#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
LRRC47	57470	mdanderson.org	37	1	3703430	3703430	+	Missense_Mutation	SNP	G	G	T	rs151150139	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:3703430G>T	ENST00000378251.1	-	2	1087	c.1060C>A	c.(1060-1062)Cgc>Agc	p.R354S	RP1-286D6.5_ENST00000607459.1_RNA	NM_020710.2	NP_065761.1	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	354							phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GTGAGGAAGCGCTTGAGTGCA	0.647																																					p.R354S													.	.			0			c.C1060A												20.0	21.0	21.0					1																	3703430		2198	4297	6495	SO:0001583	missense	57470	exon2			GGAAGCGCTTGAG	AB033011	CCDS51.1	1p36.32	2008-02-05			ENSG00000130764	ENSG00000130764			29207	protein-coding gene	gene with protein product						10574461	Standard	NM_020710		Approved	KIAA1185, RP1-286D6.3	uc001akx.1	Q8N1G4	OTTHUMG00000003506	ENST00000378251.1:c.1060C>A	1.37:g.3703430G>T	ENSP00000367498:p.Arg354Ser		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_020710	124	0.00	0	Q9ULN5	Missense_Mutation	SNP	ENST00000378251.1	37	CCDS51.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638882	0.47153	.	.	ENSG00000130764	ENST00000378251	T	0.33654	1.4	5.22	5.22	0.72569	B3/B4 tRNA-binding domain (1);	0.048889	0.85682	N	0.000000	T	0.33469	0.0864	N	0.08118	0	0.58432	D	0.999994	D	0.71674	0.998	D	0.73380	0.98	T	0.11372	-1.0590	10	0.09590	T	0.72	-34.7836	11.667	0.51379	0.0:0.0:0.7174:0.2826	.	354	Q8N1G4	LRC47_HUMAN	S	354	ENSP00000367498:R354S	ENSP00000367498:R354S	R	-	1	0	LRRC47	3693290	1.000000	0.71417	0.996000	0.52242	0.279000	0.26890	2.879000	0.48522	2.448000	0.82819	0.650000	0.86243	CGC			0.647	LRRC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009744.1		NM_020710	
CROCCP3	114819	broad.mit.edu	37	1	16812950	16812950	+	RNA	SNP	A	A	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:16812950A>G	ENST00000263511.4	-	0	1361					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TGTCCAGGTCACTTTGCATCT	0.627																																					.													.	.			0			.																																											0	.			CAGGTCACTTTGC	AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16812950A>G			Somatic	58	0.0172413793	1		WXS	Illumina HiSeq	Phase_I	65	0.12	8	.	3	0.00	0	Q96PW6	RNA	SNP	ENST00000263511.4	37																																																																																						0.627	CROCCP3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000458172.1		XM_057040	
MUL1	79594	broad.mit.edu	37	1	20834437	20834437	+	Silent	SNP	G	G	T	rs537739019	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:20834437G>T	ENST00000264198.3	-	1	217	c.81C>A	c.(79-81)tcC>tcA	p.S27S		NM_024544.2	NP_078820.2	Q969V5	MUL1_HUMAN	mitochondrial E3 ubiquitin protein ligase 1	27					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|cellular response to exogenous dsRNA (GO:0071360)|mitochondrial fission (GO:0000266)|mitochondrion localization (GO:0051646)|negative regulation of cell growth (GO:0030308)|negative regulation of chemokine (C-C motif) ligand 5 production (GO:0071650)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of innate immune response (GO:0045824)|negative regulation of mitochondrial fusion (GO:0010637)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein sumoylation (GO:0033235)|protein stabilization (GO:0050821)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)	cytoplasm (GO:0005737)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(5)	11		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		GCCGGTACACGGAGTACAGGG	0.697																																					p.S27S													.	MUL1	34		0			c.C81A												20.0	23.0	22.0					1																	20834437		2200	4295	6495	SO:0001819	synonymous_variant	79594	exon1			GTACACGGAGTAC	BC014010	CCDS208.1	1p36.12	2013-01-11	2010-09-17	2008-03-26	ENSG00000090432	ENSG00000090432		"""RING-type (C3HC4) zinc fingers"""	25762	protein-coding gene	gene with protein product	"""ring finger protein 218"", ""mitochondria-anchored protein ligase"", ""growth inhibition and death E3 ligase"", ""mitochondrial ubiquitin ligase activator of NFKB 1"""	612037	"""chromosome 1 open reading frame 166"""	C1orf166		18591963, 12761501, 18213395, 18207745	Standard	NM_024544		Approved	FLJ12875, MULAN, RNF218, MAPL, GIDE	uc001bdi.4	Q969V5	OTTHUMG00000002838	ENST00000264198.3:c.81C>A	1.37:g.20834437G>T			Somatic	136	0.0147058824	2		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_024544	7	0.00	0	B5M497|Q7Z431|Q9H9B5	Silent	SNP	ENST00000264198.3	37	CCDS208.1																																																																																					0.697	MUL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007951.1		NM_024544	
FOXD3	27022	hgsc.bcm.edu	37	1	63789225	63789225	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:63789225G>A	ENST00000371116.2	+	1	496	c.496G>A	c.(496-498)Ggc>Agc	p.G166S	RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	166					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						GACCCTGAGCGGCATCTGCGA	0.582																																					p.G166S	Pancreas(68;276 1750 11966 31252)												.	.			0			c.G496A												69.0	77.0	74.0					1																	63789225		2203	4300	6503	SO:0001583	missense	27022	exon1			CTGAGCGGCATCT	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.496G>A	1.37:g.63789225G>A	ENSP00000360157:p.Gly166Ser		Somatic	113	0	0		WXS	Illumina HiSeq	.	94	0.04	4	NM_012183	0		0	Q9BYM2|Q9UDD1	Missense_Mutation	SNP	ENST00000371116.2	37	CCDS624.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392518	0.83011	.	.	ENSG00000187140	ENST00000371116	D	0.95518	-3.73	2.9	2.9	0.33743	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.135501	0.49305	U	0.000160	D	0.96769	0.8945	M	0.81497	2.545	0.80722	D	1	D	0.71674	0.998	D	0.65140	0.932	D	0.96735	0.9542	10	0.59425	D	0.04	.	14.5761	0.68249	0.0:0.0:1.0:0.0	.	166	Q9UJU5	FOXD3_HUMAN	S	166	ENSP00000360157:G166S	ENSP00000360157:G166S	G	+	1	0	FOXD3	63561813	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.452000	0.90346	1.916000	0.55485	0.404000	0.27445	GGC			0.582	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025331.1			
MTF2	22823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	93599295	93599295	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:93599295A>G	ENST00000370298.4	+	12	1485	c.1196A>G	c.(1195-1197)aAa>aGa	p.K399R	MTF2_ENST00000545708.1_Missense_Mutation_p.K297R|MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000540243.1_Missense_Mutation_p.K297R|MTF2_ENST00000370303.4_Missense_Mutation_p.K342R	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	399					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		AAAGGAAAGAAAAAATCTGTA	0.348																																					p.K399R													.	.			0			c.A1196G												66.0	71.0	69.0					1																	93599295		2203	4300	6503	SO:0001583	missense	22823	exon12			GAAAGAAAAAATC	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1196A>G	1.37:g.93599295A>G	ENSP00000359321:p.Lys399Arg		Somatic	43	0	0		WXS	Illumina HiSeq	.	36	0.25	9	NM_007358	54	0.35	19	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	ENST00000370298.4	37	CCDS742.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.459499	0.43736	.	.	ENSG00000143033	ENST00000545708;ENST00000540243;ENST00000370298;ENST00000370303	T;T;T;T	0.31510	1.49;1.49;1.89;1.74	5.24	5.24	0.73138	.	0.090818	0.85682	D	0.000000	T	0.05318	0.0141	N	0.08118	0	0.47065	D	0.999309	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.26538	-1.0100	10	0.08837	T	0.75	-0.2044	9.898	0.41331	0.9237:0.0:0.0763:0.0	.	342;399;297	B1AKT6;Q9Y483;B4DZG1	.;MTF2_HUMAN;.	R	297;297;399;342	ENSP00000444962:K297R;ENSP00000443295:K297R;ENSP00000359321:K399R;ENSP00000359326:K342R	ENSP00000359321:K399R	K	+	2	0	MTF2	93371883	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.678000	0.68153	2.114000	0.64651	0.533000	0.62120	AAA			0.348	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000028075.3		NM_007358	
SEC22B	9554	broad.mit.edu	37	1	145109975	145109976	+	RNA	INS	-	-	C	rs376446977|rs11458983		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:145109975_145109976insC	ENST00000453618.1	+	0	673							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CAGGAACTTTGCTAAAGATCTA	0.386																																					.													.	.			0			.																																											9554	.			AACTTTGCTAAAG	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109976_145109976dupC			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	0		0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.386	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
S100A7	6278	broad.mit.edu	37	1	153430403	153430403	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:153430403T>C	ENST00000368723.3	-	3	295	c.185A>G	c.(184-186)aAg>aGg	p.K62R	S100A7_ENST00000368722.1_Missense_Mutation_p.K62R	NM_002963.3	NP_002954.2	P31151	S10A7_HUMAN	S100 calcium binding protein A7	62	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				angiogenesis (GO:0001525)|defense response to Gram-negative bacterium (GO:0050829)|epidermis development (GO:0008544)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of T cell chemotaxis (GO:0010820)|response to lipopolysaccharide (GO:0032496)|response to reactive oxygen species (GO:0000302)|sequestering of metal ion (GO:0051238)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(5)|skin(2)	10	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			ATTCTTGTCCTTTTTCTCAAA	0.418																																					p.K62R													.	S100A7	23		0			c.A185G												101.0	91.0	95.0					1																	153430403		2203	4300	6503	SO:0001583	missense	6278	exon3			TTGTCCTTTTTCT	BC034687	CCDS1039.1	1q21	2013-01-10	2006-09-11		ENSG00000143556	ENSG00000143556		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10497	protein-coding gene	gene with protein product		600353	"""S100 calcium-binding protein A7 (psoriasin 1)"", ""S100 calcium binding protein A7 (psoriasin 1)"""	PSOR1		1940442	Standard	NM_002963		Approved	S100A7c	uc001fbv.1	P31151	OTTHUMG00000013123	ENST00000368723.3:c.185A>G	1.37:g.153430403T>C	ENSP00000357712:p.Lys62Arg		Somatic	249	0	0		WXS	Illumina HiSeq	Phase_I	222	0.02	5	NM_002963	11	0.00	0	Q5SY67|Q6FGE3|Q9H1E2	Missense_Mutation	SNP	ENST00000368723.3	37	CCDS1039.1	.	.	.	.	.	.	.	.	.	.	.	11.45	1.641765	0.29157	.	.	ENSG00000143556	ENST00000368723;ENST00000368722	T;T	0.06371	3.31;3.31	2.02	0.79	0.18613	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	.	.	.	.	T	0.04543	0.0124	M	0.72118	2.19	0.09310	N	1	D	0.65815	0.995	P	0.60117	0.869	T	0.17961	-1.0352	9	0.07482	T	0.82	.	4.134	0.10162	0.3106:0.0:0.0:0.6894	.	62	P31151	S10A7_HUMAN	R	62	ENSP00000357712:K62R;ENSP00000357711:K62R	ENSP00000357711:K62R	K	-	2	0	S100A7	151697027	0.002000	0.14202	0.002000	0.10522	0.058000	0.15608	0.277000	0.18734	0.211000	0.20683	0.145000	0.16022	AAG			0.418	S100A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036789.1		NM_002963	
OPN3	23596	mdanderson.org	37	1	241803223	241803223	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr1:241803223C>T	ENST00000366554.2	-	1	440	c.334G>A	c.(334-336)Gtg>Atg	p.V112M	OPN3_ENST00000469376.1_5'UTR|OPN3_ENST00000331838.5_Missense_Mutation_p.V112M	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3	112					detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			ACGCAGCCCACGGTGTCCCAC	0.637																																					p.V112M													.	.			0			c.G334A												26.0	26.0	26.0					1																	241803223		2202	4297	6499	SO:0001583	missense	23596	exon1			AGCCCACGGTGTC	AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691	ENST00000366554.2:c.334G>A	1.37:g.241803223C>T	ENSP00000355512:p.Val112Met		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_014322	4	0.00	0	Q8IX08|Q9Y344	Missense_Mutation	SNP	ENST00000366554.2	37	CCDS31072.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977204	0.74360	.	.	ENSG00000054277	ENST00000366554;ENST00000331838	T;T	0.73363	-0.74;-0.74	4.92	2.96	0.34315	GPCR, rhodopsin-like superfamily (1);	0.155370	0.42682	D	0.000672	T	0.61375	0.2342	L	0.28694	0.88	0.09310	N	0.999998	D	0.59357	0.985	P	0.45794	0.493	T	0.54918	-0.8221	10	0.46703	T	0.11	.	5.9875	0.19442	0.1489:0.6831:0.0:0.1681	.	112	Q9H1Y3	OPN3_HUMAN	M	112	ENSP00000355512:V112M;ENSP00000328018:V112M	ENSP00000328018:V112M	V	-	1	0	OPN3	239869846	0.007000	0.16637	0.980000	0.43619	0.999000	0.98932	0.557000	0.23454	1.263000	0.44181	0.650000	0.86243	GTG			0.637	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095713.1		NM_014322	
PIP4K2A	5305	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	22830852	22830852	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr10:22830852C>T	ENST00000376573.4	-	8	1145	c.917G>A	c.(916-918)gGc>gAc	p.G306D	PIP4K2A_ENST00000323883.7_Missense_Mutation_p.G166D|PIP4K2A_ENST00000545335.1_Missense_Mutation_p.G247D	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha	306	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						CGGGTGGGTGCCATCGCTCTC	0.602																																					p.G306D													.	.			0			c.G917A												87.0	78.0	81.0					10																	22830852		2203	4300	6503	SO:0001583	missense	5305	exon8			TGGGTGCCATCGC	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.917G>A	10.37:g.22830852C>T	ENSP00000365757:p.Gly306Asp		Somatic	156	0	0		WXS	Illumina HiSeq	.	126	0.05	6	NM_005028	45	0.00	0	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Missense_Mutation	SNP	ENST00000376573.4	37	CCDS7141.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.768931	0.69878	.	.	ENSG00000150867	ENST00000376573;ENST00000323883;ENST00000545335	T;T;T	0.29917	1.55;1.55;1.55	6.07	6.07	0.98685	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.733633	0.14032	N	0.346049	T	0.41834	0.1176	M	0.81341	2.54	0.80722	D	1	B;B	0.14012	0.006;0.009	B;B	0.20577	0.03;0.013	T	0.45948	-0.9226	10	0.12430	T	0.62	-22.1989	20.6439	0.99570	0.0:1.0:0.0:0.0	.	166;306	B4DH09;P48426	.;PI42A_HUMAN	D	306;166;247	ENSP00000365757:G306D;ENSP00000326294:G166D;ENSP00000442098:G247D	ENSP00000326294:G166D	G	-	2	0	PIP4K2A	22870858	1.000000	0.71417	0.797000	0.32132	0.811000	0.45836	7.445000	0.80570	2.884000	0.98904	0.655000	0.94253	GGC			0.602	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047193.1		NM_005028	
Unknown	0	bcgsc.ca	37	10	47727808	47727809	+	IGR	INS	-	-	C	rs375537331|rs372756960	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr10:47727808_47727809insC								ANTXRL (26365 upstream) : FAM25HP (14583 downstream)																							ATGAACAGTTAACTCATTTGCG	0.322													|||unknown(NO_COVERAGE)	541	0.108027	0.1672	0.2046	5008	,	,		12497	0.0089		0.1272	False		,,,				2504	0.0419				.													.	.			0			.																																									SO:0001628	intergenic_variant	653259	.			ACAGTTAACTCAT																													10.37:g.47727808_47727809insC			Somatic	89	0	0		WXS	Illumina HiSeq	Phase_1	25	0.12	3	.	0		0		Splice_Site	INS		37																																																																																					0	0.322										
CHST3	9469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73768085	73768085	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr10:73768085G>A	ENST00000373115.4	+	3	1733	c.1296G>A	c.(1294-1296)atG>atA	p.M432I		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	432					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						GCTTCAGCATGCCCTTCAAGC	0.657																																					p.M432I													.	.			0			c.G1296A												25.0	22.0	23.0					10																	73768085		2189	4279	6468	SO:0001583	missense	9469	exon3			CAGCATGCCCTTC	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1296G>A	10.37:g.73768085G>A	ENSP00000362207:p.Met432Ile		Somatic	72	0	0		WXS	Illumina HiSeq	.	68	0.26	18	NM_004273	5	0.40	2	O75099|Q52M30	Missense_Mutation	SNP	ENST00000373115.4	37	CCDS7312.1	.	.	.	.	.	.	.	.	.	.	G	8.471	0.857567	0.17106	.	.	ENSG00000122863	ENST00000373115	D	0.83591	-1.74	5.33	3.39	0.38822	Sulfotransferase domain (1);	0.099918	0.64402	N	0.000002	T	0.55970	0.1954	N	0.01352	-0.895	0.33976	D	0.647408	B	0.02656	0.0	B	0.01281	0.0	T	0.58188	-0.7680	10	0.33141	T	0.24	-38.1907	7.731	0.28788	0.1752:0.1987:0.6261:0.0	.	432	Q7LGC8	CHST3_HUMAN	I	432	ENSP00000362207:M432I	ENSP00000362207:M432I	M	+	3	0	CHST3	73438091	0.024000	0.19004	1.000000	0.80357	0.996000	0.88848	-0.145000	0.10265	1.227000	0.43598	0.462000	0.41574	ATG			0.657	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048563.1		NM_004273	
CUZD1	50624	hgsc.bcm.edu	37	10	124596904	124596904	+	Intron	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr10:124596904G>A	ENST00000368904.1	-	6	1549				CUZD1_ENST00000545804.1_Intron|CUZD1_ENST00000392790.1_Intron					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		CAACAGAATTGGGCAGCAGTA	0.408																																					.													.	.			0			.												93.0	87.0	89.0					10																	124596904		2203	4300	6503	SO:0001627	intron_variant	0	.			AGAATTGGGCAGC	AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.599+15C>T	10.37:g.124596904G>A			Somatic	83	0	0		WXS	Illumina HiSeq	.	100	0.19	19	.	0		0		RNA	SNP	ENST00000368904.1	37	CCDS7631.1																																																																																					0.408	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050829.2		NM_022034	
DNHD1	144132	hgsc.bcm.edu;mdanderson.org	37	11	6569159	6569159	+	Missense_Mutation	SNP	G	G	T	rs571690230		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr11:6569159G>T	ENST00000527990.2	+	20	6794	c.6794G>T	c.(6793-6795)cGg>cTg	p.R2265L	DNHD1_ENST00000254579.6_Missense_Mutation_p.R2265L			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2265					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TTTCTAAACCGGTCCCAGGTT	0.527																																					p.R2265L													DNHD1,colon,carcinoma,0,2	DNHD1	0	2	0			c.G6794T												74.0	65.0	68.0					11																	6569159		692	1591	2283	SO:0001583	missense	144132	exon22			TAAACCGGTCCCA	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.6794G>T	11.37:g.6569159G>T	ENSP00000436180:p.Arg2265Leu		Somatic	66	0	0		WXS	Illumina HiSeq	.	60	0.05	3	NM_144666	15	0.00	0	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	8.630	0.893498	0.17613	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000533649	T;T	0.26660	1.72;1.72	5.82	-11.6	0.00059	.	1.991230	0.02313	N	0.072255	T	0.10465	0.0256	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16012	-1.0417	10	0.27785	T	0.31	.	4.1364	0.10172	0.5398:0.1362:0.118:0.2061	.	2265	Q96M86	DNHD1_HUMAN	L	2265;2265;556	ENSP00000254579:R2265L;ENSP00000436180:R2265L	ENSP00000254579:R2265L	R	+	2	0	DNHD1	6525735	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.924000	0.00692	-4.432000	0.00049	-1.349000	0.01238	CGG			0.527	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384673.2		NM_144666	
PRDM11	56981	mdanderson.org	37	11	45203849	45203849	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr11:45203849G>T	ENST00000530656.1	+	3	274	c.274G>T	c.(274-276)Ggg>Tgg	p.G92W	PRDM11_ENST00000263765.4_Missense_Mutation_p.G92W|PRDM11_ENST00000424263.2_Missense_Mutation_p.G58W			Q9NQV5	PRD11_HUMAN	PR domain containing 11	92							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						GAAACTGAAGGGGAAGCGCGA	0.587																																					p.G58W	NSCLC(118;1511 1736 6472 36603 43224)												.	.			0			c.G172T												77.0	72.0	74.0					11																	45203849		2203	4299	6502	SO:0001583	missense	56981	exon3			CTGAAGGGGAAGC	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.274G>T	11.37:g.45203849G>T	ENSP00000435976:p.Gly92Trp		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001256695	0		0	Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	37		.	.	.	.	.	.	.	.	.	.	G	21.6	4.175457	0.78564	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000526442;ENST00000424263	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000009	T	0.69169	0.3081	L	0.36672	1.1	0.42098	D	0.991323	D	0.89917	1.0	D	0.91635	0.999	T	0.73135	-0.4078	10	0.72032	D	0.01	-29.1909	18.3111	0.90200	0.0:0.0:1.0:0.0	.	92	Q9NQV5	PRD11_HUMAN	W	92;92;58;58	ENSP00000263765:G92W;ENSP00000435976:G92W;ENSP00000431898:G58W;ENSP00000394314:G58W	ENSP00000263765:G92W	G	+	1	0	PRDM11	45160425	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.658000	0.74407	2.331000	0.79229	0.491000	0.48974	GGG			0.587	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000389928.1		NM_020229	
RCOR2	283248	bcgsc.ca	37	11	63682723	63682723	+	Silent	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr11:63682723G>T	ENST00000301459.4	-	3	579	c.192C>A	c.(190-192)ccC>ccA	p.P64P	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	64	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						TGTAGCGTGCGGGGCTCTCTG	0.622																																					p.P64P													.	RCOR2	43		0			c.C192A																																									SO:0001819	synonymous_variant	283248	exon3			GCGTGCGGGGCTC	BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.192C>A	11.37:g.63682723G>T			Somatic	91	0	0		WXS	Illumina HiSeq	Phase_1	47	0.09	4	NM_173587	52	0.00	0	Q96FP3	Silent	SNP	ENST00000301459.4	37	CCDS8052.1																																																																																					0.622	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318233.1		NM_173587	
TYR	7299	mdanderson.org	37	11	88961033	88961033	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr11:88961033G>T	ENST00000263321.5	+	3	1581	c.1079G>T	c.(1078-1080)aGc>aTc	p.S360I		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	360					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GCCTCTCAAAGCAGCATGCAC	0.388																																					p.S360I													.	.			0			c.G1079T												146.0	120.0	129.0					11																	88961033		2201	4298	6499	SO:0001583	missense	7299	exon3			CTCAAAGCAGCAT	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1079G>T	11.37:g.88961033G>T	ENSP00000263321:p.Ser360Ile		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_000372	0		0	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370055	0.82573	.	.	ENSG00000077498	ENST00000263321	D	0.98792	-5.14	5.07	5.07	0.68467	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.179257	0.64402	D	0.000014	D	0.99102	0.9691	M	0.81112	2.525	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99597	1.0977	9	.	.	.	.	18.43	0.90622	0.0:0.0:1.0:0.0	.	360	P14679	TYRO_HUMAN	I	360	ENSP00000263321:S360I	.	S	+	2	0	TYR	88600681	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.135000	0.94478	2.514000	0.84764	0.650000	0.86243	AGC			0.388	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394045.2		NM_000372	
RNF26	79102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	119206597	119206597	+	Silent	SNP	C	C	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr11:119206597C>G	ENST00000311413.4	+	1	1361	c.765C>G	c.(763-765)acC>acG	p.T255T	RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	255						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		GGCTGGCTACCCAGGCACTCA	0.607																																					p.T255T													.	.			0			c.C765G												88.0	84.0	86.0					11																	119206597		2199	4295	6494	SO:0001819	synonymous_variant	79102	exon1			GGCTACCCAGGCA	AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.765C>G	11.37:g.119206597C>G			Somatic	45	0	0		WXS	Illumina HiSeq	.	31	0.26	8	NM_032015	55	0.33	18	Q542Y8	Silent	SNP	ENST00000311413.4	37	CCDS8419.1																																																																																					0.607	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388220.1		NM_032015	
GRAMD1B	57476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123489463	123489463	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr11:123489463C>G	ENST00000529750.1	+	18	2291	c.1964C>G	c.(1963-1965)aCc>aGc	p.T655S	GRAMD1B_ENST00000456860.2_Missense_Mutation_p.T662S|GRAMD1B_ENST00000450171.2_Missense_Mutation_p.T342S|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.T655S	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	655						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		TTGGAATACACCACGCAGACC	0.522																																					p.T655S													.	.			0			c.C1964G												47.0	51.0	49.0					11																	123489463		2045	4192	6237	SO:0001583	missense	57476	exon18			AATACACCACGCA	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1964C>G	11.37:g.123489463C>G	ENSP00000436500:p.Thr655Ser		Somatic	137	0	0		WXS	Illumina HiSeq	.	72	0.29	21	NM_020716	4	0.00	0	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769753	0.49680	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000450171	T;T;T;T;T	0.45668	1.92;1.92;1.92;1.93;0.89	4.83	4.83	0.62350	.	0.126603	0.53938	D	0.000054	T	0.22704	0.0548	N	0.10707	0.03	0.36247	D	0.853669	B;B;B;B	0.25719	0.079;0.037;0.006;0.132	B;B;B;B	0.21360	0.027;0.022;0.005;0.034	T	0.21314	-1.0249	10	0.20519	T	0.43	.	13.6563	0.62339	0.0:0.8447:0.1553:0.0	.	611;342;655;662	B7Z4N9;Q3KR37-3;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	S	662;662;655;655;615;342	ENSP00000402457:T662S;ENSP00000325628:T655S;ENSP00000436500:T655S;ENSP00000432987:T615S;ENSP00000388458:T342S	ENSP00000325628:T655S	T	+	2	0	GRAMD1B	122994673	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.900000	0.69853	2.392000	0.81423	0.455000	0.32223	ACC			0.522	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000387404.2		XM_370660	
CLSTN3	9746	broad.mit.edu	37	12	7281645	7281674	+	5'Flank	DEL	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	-	rs148894272|rs6144602|rs552263970		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr12:7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	ENST00000266546.6	+	0	0				RP11-273B20.1_ENST00000538062.1_RNA|RBP5_ENST00000266560.3_5'Flank|RBP5_ENST00000542370.1_5'Flank|RP11-273B20.1_ENST00000544657.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ACCTTGGCTTTTCCTGAGGAAGGAACCTGGAGCAGGATCCTTCCTGAGGA	0.57														5008	1.0	1.0	1.0	5008	,	,		18442	1.0		1.0	False		,,,				2504	1.0				.													.	RBP5	20		0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGCTTTTCCTGA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	Exception_encountered		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	13	0.31	4	.	5	0.00	0	D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	ENST00000266546.6	37	CCDS8575.1																																																																																					0.570	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398560.2		NM_014718	
FAM186A	121006	broad.mit.edu	37	12	50747002	50747002	+	Missense_Mutation	SNP	C	C	T	rs568838677	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr12:50747002C>T	ENST00000327337.5	-	4	3612	c.3613G>A	c.(3613-3615)Gtc>Atc	p.V1205I	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.V1205I	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1205																	GTGAGAGAGACCCTCAGGGCC	0.657													T|||	30	0.00599042	0.0091	0.0	5008	,	,		18272	0.0079		0.002	False		,,,				2504	0.0082				p.V1205I	NSCLC(138;1796 1887 12511 19463 37884)												.	FAM186A	181		0			c.G3613A												18.0	16.0	17.0					12																	50747002		692	1590	2282	SO:0001583	missense	121006	exon4			GAGAGACCCTCAG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.3613G>A	12.37:g.50747002C>T	ENSP00000329995:p.Val1205Ile		Somatic	120	0.0083333333	1		WXS	Illumina HiSeq	Phase_I	90	0.09	8	NM_001145475	0		0		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	T	4.134	0.023130	0.08006	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.03889	3.77;3.77	4.6	-1.91	0.07641	.	.	.	.	.	T	0.01835	0.0058	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49204	-0.8964	9	0.13108	T	0.6	.	6.2691	0.20945	0.0:0.2967:0.4219:0.2815	.	1205;1205	F5GYN0;A6NE01	.;F186A_HUMAN	I	1205	ENSP00000441337:V1205I;ENSP00000329995:V1205I	ENSP00000329995:V1205I	V	-	1	0	FAM186A	49033269	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-5.410000	0.00124	-0.343000	0.08351	-0.665000	0.03846	GTC			0.657	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000396838.1		XM_001718353	
NACA	4666	broad.mit.edu	37	12	57111378	57111378	+	Silent	SNP	A	A	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr12:57111378A>G	ENST00000454682.1	-	3	4217	c.3936T>C	c.(3934-3936)ccT>ccC	p.P1312P	NACA_ENST00000546392.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000552540.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1312	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						TTGCAGCTGGAGGAGTGGGGG	0.647			T	BCL6	NHL																																.				Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	NACA_ENST00000454682,NS,malignant_melanoma,0,1	NACA	131	1	0			.												34.0	44.0	41.0					12																	57111378		1405	3197	4602	SO:0001819	synonymous_variant	4666	.			AGCTGGAGGAGTG	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.3936T>C	12.37:g.57111378A>G			Somatic	141	0.0212765957	3		WXS	Illumina HiSeq	Phase_I	116	0.09	11	.	0		0		Silent	SNP	ENST00000454682.1	37																																																																																						0.647	NACA-201	KNOWN	basic	protein_coding	protein_coding				NM_005594	
NUP107	57122	mdanderson.org	37	12	69135740	69135740	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr12:69135740G>T	ENST00000229179.4	+	27	2982	c.2650G>T	c.(2650-2652)Gag>Tag	p.E884*	NUP107_ENST00000539906.1_Nonsense_Mutation_p.E855*|NUP107_ENST00000378905.2_Nonsense_Mutation_p.E645*	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	884					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			GGTATCCTCTGAGCGCCACAA	0.368																																					p.E884X													.	.			0			c.G2650T												165.0	148.0	154.0					12																	69135740		2203	4300	6503	SO:0001587	stop_gained	57122	exon27			TCCTCTGAGCGCC	AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.2650G>T	12.37:g.69135740G>T	ENSP00000229179:p.Glu884*		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	81	0.06	5	NM_020401	332	0.00	1	B4DZ67|Q6PJE1	Nonsense_Mutation	SNP	ENST00000229179.4	37	CCDS8985.1	.	.	.	.	.	.	.	.	.	.	G	43	9.842402	0.99277	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	5.51	5.51	0.81932	.	0.141818	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.7214	19.8057	0.96531	0.0:0.0:1.0:0.0	.	.	.	.	X	884;645;855	.	.	E	+	1	0	NUP107	67422007	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.577000	0.90773	2.779000	0.95612	0.655000	0.94253	GAG			0.368	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403195.1		NM_020401	
ZFC3H1	196441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	72028578	72028578	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr12:72028578T>A	ENST00000378743.3	-	11	2624	c.2266A>T	c.(2266-2268)Aaa>Taa	p.K756*		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	756					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TTTTCAGATTTTGGAGGTACT	0.328																																					p.K756X													.	.			0			c.A2266T												74.0	66.0	69.0					12																	72028578		1794	4059	5853	SO:0001587	stop_gained	196441	exon11			CAGATTTTGGAGG	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.2266A>T	12.37:g.72028578T>A	ENSP00000368017:p.Lys756*		Somatic	59	0	0		WXS	Illumina HiSeq	.	48	0.23	11	NM_144982	0		0	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Nonsense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	T	42	9.223252	0.99105	.	.	ENSG00000133858	ENST00000378743	.	.	.	5.4	5.4	0.78164	.	0.275476	0.36234	N	0.002708	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4268	0.75059	0.0:0.0:0.0:1.0	.	.	.	.	X	756	.	ENSP00000368017:K756X	K	-	1	0	ZFC3H1	70314845	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.361000	0.59461	2.054000	0.61138	0.533000	0.62120	AAA			0.328	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404751.1		NM_144982	
SETD3	84193	mdanderson.org	37	14	99876548	99876548	+	Intron	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr14:99876548G>T	ENST00000331768.5	-	8	1009				SETD3_ENST00000329331.3_Missense_Mutation_p.P285Q	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3						histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				ggaatcttctggtgtctgaag	0.547																																					p.P285Q													.	.			0			c.C854A												135.0	121.0	126.0					14																	99876548		2203	4300	6503	SO:0001627	intron_variant	84193	exon9			TCTTCTGGTGTCT	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.849+2739C>A	14.37:g.99876548G>T			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_199123	0		0	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	37	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	G	3.328	-0.137219	0.06711	.	.	ENSG00000183576	ENST00000329331	T	0.21191	2.02	1.61	1.61	0.23674	.	.	.	.	.	T	0.20820	0.0501	N	0.08118	0	0.19945	N	0.999942	D	0.60160	0.987	D	0.66196	0.942	T	0.10497	-1.0627	9	0.66056	D	0.02	.	6.6954	0.23195	0.0:0.0:1.0:0.0	.	285	A0PJU3	.	Q	285	ENSP00000327910:P285Q	ENSP00000327910:P285Q	P	-	2	0	SETD3	98946301	0.000000	0.05858	0.004000	0.12327	0.018000	0.09664	-0.330000	0.07925	1.252000	0.44001	0.655000	0.94253	CCA			0.547	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000072339.3		NM_032233	
AHNAK2	113146	broad.mit.edu	37	14	105414109	105414109	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr14:105414109G>A	ENST00000333244.5	-	7	7798	c.7679C>T	c.(7678-7680)gCc>gTc	p.A2560V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2560						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTTGAGGCCGGCTCCCTCCGG	0.627																																					p.A2560V													.	AHNAK2	719		0			c.C7679T												107.0	118.0	115.0					14																	105414109		1869	4095	5964	SO:0001583	missense	113146	exon7			AGGCCGGCTCCCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7679C>T	14.37:g.105414109G>A	ENSP00000353114:p.Ala2560Val		Somatic	185	0	0		WXS	Illumina HiSeq	Phase_I	175	0.03	6	NM_138420	0		0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	10.97	1.500590	0.26861	.	.	ENSG00000185567	ENST00000333244	T	0.00912	5.55	3.13	-0.0674	0.13760	.	.	.	.	.	T	0.01156	0.0038	M	0.66297	2.02	0.09310	N	1	P	0.35745	0.518	B	0.33339	0.162	T	0.44574	-0.9319	9	0.25751	T	0.34	.	4.4923	0.11819	0.2334:0.1824:0.5842:0.0	.	2560	Q8IVF2	AHNK2_HUMAN	V	2560	ENSP00000353114:A2560V	ENSP00000353114:A2560V	A	-	2	0	AHNAK2	104485154	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.432000	0.02430	0.072000	0.16694	0.306000	0.20318	GCC			0.627	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000410300.1		NM_138420	
MAN2C1	4123	broad.mit.edu;mdanderson.org	37	15	75654243	75654243	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr15:75654243G>A	ENST00000267978.5	-	9	1100	c.1054C>T	c.(1054-1056)Cag>Tag	p.Q352*	MAN2C1_ENST00000563622.1_Nonsense_Mutation_p.Q253*|MAN2C1_ENST00000563539.1_5'Flank|MAN2C1_ENST00000569482.1_Nonsense_Mutation_p.Q352*|MAN2C1_ENST00000565683.1_Nonsense_Mutation_p.Q352*	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	352					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						TTCTGGCCCTGCAAAAACTGC	0.622																																					p.Q352X													.	MAN2C1	76		0			c.C1054T												124.0	126.0	125.0					15																	75654243		2197	4294	6491	SO:0001587	stop_gained	4123	exon9			GGCCCTGCAAAAA	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1054C>T	15.37:g.75654243G>A	ENSP00000267978:p.Gln352*		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	82	0.05	4	NM_001256494	13	0.00	0	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Nonsense_Mutation	SNP	ENST00000267978.5	37	CCDS32298.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946387	0.92593	.	.	ENSG00000140400	ENST00000267978	.	.	.	5.54	4.59	0.56863	.	0.112811	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-19.0309	15.1417	0.72615	0.0:0.142:0.858:0.0	.	.	.	.	X	352	.	ENSP00000267978:Q352X	Q	-	1	0	MAN2C1	73441296	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.399000	0.59703	1.279000	0.44446	0.561000	0.74099	CAG			0.622	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419965.1			
ABCA3	21	mdanderson.org	37	16	2338251	2338251	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr16:2338251G>T	ENST00000301732.5	-	21	3480	c.2780C>A	c.(2779-2781)gCg>gAg	p.A927E	ABCA3_ENST00000382381.3_Missense_Mutation_p.A869E	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	927					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GACCTGTGCCGCCACCATTTT	0.637																																					p.A927E													.	.			0			c.C2780A												37.0	32.0	34.0					16																	2338251		2198	4298	6496	SO:0001583	missense	21	exon21			TGTGCCGCCACCA	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2780C>A	16.37:g.2338251G>T	ENSP00000301732:p.Ala927Glu		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001089	5	0.00	0	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170611	0.38315	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D;D	0.93366	-3.21;-2.22	5.54	-4.17	0.03857	.	0.274124	0.36482	N	0.002568	D	0.89698	0.6790	L	0.44542	1.39	0.32835	D	0.504582	B;B	0.31705	0.053;0.336	B;B	0.39094	0.176;0.29	D	0.84283	0.0495	10	0.59425	D	0.04	.	13.5978	0.62000	0.6625:0.0:0.3375:0.0	.	931;927	Q4LE27;Q99758	.;ABCA3_HUMAN	E	927;931	ENSP00000301732:A927E;ENSP00000371818:A931E	ENSP00000301732:A927E	A	-	2	0	ABCA3	2278252	0.990000	0.36364	0.000000	0.03702	0.549000	0.35272	2.348000	0.44045	-0.563000	0.06078	-0.793000	0.03317	GCG			0.637	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250784.2		NM_001089	
ZNF764	92595	mdanderson.org	37	16	30566959	30566959	+	Nonsense_Mutation	SNP	G	G	T	rs549155581		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr16:30566959G>T	ENST00000252797.2	-	3	863	c.783C>A	c.(781-783)tgC>tgA	p.C261*	ZNF764_ENST00000395091.2_Nonsense_Mutation_p.C260*|AC002310.13_ENST00000568114.1_Intron	NM_001172679.1|NM_033410.3	NP_001166150.1|NP_219363.2	Q96H86	ZN764_HUMAN	zinc finger protein 764	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7						CACAGTCGGCGCAGCCATAGG	0.721																																					p.C261X													.	.			0			c.C783A												3.0	6.0	5.0					16																	30566959		2009	3975	5984	SO:0001587	stop_gained	92595	exon3			GTCGGCGCAGCCA	BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951		"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product						12477932	Standard	NM_033410		Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.783C>A	16.37:g.30566959G>T	ENSP00000252797:p.Cys261*		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_033410	7	0.00	0	A8MZF4|B3KSN2|H9KV99|Q9BWS1	Nonsense_Mutation	SNP	ENST00000252797.2	37	CCDS10683.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752410	0.31046	.	.	ENSG00000169951	ENST00000252797;ENST00000395091	.	.	.	4.84	-3.09	0.05331	.	0.000000	0.42172	D	0.000749	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5261	12.0938	0.53742	0.5193:0.0:0.4807:0.0	.	.	.	.	X	261;260	.	ENSP00000252797:C261X	C	-	3	2	ZNF764	30474460	0.000000	0.05858	0.325000	0.25375	0.101000	0.19017	-0.362000	0.07602	-0.884000	0.03976	-1.244000	0.01528	TGC			0.721	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255541.1		NM_033410	
ZNF629	23361	mdanderson.org	37	16	30794398	30794398	+	Silent	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr16:30794398G>T	ENST00000262525.4	-	3	1458	c.1251C>A	c.(1249-1251)ctC>ctA	p.L417L	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GGTGGTTGATGAGGTTGGAGC	0.662																																					p.L417L													.	.			0			c.C1251A												52.0	56.0	54.0					16																	30794398		2197	4300	6497	SO:0001819	synonymous_variant	23361	exon3			GTTGATGAGGTTG	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1251C>A	16.37:g.30794398G>T			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001080417	0		0	Q15938	Silent	SNP	ENST00000262525.4	37	CCDS45463.1																																																																																					0.662	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434291.1		NM_015309	
ZNF423	23090	mdanderson.org	37	16	49671203	49671203	+	Silent	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr16:49671203G>T	ENST00000561648.1	-	4	1913	c.1860C>A	c.(1858-1860)ctC>ctA	p.L620L	ZNF423_ENST00000562520.1_Silent_p.L560L|ZNF423_ENST00000562871.1_Silent_p.L560L|ZNF423_ENST00000262383.2_Silent_p.L620L|ZNF423_ENST00000567169.1_Silent_p.L503L|ZNF423_ENST00000535559.1_Silent_p.L503L|ZNF423_ENST00000563137.2_Silent_p.L560L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	620					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CGCTTGCTGAGAGCCGCTGCC	0.567																																					p.L620L													.	.			0			c.C1860A												78.0	69.0	72.0					16																	49671203		2198	4300	6498	SO:0001819	synonymous_variant	23090	exon4			TGCTGAGAGCCGC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1860C>A	16.37:g.49671203G>T			Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	68	0.07	5	NM_015069	5	0.00	0	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	CCDS32445.1																																																																																					0.567	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000423258.1		NM_015069	
COX4I1	1327	broad.mit.edu	37	16	85838605	85838605	+	Silent	SNP	T	T	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr16:85838605T>C	ENST00000562336.1	+	3	329	c.136T>C	c.(136-138)Ttg>Ctg	p.L46L	COX4I1_ENST00000564903.1_Silent_p.L46L|COX4I1_ENST00000253452.2_Silent_p.L46L|COX4I1_ENST00000568794.1_Silent_p.L46L|COX4I1_ENST00000570123.1_3'UTR|COX4I1_ENST00000561569.1_Silent_p.L46L			P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	46					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-c oxidase activity (GO:0004129)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9		Renal(780;0.228)				TGACCACCCCTTGCCGGAGGT	0.493																																					p.L46L													.	COX4I1	20		0			c.T136C												53.0	56.0	55.0					16																	85838605		2198	4300	6498	SO:0001819	synonymous_variant	1327	exon3			CACCCCTTGCCGG	AF005889	CCDS10955.1	16q24.1	2012-10-02	2001-11-30	2001-12-07	ENSG00000131143	ENSG00000131143	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2265	protein-coding gene	gene with protein product		123864	"""cytochrome c oxidase subunit IV"""	COX4		2444497, 2157630	Standard	NM_001861		Approved	COX4-1	uc002fje.3	P13073	OTTHUMG00000137649	ENST00000562336.1:c.136T>C	16.37:g.85838605T>C			Somatic	123	0.1382113821	17		WXS	Illumina HiSeq	Phase_I	93	0.16	15	NM_001861	2211	0.03	66	B2R4J2|D3DUM7|Q6P666	Silent	SNP	ENST00000562336.1	37	CCDS10955.1																																																																																					0.493	COX4I1-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430873.1		NM_001861	
ALOX12B	242	mdanderson.org	37	17	7979514	7979514	+	Missense_Mutation	SNP	G	G	T	rs141010860		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:7979514G>T	ENST00000319144.4	-	11	1771	c.1511C>A	c.(1510-1512)gCg>gAg	p.A504E	ALOX12B_ENST00000577351.1_5'UTR	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	504	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						ATTCCACACCGCCAAGCTGTC	0.572										Multiple Myeloma(8;0.094)																											p.A504E													.	.			0			c.C1511A												135.0	111.0	119.0					17																	7979514		2203	4300	6503	SO:0001583	missense	242	exon11			CACACCGCCAAGC	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.1511C>A	17.37:g.7979514G>T	ENSP00000315167:p.Ala504Glu		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001139	1	0.00	0		Missense_Mutation	SNP	ENST00000319144.4	37	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.887115	0.33348	.	.	ENSG00000179477	ENST00000319144	T	0.74632	-0.86	4.98	2.81	0.32909	Lipoxygenase, C-terminal (3);	0.308672	0.34046	N	0.004319	T	0.62344	0.2420	N	0.25485	0.75	0.09310	N	1	P	0.36282	0.546	B	0.41374	0.355	T	0.55970	-0.8056	10	0.51188	T	0.08	-15.1141	7.8713	0.29567	0.0:0.2787:0.5577:0.1636	.	504	O75342	LX12B_HUMAN	E	504	ENSP00000315167:A504E	ENSP00000315167:A504E	A	-	2	0	ALOX12B	7920239	0.375000	0.25089	0.223000	0.23860	0.104000	0.19210	0.789000	0.26886	1.077000	0.40990	0.455000	0.32223	GCG			0.572	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226984.3			
RAI1	10743	mdanderson.org	37	17	17701342	17701342	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:17701342G>T	ENST00000353383.1	+	3	5549	c.5080G>T	c.(5080-5082)Gcc>Tcc	p.A1694S	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1694					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CCAAAACCCGGCCAACTTCAA	0.592																																					p.A1694S													.	.			0			c.G5080T												85.0	86.0	86.0					17																	17701342		2203	4300	6503	SO:0001583	missense	10743	exon3			AACCCGGCCAACT	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5080G>T	17.37:g.17701342G>T	ENSP00000323074:p.Ala1694Ser		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	67	0.07	5	NM_030665	36	0.00	0	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.712777	0.68730	.	.	ENSG00000108557	ENST00000353383;ENST00000395776;ENST00000315321	T	0.41400	1.0	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000003	T	0.54951	0.1890	L	0.48642	1.525	0.80722	D	1	D	0.67145	0.996	D	0.70227	0.968	T	0.54944	-0.8217	10	0.52906	T	0.07	.	12.9576	0.58438	0.0812:0.0:0.9188:0.0	.	1694	Q7Z5J4	RAI1_HUMAN	S	1694;1694;1582	ENSP00000323074:A1694S	ENSP00000322928:A1582S	A	+	1	0	RAI1	17642067	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.246000	0.65411	2.382000	0.81193	0.555000	0.69702	GCC			0.592	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131775.1		NM_030665	
SMURF2P1	0	broad.mit.edu	37	17	28935711	28935713	+	RNA	DEL	GTA	GTA	-	rs72173531|rs568988840	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	GTA	GTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:28935711_28935713delGTA	ENST00000579301.1	+	0	431									SMAD specific E3 ubiquitin protein ligase 2 pseudogene 1																		atatatacatgtagtatatatgt	0.296														649	0.129593	0.0477	0.1859	5008	,	,		16183	0.1438		0.1064	False		,,,				2504	0.2096				.													.	.			0			.																																											0	.			ATACATGTAGTAT			17q11.2	2012-10-05			ENSG00000248121	ENSG00000248121			44402	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000132798		17.37:g.28935714_28935716delGTA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	12	0.42	5	.	0		0		RNA	DEL	ENST00000579301.1	37																																																																																						0.296	SMURF2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000444254.1			
GAS2L2	246176	broad.mit.edu	37	17	34077157	34077157	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:34077157T>G	ENST00000254466.6	-	2	593	c.566A>C	c.(565-567)gAc>gCc	p.D189A	GAS2L2_ENST00000587565.1_Intron	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	189					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGGCGAGGGGTCGGGCGGGGG	0.741																																					p.D189A													GAS2L2,right_upper_lobe,carcinoma,0,2	GAS2L2	94	2	0			c.A566C												20.0	26.0	24.0					17																	34077157		2188	4280	6468	SO:0001583	missense	246176	exon2			GAGGGGTCGGGCG	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.566A>C	17.37:g.34077157T>G	ENSP00000254466:p.Asp189Ala		Somatic	83	0.3493975904	29		WXS	Illumina HiSeq	Phase_I	80	0.38	30	NM_139285	0		0	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	T	7.826	0.718860	0.15372	.	.	ENSG00000132139	ENST00000254466	T	0.18016	2.24	4.98	2.77	0.32553	.	1.437920	0.04140	N	0.319452	T	0.17152	0.0412	L	0.51422	1.61	0.26149	N	0.980163	P	0.37781	0.608	B	0.30401	0.115	T	0.28902	-1.0029	10	0.49607	T	0.09	0.0179	8.0796	0.30737	0.0:0.1677:0.0:0.8323	.	189	Q8NHY3	GA2L2_HUMAN	A	189	ENSP00000254466:D189A	ENSP00000254466:D189A	D	-	2	0	GAS2L2	31101270	0.986000	0.35501	0.134000	0.22075	0.011000	0.07611	2.112000	0.41892	0.749000	0.32854	0.402000	0.26972	GAC			0.741	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256497.1		NM_139285	
SMARCE1	6605	mdanderson.org	37	17	38798746	38798746	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:38798746G>T	ENST00000348513.6	-	4	897	c.117C>A	c.(115-117)taC>taA	p.Y39*	KRT222_ENST00000476049.1_Intron|SMARCE1_ENST00000580419.1_Intron|SMARCE1_ENST00000578044.1_Intron|SMARCE1_ENST00000377808.4_Intron|SMARCE1_ENST00000474246.1_Nonsense_Mutation_p.Y39*|SMARCE1_ENST00000400122.3_Intron|SMARCE1_ENST00000544009.1_Intron|SMARCE1_ENST00000431889.2_Nonsense_Mutation_p.Y21*	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	39	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)			large_intestine(1)	1		Breast(137;0.000812)				CTCCCAGCCTGTAGTTGTTGT	0.493																																					p.Y39X													.	.			0			c.C117A												128.0	123.0	125.0					17																	38798746		2203	4300	6503	SO:0001587	stop_gained	6605	exon4			CAGCCTGTAGTTG	AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.117C>A	17.37:g.38798746G>T	ENSP00000323967:p.Tyr39*		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_003079	128	0.00	0	B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Nonsense_Mutation	SNP	ENST00000348513.6	37	CCDS11370.1	.	.	.	.	.	.	.	.	.	.	G	36	5.880098	0.97062	.	.	ENSG00000073584	ENST00000348513;ENST00000431889	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	.	.	.	X	39;21	.	ENSP00000323967:Y39X	Y	-	3	2	SMARCE1	36052272	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.882000	0.98803	0.655000	0.94253	TAC			0.493	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257203.1		NM_003079	
KRTAP2-4	85294	hgsc.bcm.edu	37	17	39221816	39221816	+	Nonsense_Mutation	SNP	C	C	T	rs200049107		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:39221816C>T	ENST00000394015.2	-	1	315	c.282G>A	c.(280-282)tgG>tgA	p.W94*		NM_033184.3	NP_149440.1	Q9BYR9	KRA24_HUMAN	keratin associated protein 2-4	94	10 X 5 AA repeats of C-C-[CDPQRW]- [ADPRS]-[CIPSTV].					keratin filament (GO:0045095)		p.W94*(1)		skin(1)	1		Breast(137;0.000496)|Myeloproliferative disorder(1115;0.204)	STAD - Stomach adenocarcinoma(17;0.000371)			AGGTGGTGGCCCAGCAGCAGG	0.716																																					p.W94X													KRTAP2-4,trunk,malignant_melanoma,0,1	KRTAP2-4	0	1	1	Substitution - Nonsense(1)	skin(1)	c.G282A												9.0	9.0	9.0					17																	39221816		1454	3133	4587	SO:0001587	stop_gained	85294	exon1			GGTGGCCCAGCAG	AJ406930		17q21.2	2012-04-19			ENSG00000213417	ENSG00000213417		"""Keratin associated proteins"""	18891	protein-coding gene	gene with protein product						11279113	Standard	NM_033184		Approved	KAP2.4	uc002hvy.3	Q9BYR9	OTTHUMG00000133594	ENST00000394015.2:c.282G>A	17.37:g.39221816C>T	ENSP00000377583:p.Trp94*		Somatic	16	0.125	2		WXS	Illumina HiSeq	.	15	0.20	3	NM_033184	0		0	Q495J2	Nonsense_Mutation	SNP	ENST00000394015.2	37	CCDS32648.1	.	.	.	.	.	.	.	.	.	.	.	25.2	4.608564	0.87258	.	.	ENSG00000213417	ENST00000394015	.	.	.	5.58	5.58	0.84498	.	0.187904	0.26119	U	0.026230	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	15.0735	0.72059	0.0:1.0:0.0:0.0	.	.	.	.	X	94	.	ENSP00000377583:W94X	W	-	3	0	KRTAP2-4	36475342	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	0.989000	0.29629	2.624000	0.88883	0.655000	0.94253	TGG			0.716	KRTAP2-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257698.1		NM_033184	
SP6	80320	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	45924781	45924781	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:45924781C>T	ENST00000536300.1	-	2	1346	c.1015G>A	c.(1015-1017)Gcc>Acc	p.A339T	SP6_ENST00000342234.2_Missense_Mutation_p.A339T	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	339					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						TCCTCCTTGGCGCCCTCGTGG	0.701																																					p.A339T													.	SP6	26		0			c.G1015A												20.0	22.0	21.0					17																	45924781		2203	4300	6503	SO:0001583	missense	80320	exon2			CCTTGGCGCCCTC		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.1015G>A	17.37:g.45924781C>T	ENSP00000438209:p.Ala339Thr		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	120	0.07	8	NM_001258248	2	0.00	0	B3KXS4	Missense_Mutation	SNP	ENST00000536300.1	37	CCDS11520.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736842	0.30774	.	.	ENSG00000189120	ENST00000342234;ENST00000536300	T;T	0.69806	-0.43;-0.43	4.4	1.03	0.20045	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.346065	0.21039	N	0.081216	T	0.39009	0.1062	N	0.08118	0	0.31347	N	0.682953	B	0.15930	0.015	B	0.10450	0.005	T	0.29761	-1.0001	10	0.19590	T	0.45	.	7.2294	0.26034	0.1473:0.6749:0.0:0.1778	.	339	Q3SY56	SP6_HUMAN	T	339	ENSP00000340799:A339T;ENSP00000438209:A339T	ENSP00000340799:A339T	A	-	1	0	SP6	43279780	0.014000	0.17966	1.000000	0.80357	0.983000	0.72400	0.354000	0.20146	0.489000	0.27749	0.462000	0.41574	GCC			0.701	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441395.1		NM_199262	
CARD14	79092	mdanderson.org	37	17	78164655	78164655	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:78164655C>T	ENST00000573882.1	+	9	1582	c.1046C>T	c.(1045-1047)gCg>gTg	p.A349V	CARD14_ENST00000392434.2_Missense_Mutation_p.A112V|CARD14_ENST00000344227.2_Missense_Mutation_p.A349V|CARD14_ENST00000570421.1_Missense_Mutation_p.A349V|CARD14_ENST00000573754.1_3'UTR			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	349					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			AAGGTGAATGCGCTGCAGGCC	0.617																																					p.A349V													.	.			0			c.C1046T												80.0	77.0	78.0					17																	78164655		2203	4300	6503	SO:0001583	missense	79092	exon7			TGAATGCGCTGCA	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1046C>T	17.37:g.78164655C>T	ENSP00000458715:p.Ala349Val		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_024110	0		0	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	c	7.090	0.571936	0.13623	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.35605	1.3;1.3	4.26	2.21	0.28008	.	0.589265	0.17040	N	0.189368	T	0.41050	0.1142	M	0.73962	2.25	0.09310	N	1	P;D;P	0.61697	0.952;0.99;0.685	B;P;B	0.46110	0.146;0.504;0.062	T	0.32214	-0.9915	10	0.62326	D	0.03	-4.5366	9.2707	0.37670	0.0:0.815:0.0:0.185	.	349;112;349	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	V	349;112;112	ENSP00000344549:A349V;ENSP00000376229:A112V	ENSP00000308507:A112V	A	+	2	0	CARD14	75779250	0.130000	0.22417	0.002000	0.10522	0.012000	0.07955	1.333000	0.33816	0.264000	0.21851	0.651000	0.88453	GCG			0.617	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437507.1			
ENDOV	284131	ucsc.edu	37	17	78409975	78409975	+	3'UTR	SNP	A	A	G	rs12939348	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:78409975A>G	ENST00000518137.1	+	0	909				ENDOV_ENST00000517795.1_3'UTR|ENDOV_ENST00000518901.1_3'UTR|ENDOV_ENST00000520367.1_3'UTR|ENDOV_ENST00000518907.1_Missense_Mutation_p.I59V|ENDOV_ENST00000520284.1_Missense_Mutation_p.I59V	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V						DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						tcctcgtctcattcctgatcG	0.532								Direct reversal of damage																													.													.	ENDOV	26		0			.												107.0	88.0	94.0					17																	78409975		1568	3582	5150	SO:0001624	3_prime_UTR_variant	284131	.			CGTCTCATTCCTG		CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.*32A>G	17.37:g.78409975A>G			Somatic	50	0.04	2		WXS	Illumina HiSeq		39	0.10	4	.	19	0.05	1	I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Missense_Mutation	SNP	ENST00000518137.1	37	CCDS54172.1																																																																																					0.532	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379487.1		NM_173627	
CCDC57	284001	mdanderson.org	37	17	80086422	80086422	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr17:80086422G>T	ENST00000389641.4	-	16	2332	c.2296C>A	c.(2296-2298)Cag>Aag	p.Q766K	CCDC57_ENST00000392346.2_Missense_Mutation_p.Q123K|CCDC57_ENST00000392347.1_Missense_Mutation_p.Q766K			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	766										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GAGCGGGGCTGGTGCTTTCCC	0.607																																					p.Q765K													.	.			0			c.C2293A												51.0	60.0	57.0					17																	80086422		2110	4203	6313	SO:0001583	missense	284001	exon15			GGGGCTGGTGCTT	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2296C>A	17.37:g.80086422G>T	ENSP00000374292:p.Gln766Lys		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_198082	12	0.00	0	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.967|5.967	0.362374|0.362374	0.11296|0.11296	.|.	.|.	ENSG00000176155|ENSG00000176155	ENST00000392345;ENST00000419322|ENST00000389641;ENST00000392347;ENST00000392346;ENST00000324808	.|T;T;T	.|0.15372	.|2.43;2.43;2.63	1.82|1.82	-0.296|-0.296	0.12824|0.12824	.|.	.|1.030140	.|0.07829	.|U	.|0.961053	T|T	0.10035|0.10035	0.0246|0.0246	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B;B	.|0.17268	.|0.021;0.005	.|B;B	.|0.19148	.|0.024;0.003	T|T	0.40646|0.40646	-0.9552|-0.9552	5|10	.|0.23891	.|T	.|0.37	-3.5856|-3.5856	4.5521|4.5521	0.12117|0.12117	0.3463:0.0:0.6537:0.0|0.3463:0.0:0.6537:0.0	.|.	.|72;766	.|E7ENZ0;Q2TAC2	.|.;CCD57_HUMAN	Q|K	4;222|766;766;123;72	.|ENSP00000374292:Q766K;ENSP00000376158:Q766K;ENSP00000376157:Q123K	.|ENSP00000315223:Q72K	P|Q	-|-	2|1	0|0	CCDC57|CCDC57	77679711|77679711	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	1.116000|1.116000	0.31221|0.31221	-0.042000|-0.042000	0.13535|0.13535	-1.520000|-1.520000	0.00934|0.00934	CCA|CAG			0.607	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000277182.3		NM_198082	
MIER2	54531	broad.mit.edu	37	19	327235	327235	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr19:327235G>A	ENST00000264819.4	-	5	401	c.391C>T	c.(391-393)Ctt>Ttt	p.L131F	MIER2_ENST00000592722.1_5'Flank	NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	131					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCCTGAAAGCAAATCCTTC	0.433																																					p.L131F													.	MIER2	51		0			c.C391T												228.0	219.0	222.0					19																	327235		2203	4300	6503	SO:0001583	missense	54531	exon5			CTGAAAGCAAATC	AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.391C>T	19.37:g.327235G>A	ENSP00000264819:p.Leu131Phe		Somatic	87	0.0689655172	6		WXS	Illumina HiSeq	Phase_I	92	0.16	15	NM_017550	90	0.00	0	Q9ULM7	Missense_Mutation	SNP	ENST00000264819.4	37	CCDS32855.1	.	.	.	.	.	.	.	.	.	.	.	17.95	3.513315	0.64522	.	.	ENSG00000105556	ENST00000264819	T	0.36157	1.27	5.14	4.1	0.47936	.	0.000000	0.43416	D	0.000567	T	0.37758	0.1015	M	0.63428	1.95	0.49130	D	0.999756	P	0.44044	0.825	B	0.41764	0.366	T	0.33727	-0.9857	10	0.72032	D	0.01	-16.4891	11.2349	0.48933	0.0846:0.0:0.9154:0.0	.	131	Q8N344	MIER2_HUMAN	F	131	ENSP00000264819:L131F	ENSP00000264819:L131F	L	-	1	0	MIER2	278235	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.015000	0.64035	1.173000	0.42796	0.555000	0.69702	CTT			0.433	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451784.1		XM_041843	
S1PR2	9294	mdanderson.org	37	19	10334950	10334950	+	Missense_Mutation	SNP	C	C	T	rs141230424		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr19:10334950C>T	ENST00000590320.1	-	2	742	c.632G>A	c.(631-633)cGc>cAc	p.R211H	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	211					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						GCAGTAGATGCGCACGTACAG	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		19399	0.0		0.001	False		,,,				2504	0.0				p.R211H	Pancreas(194;229 3020 15179 45747)												.	.			0			c.G632A							C	HIS/ARG	0,4406		0,0,2203	79.0	64.0	69.0		632	4.8	1.0	19	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense	S1PR2	NM_004230.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	211/354	10334950	1,13005	2203	4300	6503	SO:0001583	missense	9294	exon2			TAGATGCGCACGT	AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.632G>A	19.37:g.10334950C>T	ENSP00000466933:p.Arg211His		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_004230	1	0.00	0	Q86UN8	Missense_Mutation	SNP	ENST00000590320.1	37	CCDS12229.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.96	2.988272	0.53934	0.0	1.16E-4	ENSG00000175898	ENST00000317726	.	.	.	5.81	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.134693	0.48286	N	0.000189	T	0.46034	0.1372	L	0.48642	1.525	0.50039	D	0.999848	B	0.23540	0.087	B	0.19148	0.024	T	0.33343	-0.9872	9	0.15066	T	0.55	.	10.1201	0.42616	0.0:0.8451:0.0:0.1549	.	211	O95136	S1PR2_HUMAN	H	211	.	ENSP00000322049:R211H	R	-	2	0	S1PR2	10195950	0.995000	0.38212	0.987000	0.45799	0.246000	0.25737	1.601000	0.36773	1.474000	0.48178	-0.144000	0.13903	CGC	0		0.602	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451194.1		NM_004230	
SMARCA4	6597	ucsc.edu	37	19	11123647	11123647	+	Missense_Mutation	SNP	T	T	G	rs201128299	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr19:11123647T>G	ENST00000429416.3	+	17	2578	c.2297T>G	c.(2296-2298)gTg>gGg	p.V766G	SMARCA4_ENST00000344626.4_Missense_Mutation_p.V766G|SMARCA4_ENST00000413806.3_Missense_Mutation_p.V766G|SMARCA4_ENST00000450717.3_Missense_Mutation_p.V766G|SMARCA4_ENST00000589677.1_Missense_Mutation_p.V766G|SMARCA4_ENST00000541122.2_Missense_Mutation_p.V766G|SMARCA4_ENST00000444061.3_Missense_Mutation_p.V766G|CTC-215O4.4_ENST00000587831.1_RNA|SMARCA4_ENST00000358026.2_Missense_Mutation_p.V766G|RN7SL192P_ENST00000584303.1_RNA|SMARCA4_ENST00000590574.1_Missense_Mutation_p.V766G	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	766	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GAGTGGCTGGTGTCCCTGTAC	0.592			"""F, N, Mis"""		NSCLC																																p.V766G				Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4_ENST00000358026,NS,carcinoma,-1,2	SMARCA4	502	2	1	Unknown(1)	lung(1)	c.T2297G												120.0	94.0	103.0					19																	11123647		2203	4300	6503	SO:0001583	missense	6597	exon16			GGCTGGTGTCCCT	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2297T>G	19.37:g.11123647T>G	ENSP00000395654:p.Val766Gly		Somatic	150	0.0666666667	10		RNA-Seq	Illumina HiSeq		159	0.09	14	NM_003072	94	0.22	21	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.709111	0.89018	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	4.73	4.73	0.59995	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.96247	0.8776	M	0.77820	2.39	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0;0.999;0.999	D	0.96694	0.9513	10	0.87932	D	0	-43.9195	13.3423	0.60551	0.0:0.0:0.0:1.0	.	766;766;766;766;766;766;766	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	G	766;766;830;766;766;766;766;766	ENSP00000395654:V766G;ENSP00000350720:V766G;ENSP00000343896:V766G;ENSP00000445036:V766G;ENSP00000392837:V766G;ENSP00000397783:V766G;ENSP00000414727:V766G	ENSP00000343896:V766G	V	+	2	0	SMARCA4	10984647	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.868000	0.87116	1.988000	0.58038	0.533000	0.62120	GTG			0.592	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000452638.2		NM_003072	
NACC1	112939	mdanderson.org	37	19	13246749	13246749	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr19:13246749C>T	ENST00000292431.4	+	2	854	c.728C>T	c.(727-729)gCc>gTc	p.A243V		NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	243					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						GGGCAGCCAGCCGGTGGGGTG	0.741																																					p.A243V													.	.			0			c.C728T												8.0	11.0	10.0					19																	13246749		2135	4178	6313	SO:0001583	missense	112939	exon2			AGCCAGCCGGTGG	AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.728C>T	19.37:g.13246749C>T	ENSP00000292431:p.Ala243Val		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_052876	18	0.00	0		Missense_Mutation	SNP	ENST00000292431.4	37	CCDS12294.1	.	.	.	.	.	.	.	.	.	.	C	0.126	-1.119293	0.01785	.	.	ENSG00000160877	ENST00000292431	T	0.53857	0.6	2.27	0.0361	0.14190	.	0.667620	0.14070	N	0.343408	T	0.29882	0.0747	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15578	-1.0432	10	0.17369	T	0.5	.	4.5666	0.12189	0.0:0.6702:0.0:0.3298	.	243	Q96RE7	NACC1_HUMAN	V	243	ENSP00000292431:A243V	ENSP00000292431:A243V	A	+	2	0	NACC1	13107749	0.002000	0.14202	0.001000	0.08648	0.084000	0.17831	1.177000	0.31969	0.075000	0.16796	0.400000	0.26472	GCC			0.741	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452879.1		NM_052876	
EIF5B	9669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99992927	99992927	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr2:99992927G>A	ENST00000289371.6	+	10	1872	c.1670G>A	c.(1669-1671)aGt>aAt	p.S557N		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	557	Asp/Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						gagggagaaAGTGAAGGCAGT	0.418																																					p.S557N	Colon(162;2388 2567 2705 3444)												.	.			0			c.G1670A												68.0	70.0	69.0					2																	99992927		2121	4224	6345	SO:0001583	missense	9669	exon10			GAGAAAGTGAAGG	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.1670G>A	2.37:g.99992927G>A	ENSP00000289371:p.Ser557Asn		Somatic	100	0	0		WXS	Illumina HiSeq	.	120	0.18	21	NM_015904	228	0.24	55	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	ENST00000289371.6	37	CCDS42721.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628005	0.46944	.	.	ENSG00000158417	ENST00000289371	T	0.48836	0.8	6.17	6.17	0.99709	.	.	.	.	.	T	0.49218	0.1544	L	0.47716	1.5	0.41935	D	0.990584	D	0.53151	0.958	P	0.44447	0.45	T	0.37103	-0.9720	8	.	.	.	-3.2603	20.8794	0.99867	0.0:0.0:1.0:0.0	.	557	O60841	IF2P_HUMAN	N	557	ENSP00000289371:S557N	.	S	+	2	0	EIF5B	99359359	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.438000	0.73426	2.941000	0.99782	0.655000	0.94253	AGT			0.418	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000330364.2		NM_015904	
FARP2	9855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242350476	242350476	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr2:242350476G>C	ENST00000264042.3	+	6	609	c.439G>C	c.(439-441)Gac>Cac	p.D147H	FARP2_ENST00000373287.4_Missense_Mutation_p.D147H|FARP2_ENST00000545004.1_Missense_Mutation_p.D147H	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	147	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ACTTAAGAGAGACCTGCTGGA	0.483																																					p.D147H													.	.			0			c.G439C												115.0	99.0	105.0					2																	242350476		2203	4300	6503	SO:0001583	missense	9855	exon6			AAGAGAGACCTGC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.439G>C	2.37:g.242350476G>C	ENSP00000264042:p.Asp147His		Somatic	78	0	0		WXS	Illumina HiSeq	.	52	0.21	11	NM_014808	2	0.50	1	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	37	CCDS33424.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843557	0.91197	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287	T;T;T	0.80824	-1.42;-1.42;-1.42	5.44	5.44	0.79542	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.166539	0.51477	D	0.000084	D	0.94095	0.8107	H	0.97806	4.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.969;0.996;0.97	D	0.96104	0.9071	10	0.87932	D	0	.	19.2455	0.93901	0.0:0.0:1.0:0.0	.	147;147;147	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	H	147	ENSP00000264042:D147H;ENSP00000443876:D147H;ENSP00000362384:D147H	ENSP00000264042:D147H	D	+	1	0	FARP2	241999149	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.642000	0.91036	2.544000	0.85801	0.655000	0.94253	GAC			0.483	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323153.1			
SIRPG	55423	broad.mit.edu	37	20	1615980	1615980	+	Silent	SNP	C	C	T	rs147655438		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr20:1615980C>T	ENST00000303415.3	-	4	1078	c.1014G>A	c.(1012-1014)gcG>gcA	p.A338A	SIRPG_ENST00000381583.2_Intron|SIRPG_ENST00000216927.4_Intron|SIRPG_ENST00000381580.1_Silent_p.A305A|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000344103.4_Intron|RP11-77C3.3_ENST00000456177.1_RNA	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	338	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						GTTTGCTGACCGCCAGCTGCC	0.502																																					p.A338A													SIRPG,NS,carcinoma,0,1	SIRPG	61	1	0			c.G1014A							C	,,	1,4405		0,1,2202	116.0	94.0	101.0		,1014,	-0.9	0.0	20	dbSNP_134	101	0,8600		0,0,4300	no	intron,coding-synonymous,intron	SIRPG	NM_001039508.1,NM_018556.3,NM_080816.2	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	,338/388,	1615980	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55423	exon4			GCTGACCGCCAGC	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.1014G>A	20.37:g.1615980C>T			Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	99	0.04	4	NM_018556	14	0.00	0	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000303415.3	37	CCDS13020.2																																																																																					0.502	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077566.2		NM_018556	
FOXA2	3170	broad.mit.edu	37	20	22562677	22562677	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr20:22562677G>C	ENST00000377115.4	-	3	1366	c.1185C>G	c.(1183-1185)caC>caG	p.H395Q	FOXA2_ENST00000419308.2_Missense_Mutation_p.H401Q	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	395	Transactivation domain 2. {ECO:0000250}.				adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					TGTGGGGTtggtggtggtggt	0.612																																					p.H401Q													.	FOXA2	48		0			c.C1203G												160.0	156.0	158.0					20																	22562677		2203	4300	6503	SO:0001583	missense	3170	exon2			GGGTTGGTGGTGG	AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.1185C>G	20.37:g.22562677G>C	ENSP00000366319:p.His395Gln		Somatic	223	0.0044843049	1		WXS	Illumina HiSeq	Phase_I	166	0.02	3	NM_021784	0		0	Q8WUW4|Q96DF7	Missense_Mutation	SNP	ENST00000377115.4	37	CCDS13147.1	.	.	.	.	.	.	.	.	.	.	G	5.824	0.336270	0.11013	.	.	ENSG00000125798	ENST00000377115;ENST00000419308;ENST00000319993;ENST00000444877	D;D;D	0.89485	-2.51;-2.51;-2.52	4.15	-0.0701	0.13748	Forkhead box protein, C-terminal (1);	.	.	.	.	T	0.81451	0.4825	L	0.36672	1.1	0.32494	N	0.539792	B;B	0.14805	0.011;0.011	B;B	0.14023	0.01;0.01	T	0.74278	-0.3717	9	0.40728	T	0.16	.	8.4046	0.32608	0.4526:0.0:0.5474:0.0	.	395;401	Q9Y261;B0ZTD4	FOXA2_HUMAN;.	Q	395;395;401;281	ENSP00000366319:H395Q;ENSP00000400341:H395Q;ENSP00000315955:H401Q	ENSP00000315955:H401Q	H	-	3	2	FOXA2	22510677	1.000000	0.71417	0.999000	0.59377	0.517000	0.34286	1.203000	0.32284	0.134000	0.18681	-0.348000	0.07805	CAC			0.612	FOXA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000078289.1			
RALGAPB	57148	broad.mit.edu	37	20	37195815	37195815	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr20:37195815G>T	ENST00000262879.6	+	26	4178	c.3894G>T	c.(3892-3894)caG>caT	p.Q1298H	RALGAPB_ENST00000397038.1_Missense_Mutation_p.Q1077H|RALGAPB_ENST00000397040.1_Missense_Mutation_p.Q1298H|RALGAPB_ENST00000397042.3_Missense_Mutation_p.Q1295H			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1298	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TTCTGAAACAGCCATCCCTGA	0.388																																					p.Q1298H													.	RALGAPB	134		0			c.G3894T												144.0	133.0	137.0					20																	37195815		2203	4300	6503	SO:0001583	missense	57148	exon26			GAAACAGCCATCC	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.3894G>T	20.37:g.37195815G>T	ENSP00000262879:p.Gln1298His		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	99	0.03	3	NM_020336	43	0.00	0	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	ENST00000262879.6	37	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681907	0.68042	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	.	.	.	5.42	2.4	0.29515	Rap/ran-GAP (1);	0.053919	0.85682	D	0.000000	T	0.59636	0.2208	L	0.44542	1.39	0.58432	D	0.999998	D;D	0.57899	0.981;0.981	P;P	0.57009	0.811;0.811	T	0.55921	-0.8064	9	0.36615	T	0.2	.	10.8124	0.46555	0.2085:0.0:0.7915:0.0	.	1295;1298	A2A2E9;Q86X10	.;RLGPB_HUMAN	H	1298;1295;1077;1298;1127	.	ENSP00000262879:Q1298H	Q	+	3	2	RALGAPB	36629229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.076000	0.50081	0.682000	0.31407	0.591000	0.81541	CAG			0.388	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000079191.1		NM_020336	
MIR3687-2	103504728	broad.mit.edu	37	21	9825838	9825839	+	RNA	INS	-	-	GCG	rs372061766|rs369177681|rs563875271	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr21:9825838_9825839insGCG	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						cggccgcgactgcggcggcggt	0.842																																					.													.	.			0			.																																											0	.			CGCGACTGCGGCG																													21.37:g.9825845_9825847dupGCG			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	11	0.45	5	.	0		0		RNA	INS	ENST00000577708.1	37																																																																																						0.842	MIR3687-201	KNOWN	basic	miRNA	miRNA					
ADAMTS5	11096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	28302337	28302337	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr21:28302337C>G	ENST00000284987.5	-	7	2214	c.2093G>C	c.(2092-2094)tGc>tCc	p.C698S	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	698	Cys-rich.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CCCCCGGACGCAGACGGAATT	0.498																																					p.C698S	Esophageal Squamous(53;683 1080 10100 14424 45938)												ADAMTS5,colon,carcinoma,+1,2	ADAMTS5	1	2	0			c.G2093C												225.0	200.0	209.0					21																	28302337		2203	4300	6503	SO:0001583	missense	11096	exon7			CGGACGCAGACGG	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2093G>C	21.37:g.28302337C>G	ENSP00000284987:p.Cys698Ser		Somatic	157	0	0		WXS	Illumina HiSeq	.	135	0.36	48	NM_007038	11	0.36	4	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508910	0.85282	.	.	ENSG00000154736	ENST00000284987	D	0.82167	-1.58	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.94938	0.8363	H	0.97265	3.97	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.95888	0.8904	10	0.87932	D	0	.	20.428	0.99075	0.0:1.0:0.0:0.0	.	698	Q9UNA0	ATS5_HUMAN	S	698	ENSP00000284987:C698S	ENSP00000284987:C698S	C	-	2	0	ADAMTS5	27224208	1.000000	0.71417	0.806000	0.32338	0.531000	0.34715	7.412000	0.80091	2.837000	0.97791	0.655000	0.94253	TGC			0.498	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000171648.1			
HLCS	3141	hgsc.bcm.edu	37	21	38269383	38269383	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr21:38269383C>G	ENST00000399120.1	-	7	2458	c.1228G>C	c.(1228-1230)Gag>Cag	p.E410Q	HLCS_ENST00000482273.1_5'UTR|HLCS_ENST00000336648.4_Missense_Mutation_p.E410Q	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	410					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	ATTTCTCCCTCGGAGTCCACA	0.418																																					p.E410Q													.	.			0			c.G1228C												76.0	85.0	82.0					21																	38269383		2203	4300	6503	SO:0001583	missense	3141	exon7			CTCCCTCGGAGTC		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1228G>C	21.37:g.38269383C>G	ENSP00000382071:p.Glu410Gln		Somatic	102	0	0		WXS	Illumina HiSeq	.	100	0.04	4	NM_000411	16	0.00	0	B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	ENST00000399120.1	37	CCDS13647.1	.	.	.	.	.	.	.	.	.	.	C	6.694	0.496735	0.12762	.	.	ENSG00000159267	ENST00000399120;ENST00000336648	D;D	0.98192	-4.78;-4.78	5.12	3.17	0.36434	.	0.601719	0.19029	N	0.124617	D	0.95774	0.8625	L	0.55481	1.735	0.09310	N	1	P	0.41345	0.746	B	0.38880	0.284	D	0.90160	0.4227	10	0.22706	T	0.39	.	9.9605	0.41693	0.0:0.784:0.139:0.077	.	410	P50747	BPL1_HUMAN	Q	410	ENSP00000382071:E410Q;ENSP00000338387:E410Q	ENSP00000338387:E410Q	E	-	1	0	HLCS	37191253	0.133000	0.22466	0.053000	0.19242	0.263000	0.26337	2.110000	0.41873	1.295000	0.44724	0.563000	0.77884	GAG			0.418	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000194687.2			
KRTAP10-2	386679	mdanderson.org	37	21	45971147	45971147	+	Silent	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr21:45971147G>A	ENST00000391621.1	-	1	241	c.195C>T	c.(193-195)agC>agT	p.S65S	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	65	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						ATTGGCAGGCGCTGGGCTCAC	0.706																																					p.S65S													.	.			0			c.C195T												35.0	40.0	38.0					21																	45971147		2198	4287	6485	SO:0001819	synonymous_variant	386679	exon1			GCAGGCGCTGGGC	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.195C>T	21.37:g.45971147G>A			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_198693	0		0	Q70LJ5	Silent	SNP	ENST00000391621.1	37	CCDS42955.1																																																																																					0.706	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128027.1			
POM121L9P	29774	broad.mit.edu	37	22	24659809	24659809	+	RNA	SNP	G	G	A	rs376621154		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr22:24659809G>A	ENST00000414583.2	+	0	3334					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CCCTATCTGCGCACCCGGAGG	0.612																																					.													.	.			0			.																																											0	.			ATCTGCGCACCCG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659809G>A			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	18	0.50	9	.	0		0		RNA	SNP	ENST00000414583.2	37																																																																																						0.612	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
POM121L9P	29774	broad.mit.edu	37	22	24659813	24659813	+	RNA	SNP	C	C	T	rs368832816		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr22:24659813C>T	ENST00000414583.2	+	0	3338					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		ATCTGCGCACCCGGAGGTGGG	0.607																																					.													.	.			0			.																																											0	.			GCGCACCCGGAGG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659813C>T			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	18	0.50	9	.	0		0		RNA	SNP	ENST00000414583.2	37																																																																																						0.607	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
PRR14L	253143	broad.mit.edu	37	22	32109902	32109902	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr22:32109902G>T	ENST00000327423.6	-	4	4112	c.3923C>A	c.(3922-3924)gCt>gAt	p.A1308D	PRR14L_ENST00000397493.2_Missense_Mutation_p.A1308D|PRR14L_ENST00000461722.1_5'Flank|PRR14L_ENST00000434485.1_Missense_Mutation_p.A1308D	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1308										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						AGCTTTGCAAGCATTCTTTTC	0.418											OREG0003535	type=REGULATORY REGION|Gene=AK130944|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.A1308D													.	PRR14L	198		0			c.C3923A												113.0	88.0	95.0					22																	32109902		692	1591	2283	SO:0001583	missense	253143	exon4			TTGCAAGCATTCT	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.3923C>A	22.37:g.32109902G>T	ENSP00000331845:p.Ala1308Asp		Somatic	141	0	0	829	WXS	Illumina HiSeq	Phase_I	165	0.02	4	NM_173566	0		0	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	ENST00000327423.6	37	CCDS13900.2	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770778	0.49680	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.06528	3.29;3.31;3.3	4.23	-0.963	0.10330	.	1.991190	0.03130	N	0.165003	T	0.05777	0.0151	L	0.29908	0.895	0.09310	N	1	P;B;P	0.47677	0.815;0.358;0.899	B;B;B	0.39258	0.295;0.203;0.295	T	0.41752	-0.9491	9	.	.	.	0.3283	8.2278	0.31579	0.5549:0.0:0.4451:0.0	.	1308;1308;1308	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	D	1308	ENSP00000380630:A1308D;ENSP00000331845:A1308D;ENSP00000388314:A1308D	.	A	-	2	0	PRR14L	30439902	0.000000	0.05858	0.000000	0.03702	0.276000	0.26787	-0.426000	0.07008	-0.482000	0.06782	0.650000	0.86243	GCT			0.418	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000074993.2		NM_173566	
C22orf34	348645	broad.mit.edu	37	22	50014178	50014178	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr22:50014178G>T	ENST00000400023.1	-	4	582	c.500C>A	c.(499-501)gCg>gAg	p.A167E	C22orf34_ENST00000405854.1_Silent_p.R192R			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	0										pancreas(1)	1						gagcgcaatcgcctccaggct	0.522																																					.													.	C22orf34	2		0			.																																									SO:0001583	missense	0	.			GCAATCGCCTCCA	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000400023.1:c.500C>A	22.37:g.50014178G>T	ENSP00000382900:p.Ala167Glu		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	43	0.09	4	.	1	0.00	0	Q147Y0|Q5R3D1|Q6ZTN8	Missense_Mutation	SNP	ENST00000400023.1	37		.	.	.	.	.	.	.	.	.	.	G	0.013	-1.627471	0.00813	.	.	ENSG00000188511	ENST00000400023	.	.	.	0.578	-1.16	0.09678	.	.	.	.	.	T	0.13072	0.0317	.	.	.	0.09310	N	1	B	0.33135	0.399	B	0.25140	0.058	T	0.13953	-1.0490	5	.	.	.	.	.	.	.	.	167	Q6ZV56-2	.	E	167	.	.	A	-	2	0	C22orf34	48400182	0.003000	0.15002	0.003000	0.11579	0.004000	0.04260	-1.704000	0.01898	-2.278000	0.00677	-2.492000	0.00194	GCG			0.522	C22orf34-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000075312.2		NR_026997	
DCLK3	85443	mdanderson.org	37	3	36779310	36779310	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr3:36779310G>T	ENST00000416516.2	-	2	1331	c.841C>A	c.(841-843)Cag>Aag	p.Q281K		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	281						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						AAGCCCGCCTGGTGCTCTCTC	0.572																																					p.Q281K													.	.			0			c.C841A												91.0	96.0	95.0					3																	36779310		1926	4121	6047	SO:0001583	missense	85443	exon2			CCGCCTGGTGCTC	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.841C>A	3.37:g.36779310G>T	ENSP00000394484:p.Gln281Lys		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_033403	5	0.00	0		Missense_Mutation	SNP	ENST00000416516.2	37	CCDS43064.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.267774	0.23136	.	.	ENSG00000163673	ENST00000416516	T	0.66280	-0.2	5.48	5.48	0.80851	.	0.285397	0.19062	N	0.123741	T	0.47154	0.1430	N	0.24115	0.695	0.09310	N	1	B	0.16396	0.017	B	0.09377	0.004	T	0.19095	-1.0316	10	0.02654	T	1	.	19.3606	0.94436	0.0:0.0:1.0:0.0	.	281	Q9C098	DCLK3_HUMAN	K	281	ENSP00000394484:Q281K	ENSP00000394484:Q281K	Q	-	1	0	DCLK3	36754314	0.053000	0.20554	0.029000	0.17559	0.437000	0.31866	2.501000	0.45389	2.746000	0.94184	0.655000	0.94253	CAG			0.572	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341727.1		XM_047355	
GPR87	53836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	151012124	151012124	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr3:151012124C>G	ENST00000260843.4	-	3	1374	c.910G>C	c.(910-912)Gcg>Ccg	p.A304P	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	304					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACATTACACGCAGACAAGAAA	0.338																																					p.A304P													GPR87,colon,carcinoma,+1,1	GPR87	1	1	0			c.G910C												111.0	114.0	113.0					3																	151012124		2203	4300	6503	SO:0001583	missense	53836	exon3			TACACGCAGACAA	AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.910G>C	3.37:g.151012124C>G	ENSP00000260843:p.Ala304Pro		Somatic	246	0.0081300813	2		WXS	Illumina HiSeq	.	133	0.30	40	NM_023915	0		0	Q5KU35|Q96JZ8|Q9BXC2	Missense_Mutation	SNP	ENST00000260843.4	37	CCDS3157.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095795	0.76870	.	.	ENSG00000138271	ENST00000260843	T	0.32023	1.47	5.45	5.45	0.79879	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63873	0.2548	M	0.88241	2.94	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.67971	-0.5532	10	0.51188	T	0.08	-11.3655	19.2508	0.93925	0.0:1.0:0.0:0.0	.	304	Q9BY21	GPR87_HUMAN	P	304	ENSP00000260843:A304P	ENSP00000260843:A304P	A	-	1	0	GPR87	152494814	0.963000	0.33076	0.984000	0.44739	0.956000	0.61745	2.285000	0.43487	2.719000	0.93026	0.655000	0.94253	GCG			0.338	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357788.1			
WFS1	7466	mdanderson.org	37	4	6293696	6293696	+	Silent	SNP	C	C	T	rs1801213	byFrequency	TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr4:6293696C>T	ENST00000226760.1	+	6	854	c.684C>T	c.(682-684)cgC>cgT	p.R228R	WFS1_ENST00000503569.1_Silent_p.R228R	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	228					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		AGCAGAGGCGCATGCTGGAGC	0.642																																					p.R228R													WFS1,NS,carcinoma,0,1	WFS1	0	1	0			c.C684T												47.0	40.0	42.0					4																	6293696		2196	4299	6495	SO:0001819	synonymous_variant	7466	exon6			GAGGCGCATGCTG	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.684C>T	4.37:g.6293696C>T			Somatic	199	0	0		WXS	Illumina HiSeq	Phase_I	120	0.03	3	NM_006005	13	0.00	0	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Silent	SNP	ENST00000226760.1	37	CCDS3386.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232779	0.58777	.	.	ENSG00000109501	ENST00000506362	.	.	.	4.37	1.53	0.23141	.	.	.	.	.	T	0.54303	0.1850	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41928	-0.9481	4	.	.	.	-44.9845	6.9398	0.24486	0.2177:0.2494:0.5329:0.0	.	.	.	.	V	94	.	.	A	+	2	0	WFS1	6344597	0.811000	0.29063	0.994000	0.49952	0.974000	0.67602	-0.097000	0.11042	0.069000	0.16605	-0.216000	0.12614	GCA			0.642	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206863.1			
KLB	152831	mdanderson.org	37	4	39448478	39448478	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr4:39448478C>T	ENST00000257408.4	+	4	2229	c.2132C>T	c.(2131-2133)gCg>gTg	p.A711V		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	711	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						ACCTACGGGGCGGCGCACAAC	0.662																																					p.A711V													.	.			0			c.C2132T												48.0	52.0	51.0					4																	39448478		2203	4300	6503	SO:0001583	missense	152831	exon4			ACGGGGCGGCGCA	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2132C>T	4.37:g.39448478C>T	ENSP00000257408:p.Ala711Val		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_175737	2	0.00	0	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.909084	0.52439	.	.	ENSG00000134962	ENST00000257408	T	0.31769	1.48	5.75	5.75	0.90469	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.41811	0.1175	L	0.33710	1.025	0.45427	D	0.998407	D;D	0.76494	0.999;0.999	D;D	0.66602	0.945;0.945	T	0.05451	-1.0884	10	0.07325	T	0.83	-17.652	19.9358	0.97142	0.0:1.0:0.0:0.0	.	702;711	B7ZL50;Q86Z14	.;KLOTB_HUMAN	V	711	ENSP00000257408:A711V	ENSP00000257408:A711V	A	+	2	0	KLB	39124873	1.000000	0.71417	0.899000	0.35326	0.474000	0.32979	4.509000	0.60448	2.722000	0.93159	0.491000	0.48974	GCG			0.662	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250429.1		NM_175737	
LRRC66	339977	broad.mit.edu	37	4	52861480	52861480	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr4:52861480G>A	ENST00000343457.3	-	4	1714	c.1708C>T	c.(1708-1710)Cgt>Tgt	p.R570C		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	570						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GAATCATAACGGCTTGAGCCA	0.498																																					p.R570C													.	LRRC66	128		0			c.C1708T												103.0	114.0	110.0					4																	52861480		2164	4289	6453	SO:0001583	missense	339977	exon4			CATAACGGCTTGA	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1708C>T	4.37:g.52861480G>A	ENSP00000341944:p.Arg570Cys		Somatic	136	0.0073529412	1		WXS	Illumina HiSeq	Phase_I	263	0.02	4	NM_001024611	2	0.00	0		Missense_Mutation	SNP	ENST00000343457.3	37	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	G	6.361	0.434716	0.12045	.	.	ENSG00000188993	ENST00000343457	D	0.82081	-1.57	3.96	-1.21	0.09524	.	2.119790	0.02037	N	0.048960	T	0.70098	0.3185	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52366	-0.8585	10	0.46703	T	0.11	6.1939	2.9222	0.05772	0.1569:0.1164:0.4888:0.2378	.	570	Q68CR7	LRC66_HUMAN	C	570	ENSP00000341944:R570C	ENSP00000341944:R570C	R	-	1	0	LRRC66	52556237	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.129000	0.03244	-0.789000	0.04498	-2.403000	0.00223	CGT			0.498	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361473.1		NM_001024611	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599340	55599340	+	Missense_Mutation	SNP	T	T	G	rs121913514		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr4:55599340T>G	ENST00000288135.5	+	17	2563	c.2466T>G	c.(2464-2466)aaT>aaG	p.N822K		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	822	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> K (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N822K(34)|p.N822N(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATGATTCTAATTATGTGGTTA	0.383	N822K(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.N822K			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,+2,48	KIT	2	48	35	Substitution - Missense(34)|Substitution - coding silent(1)	soft_tissue(17)|haematopoietic_and_lymphoid_tissue(11)|skin(4)|testis(2)|genital_tract(1)	c.T2466G												149.0	151.0	151.0					4																	55599340		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TTCTAATTATGTG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2466T>G	4.37:g.55599340T>G	ENSP00000288135:p.Asn822Lys		Somatic	95	0	0		WXS	Illumina HiSeq	.	131	0.78	102	NM_000222	62	0.84	52	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.597891	0.66332	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82344	-1.6;-1.6	5.47	3.01	0.34805	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000009	D	0.84284	0.5438	L	0.33293	1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	D	0.83792	0.0231	10	0.87932	D	0	.	8.7243	0.34460	0.0:0.2153:0.0:0.7847	.	818;822	P10721-2;P10721	.;KIT_HUMAN	K	822;818	ENSP00000288135:N822K;ENSP00000390987:N818K	ENSP00000288135:N822K	N	+	3	2	KIT	55294097	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.920000	0.40025	0.883000	0.36040	0.477000	0.44152	AAT			0.383	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
CAMK2D	817	mdanderson.org	37	4	114458562	114458562	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr4:114458562G>A	ENST00000342666.5	-	7	451	c.452C>T	c.(451-453)gCa>gTa	p.A151V	CAMK2D_ENST00000418639.2_Missense_Mutation_p.A151V|CAMK2D_ENST00000508738.1_Missense_Mutation_p.A151V|CAMK2D_ENST00000394524.3_Missense_Mutation_p.A151V|CAMK2D_ENST00000429180.1_Missense_Mutation_p.A151V|CAMK2D_ENST00000296402.5_Missense_Mutation_p.A151V|CAMK2D_ENST00000514328.1_Missense_Mutation_p.A151V|CAMK2D_ENST00000394522.3_Missense_Mutation_p.A151V|CAMK2D_ENST00000515496.1_Missense_Mutation_p.A151V|CAMK2D_ENST00000454265.2_Missense_Mutation_p.A151V|CAMK2D_ENST00000379773.2_Missense_Mutation_p.A151V|CAMK2D_ENST00000394526.2_Missense_Mutation_p.A151V|CAMK2D_ENST00000511664.1_Missense_Mutation_p.A151V|CAMK2D_ENST00000505990.1_Missense_Mutation_p.A151V			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		TTTCACAGCTGCTCCCTTGGA	0.428																																					p.A151V													.	.			0			c.C452T												89.0	86.0	87.0					4																	114458562		2203	4300	6503	SO:0001583	missense	817	exon7			ACAGCTGCTCCCT	U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.452C>T	4.37:g.114458562G>A	ENSP00000339740:p.Ala151Val		Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_172115	0		0	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Missense_Mutation	SNP	ENST00000342666.5	37	CCDS3703.1	.	.	.	.	.	.	.	.	.	.	G	35	5.520067	0.96416	.	.	ENSG00000145349	ENST00000394524;ENST00000454265;ENST00000429180;ENST00000418639;ENST00000394526;ENST00000296402;ENST00000511664;ENST00000342666;ENST00000515496;ENST00000514328;ENST00000394522;ENST00000505990;ENST00000379773;ENST00000508738	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.68765	-0.35;-0.28;-0.3;-0.27;-0.27;-0.35;-0.33;-0.34;-0.27;-0.34;-0.34;-0.33;-0.35;-0.35	5.9	5.9	0.94986	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78027	0.4219	L	0.41710	1.295	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.998	T	0.78542	-0.2164	10	0.87932	D	0	.	20.2626	0.98452	0.0:0.0:1.0:0.0	.	151;151;151;151;151	E9PF82;Q13557-3;Q13557-6;Q13557-12;Q13557	.;.;.;.;KCC2D_HUMAN	V	151	ENSP00000378032:A151V;ENSP00000415248:A151V;ENSP00000415707:A151V;ENSP00000406131:A151V;ENSP00000378034:A151V;ENSP00000296402:A151V;ENSP00000425824:A151V;ENSP00000339740:A151V;ENSP00000423482:A151V;ENSP00000423677:A151V;ENSP00000378030:A151V;ENSP00000424245:A151V;ENSP00000369098:A151V;ENSP00000422566:A151V	ENSP00000296402:A151V	A	-	2	0	CAMK2D	114678011	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.832000	0.99423	2.802000	0.96397	0.650000	0.86243	GCA			0.428	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000256420.2			
PALLD	23022	broad.mit.edu	37	4	169632802	169632802	+	Silent	SNP	T	T	C	rs370282753		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr4:169632802T>C	ENST00000505667.1	+	10	1865	c.1692T>C	c.(1690-1692)ccT>ccC	p.P564P	PALLD_ENST00000512127.1_Silent_p.P182P|PALLD_ENST00000261509.6_Silent_p.P564P|PALLD_ENST00000335742.7_Silent_p.P182P			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	564	Interaction with VASP. {ECO:0000250}.|Poly-Pro.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		ACTTTCCACCTCCCCCTCCAA	0.478									Pancreatic Cancer, Familial Clustering of																												p.P564P	Esophageal Squamous(109;1482 1532 18347 40239 51172)												.	PALLD	179		0			c.T1692C							T	,,	0,4406		0,0,2203	90.0	81.0	84.0		1692,546,1692	0.7	1.0	4		84	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	PALLD	NM_001166108.1,NM_001166109.1,NM_016081.3	,,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,,	564/1124,182/778,564/1107	169632802	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23022	exon10	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	TCCACCTCCCCCT	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1692T>C	4.37:g.169632802T>C			Somatic	323	0.0030959752	1		WXS	Illumina HiSeq	Phase_I	214	0.03	6	NM_001166108	2	0.00	0	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	37	CCDS54818.1																																																																																					0.478	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000363762.1		NM_016081	
MIER3	166968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	56219619	56219619	+	Missense_Mutation	SNP	C	C	G	rs375553373		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr5:56219619C>G	ENST00000381199.3	-	12	1104	c.1094G>C	c.(1093-1095)gGt>gCt	p.G365A	MIER3_ENST00000381226.3_Missense_Mutation_p.G370A|MIER3_ENST00000409421.1_Missense_Mutation_p.G302A|MIER3_ENST00000381213.3_Missense_Mutation_p.G364A|SETD9_ENST00000541720.1_Intron			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		TACCGTCCCACCCAAAGCTTC	0.403																																					p.G364A													.	.			0			c.G1091C												149.0	146.0	147.0					5																	56219619		2203	4300	6503	SO:0001583	missense	166968	exon12			GTCCCACCCAAAG	BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.1094G>C	5.37:g.56219619C>G	ENSP00000370596:p.Gly365Ala		Somatic	265	0	0		WXS	Illumina HiSeq	.	172	0.31	54	NM_152622	4	0.25	1	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	ENST00000381199.3	37		.	.	.	.	.	.	.	.	.	.	C	17.50	3.404331	0.62288	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.98	5.98	0.97165	.	0.387579	0.31082	N	0.008289	T	0.49677	0.1571	L	0.41710	1.295	0.52501	D	0.999955	B;B;B	0.29162	0.024;0.165;0.235	B;B;B	0.27380	0.005;0.069;0.079	T	0.46555	-0.9183	10	0.66056	D	0.02	-16.2893	20.4496	0.99125	0.0:1.0:0.0:0.0	.	365;370;364	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	A	370;364;365;302	ENSP00000370624:G370A;ENSP00000370611:G364A;ENSP00000370596:G365A;ENSP00000386584:G302A	ENSP00000370596:G365A	G	-	2	0	MIER3	56255376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.326000	0.72905	2.838000	0.97847	0.563000	0.77884	GGT			0.403	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000132523.2		NM_152622	
PRRC1	133619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	126869374	126869374	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr5:126869374G>C	ENST00000296666.8	+	6	1005	c.817G>C	c.(817-819)Gtc>Ctc	p.V273L	PRRC1_ENST00000442138.2_Missense_Mutation_p.V273L|PRRC1_ENST00000512635.2_Missense_Mutation_p.V273L	NM_130809.3	NP_570721.1	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	273						Golgi apparatus (GO:0005794)				endometrium(1)|large_intestine(1)|lung(4)	6		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		AGTTGCTGCTGTCCGAGATGC	0.428																																					p.V273L													.	.			0			c.G817C												117.0	117.0	117.0					5																	126869374		2203	4300	6503	SO:0001583	missense	133619	exon6			GCTGCTGTCCGAG	AJ515429	CCDS4143.1, CCDS68943.1	5q23.2	2008-02-05			ENSG00000164244	ENSG00000164244			28164	protein-coding gene	gene with protein product						15541471	Standard	NM_130809		Approved	FLJ32875	uc003kuk.3	Q96M27	OTTHUMG00000128982	ENST00000296666.8:c.817G>C	5.37:g.126869374G>C	ENSP00000296666:p.Val273Leu		Somatic	143	0	0		WXS	Illumina HiSeq	.	103	0.21	22	NM_130809	16	0.19	3	Q69YM8|Q7L2U7|Q86Y42|Q8IVJ4|Q8IVL4|Q8NEZ7|Q96AJ3	Missense_Mutation	SNP	ENST00000296666.8	37	CCDS4143.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.413756	0.62511	.	.	ENSG00000164244	ENST00000296666;ENST00000442138;ENST00000330542;ENST00000414018;ENST00000512635;ENST00000512535	.	.	.	5.24	3.47	0.39725	.	0.121139	0.56097	D	0.000038	T	0.55561	0.1928	M	0.61703	1.905	0.51233	D	0.99991	P;P	0.41848	0.737;0.763	B;B	0.43225	0.412;0.329	T	0.57266	-0.7841	9	0.72032	D	0.01	-8.7957	8.5772	0.33605	0.2569:0.0:0.7431:0.0	.	273;273	Q96M27;Q96M27-5	PRRC1_HUMAN;.	L	273	.	ENSP00000296666:V273L	V	+	1	0	PRRC1	126897273	0.997000	0.39634	0.994000	0.49952	0.998000	0.95712	2.561000	0.45905	0.787000	0.33731	0.563000	0.77884	GTC			0.428	PRRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250971.3		NM_130809	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176638277	176638277	+	Silent	SNP	A	A	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr5:176638277A>T	ENST00000439151.2	+	5	2922	c.2877A>T	c.(2875-2877)ggA>ggT	p.G959G	NSD1_ENST00000354179.4_Silent_p.G690G|NSD1_ENST00000361032.4_Silent_p.G856G|NSD1_ENST00000347982.4_Silent_p.G690G	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	959					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TGGTTTCAGGAGGCTCCACAC	0.507			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.G959G				Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	.			0			c.A2877T												65.0	64.0	64.0					5																	176638277		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon5	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	TTCAGGAGGCTCC	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2877A>T	5.37:g.176638277A>T			Somatic	226	0	0		WXS	Illumina HiSeq	.	168	0.30	50	NM_022455	1	1.00	1	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																					0.507	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253412.2		NM_172349	
MUC21	394263	mdanderson.org	37	6	30954594	30954594	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr6:30954594G>C	ENST00000376296.3	+	2	883	c.642G>C	c.(640-642)gaG>gaC	p.E214D	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	214	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAACTCTGAGTCCAGAACGA	0.612																																					p.E214D													.	.			0			c.G642C												154.0	152.0	153.0					6																	30954594		2203	4300	6503	SO:0001583	missense	394263	exon2			CTCTGAGTCCAGA	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.642G>C	6.37:g.30954594G>C	ENSP00000365473:p.Glu214Asp		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001010909	18	0.00	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	3.066	-0.192132	0.06299	.	.	ENSG00000204544	ENST00000376296	T	0.01787	4.64	3.54	-7.08	0.01558	.	.	.	.	.	T	0.00384	0.0012	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.43196	-0.9406	8	.	.	.	.	10.9515	0.47332	0.1259:0.5078:0.3663:0.0	.	214	Q5SSG8	MUC21_HUMAN	D	214	ENSP00000365473:E214D	.	E	+	3	2	MUC21	31062573	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.756000	0.04777	-2.750000	0.00375	-0.349000	0.07799	GAG			0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
TNXB	7148	broad.mit.edu	37	6	32012870	32012870	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr6:32012870G>T	ENST00000375244.3	-	32	11041	c.10840C>A	c.(10840-10842)Ctg>Atg	p.L3614M	TNXB_ENST00000451343.1_Missense_Mutation_p.L43M|TNXB_ENST00000375247.2_Missense_Mutation_p.L3612M			P22105	TENX_HUMAN	tenascin XB	3659	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTGGGCTCCAGGCCTGAGATG	0.642																																					p.L3612M													.	TNXB	553		0			c.C10834A												41.0	36.0	38.0					6																	32012870		1509	2706	4215	SO:0001583	missense	7148	exon32			GCTCCAGGCCTGA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10840C>A	6.37:g.32012870G>T	ENSP00000364393:p.Leu3614Met		Somatic	297	0.0033670034	1		WXS	Illumina HiSeq	Phase_I	301	0.02	5	NM_019105	4	0.00	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	g	25.3	4.623766	0.87460	.	.	ENSG00000168477	ENST00000375244;ENST00000451343;ENST00000375247	T;T;T	0.38560	1.13;1.13;1.13	4.85	4.85	0.62838	.	0.000000	0.46145	D	0.000310	T	0.71151	0.3306	H	0.95402	3.665	0.40565	D	0.981242	D	0.89917	1.0	D	0.91635	0.999	T	0.80797	-0.1222	10	0.72032	D	0.01	.	16.9014	0.86114	0.0:0.0:1.0:0.0	.	3612	P22105-3	.	M	3614;43;3612	ENSP00000364393:L3614M;ENSP00000407685:L43M;ENSP00000364396:L3612M	ENSP00000364393:L3614M	L	-	1	2	TNXB	32120848	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.483000	0.53194	2.526000	0.85167	0.651000	0.88453	CTG			0.642	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000268927.2		NM_019105	
RGL2	5863	mdanderson.org	37	6	33263293	33263293	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr6:33263293C>A	ENST00000497454.1	-	7	1507	c.1012G>T	c.(1012-1014)Gtg>Ttg	p.V338L	RGL2_ENST00000437840.2_5'UTR|PFDN6_ENST00000463584.1_Intron|RGL2_ENST00000444031.2_Missense_Mutation_p.V256L	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	338	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.V338L(1)		breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						ACCTCTGCCACGCGGATCCAC	0.617																																					p.V338L													RGL2,NS,carcinoma,0,1	RGL2	0	1	1	Substitution - Missense(1)	lung(1)	c.G1012T												47.0	48.0	48.0					6																	33263293		2203	4300	6503	SO:0001583	missense	5863	exon7			CTGCCACGCGGAT		CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.1012G>T	6.37:g.33263293C>A	ENSP00000420211:p.Val338Leu		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_004761	16	0.00	0	B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	ENST00000497454.1	37	CCDS4774.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297173	0.60086	.	.	ENSG00000237441	ENST00000497454;ENST00000421215;ENST00000444031	T;T	0.38401	1.14;1.14	4.91	4.91	0.64330	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.068019	0.64402	D	0.000016	T	0.45657	0.1353	M	0.64630	1.985	0.58432	D	0.999992	D;D	0.57571	0.97;0.98	D;P	0.62955	0.909;0.902	T	0.45264	-0.9273	10	0.72032	D	0.01	.	13.4774	0.61316	0.0:1.0:0.0:0.0	.	256;338	B4DG72;O15211	.;RGL2_HUMAN	L	338;202;256	ENSP00000420211:V338L;ENSP00000403070:V256L	ENSP00000400083:V202L	V	-	1	0	RGL2	33371271	1.000000	0.71417	0.958000	0.39756	0.700000	0.40528	4.869000	0.63028	2.542000	0.85734	0.643000	0.83706	GTG			0.617	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076098.2			
TOMM6	100188893	mdanderson.org	37	6	41756999	41756999	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr6:41756999C>T	ENST00000398884.3	+	2	194	c.158C>T	c.(157-159)gCt>gTt	p.A53V	RP11-298J23.9_ENST00000594586.1_RNA|TOMM6_ENST00000398881.3_Missense_Mutation_p.A53V	NM_001134493.1	NP_001127965.1	Q96B49	TOM6_HUMAN	translocase of outer mitochondrial membrane 6 homolog (yeast)	53					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)											GGACTCTTTGCTGCGGGAGTT	0.473																																					p.A53V													.	.			0			c.C158T												129.0	106.0	113.0					6																	41756999		692	1591	2283	SO:0001583	missense	100188893	exon2			TCTTTGCTGCGGG	AF216754	CCDS47424.1	6p21.1	2010-08-05			ENSG00000214736	ENSG00000214736			34528	protein-coding gene	gene with protein product	"""over-expressed breast tumor protein"""					18331822	Standard	NM_001134493		Approved	OBTP	uc011dug.1	Q96B49	OTTHUMG00000137505	ENST00000398884.3:c.158C>T	6.37:g.41756999C>T	ENSP00000381859:p.Ala53Val		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	74	0.05	4	NM_001134493	2481	0.00	2	B2DG15|Q9UH52	Missense_Mutation	SNP	ENST00000398884.3	37	CCDS47424.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919178	0.73098	.	.	ENSG00000214736	ENST00000398884;ENST00000398881	.	.	.	6.17	6.17	0.99709	.	0.000000	0.43747	U	0.000528	T	0.77519	0.4142	.	.	.	0.43977	D	0.996663	D	0.76494	0.999	D	0.83275	0.996	T	0.76586	-0.2905	8	0.54805	T	0.06	-9.6377	18.6524	0.91435	0.0:1.0:0.0:0.0	.	53	Q96B49	TOM6_HUMAN	V	53	.	ENSP00000381856:A53V	A	+	2	0	TOMM6	41864977	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.102000	0.64572	2.941000	0.99782	0.655000	0.94253	GCT			0.473	TOMM6-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268822.1			
GRM1	2911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	146720361	146720361	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr6:146720361C>G	ENST00000282753.1	+	7	2421	c.2186C>G	c.(2185-2187)cCc>cGc	p.P729R	GRM1_ENST00000361719.2_Missense_Mutation_p.P729R|GRM1_ENST00000355289.4_Missense_Mutation_p.P729R|GRM1_ENST00000492807.2_Missense_Mutation_p.P729R|GRM1_ENST00000392299.2_Missense_Mutation_p.P729R|GRM1_ENST00000507907.1_Missense_Mutation_p.P729R			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	729					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		ATCATGGAACCCCCTATGCCC	0.517																																					p.P729R													GRM1,leg,malignant_melanoma,-1,1	GRM1	-1	1	0			c.C2186G												118.0	114.0	115.0					6																	146720361		2203	4300	6503	SO:0001583	missense	2911	exon8			TGGAACCCCCTAT	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2186C>G	6.37:g.146720361C>G	ENSP00000282753:p.Pro729Arg		Somatic	221	0	0		WXS	Illumina HiSeq	.	167	0.13	22	NM_000838	0		0	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260178	0.59321	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57;-2.57	5.51	5.51	0.81932	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95456	0.8524	M	0.89785	3.06	0.80722	D	1	D;D;P	0.89917	0.964;1.0;0.802	P;D;P	0.97110	0.477;1.0;0.477	D	0.95841	0.8866	10	0.87932	D	0	.	19.4081	0.94656	0.0:1.0:0.0:0.0	.	729;729;729	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	R	729	ENSP00000354896:P729R;ENSP00000376119:P729R;ENSP00000424095:P729R;ENSP00000282753:P729R;ENSP00000347437:P729R;ENSP00000425599:P729R	ENSP00000282753:P729R	P	+	2	0	GRM1	146762054	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.920000	0.70017	2.604000	0.88044	0.585000	0.79938	CCC			0.517	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042574.1		NM_000838	
CCT6P1	643253	broad.mit.edu	37	7	65226641	65226641	+	RNA	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr7:65226641G>T	ENST00000442266.1	+	0	1167				SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		AGGTTCTTGCGCAGAATTCTG	0.383																																					.													.	.			0			.																																											0	.			TCTTGCGCAGAAT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65226641G>T			Somatic	122	0.0081967213	1		WXS	Illumina HiSeq	Phase_I	122	0.04	5	.	10	0.00	0		RNA	SNP	ENST00000442266.1	37																																																																																						0.383	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345507.1		NR_003110	
GATAD1	57798	mdanderson.org	37	7	92077209	92077209	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr7:92077209G>A	ENST00000287957.3	+	1	443	c.166G>A	c.(166-168)Ggc>Agc	p.G56S		NM_021167.4	NP_066990.3	Q8WUU5	GATD1_HUMAN	GATA zinc finger domain containing 1	56	Gly-rich.					nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(3)	6	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)			tgggggcagcggcggcggcgg	0.786																																					p.G56S													.	.			0			c.G166A												1.0	1.0	1.0					7																	92077209		681	1336	2017	SO:0001583	missense	57798	exon1			GGCAGCGGCGGCG		CCDS5625.1	7q21-q22	2014-09-17			ENSG00000157259	ENSG00000157259		"""GATA zinc finger domain containing"""	29941	protein-coding gene	gene with protein product	"""ocular development associated gene"""	614518				12062807	Standard	NM_021167		Approved	ODAG, RG083M05.2, FLJ22489	uc003ulx.2	Q8WUU5	OTTHUMG00000131201	ENST00000287957.3:c.166G>A	7.37:g.92077209G>A	ENSP00000287957:p.Gly56Ser		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_021167	0		0	B2RE37|D6W5Q5|Q8N5Y5|Q99995|Q9H689	Missense_Mutation	SNP	ENST00000287957.3	37	CCDS5625.1	.	.	.	.	.	.	.	.	.	.	G	4.618	0.114951	0.08831	.	.	ENSG00000157259	ENST00000287957	D	0.94457	-3.43	4.49	3.61	0.41365	.	0.509864	0.14458	N	0.318360	D	0.84000	0.5376	N	0.08118	0	0.45076	D	0.998092	B	0.14438	0.01	B	0.06405	0.002	T	0.74272	-0.3719	10	0.08179	T	0.78	-10.0547	7.2997	0.26413	0.2045:0.0:0.7954:0.0	.	56	Q8WUU5	GATD1_HUMAN	S	56	ENSP00000287957:G56S	ENSP00000287957:G56S	G	+	1	0	GATAD1	91915145	0.951000	0.32395	0.204000	0.23530	0.037000	0.13140	0.283000	0.18846	1.015000	0.39444	-0.268000	0.10319	GGC			0.786	GATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253929.2		NM_021167	
COL1A2	1278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	94042436	94042436	+	Silent	SNP	T	T	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr7:94042436T>C	ENST00000297268.6	+	26	2016	c.1545T>C	c.(1543-1545)ctT>ctC	p.L515L		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	515					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ATGCTGGTCTTGCTGGTGCTC	0.363										HNSCC(75;0.22)																											p.L515L													.	.			0			c.T1545C												314.0	280.0	292.0					7																	94042436		2203	4300	6503	SO:0001819	synonymous_variant	1278	exon26			TGGTCTTGCTGGT	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1545T>C	7.37:g.94042436T>C			Somatic	239	0	0		WXS	Illumina HiSeq	.	238	0.22	53	NM_000089	91	0.04	4	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	37	CCDS34682.1																																																																																					0.363	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309045.2		NM_000089	
ABCF2	10061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150921079	150921079	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr7:150921079C>T	ENST00000287844.2	-	4	598	c.489G>A	c.(487-489)atG>atA	p.M163I	ABCF2_ENST00000222388.2_Missense_Mutation_p.M163I|ABCF2_ENST00000473874.1_5'Flank	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	163	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGTCGACTTCCATCACACAAT	0.582																																					p.M163I													.	.			0			c.G489A												118.0	101.0	106.0					7																	150921079		2203	4300	6503	SO:0001583	missense	10061	exon4			GACTTCCATCACA	AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.489G>A	7.37:g.150921079C>T	ENSP00000287844:p.Met163Ile		Somatic	101	0	0		WXS	Illumina HiSeq	.	94	0.15	14	NM_005692	80	0.31	25	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	ENST00000287844.2	37	CCDS5923.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249623	0.59212	.	.	ENSG00000033050	ENST00000222388;ENST00000287844;ENST00000468073;ENST00000441774	D;D;T;T	0.91124	-2.74;-2.79;3.94;3.94	5.81	5.81	0.92471	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.84701	0.5530	N	0.17564	0.495	0.80722	D	1	B;B	0.16166	0.016;0.016	B;B	0.21360	0.034;0.034	T	0.78324	-0.2248	10	0.29301	T	0.29	-0.0301	19.0707	0.93134	0.0:1.0:0.0:0.0	.	163;163	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	I	163	ENSP00000222388:M163I;ENSP00000287844:M163I;ENSP00000419720:M163I;ENSP00000395785:M163I	ENSP00000222388:M163I	M	-	3	0	ABCF2	150552012	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.549000	0.82163	2.746000	0.94184	0.655000	0.94253	ATG			0.582	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336086.1		NM_005692	
LEPROTL1	23484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	29963269	29963269	+	Missense_Mutation	SNP	G	G	T	rs371805932		TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr8:29963269G>T	ENST00000321250.8	+	4	402	c.287G>T	c.(286-288)tGg>tTg	p.W96L	LEPROTL1_ENST00000523116.1_Intron|LEPROTL1_ENST00000518001.1_Missense_Mutation_p.W35L|LEPROTL1_ENST00000442880.2_Intron|LEPROTL1_ENST00000518192.1_Missense_Mutation_p.W119L	NM_015344.2	NP_056159.2	O95214	LERL1_HUMAN	leptin receptor overlapping transcript-like 1	96						integral component of membrane (GO:0016021)		p.A98fs*27(1)		endometrium(1)|kidney(1)|large_intestine(3)	5				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		TAGATTGAGTGGGGAGCTTGT	0.388																																					p.W96L													.	.			1	Insertion - Frameshift(1)	large_intestine(1)	c.G287T							G	,LEU/TRP	0,4406		0,0,2203	139.0	130.0	133.0		,287	4.8	1.0	8		133	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	LEPROTL1	NM_001128208.1,NM_015344.2	,61	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	,	,96/132	29963269	1,13005	2203	4300	6503	SO:0001583	missense	23484	exon4			TTGAGTGGGGAGC	AF063605	CCDS6075.1, CCDS47834.1	8p12	2014-09-11			ENSG00000104660	ENSG00000104660			6555	protein-coding gene	gene with protein product		607338				11342119	Standard	NM_015344		Approved	my047, Vps55	uc003xhx.2	O95214	OTTHUMG00000163820	ENST00000321250.8:c.287G>T	8.37:g.29963269G>T	ENSP00000314625:p.Trp96Leu		Somatic	89	0	0		WXS	Illumina HiSeq	.	88	0.10	9	NM_015344	140	0.19	27	E9PHP8|Q9BW48	Missense_Mutation	SNP	ENST00000321250.8	37	CCDS6075.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252087	0.39797	0.0	1.16E-4	ENSG00000104660	ENST00000321250;ENST00000518001;ENST00000518192	.	.	.	5.7	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.72661	0.3488	M	0.72894	2.215	0.80722	D	1	P	0.47253	0.892	P	0.55222	0.771	T	0.75991	-0.3122	9	0.87932	D	0	.	12.4423	0.55631	0.081:0.0:0.919:0.0	.	96	O95214	LERL1_HUMAN	L	96;35;119	.	ENSP00000314625:W96L	W	+	2	0	LEPROTL1	30082811	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	9.384000	0.97219	1.411000	0.46957	0.555000	0.69702	TGG			0.388	LEPROTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375771.2			
BAI1	575	mdanderson.org	37	8	143560839	143560839	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr8:143560839C>T	ENST00000517894.1	+	8	2611	c.1717C>T	c.(1717-1719)Cgg>Tgg	p.R573W	BAI1_ENST00000323289.5_Missense_Mutation_p.R573W			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	573	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGGCACCCAGCGGTGTCCCGG	0.706																																					p.R573W													.	.			0			c.C1717T												8.0	12.0	11.0					8																	143560839		1981	4127	6108	SO:0001583	missense	575	exon7			ACCCAGCGGTGTC	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1717C>T	8.37:g.143560839C>T	ENSP00000430945:p.Arg573Trp		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_001702	0		0		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	c	19.97	3.925435	0.73213	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.54071	0.59;0.59	4.98	2.9	0.33743	.	0.066755	0.56097	U	0.000021	T	0.69682	0.3138	M	0.83483	2.645	0.32248	N	0.571854	D	0.89917	1.0	D	0.74674	0.984	T	0.75468	-0.3307	10	0.72032	D	0.01	.	8.4895	0.33091	0.2356:0.6424:0.122:0.0	.	573	E9PBK0	.	W	573	ENSP00000430945:R573W;ENSP00000313046:R573W	ENSP00000313046:R573W	R	+	1	2	BAI1	143557841	1.000000	0.71417	0.995000	0.50966	0.948000	0.59901	2.104000	0.41815	1.053000	0.40415	0.457000	0.33378	CGG			0.706	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000379963.3		NM_001702	
OPLAH	26873	hgsc.bcm.edu	37	8	145111362	145111362	+	Silent	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr8:145111362G>T	ENST00000426825.1	-	14	1990	c.1909C>A	c.(1909-1911)Cgg>Agg	p.R637R	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	637					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCGGTGCCCCGCACTCGCACA	0.667																																					p.R637R													.	.			0			c.C1909A												27.0	33.0	31.0					8																	145111362		2028	4160	6188	SO:0001819	synonymous_variant	26873	exon14			TGCCCCGCACTCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1909C>A	8.37:g.145111362G>T			Somatic	92	0	0		WXS	Illumina HiSeq	.	86	0.05	4	NM_017570	5	0.00	0	A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	ENST00000426825.1	37																																																																																						0.667	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_017570	
GLIS3	169792	hgsc.bcm.edu	37	9	3829449	3829449	+	Silent	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr9:3829449G>T	ENST00000324333.10	-	9	2245	c.2052C>A	c.(2050-2052)ccC>ccA	p.P684P	GLIS3_ENST00000381971.3_Silent_p.P839P|GLIS3_ENST00000461870.1_5'UTR	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	684					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TCTGGGAATCGGGGTAGTGTG	0.537																																					p.P839P													GLIS3_ENST00000381971,NS,carcinoma,0,2	GLIS3_ENST00000381971	0	2	0			c.C2517A												94.0	79.0	84.0					9																	3829449		2203	4300	6503	SO:0001819	synonymous_variant	169792	exon10			GGAATCGGGGTAG	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.2052C>A	9.37:g.3829449G>T			Somatic	131	0	0		WXS	Illumina HiSeq	.	86	0.05	4	NM_001042413	0		0	B1AL19|Q1PHK5	Silent	SNP	ENST00000324333.10	37	CCDS6451.1																																																																																					0.537	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000051559.1		NM_152629	
PIGO	84720	mdanderson.org	37	9	35091711	35091711	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr9:35091711C>T	ENST00000378617.3	-	7	2567	c.2173G>A	c.(2173-2175)Gca>Aca	p.A725T	PIGO_ENST00000298004.5_Intron|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000341666.3_Missense_Mutation_p.A725T	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	725					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GCCTCATCTGCCCCCGACGCC	0.652																																					p.A725T													PIGO,face,carcinoma,+1,1	PIGO	1	1	0			c.G2173A												26.0	29.0	28.0					9																	35091711		2145	4203	6348	SO:0001583	missense	84720	exon7			CATCTGCCCCCGA	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2173G>A	9.37:g.35091711C>T	ENSP00000367880:p.Ala725Thr		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_032634	22	0.00	0	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	ENST00000378617.3	37	CCDS6575.1	.	.	.	.	.	.	.	.	.	.	C	3.979	-0.006718	0.07773	.	.	ENSG00000165282	ENST00000378617;ENST00000341666	T;T	0.55588	0.51;0.51	5.44	3.54	0.40534	.	0.184475	0.47455	D	0.000227	T	0.27419	0.0673	N	0.08118	0	0.80722	D	1	B	0.15473	0.013	B	0.11329	0.006	T	0.09640	-1.0665	10	0.13853	T	0.58	-6.1075	9.7817	0.40651	0.2347:0.6946:0.0:0.0707	.	725	Q8TEQ8	PIGO_HUMAN	T	725	ENSP00000367880:A725T;ENSP00000339382:A725T	ENSP00000339382:A725T	A	-	1	0	PIGO	35081711	0.558000	0.26554	0.888000	0.34837	0.178000	0.23041	0.942000	0.29017	2.837000	0.97791	0.655000	0.94253	GCA			0.652	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052284.1		NM_032634	
COL15A1	1306	mdanderson.org	37	9	101807052	101807052	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr9:101807052G>T	ENST00000375001.3	+	26	3102	c.2679G>T	c.(2677-2679)atG>atT	p.M893I		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	893	Collagen-like 4.|Triple-helical region 5 (COL5).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CAGGACCAATGGTAAGTCAGA	0.443																																					p.M893I													.	.			0			c.G2679T												86.0	83.0	84.0					9																	101807052		2203	4300	6503	SO:0001630	splice_region_variant	1306	exon26			ACCAATGGTAAGT	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2679+1G>T	9.37:g.101807052G>T			Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001855	10	0.00	0	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.880283	0.51801	.	.	ENSG00000204291	ENST00000375001	D	0.92545	-3.06	5.32	5.32	0.75619	C-type lectin fold (1);	0.226096	0.46442	D	0.000294	D	0.85643	0.5744	N	0.05177	-0.1	0.46113	D	0.998878	P	0.38978	0.652	B	0.44224	0.444	D	0.86181	0.1606	10	0.36615	T	0.2	-11.0523	14.5084	0.67767	0.0:0.0:1.0:0.0	.	893	P39059	COFA1_HUMAN	I	893	ENSP00000364140:M893I	ENSP00000364140:M893I	M	+	3	0	COL15A1	100846873	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	5.369000	0.66138	2.487000	0.83934	0.591000	0.81541	ATG			0.443	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053386.3		NM_001855	Missense_Mutation
ASTN2	23245	mdanderson.org	37	9	119976991	119976991	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr9:119976991G>C	ENST00000313400.4	-	3	761	c.661C>G	c.(661-663)Ctg>Gtg	p.L221V	ASTN2_ENST00000361209.2_Missense_Mutation_p.L221V|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.L221V			O75129	ASTN2_HUMAN	astrotactin 2	221					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTGAACACCAGCAGCAGCAGC	0.602																																					p.L221V													ASTN2,right_upper_lobe,carcinoma,+2,2	ASTN2	2	2	0			c.C661G												34.0	35.0	35.0					9																	119976991		2203	4300	6503	SO:0001583	missense	23245	exon3			ACACCAGCAGCAG	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.661C>G	9.37:g.119976991G>C	ENSP00000314038:p.Leu221Val		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_014010	0		0	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	G	19.87	3.907561	0.72868	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.14022	2.62;2.62;2.54	5.41	4.5	0.54988	.	0.000000	0.56097	D	0.000023	T	0.23249	0.0562	L	0.27053	0.805	0.47476	D	0.999432	D;D;P	0.69078	0.971;0.997;0.946	P;D;P	0.72625	0.835;0.978;0.808	T	0.01982	-1.1235	9	.	.	.	-12.1738	14.2439	0.65975	0.0739:0.0:0.9261:0.0	.	221;221;221	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	V	221	ENSP00000314038:L221V;ENSP00000363108:L221V;ENSP00000354504:L221V	.	L	-	1	2	ASTN2	119016812	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.130000	0.57964	1.250000	0.43966	0.655000	0.94253	CTG			0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding				NM_014010	
WWC3	55841	mdanderson.org	37	X	10098006	10098006	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chrX:10098006G>T	ENST00000380861.4	+	18	2834	c.2443G>T	c.(2443-2445)Gcg>Tcg	p.A815S	WWC3_ENST00000454666.1_Missense_Mutation_p.A815S	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	815					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GAGTTGGCAAGCGGACTCGGT	0.542																																					p.A815S													.	.			0			c.G2443T												112.0	87.0	96.0					X																	10098006		2203	4300	6503	SO:0001583	missense	55841	exon18			TGGCAAGCGGACT	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2443G>T	X.37:g.10098006G>T	ENSP00000370242:p.Ala815Ser		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_015691	0		0	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360483	0.61403	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.05199	3.48;3.48	5.78	5.78	0.91487	.	0.457691	0.23933	N	0.043134	T	0.10252	0.0251	L	0.46157	1.445	0.54753	D	0.999989	B	0.24426	0.103	B	0.31290	0.127	T	0.23511	-1.0186	9	.	.	.	-4.4935	19.0442	0.93013	0.0:0.0:1.0:0.0	.	815	Q9ULE0	WWC3_HUMAN	S	815;815;310	ENSP00000370242:A815S;ENSP00000399584:A815S	.	A	+	1	0	WWC3	10058006	1.000000	0.71417	0.874000	0.34290	0.452000	0.32318	8.684000	0.91242	2.447000	0.82792	0.544000	0.68410	GCG			0.542	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055725.1		NM_015691	
CPNE9	151835	mdanderson.org	37	3	9754683	9754683	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHL-01A-11D-A42Y-10	TCGA-2G-AAHL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b32e51f-53fa-4dbd-b41f-a2c7bf173d75	fee4df93-5a3c-4c18-92e3-8306991eaaa2	g.chr3:9754683G>T	ENST00000383832.3	+	10	760	c.570G>T	c.(568-570)gaG>gaT	p.E190D	CPNE9_ENST00000383831.3_Missense_Mutation_p.E190D	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	190	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					ACAAGACAGAGGTTGTGAAAA	0.522																																					.													.	.			0			.												42.0	42.0	42.0					3																	9754683		2022	4215	6237	SO:0001583	missense	151835	.			GACAGAGGTTGTG		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.570G>T	3.37:g.9754683G>T	ENSP00000373343:p.Glu190Asp		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	.	9	0.00	0	A1L430|A6NDX6|A8MSP8	Missense_Mutation	SNP	ENST00000383832.3	37	CCDS2574.2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982026	0.74474	.	.	ENSG00000144550	ENST00000383832;ENST00000383831	T;T	0.70399	-0.48;-0.48	4.92	1.13	0.20643	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.69088	0.3072	M	0.78637	2.42	0.40942	D	0.984471	P	0.40000	0.698	B	0.40940	0.344	T	0.69000	-0.5261	10	0.66056	D	0.02	.	9.1363	0.36877	0.3016:0.0:0.6984:0.0	.	190	Q8IYJ1	CPNE9_HUMAN	D	190	ENSP00000373343:E190D;ENSP00000373342:E190D	ENSP00000373342:E190D	E	+	3	2	CPNE9	9729683	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	0.967000	0.29344	0.160000	0.19432	0.491000	0.48974	GAG			0.522	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250205.4		NM_001033755	
