATATGG	0.269																																					p.D112Y													.	BCKDHB	36		0			c.G334T												109.0	115.0	113.0					6																	80838937		2203	4300	6503	SO:0001583	missense	594	exon3			TTGCGAGACAAAT	M55575	CCDS4994.1	6q14.1	2008-07-31	2008-07-31		ENSG00000083123	ENSG00000083123			987	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	248611					Standard	NM_183050		Approved		uc003pje.2	P21953	OTTHUMG00000016430	ENST00000320393.6:c.334G>T	6.37:g.80838937G>T	ENSP00000318351:p.Asp112Tyr		Somatic	275	0	0		WXS	Illumina HiSeq	Phase_I	414	0.01	6	NM_000056	19	0.00	0	Q5T2J3|Q9BQL0	Missense_Mutation	SNP	ENST00000320393.6	37	CCDS4994.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911592	0.72983	.	.	ENSG00000083123	ENST00000369760;ENST00000320393;ENST00000356489;ENST00000545529;ENST00000541767	D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9	5.81	5.81	0.92471	Transketolase-like, pyrimidine-binding domain (2);	0.041988	0.85682	D	0.000000	D	0.96965	0.9009	H	0.95611	3.695	0.80722	D	1	D	0.64830	0.994	D	0.67103	0.949	D	0.97609	1.0128	10	0.87932	D	0	-25.3718	15.5827	0.76459	0.0:0.0:1.0:0.0	.	112	P21953	ODBB_HUMAN	Y	112;112;112;112;42	ENSP00000358775:D112Y;ENSP00000318351:D112Y;ENSP00000348880:D112Y;ENSP00000443564:D112Y	ENSP00000318351:D112Y	D	+	1	0	BCKDHB	80895656	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.620000	0.83070	2.746000	0.94184	0.655000	0.94253	GAC			0.269	BCKDHB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043911.2		NM_000056	
MMS22L	253714	hgsc.bcm.edu	37	6	97720567	97720567	+	Intron	SNP	A	A	G	rs200808076		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr6:97720567A>G	ENST00000275053.4	-	6	872				MMS22L_ENST00000369251.2_Intron|MMS22L_ENST00000506256.1_Intron	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein						double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						AAATCAAATGAAACAAGTCAA	0.358																																					.													.	.			0			.												44.0	49.0	48.0					6																	97720567		2203	4300	6503	SO:0001627	intron_variant	100302287	.			CAAATGAAACAAG		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.606+12T>C	6.37:g.97720567A>G			Somatic	79	0	0		WXS	Illumina HiSeq	.	81	0.10	8	.	0		0	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	RNA	SNP	ENST00000275053.4	37	CCDS5039.1																																																																																					0.358	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041573.3		NM_198468	
Unknown	0	bcgsc.ca	37	7	35473	35473	+	IGR	SNP	T	T	C			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr7:35473T>C								None (None upstream) : AC093627.7 (35498 downstream)																							ctgctgctgctgccgccgccg	0.547																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TGCTGCTGCCGCC																													7.37:g.35473T>C			Somatic	425	0.0282352941	12		WXS	Illumina HiSeq	Phase_1	567	0.04	21	.	3	0.33	1		RNA	SNP		37																																																																																					0	0.547								rescued with RNA-seq		
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	174	0.03	5	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
FAM185A	222234	broad.mit.edu	37	7	102401776	102401776	+	Silent	SNP	T	T	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr7:102401776T>G	ENST00000413034.2	+	4	711	c.711T>G	c.(709-711)ggT>ggG	p.G237G	FAM185A_ENST00000481697.1_3'UTR|FAM185A_ENST00000409231.3_Silent_p.G120G	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	237										kidney(1)	1						CCGAAGATGGTTTGCTGAAAG	0.383																																					p.G237G													.	FAM185A	10		0			c.T711G												207.0	168.0	180.0					7																	102401776		692	1591	2283	SO:0001819	synonymous_variant	222234	exon4			AGATGGTTTGCTG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.711T>G	7.37:g.102401776T>G			Somatic	484	0.0020661157	1		WXS	Illumina HiSeq	Phase_I	688	0.01	4	NM_001145268	7	0.00	0	A8MUR7|B4DQD3|C9IZ91	Silent	SNP	ENST00000413034.2	37	CCDS47676.1																																																																																					0.383	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349482.1		NM_001145268	
DENND2A	27147	broad.mit.edu	37	7	140221669	140221669	+	Missense_Mutation	SNP	C	C	T	rs202110826		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr7:140221669C>T	ENST00000275884.6	-	17	3314	c.2897G>A	c.(2896-2898)cGg>cAg	p.R966Q	DENND2A_ENST00000537639.1_Missense_Mutation_p.R966Q|DENND2A_ENST00000496613.1_Missense_Mutation_p.R966Q			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	966					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					GGCATCCTGCCGGCGCAGCTC	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18306	0.0		0.0	False		,,,				2504	0.0				p.R966Q													.	DENND2A	132		0			c.G2897A												41.0	47.0	45.0					7																	140221669		2075	4236	6311	SO:0001583	missense	27147	exon16			TCCTGCCGGCGCA	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.2897G>A	7.37:g.140221669C>T	ENSP00000275884:p.Arg966Gln		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	208	0.02	5	NM_015689	30	0.00	0	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	CCDS43659.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.08	2.427419	0.43122	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613	T;T;T	0.04502	3.61;3.61;3.61	4.84	1.67	0.24075	.	0.228496	0.34411	N	0.003981	T	0.03053	0.0090	N	0.19112	0.55	0.33395	D	0.576662	B	0.13594	0.008	B	0.06405	0.002	T	0.20773	-1.0265	10	0.46703	T	0.11	-11.7899	5.6189	0.17446	0.0:0.4141:0.0:0.5859	.	966	Q9ULE3	DEN2A_HUMAN	Q	966	ENSP00000275884:R966Q;ENSP00000442245:R966Q;ENSP00000419654:R966Q	ENSP00000275884:R966Q	R	-	2	0	DENND2A	139868138	0.996000	0.38824	1.000000	0.80357	0.683000	0.39861	2.254000	0.43214	0.573000	0.29400	-0.355000	0.07637	CGG			0.582	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348742.1		NM_015689	
TRPV5	56302	broad.mit.edu	37	7	142605705	142605705	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr7:142605705T>C	ENST00000265310.1	-	15	2513	c.2165A>G	c.(2164-2166)gAt>gGt	p.D722G		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	722	Involved in Ca(2+)-dependent inactivation. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CTCCTCTCCATCCCCCTCACT	0.567																																					p.D722G													.	TRPV5	164		0			c.A2165G												111.0	106.0	108.0					7																	142605705		2203	4300	6503	SO:0001583	missense	56302	exon15			TCTCCATCCCCCT	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.2165A>G	7.37:g.142605705T>C	ENSP00000265310:p.Asp722Gly		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	161	0.04	6	NM_019841	0		0	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	37	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	T	9.181	1.023601	0.19433	.	.	ENSG00000127412	ENST00000265310;ENST00000439304	T;T	0.80566	-1.39;-1.39	4.99	4.99	0.66335	.	0.311301	0.31989	N	0.006744	T	0.74794	0.3763	L	0.60455	1.87	0.45354	D	0.998345	B	0.12630	0.006	B	0.08055	0.003	T	0.72250	-0.4348	10	0.51188	T	0.08	-15.0022	8.1594	0.31190	0.1917:0.0:0.0:0.8083	.	722	Q9NQA5	TRPV5_HUMAN	G	722;667	ENSP00000265310:D722G;ENSP00000406361:D667G	ENSP00000265310:D722G	D	-	2	0	TRPV5	142315827	0.933000	0.31639	0.795000	0.32087	0.049000	0.14656	2.797000	0.47877	2.113000	0.64589	0.533000	0.62120	GAT			0.567	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347660.1		NM_019841	
CLDN23	137075	broad.mit.edu;mdanderson.org	37	8	8560263	8560263	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr8:8560263G>T	ENST00000519106.1	+	1	816	c.355G>T	c.(355-357)Gtc>Ttc	p.V119F		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	119					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		GCTCTCGGGCGTCGTGCTCTT	0.716																																					p.V119F													.	CLDN23	5		0			c.G355T												18.0	22.0	20.0					8																	8560263		2174	4254	6428	SO:0001583	missense	137075	exon1			TCGGGCGTCGTGC	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.355G>T	8.37:g.8560263G>T	ENSP00000428780:p.Val119Phe		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_194284	1	0.00	0	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572970	0.28092	.	.	ENSG00000253958	ENST00000519106	D	0.89617	-2.54	4.69	-5.52	0.02560	.	.	.	.	.	D	0.85358	0.5678	M	0.64404	1.975	0.09310	N	1	P	0.39624	0.681	B	0.42495	0.389	T	0.78018	-0.2368	9	0.52906	T	0.07	.	7.1817	0.25776	0.0773:0.5817:0.1601:0.1809	.	119	Q96B33	CLD23_HUMAN	F	119	ENSP00000428780:V119F	ENSP00000428780:V119F	V	+	1	0	CLDN23	8597673	0.000000	0.05858	0.002000	0.10522	0.106000	0.19336	-0.660000	0.05317	-0.756000	0.04703	-1.752000	0.00675	GTC			0.716	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374721.1		NM_194284	
PPP2R2A	5520	broad.mit.edu	37	8	26217684	26217684	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr8:26217684G>T	ENST00000380737.3	+	5	675		c.e5-1		PPP2R2A_ENST00000315985.7_Splice_Site	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha						G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TTTCTTCCCAGATAAAACAAT	0.318																																					.													.	PPP2R2A	44		0			c.347-1G>T												52.0	56.0	54.0					8																	26217684		2202	4297	6499	SO:0001630	splice_region_variant	5520	exon5			TTCCCAGATAAAA	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.347-1G>T	8.37:g.26217684G>T			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_002717	1	0.00	0	B2RBU8|B4E1T7|P50409|Q00007	Splice_Site	SNP	ENST00000380737.3	37	CCDS34867.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620661	0.66787	.	.	ENSG00000221914	ENST00000380737;ENST00000315985	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0947	0.93246	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPP2R2A	26273601	1.000000	0.71417	0.997000	0.53966	0.787000	0.44495	9.623000	0.98386	2.593000	0.87608	0.585000	0.79938	.			0.318	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375954.2		NM_002717	Intron
ADAM2	2515	broad.mit.edu	37	8	39694657	39694657	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr8:39694657G>T	ENST00000265708.4	-	2	233	c.130C>A	c.(130-132)Cag>Aag	p.Q44K	ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000521880.1_Missense_Mutation_p.Q44K|ADAM2_ENST00000347580.4_Missense_Mutation_p.Q44K|ADAM2_ENST00000379853.2_Missense_Mutation_p.Q44K	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	44					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TTCATTACCTGCGATTCAATT	0.303																																					p.Q44K													.	ADAM2	124		0			c.C130A												69.0	69.0	69.0					8																	39694657		2203	4297	6500	SO:0001583	missense	2515	exon2			TTACCTGCGATTC	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.130C>A	8.37:g.39694657G>T	ENSP00000265708:p.Gln44Lys		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	227	0.02	5	NM_001464	0		0	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	G	8.232	0.804839	0.16467	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.05786	3.39;3.39;3.39;3.39	3.83	-7.52	0.01341	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.04679	0.0127	L	0.32530	0.975	0.09310	N	1	B;B;B;B	0.23249	0.051;0.004;0.082;0.051	B;B;B;B	0.28305	0.088;0.005;0.053;0.088	T	0.40813	-0.9543	8	.	.	.	.	9.3124	0.37912	0.0:0.3178:0.1463:0.5359	.	44;44;44;44	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	K	44	ENSP00000343854:Q44K;ENSP00000369182:Q44K;ENSP00000265708:Q44K;ENSP00000429352:Q44K	.	Q	-	1	0	ADAM2	39813814	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.802000	0.04545	-1.787000	0.01268	-0.302000	0.09304	CAG			0.303	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376926.1		NM_001464	
KANK1	23189	broad.mit.edu	37	9	732477	732477	+	Silent	SNP	G	G	A	rs569686873|rs370051574		TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr9:732477G>A	ENST00000382303.1	+	10	3757	c.3105G>A	c.(3103-3105)gaG>gaA	p.E1035E	KANK1_ENST00000382297.2_Silent_p.E1035E|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Silent_p.E877E	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1035					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TTGAAGAAGAGGAGGAGGAGG	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		19819	0.0		0.0	False		,,,				2504	0.001				p.E1035E													KANK1_ENST00000382303,NS,carcinoma,0,4	KANK1	231	4	0			c.G3105A												153.0	134.0	140.0					9																	732477		2203	4300	6503	SO:0001819	synonymous_variant	23189	exon10			AGAAGAGGAGGAG	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3105G>A	9.37:g.732477G>A			Somatic	101	0.0099009901	1		WXS	Illumina HiSeq	Phase_I	141	0.03	4	NM_001256876	57	0.00	0	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	CCDS34976.1																																																																																					0.468	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051484.2		NM_015158	
PPAPDC2	403313	mdanderson.org	37	9	4662565	4662565	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr9:4662565C>A	ENST00000381883.2	+	1	268	c.190C>A	c.(190-192)Cca>Aca	p.P64T	SPATA6L_ENST00000381895.5_Intron|SPATA6L_ENST00000381890.5_Intron|SPATA6L_ENST00000475086.1_Intron|SPATA6L_ENST00000454239.2_Intron|SPATA6L_ENST00000223517.5_Intron	NM_203453.3	NP_982278.3	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain containing 2	64						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(2)|lung(1)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		ATCGGAGAGCCCAGTTCACCG	0.751											OREG0019084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P64T	Melanoma(187;1057 3809 8526)												.	.			0			c.C190A												6.0	8.0	7.0					9																	4662565		1825	3757	5582	SO:0001583	missense	403313	exon1			GAGAGCCCAGTTC	AK128369	CCDS34981.1	9p24	2010-04-23			ENSG00000205808	ENSG00000205808			23682	protein-coding gene	gene with protein product	"""polyisoprenoid diphosphate phosphatase type 1"""	611666				16464866	Standard	NM_203453		Approved	FLJ90191, FLJ46512, PDP1	uc003zin.4	Q8IY26	OTTHUMG00000019466	ENST00000381883.2:c.190C>A	9.37:g.4662565C>A	ENSP00000371307:p.Pro64Thr		Somatic	11	0	0	620	WXS	Illumina HiSeq	Phase_I	9	0.11	1	NM_203453	1	0.00	0	B3KY05|Q5JVJ6|Q8NCK9	Missense_Mutation	SNP	ENST00000381883.2	37	CCDS34981.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555498	0.86231	.	.	ENSG00000205808	ENST00000381883	T	0.18174	2.23	4.98	4.98	0.66077	.	0.068700	0.64402	U	0.000015	T	0.37210	0.0995	L	0.55481	1.735	0.53688	D	0.999974	D	0.89917	1.0	D	0.85130	0.997	T	0.02288	-1.1182	10	0.45353	T	0.12	-11.5397	15.7928	0.78380	0.0:1.0:0.0:0.0	.	64	Q8IY26	PPAC2_HUMAN	T	64	ENSP00000371307:P64T	ENSP00000371307:P64T	P	+	1	0	PPAPDC2	4652565	1.000000	0.71417	0.998000	0.56505	0.767000	0.43475	4.788000	0.62439	2.588000	0.87417	0.655000	0.94253	CCA			0.751	PPAPDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051567.1		NM_203453	
RUSC2	9853	broad.mit.edu	37	9	35556093	35556093	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr9:35556093G>A	ENST00000455600.1	+	4	3370	c.2801G>A	c.(2800-2802)gGc>gAc	p.G934D		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	934						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GAGTTCCCTGGCTCCCTCAGT	0.597																																					p.G934D													.	RUSC2	88		0			c.G2801A												47.0	46.0	47.0					9																	35556093		2203	4300	6503	SO:0001583	missense	9853	exon4			TCCCTGGCTCCCT	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.2801G>A	9.37:g.35556093G>A	ENSP00000393922:p.Gly934Asp		Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	190	0.03	5	NM_014806	65	0.00	0	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143155	0.57044	.	.	ENSG00000198853	ENST00000361226;ENST00000455600	T;T	0.25414	1.8;1.8	5.58	5.58	0.84498	.	0.271376	0.37955	N	0.001868	T	0.27559	0.0677	L	0.44542	1.39	0.42620	D	0.993345	P	0.50066	0.931	B	0.41571	0.36	T	0.04140	-1.0974	10	0.62326	D	0.03	-11.6863	18.5361	0.91011	0.0:0.0:1.0:0.0	.	934	Q8N2Y8	RUSC2_HUMAN	D	934	ENSP00000355177:G934D;ENSP00000393922:G934D	ENSP00000355177:G934D	G	+	2	0	RUSC2	35546093	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.200000	0.65158	2.624000	0.88883	0.561000	0.74099	GGC			0.597	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052309.1		XM_048462	
ZNF618	114991	broad.mit.edu	37	9	116811230	116811230	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr9:116811230G>T	ENST00000374126.5	+	15	1747	c.1648G>T	c.(1648-1650)Ggt>Tgt	p.G550C	ZNF618_ENST00000470105.1_3'UTR|ZNF618_ENST00000288466.7_Missense_Mutation_p.G457C			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	550					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						CCTAGGCATCGGTGTCACCTG	0.577																																					p.G457C													.	ZNF618	184		0			c.G1369T												27.0	30.0	29.0					9																	116811230		2192	4281	6473	SO:0001583	missense	114991	exon14			GGCATCGGTGTCA	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.1648G>T	9.37:g.116811230G>T	ENSP00000363241:p.Gly550Cys		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	81	0.05	4	NM_133374	14	0.00	0	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	ENST00000374126.5	37		.	.	.	.	.	.	.	.	.	.	G	15.89	2.966665	0.53507	.	.	ENSG00000157657	ENST00000374126;ENST00000288466	T	0.02177	4.41	5.23	5.23	0.72850	Ribonuclease H-like (1);	0.053519	0.85682	D	0.000000	T	0.13200	0.0320	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.976;0.992	T	0.00187	-1.1941	9	0.66056	D	0.02	-21.4601	17.7931	0.88561	0.0:0.0:1.0:0.0	.	517;550;457	B9EG82;Q5T7W0;Q5T7W0-2	.;ZN618_HUMAN;.	C	550;457	ENSP00000288466:G457C	ENSP00000288466:G457C	G	+	1	0	ZNF618	115851051	1.000000	0.71417	0.990000	0.47175	0.576000	0.36127	9.188000	0.94921	2.440000	0.82611	0.462000	0.41574	GGT			0.577	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000053749.1		XM_054983	
RAPGEF1	2889	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	134497251	134497253	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr9:134497251_134497253delAGG	ENST00000372189.3	-	11	1907_1909	c.1784_1786delCCT	c.(1783-1788)tccttc>ttc	p.S595del	RAPGEF1_ENST00000372190.3_In_Frame_Del_p.S613del|RAPGEF1_ENST00000372195.1_In_Frame_Del_p.S612del	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	595					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		ACCCCACTGAAGGAGTCGCTGAA	0.606																																					p.613_614del													.	RAPGEF1	126		0			c.1839_1841del																																									SO:0001651	inframe_deletion	2889	exon11			CACTGAAGGAGTC	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1784_1786delCCT	9.37:g.134497251_134497253delAGG	ENSP00000361263:p.Ser595del		Somatic	143	0	0		WXS	Illumina HiSeq	.	144	0.16	23	NM_198679	93	0.00	0	Q5JUE4|Q8IV73	In_Frame_Del	DEL	ENST00000372189.3	37	CCDS48047.1																																																																																					0.606	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000054759.2		NM_005312	
ADAMTS13	11093	mdanderson.org	37	9	136297802	136297802	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr9:136297802G>T	ENST00000371929.3	+	9	1525	c.1081G>T	c.(1081-1083)Ggc>Tgc	p.G361C	ADAMTS13_ENST00000356589.2_Missense_Mutation_p.G330C|ADAMTS13_ENST00000371916.1_Silent_p.V260V|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.G361C|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.G33C	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	361	Disintegrin.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GACAGAATGTGGCGTGGAGAA	0.622																																					p.G361C													.	.			0			c.G1081T												43.0	33.0	36.0					9																	136297802		2195	4277	6472	SO:0001583	missense	11093	exon9			GAATGTGGCGTGG	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1081G>T	9.37:g.136297802G>T	ENSP00000360997:p.Gly361Cys		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	27	0.07	2	NM_139025	0		0	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331211	0.41297	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.74421	-0.84;-0.82;-0.75;-0.2	5.35	4.46	0.54185	.	.	.	.	.	D	0.89319	0.6681	M	0.94142	3.5	0.53005	D	0.999964	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	D	0.91715	0.5384	9	0.87932	D	0	.	13.279	0.60205	0.0765:0.0:0.9235:0.0	.	361;330;361	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	C	361;361;330;33	ENSP00000360997:G361C;ENSP00000347927:G361C;ENSP00000348997:G330C;ENSP00000444504:G33C	ENSP00000347927:G361C	G	+	1	0	ADAMTS13	135287623	1.000000	0.71417	0.128000	0.21923	0.004000	0.04260	6.857000	0.75455	1.247000	0.43917	-0.208000	0.12717	GGC			0.622	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054920.1		NM_139025	
UBAC1	10422	mdanderson.org	37	9	138852939	138852939	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chr9:138852939C>T	ENST00000371756.3	-	1	287	c.70G>A	c.(70-72)Gcc>Acc	p.A24T		NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	24	Ubiquitin-like.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		AGCCACTCGGCGCCGTCGGAC	0.711																																					p.A24T	NSCLC(78;973 1398 27381 29552 42415)												.	.			0			c.G70A												19.0	17.0	18.0					9																	138852939		2127	4182	6309	SO:0001583	missense	10422	exon1			ACTCGGCGCCGTC	AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.70G>A	9.37:g.138852939C>T	ENSP00000360821:p.Ala24Thr		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_016172	47	0.00	0	O75500|Q9UMW7	Missense_Mutation	SNP	ENST00000371756.3	37	CCDS35177.1	.	.	.	.	.	.	.	.	.	.	c	5.136	0.210702	0.09757	.	.	ENSG00000130560	ENST00000371756	T	0.22539	1.95	3.92	-5.19	0.02832	.	0.570575	0.17950	N	0.156555	T	0.07007	0.0178	N	0.11560	0.145	0.21220	N	0.99976	B	0.06786	0.001	B	0.01281	0.0	T	0.34204	-0.9838	10	0.13108	T	0.6	-5.1291	6.5867	0.22624	0.123:0.3346:0.0:0.5424	.	24	Q9BSL1	UBAC1_HUMAN	T	24	ENSP00000360821:A24T	ENSP00000360821:A24T	A	-	1	0	UBAC1	137992760	0.403000	0.25319	0.856000	0.33681	0.190000	0.23558	-0.561000	0.05957	-1.060000	0.03189	-1.449000	0.01048	GCC			0.711	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055034.1		NM_016172	
MT-ND5	4540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	13448	13448	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chrM:13448C>T	ENST00000361567.2	+	1	1112	c.1112C>T	c.(1111-1113)aCc>aTc	p.T371I	MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	371					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCTCACTTCAACCTCCCTCAC	0.428																																					p.T371I													.	.			0			c.C1112T																																									SO:0001583	missense	0	exon1			CTTCAACCTCCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1112C>T	M.37:g.13448C>T	ENSP00000354813:p.Thr371Ile		Somatic	18	0	0		WXS	Illumina HiSeq	.	20	0.45	9	ENST00000361567	0		0	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	37																																																																																						0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024036	
PNPLA4	8228	broad.mit.edu	37	X	7868821	7868821	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chrX:7868821A>G	ENST00000381042.4	-	7	838	c.668T>C	c.(667-669)cTt>cCt	p.L223P	PNPLA4_ENST00000537427.1_Missense_Mutation_p.L136P|PNPLA4_ENST00000444736.1_Missense_Mutation_p.L223P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	223					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGGGGGAAAAAGGGCTTGGTT	0.353																																					p.L223P													.	PNPLA4	24		0			c.T668C												57.0	52.0	54.0					X																	7868821		2203	4299	6502	SO:0001583	missense	8228	exon7			GGAAAAAGGGCTT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.668T>C	X.37:g.7868821A>G	ENSP00000370430:p.Leu223Pro		Somatic	300	0	0		WXS	Illumina HiSeq	Phase_I	430	0.02	8	NM_004650	20	0.00	0	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341460	0.41498	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.81078	-1.45;-1.45;-1.45	4.38	4.38	0.52667	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.193685	0.33127	N	0.005243	D	0.89866	0.6839	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90635	0.4570	10	0.87932	D	0	-22.634	9.3053	0.37872	1.0:0.0:0.0:0.0	.	223	P41247	PLPL4_HUMAN	P	223;223;136	ENSP00000370430:L223P;ENSP00000415245:L223P;ENSP00000443157:L136P	ENSP00000370430:L223P	L	-	2	0	PNPLA4	7828821	1.000000	0.71417	0.139000	0.22197	0.388000	0.30384	5.486000	0.66856	1.452000	0.47756	0.481000	0.45027	CTT			0.353	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055687.1		NM_004650	
CYLC1	1538	broad.mit.edu	37	X	83129489	83129489	+	Silent	SNP	A	A	G			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chrX:83129489A>G	ENST00000329312.4	+	4	1810	c.1773A>G	c.(1771-1773)aaA>aaG	p.K591K		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	591					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TCAATGAAAAAGGGGAAAAAG	0.418																																					p.K591K													.	CYLC1	272		0			c.A1773G												67.0	59.0	61.0					X																	83129489		2202	4299	6501	SO:0001819	synonymous_variant	1538	exon4			TGAAAAAGGGGAA	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1773A>G	X.37:g.83129489A>G			Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	210	0.01	3	NM_021118	0		0	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																					0.418	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057371.1		NM_021118	
SASH3	54440	mdanderson.org	37	X	128926627	128926627	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chrX:128926627G>T	ENST00000356892.3	+	6	730	c.616G>T	c.(616-618)Gaa>Taa	p.E206*	RP4-753P9.3_ENST00000432513.1_RNA	NM_018990.3	NP_061863.1	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	206	SH3.				homeostasis of number of cells within a tissue (GO:0048873)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tumor necrosis factor production (GO:0032760)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	12						CCAGATCATTGAAAAGCCACC	0.567																																					p.E206X													.	.			0			c.G616T												101.0	99.0	100.0					X																	128926627		2203	4300	6503	SO:0001587	stop_gained	54440	exon6			ATCATTGAAAAGC	BC051881	CCDS14614.1	Xq26	2013-01-10	2008-02-18	2008-02-18	ENSG00000122122	ENSG00000122122		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	15975	protein-coding gene	gene with protein product		300441	"""chromosome X open reading frame 9"""	CXorf9		11470164	Standard	NM_018990		Approved	SLY, 753P9, SH3D6C, HACS2	uc004euu.3	O75995	OTTHUMG00000022372	ENST00000356892.3:c.616G>T	X.37:g.128926627G>T	ENSP00000349359:p.Glu206*		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_018990	52	0.00	0	A6NCH1|A8K7K8|Q5JZ38	Nonsense_Mutation	SNP	ENST00000356892.3	37	CCDS14614.1	.	.	.	.	.	.	.	.	.	.	G	36	5.915435	0.97099	.	.	ENSG00000122122	ENST00000443760;ENST00000356892	.	.	.	5.47	4.6	0.57074	.	0.089217	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-12.9938	13.4102	0.60938	0.079:0.0:0.921:0.0	.	.	.	.	X	224;206	.	ENSP00000349359:E206X	E	+	1	0	SASH3	128754308	1.000000	0.71417	0.969000	0.41365	0.934000	0.57294	4.186000	0.58337	1.092000	0.41356	-0.344000	0.07964	GAA			0.567	SASH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058208.1		NM_018990	
USP9Y	8287	broad.mit.edu	37	Y	14952959	14952959	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHA-01A-11D-A42Y-10	TCGA-2G-AAHA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc8f661f-51cf-492d-aebf-c9ea75151dae	8cf937d8-88aa-4896-adb5-fd5479580dc3	g.chrY:14952959G>T	ENST00000338981.3	+	37	7057	c.6112G>T	c.(6112-6114)Gca>Tca	p.A2038S	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	2038					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GTTGCCTGAAGCAGAAGAAAT	0.323																																					p.A2038S													.	USP9Y	49		0			c.G6112T												52.0	52.0	52.0					Y																	14952959		590	1930	2520	SO:0001583	missense	8287	exon37			CCTGAAGCAGAAG	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.6112G>T	Y.37:g.14952959G>T	ENSP00000342812:p.Ala2038Ser		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	180	0.02	4	NM_004654	13	0.00	0	O14601	Missense_Mutation	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																					0.323	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088703.2		NM_004654	
