#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CLCNKB	1188	broad.mit.edu	37	1	16383402	16383402	+	Silent	SNP	C	C	T	rs6698427		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:16383402C>T	ENST00000375679.4	+	20	2166	c.2055C>T	c.(2053-2055)gcC>gcT	p.A685A	FAM131C_ENST00000494078.1_5'Flank|CLCNKB_ENST00000375667.3_Silent_p.A515A	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	685					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		ATCCGCCAGCCCCAAAGTGAG	0.587																																					p.A685A													.	CLCNKB	50		0			c.C2055T												66.0	64.0	65.0					1																	16383402		2203	4300	6503	SO:0001819	synonymous_variant	1188	exon20			GCCAGCCCCAAAG	AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.2055C>T	1.37:g.16383402C>T			Somatic	512	0.001953125	1		WXS	Illumina HiSeq	Phase_I	372	0.01	5	NM_000085	2	0.00	0	B3KUY3|Q5T5Q7|Q5T5Q8	Silent	SNP	ENST00000375679.4	37	CCDS168.1																																																																																					0.587	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026331.1		NM_000085	
ESPNP	284729	broad.mit.edu	37	1	17019432	17019433	+	RNA	INS	-	-	GC	rs138548890|rs60613316		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:17019432_17019433insGC	ENST00000492551.1	-	0	1938					NR_026567.1				espin pseudogene																		GTACACGCCGTGCGCCAGGCCC	0.713																																					.													.	.			0			.																																											0	.			ACGCCGTGCGCCA	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17019435_17019436dupGC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	1	0.00	0		RNA	INS	ENST00000492551.1	37																																																																																						0.713	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000326311.1			
SERINC2	347735	broad.mit.edu	37	1	31897662	31897662	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:31897662A>C	ENST00000373709.3	+	3	484	c.334A>C	c.(334-336)Acc>Ccc	p.T112P	SERINC2_ENST00000373710.1_Missense_Mutation_p.T121P|SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000536384.1_Missense_Mutation_p.T116P|SERINC2_ENST00000536859.1_Missense_Mutation_p.T116P	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	112					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CTTCTTTTTCACCCTGCTCAT	0.657																																					p.T121P													.	SERINC2	44		0			c.A361C												18.0	19.0	19.0					1																	31897662		2203	4299	6502	SO:0001583	missense	347735	exon4			TTTTTCACCCTGC	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.334A>C	1.37:g.31897662A>C	ENSP00000362813:p.Thr112Pro		Somatic	161	0.2236024845	36		WXS	Illumina HiSeq	Phase_I	99	0.20	20	NM_001199038	11	0.09	1	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	ENST00000373709.3	37	CCDS30662.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.027057	0.35797	.	.	ENSG00000168528	ENST00000373710;ENST00000536859;ENST00000373709;ENST00000536384	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	4.3	1.86	0.25419	.	0.398700	0.29355	N	0.012382	T	0.11879	0.0289	L	0.43152	1.355	0.28690	N	0.90465	B;B;B;P	0.35328	0.33;0.33;0.33;0.495	B;B;B;B	0.41412	0.356;0.356;0.356;0.356	T	0.12192	-1.0557	10	0.41790	T	0.15	-30.1886	2.2137	0.03955	0.3941:0.0:0.1942:0.4117	.	116;121;116;112	B4DJK5;E7EUZ9;B7Z567;Q96SA4	.;.;.;SERC2_HUMAN	P	121;116;112;116	ENSP00000362814:T121P;ENSP00000444307:T116P;ENSP00000362813:T112P;ENSP00000439048:T116P	ENSP00000362813:T112P	T	+	1	0	SERINC2	31670249	0.003000	0.15002	0.968000	0.41197	0.339000	0.28857	0.973000	0.29422	0.183000	0.20059	0.533000	0.62120	ACC			0.657	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010680.1		NM_018565	
SFPQ	6421	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	35656135	35656135	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:35656135delG	ENST00000357214.5	-	4	1477	c.1379delC	c.(1378-1380)cctfs	p.P460fs		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	460					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				AAGTTTTTCAGGAAGACCATC	0.328			T	TFE3	papillary renal cell																																p.P460fs				Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	51		0			c.1380delT												87.0	86.0	87.0					1																	35656135		2203	4300	6503	SO:0001589	frameshift_variant	6421	exon4			TTTTCAGGAAGAC	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1379delC	1.37:g.35656135delG	ENSP00000349748:p.Pro460fs		Somatic	395	0	0		WXS	Illumina HiSeq	.	356	0.12	43	NM_005066	456	0.00	0	P30808|Q5SZ71	Frame_Shift_Del	DEL	ENST00000357214.5	37	CCDS388.1																																																																																					0.328	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011984.4		NM_005066	
ARTN	9048	mdanderson.org	37	1	44401810	44401810	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:44401810G>A	ENST00000372359.5	+	4	888	c.106G>A	c.(106-108)Gtc>Atc	p.V36I	ARTN_ENST00000438616.3_Missense_Mutation_p.V53I|ARTN_ENST00000414809.3_Missense_Mutation_p.V44I|ARTN_ENST00000479128.1_Missense_Mutation_p.V44I|ARTN_ENST00000498139.2_Missense_Mutation_p.V44I|ARTN_ENST00000472435.1_Missense_Mutation_p.V44I|ARTN_ENST00000372354.3_Missense_Mutation_p.V36I	NM_057091.2	NP_476432.2	Q5T4W7	ARTN_HUMAN	artemin	36					axon guidance (GO:0007411)|induction of positive chemotaxis (GO:0050930)|lymphocyte migration into lymphoid organs (GO:0097021)|neuroblast proliferation (GO:0007405)|peripheral nervous system development (GO:0007422)|Peyer's patch morphogenesis (GO:0061146)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)					Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				GCTGAGCAGCGTCGCAGAGGC	0.751																																					p.V44I													.	.			0			c.G130A												11.0	13.0	13.0					1																	44401810		2127	4251	6378	SO:0001583	missense	9048	exon3			AGCAGCGTCGCAG	AF109401	CCDS501.1, CCDS502.1	1p33-p32	2014-01-30			ENSG00000117407	ENSG00000117407		"""Endogenous ligands"""	727	protein-coding gene	gene with protein product	"""neublastin"", ""neurotrophic factor"""	603886				9883723	Standard	NM_057090		Approved	NBN, EVN, ENOVIN	uc001ckt.3	Q5T4W7	OTTHUMG00000007705	ENST00000372359.5:c.106G>A	1.37:g.44401810G>A	ENSP00000361434:p.Val36Ile		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	17	0.18	3	NM_001136215	1	0.00	0	D3DPY1|D3DPY3|O95441|O96030|Q6P6A3	Missense_Mutation	SNP	ENST00000372359.5	37	CCDS501.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585667	0.66105	.	.	ENSG00000117407	ENST00000372359;ENST00000414809;ENST00000477048;ENST00000471394;ENST00000498139;ENST00000491846;ENST00000479128;ENST00000472435;ENST00000474592;ENST00000372354;ENST00000438616	D;D;T;T;D;T;T;T;T;D;D	0.85629	-1.95;-1.95;0.33;0.33;-1.95;0.43;0.36;0.36;0.43;-1.95;-2.01	4.01	3.08	0.35506	.	0.128196	0.32868	N	0.005553	T	0.69931	0.3166	L	0.29908	0.895	0.24081	N	0.995943	P;P;P	0.42456	0.78;0.78;0.672	B;B;B	0.28553	0.091;0.091;0.042	T	0.62604	-0.6819	10	0.40728	T	0.16	-13.6255	9.0827	0.36561	0.0:0.0:0.7809:0.2191	.	53;44;36	Q5T4W7-2;Q5T4W7-3;Q5T4W7	.;.;ARTN_HUMAN	I	36;44;36;36;44;44;44;44;44;36;53	ENSP00000361434:V36I;ENSP00000387435:V44I;ENSP00000434784:V36I;ENSP00000435804:V36I;ENSP00000436727:V44I;ENSP00000436149:V44I;ENSP00000434071:V44I;ENSP00000435140:V44I;ENSP00000434856:V44I;ENSP00000361429:V36I;ENSP00000391998:V53I	ENSP00000361429:V36I	V	+	1	0	ARTN	44174397	1.000000	0.71417	0.821000	0.32701	0.943000	0.58893	1.163000	0.31798	1.009000	0.39289	0.491000	0.48974	GTC			0.751	ARTN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000020713.2		NM_057090	
SLC6A17	388662	mdanderson.org	37	1	110740797	110740797	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:110740797C>T	ENST00000331565.4	+	12	2400	c.1915C>T	c.(1915-1917)Cgg>Tgg	p.R639W		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	639					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GTTCGTCCTGCGGCACTTCCA	0.597																																					p.R639W													.	.			0			c.C1915T												119.0	93.0	102.0					1																	110740797		2203	4300	6503	SO:0001583	missense	388662	exon12			GTCCTGCGGCACT		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1915C>T	1.37:g.110740797C>T	ENSP00000330199:p.Arg639Trp		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	60	0.07	4	NM_001010898	3	0.00	0	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087218	0.55968	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.75938	-0.98	4.63	3.69	0.42338	.	0.062112	0.64402	D	0.000003	T	0.57755	0.2075	M	0.68728	2.09	0.52501	D	0.999959	B	0.22604	0.072	B	0.27715	0.082	T	0.62506	-0.6840	10	0.72032	D	0.01	.	7.5234	0.27641	0.1758:0.7391:0.0:0.0851	.	639	Q9H1V8	S6A17_HUMAN	W	639	ENSP00000330199:R639W	ENSP00000330199:R639W	R	+	1	2	SLC6A17	110542320	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.960000	0.40422	0.885000	0.36088	0.455000	0.32223	CGG			0.597	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032550.2		XM_371280	
CSDE1	7812	hgsc.bcm.edu;bcgsc.ca	37	1	115262299	115262299	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:115262299T>C	ENST00000358528.4	-	18	2543	c.2117A>G	c.(2116-2118)cAg>cGg	p.Q706R	NRAS_ENST00000369535.4_5'Flank|CSDE1_ENST00000530886.1_Missense_Mutation_p.Q576R|CSDE1_ENST00000369530.1_Missense_Mutation_p.Q721R|CSDE1_ENST00000483407.1_5'Flank|CSDE1_ENST00000438362.2_Missense_Mutation_p.Q752R|CSDE1_ENST00000261443.5_Missense_Mutation_p.Q675R|CSDE1_ENST00000339438.6_Missense_Mutation_p.Q675R|CSDE1_ENST00000534699.1_Missense_Mutation_p.Q706R	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	706	CSD 9.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATGCCATCCTGAACTTCTTT	0.438																																					p.Q752R													CSDE1,face,carcinoma,-1,1	CSDE1	-1	1	0			c.A2255G												165.0	173.0	170.0					1																	115262299		2203	4300	6503	SO:0001583	missense	7812	exon19			CCATCCTGAACTT		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.2117A>G	1.37:g.115262299T>C	ENSP00000351329:p.Gln706Arg		Somatic	152	0	0		WXS	Illumina HiSeq	.	106	0.06	6	NM_001242891	1130	0.00	0	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.483279	0.44147	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	6.17	6.17	0.99709	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);Nucleic acid-binding, OB-fold (1);	0.050145	0.85682	D	0.000000	T	0.38374	0.1038	L	0.39147	1.195	0.58432	D	0.999999	P;P;P	0.43231	0.801;0.761;0.531	B;B;B	0.42827	0.258;0.399;0.141	T	0.27571	-1.0070	9	0.14656	T	0.56	-7.632	16.8222	0.85835	0.0:0.0:0.0:1.0	.	721;706;752	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	R	675;752;706;675;576;721;706	.	ENSP00000261443:Q675R	Q	-	2	0	CSDE1	115063822	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.844000	0.69430	2.371000	0.80710	0.533000	0.62120	CAG			0.438	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033397.1		NM_007158	
CELF3	11189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	151679178	151679178	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:151679178G>A	ENST00000290583.4	-	9	1748	c.955C>T	c.(955-957)Cag>Tag	p.Q319*	CELF3_ENST00000392706.3_Intron|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000290585.4_Nonsense_Mutation_p.Q269*	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	319					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						TAGGCCTGCTGCAGGGGGTCC	0.682																																					p.Q319X													.	.			0			c.C955T												7.0	9.0	8.0					1																	151679178		1891	3607	5498	SO:0001587	stop_gained	11189	exon9			CCTGCTGCAGGGG	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.955C>T	1.37:g.151679178G>A	ENSP00000290583:p.Gln319*		Somatic	126	0	0		WXS	Illumina HiSeq	.	94	0.13	12	NM_007185	0		0	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Nonsense_Mutation	SNP	ENST00000290583.4	37	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	44	11.128638	0.99520	.	.	ENSG00000159409	ENST00000290585;ENST00000290583	.	.	.	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-13.4739	15.9059	0.79430	0.0:0.0:1.0:0.0	.	.	.	.	X	269;319	.	ENSP00000290583:Q319X	Q	-	1	0	CELF3	149945802	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.193000	0.72075	2.325000	0.78763	0.561000	0.74099	CAG			0.682	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000036663.2		NM_007185	
VANGL2	57216	mdanderson.org	37	1	160388802	160388802	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:160388802G>T	ENST00000368061.2	+	4	677	c.203G>T	c.(202-204)tGg>tTg	p.W68L		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	68					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)		p.E70fs*17(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GATGACAACTGGGGGGAAACG	0.557																																					p.W68L													.	.			1	Insertion - Frameshift(1)	large_intestine(1)	c.G203T												82.0	82.0	82.0					1																	160388802		2203	4300	6503	SO:0001583	missense	57216	exon4			ACAACTGGGGGGA	AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.203G>T	1.37:g.160388802G>T	ENSP00000357040:p.Trp68Leu		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	86	0.05	4	NM_020335	2	0.00	0	D3DVE9|Q5T212	Missense_Mutation	SNP	ENST00000368061.2	37	CCDS30915.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371505	0.82573	.	.	ENSG00000162738	ENST00000368061	D	0.88509	-2.39	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.94775	0.8313	M	0.90252	3.1	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.95789	0.8823	10	0.87932	D	0	-12.4429	16.2429	0.82424	0.0:0.0:1.0:0.0	.	68	Q9ULK5	VANG2_HUMAN	L	68	ENSP00000357040:W68L	ENSP00000357040:W68L	W	+	2	0	VANGL2	158655426	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.341000	0.97041	2.232000	0.73038	0.563000	0.77884	TGG			0.557	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080677.1		NM_020335	
ADCK3	56997	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	227171330	227171332	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:227171330_227171332delAGA	ENST00000366779.1	+	14	3929_3931	c.1158_1160delAGA	c.(1156-1161)ccagaa>cca	p.E387del	ADCK3_ENST00000433743.2_In_Frame_Del_p.E61del|ADCK3_ENST00000458507.2_In_Frame_Del_p.E108del|ADCK3_ENST00000366777.3_In_Frame_Del_p.E387del|ADCK3_ENST00000366778.1_In_Frame_Del_p.E335del|ADCK3_ENST00000478406.1_3'UTR			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	387	Protein kinase.				cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						ACATGCTTCCAGAAGGTCTGAGG	0.596																																					p.386_387del													.	ADCK3	77		0			c.1157_1159del																																									SO:0001651	inframe_deletion	56997	exon9			GCTTCCAGAAGGT	AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1158_1160delAGA	1.37:g.227171330_227171332delAGA	ENSP00000355741:p.Glu387del		Somatic	183	0	0		WXS	Illumina HiSeq	.	141	0.13	18	NM_020247	52	0.00	0	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	In_Frame_Del	DEL	ENST00000366779.1	37	CCDS1557.1																																																																																					0.596	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091712.1		NM_020247	
FMN2	56776	mdanderson.org	37	1	240256436	240256436	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr1:240256436G>T	ENST00000319653.9	+	1	1257	c.1027G>T	c.(1027-1029)Ggg>Tgg	p.G343W		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	343					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCGAGGGGCTGGGGACACGGA	0.726																																					p.G343W													.	.			0			c.G1027T												5.0	7.0	6.0					1																	240256436		1632	3487	5119	SO:0001583	missense	56776	exon1			GGGGCTGGGGACA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1027G>T	1.37:g.240256436G>T	ENSP00000318884:p.Gly343Trp		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_020066	7	0.00	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	8.760	0.923363	0.18056	.	.	ENSG00000155816	ENST00000319653	T	0.36340	1.26	3.71	3.71	0.42584	.	0.434742	0.20408	N	0.092919	T	0.41073	0.1143	L	0.40543	1.245	0.51482	D	0.99992	D	0.58620	0.983	P	0.53006	0.715	T	0.40213	-0.9575	10	0.87932	D	0	.	12.6811	0.56922	0.0:0.0:1.0:0.0	.	343	Q9NZ56	FMN2_HUMAN	W	343	ENSP00000318884:G343W	ENSP00000318884:G343W	G	+	1	0	FMN2	238323059	0.947000	0.32204	0.231000	0.23993	0.784000	0.44337	2.943000	0.49026	2.051000	0.60960	0.407000	0.27541	GGG			0.726	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
RET	5979	ucsc.edu	37	10	43600502	43600502	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr10:43600502G>A	ENST00000355710.3	+	4	960	c.728G>A	c.(727-729)tGc>tAc	p.C243Y	RET_ENST00000340058.5_Missense_Mutation_p.C243Y	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	243	Cadherin. {ECO:0000255|PROSITE- ProRule:PRU00043}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GTGGCCGTGTGCACCGTGCAC	0.731		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.C243Y	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	RET	916		0			c.G728A												36.0	34.0	35.0					10																	43600502		2201	4297	6498	SO:0001583	missense	5979	exon4	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	CCGTGTGCACCGT	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.728G>A	10.37:g.43600502G>A	ENSP00000347942:p.Cys243Tyr		Somatic	50	0	0		WXS	Illumina HiSeq		35	0.11	4	NM_020975	5	0.00	0	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	37	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	g	22.3	4.265183	0.80358	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	D;D	0.82344	-1.6;-1.6	4.79	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.134094	0.64402	D	0.000001	D	0.89389	0.6701	M	0.61703	1.905	0.80722	D	1	D;D	0.63880	0.993;0.963	D;P	0.66351	0.943;0.819	D	0.90578	0.4527	10	0.87932	D	0	.	17.6953	0.88279	0.0:0.0:1.0:0.0	.	243;243	P07949;P07949-2	RET_HUMAN;.	Y	243	ENSP00000347942:C243Y;ENSP00000344798:C243Y	ENSP00000344798:C243Y	C	+	2	0	RET	42920508	1.000000	0.71417	0.349000	0.25694	0.376000	0.30014	8.386000	0.90166	2.493000	0.84123	0.550000	0.68814	TGC			0.731	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047694.2		NM_020975	
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	56077049	56077049	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr10:56077049T>C	ENST00000320301.6	-	8	1252	c.858A>G	c.(856-858)atA>atG	p.I286M	PCDH15_ENST00000373955.1_Missense_Mutation_p.I286M|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.I286M|PCDH15_ENST00000395446.1_Missense_Mutation_p.I286M|PCDH15_ENST00000414778.1_Missense_Mutation_p.I291M|PCDH15_ENST00000395440.1_Missense_Mutation_p.I286M|PCDH15_ENST00000395433.1_Missense_Mutation_p.I264M|PCDH15_ENST00000373965.2_Missense_Mutation_p.I286M|PCDH15_ENST00000437009.1_Missense_Mutation_p.I286M|PCDH15_ENST00000395438.1_Missense_Mutation_p.I286M|PCDH15_ENST00000395445.1_Missense_Mutation_p.I286M|PCDH15_ENST00000395432.2_Missense_Mutation_p.I249M|PCDH15_ENST00000395442.1_Missense_Mutation_p.I286M|PCDH15_ENST00000373957.3_Missense_Mutation_p.I264M|PCDH15_ENST00000395430.1_Missense_Mutation_p.I286M	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	286	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCAACTCAGGTATGGCAGCTT	0.403										HNSCC(58;0.16)																											p.I291M													.	.			0			c.A873G												116.0	102.0	107.0					10																	56077049		2203	4300	6503	SO:0001583	missense	65217	exon9			CTCAGGTATGGCA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.858A>G	10.37:g.56077049T>C	ENSP00000322604:p.Ile286Met		Somatic	118	0	0		WXS	Illumina HiSeq	.	75	0.13	10	NM_001142763	0		0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	T	15.74	2.923652	0.52653	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.61158	0.36;0.46;0.4;0.33;0.42;0.66;0.49;0.13;0.31;0.37;0.32;0.32;0.32;0.36;0.47	4.77	-2.64	0.06114	Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.59266	0.2181	L	0.60845	1.875	0.35613	D	0.80879	D;D;D;D;D;D;D;P;D;D;D;D;P;P;D	0.59357	0.972;0.985;0.985;0.985;0.983;0.985;0.972;0.848;0.985;0.985;0.957;0.957;0.682;0.913;0.985	P;P;P;P;P;P;P;P;P;P;P;P;P;P;P	0.61533	0.866;0.866;0.89;0.89;0.887;0.866;0.866;0.66;0.825;0.825;0.729;0.729;0.564;0.463;0.89	T	0.64512	-0.6390	9	0.87932	D	0	.	0.9715	0.01416	0.4167:0.1188:0.2673:0.1972	.	264;286;286;291;286;249;286;286;286;286;286;291;286;264;286	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	M	286;291;286;286;286;286;286;286;249;286;264;264;286;286;291;286;286	ENSP00000363076:I286M;ENSP00000410304:I291M;ENSP00000378826:I286M;ENSP00000378832:I286M;ENSP00000378833:I286M;ENSP00000378829:I286M;ENSP00000378827:I286M;ENSP00000378820:I249M;ENSP00000354950:I286M;ENSP00000378821:I264M;ENSP00000363068:I264M;ENSP00000322604:I286M;ENSP00000378818:I286M;ENSP00000412628:I286M;ENSP00000363066:I286M	ENSP00000322604:I286M	I	-	3	3	PCDH15	55747055	0.070000	0.21116	0.995000	0.50966	0.997000	0.91878	-0.813000	0.04491	-0.398000	0.07679	0.455000	0.32223	ATA			0.403	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000048121.2		NM_033056	
ZSWIM8	23053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	75558169	75558169	+	Silent	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr10:75558169C>T	ENST00000605216.1	+	20	4336	c.4119C>T	c.(4117-4119)aaC>aaT	p.N1373N	ZSWIM8_ENST00000398706.2_Silent_p.N1378N|ZSWIM8_ENST00000604729.1_Silent_p.N1378N|RP11-574K11.31_ENST00000603027.1_Intron|ZSWIM8_ENST00000604524.1_Silent_p.N1373N|ZSWIM8_ENST00000603114.1_Silent_p.N1340N|ZSWIM8-AS1_ENST00000456638.2_RNA	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1373							zinc ion binding (GO:0008270)										ATGCATTGAACCCTAATGAGA	0.607																																					p.N1378N													KIAA0913_ENST00000412131,NS,carcinoma,+2,3	KIAA0913_ENST00000412131	2	3	0			c.C4134T												45.0	46.0	46.0					10																	75558169		1982	4151	6133	SO:0001819	synonymous_variant	23053	exon20			ATTGAACCCTAAT	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.4119C>T	10.37:g.75558169C>T			Somatic	88	0	0		WXS	Illumina HiSeq	.	64	0.16	10	NM_015037	32	0.19	6	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Silent	SNP	ENST00000605216.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.436|4.436	0.080683|0.080683	0.08533|0.08533	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000433366|ENST00000412198	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|.	.|.	.|.	.|.	T|T	0.75095|0.75095	0.3803|0.3803	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.73467|0.73467	-0.3973|-0.3973	4|4	.|.	.|.	.|.	-8.0132|-8.0132	19.266|19.266	0.93985|0.93985	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	S|I	1089|648	.|.	.|.	P|T	+|+	1|2	0|0	KIAA0913|KIAA0913	75228175|75228175	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.034000|3.034000	0.49751|0.49751	2.572000|2.572000	0.86782|0.86782	0.563000|0.563000	0.77884|0.77884	CCC|ACC			0.607	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000468545.1		NM_001242487	
MUC6	4588	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1027502	1027502	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr11:1027502C>T	ENST00000421673.2	-	17	2047	c.1997G>A	c.(1996-1998)gGt>gAt	p.G666D		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	666					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGTGTTACCCGTGCAGGG	0.697																																					p.G666D													.	MUC6	408		0			c.G1997A												39.0	46.0	44.0					11																	1027502		2121	4205	6326	SO:0001583	missense	4588	exon17			GTGTTACCCGTGC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.1997G>A	11.37:g.1027502C>T	ENSP00000406861:p.Gly666Asp		Somatic	118	0.0084745763	1		WXS	Illumina HiSeq	Phase_I	66	0.20	13	NM_005961	0		0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429545	0.43122	.	.	ENSG00000184956	ENST00000421673	D	0.90385	-2.66	4.02	4.02	0.46733	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.93625	0.7964	L	0.56199	1.76	0.44652	D	0.997631	D	0.89917	1.0	D	0.97110	1.0	D	0.93223	0.6610	9	0.41790	T	0.15	.	16.7076	0.85376	0.0:1.0:0.0:0.0	.	666	Q6W4X9	MUC6_HUMAN	D	666	ENSP00000406861:G666D	ENSP00000406861:G666D	G	-	2	0	MUC6	1017502	0.332000	0.24722	0.838000	0.33150	0.054000	0.15201	1.195000	0.32186	2.253000	0.74438	0.436000	0.28706	GGT			0.697	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
MUC2	4583	mdanderson.org	37	11	1092971	1092971	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr11:1092971C>T	ENST00000441003.2	+	30	4817	c.4790C>T	c.(4789-4791)aCa>aTa	p.T1597I	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaaccccaacacccaccggc	0.632																																					p.T1597I													MUC2_ENST00000441003,NS,carcinoma,0,1	MUC2_ENST00000441003	0	1	0			c.C4790T												47.0	82.0	70.0					11																	1092971		1782	3233	5015	SO:0001583	missense	4583	exon30			CCCCAACACCCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4790C>T	11.37:g.1092971C>T	ENSP00000415183:p.Thr1597Ile		Somatic	50	0.02	1		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.395	-0.338980	0.05243	.	.	ENSG00000198788	ENST00000441003	T	0.14640	2.49	1.75	0.762	0.18454	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.41520	-0.9504	8	0.22109	T	0.4	.	4.3366	0.11089	0.0:0.6142:0.0:0.3858	.	1597	E7EUV1	.	I	1597	ENSP00000415183:T1597I	ENSP00000415183:T1597I	T	+	2	0	MUC2	1082971	0.029000	0.19370	0.001000	0.08648	0.134000	0.20937	1.107000	0.31110	0.104000	0.17725	0.121000	0.15741	ACA			0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
KRTAP5-5	439915	bcgsc.ca	37	11	1651203	1651210	+	Frame_Shift_Del	DEL	TGTGGGGG	TGTGGGGG	-			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	TGTGGGGG	TGTGGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr11:1651203_1651210delTGTGGGGG	ENST00000399676.2	+	1	171_178	c.133_140delTGTGGGGG	c.(133-141)tgtgggggcfs	p.CGG45fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	45						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggaggctgtgggggctgtggctcc	0.702																																					p.45_47del													.	KRTAP5-5	86		0			c.133_140del																																									SO:0001589	frameshift_variant	439915	exon1			GGAGGCTGTGGGG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.133_140delTGTGGGGG	11.37:g.1651203_1651210delTGTGGGGG	ENSP00000382584:p.Cys45fs		Somatic	76	0.0131578947	1		WXS	Illumina HiSeq	Phase_1	38	0.11	4	NM_001001480	0		0	A8MWN2	Frame_Shift_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																					0.702	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127919.1			
CTSD	1509	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1775040	1775040	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr11:1775040G>T	ENST00000236671.2	-	8	1196	c.1064C>A	c.(1063-1065)aCg>aAg	p.T355K	RP11-295K3.1_ENST00000427721.1_Missense_Mutation_p.R226S	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	355					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CACCTTGAGCGTGTAGTCCTC	0.662																																					p.T355K													.	.			0			c.C1064A												76.0	73.0	74.0					11																	1775040		2202	4299	6501	SO:0001583	missense	1509	exon8			TTGAGCGTGTAGT	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.1064C>A	11.37:g.1775040G>T	ENSP00000236671:p.Thr355Lys		Somatic	111	0	0		WXS	Illumina HiSeq	.	77	0.13	10	NM_001909	4897	0.05	237	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	19.40|19.40	3.820900|3.820900	0.71028|0.71028	.|.	.|.	ENSG00000250644|ENSG00000117984	ENST00000427721|ENST00000236671;ENST00000429746	.|T;T	.|0.58060	.|0.36;0.36	3.87|3.87	1.35|1.35	0.21983|0.21983	.|Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	.|0.660679	.|0.15212	.|N	.|0.274408	T|T	0.56920|0.56920	0.2018|0.2018	L|L	0.41356|0.41356	1.27|1.27	0.26776|0.26776	N|N	0.969705|0.969705	.|D	.|0.71674	.|0.998	.|D	.|0.64237	.|0.923	T|T	0.48293|0.48293	-0.9048|-0.9048	5|10	.|0.87932	.|D	.|0	.|.	7.7234|7.7234	0.28746|0.28746	0.8373:0.0:0.1627:0.0|0.8373:0.0:0.1627:0.0	.|.	.|355	.|P07339	.|CATD_HUMAN	S|K	226|355;132	.|ENSP00000236671:T355K;ENSP00000402586:T132K	.|ENSP00000236671:T355K	R|T	-|-	1|2	0|0	RP11-295K3.1|CTSD	1731616|1731616	0.033000|0.033000	0.19621|0.19621	0.005000|0.005000	0.12908|0.12908	0.217000|0.217000	0.24651|0.24651	2.835000|2.835000	0.48175|0.48175	0.172000|0.172000	0.19760|0.19760	0.462000|0.462000	0.41574|0.41574	CGC|ACG			0.662	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000104272.5		NM_001909	
CBX3P1	159770	bcgsc.ca	37	11	27828350	27828350	+	RNA	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr11:27828350G>T	ENST00000530663.1	-	0	147																											GCCAGAGGTCGTGATCCTGAA	0.433																																					.													.	.			0			.																																											159770	.			GAGGTCGTGATCC																													11.37:g.27828350G>T			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_1	72	0.24	17	.	0		0		RNA	SNP	ENST00000530663.1	37																																																																																						0.433	RP11-587D21.4-001	KNOWN	basic	sense_overlapping	sense_overlapping		OTTHUMT00000388184.1			
DAK	26007	mdanderson.org	37	11	61109960	61109960	+	Missense_Mutation	SNP	G	G	T	rs200763152	byFrequency	TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr11:61109960G>T	ENST00000394900.3	+	8	912	c.683G>T	c.(682-684)cGg>cTg	p.R228L		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	228	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						GGTGTGCGCCGGATAAAGGTA	0.592																																					p.R228L													.	.			0			c.G683T												109.0	115.0	113.0					11																	61109960		2203	4299	6502	SO:0001583	missense	26007	exon8			TGCGCCGGATAAA		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.683G>T	11.37:g.61109960G>T	ENSP00000378360:p.Arg228Leu		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_015533	46	0.00	0	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	G	32	5.178240	0.94846	.	.	ENSG00000149476	ENST00000394900;ENST00000529479	T;T	0.33216	1.42;1.42	5.67	5.67	0.87782	Dak kinase (2);	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	H	0.94771	3.58	0.80722	D	1	D;P	0.89917	1.0;0.763	D;P	0.79108	0.992;0.568	T	0.71388	-0.4608	10	0.29301	T	0.29	-20.2602	19.7606	0.96314	0.0:0.0:1.0:0.0	.	228;228	Q2L9C1;Q3LXA3	.;DHAK_HUMAN	L	228;227	ENSP00000378360:R228L;ENSP00000432539:R227L	ENSP00000378360:R228L	R	+	2	0	DAK	60866536	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	7.914000	0.87478	2.673000	0.90976	0.563000	0.77884	CGG			0.592	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394425.4		NM_015533	
THYN1	29087	broad.mit.edu	37	11	134118345	134118345	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr11:134118345T>C	ENST00000341541.3	-	7	1126	c.665A>G	c.(664-666)aAg>aGg	p.K222R	THYN1_ENST00000392595.2_Missense_Mutation_p.K222R|THYN1_ENST00000525677.1_5'Flank|THYN1_ENST00000392594.3_Missense_Mutation_p.K222R|THYN1_ENST00000352327.5_3'UTR	NM_014174.2	NP_054893.1	Q9P016	THYN1_HUMAN	thymocyte nuclear protein 1	222						nucleus (GO:0005634)				endometrium(2)|kidney(1)|lung(3)|pancreas(1)	7	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;1.68e-10)|all cancers(11;1.95e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00148)|Lung(977;0.207)		ACTTGGTTCCTTTTCCTCCAG	0.413																																					p.K222R													.	THYN1	21		0			c.A665G												128.0	134.0	132.0					11																	134118345		2201	4297	6498	SO:0001583	missense	29087	exon7			GGTTCCTTTTCCT	BC006978	CCDS8496.1, CCDS8497.1	11q25	2006-02-09			ENSG00000151500	ENSG00000151500			29560	protein-coding gene	gene with protein product		613739				14601557, 12384300	Standard	NM_014174		Approved	THY28	uc001qhg.3	Q9P016	OTTHUMG00000167176	ENST00000341541.3:c.665A>G	11.37:g.134118345T>C	ENSP00000341657:p.Lys222Arg		Somatic	324	0.0030864198	1		WXS	Illumina HiSeq	Phase_I	208	0.02	4	NM_014174	188	0.00	0	Q567Q2|Q9H3L4|Q9HC20	Missense_Mutation	SNP	ENST00000341541.3	37	CCDS8496.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.472361	0.43942	.	.	ENSG00000151500	ENST00000392595;ENST00000341541;ENST00000392594	.	.	.	5.71	4.55	0.56014	PUA-like domain (1);	0.364727	0.34223	N	0.004143	T	0.62804	0.2458	M	0.77103	2.36	0.80722	D	1	B	0.10296	0.003	B	0.12156	0.007	T	0.59418	-0.7458	9	0.40728	T	0.16	-24.9466	12.436	0.55600	0.0:0.0:0.1405:0.8595	.	222	Q9P016	THYN1_HUMAN	R	222	.	ENSP00000341657:K222R	K	-	2	0	THYN1	133623555	1.000000	0.71417	0.903000	0.35520	0.636000	0.38137	3.819000	0.55686	0.949000	0.37715	0.523000	0.50628	AAG			0.413	THYN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393599.1		NM_014174	
BIN2	51411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	51685422	51685422	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr12:51685422G>A	ENST00000267012.4	-	10	1529	c.1468C>T	c.(1468-1470)Cag>Tag	p.Q490*	BIN2_ENST00000604560.1_Nonsense_Mutation_p.Q463*|BIN2_ENST00000544402.1_Nonsense_Mutation_p.Q464*|BIN2_ENST00000452142.2_Nonsense_Mutation_p.Q458*	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	490					cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						TCAGGGTTCTGATTGTGGATG	0.403																																					p.Q490X													.	.			0			c.C1468T												37.0	38.0	38.0					12																	51685422		2199	4291	6490	SO:0001587	stop_gained	51411	exon10			GGTTCTGATTGTG	AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.1468C>T	12.37:g.51685422G>A	ENSP00000267012:p.Gln490*		Somatic	239	0	0		WXS	Illumina HiSeq	.	199	0.10	20	NM_016293	164	0.03	5	Q86VV0|Q9NWK4|Q9UKN4	Nonsense_Mutation	SNP	ENST00000267012.4	37	CCDS8811.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075812	0.55646	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	.	.	.	4.09	1.1	0.20463	.	4.676830	0.00397	N	0.000042	.	.	.	.	.	.	0.48135	A	0.999595	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	7.0E-4	5.6898	0.17823	0.1124:0.388:0.4996:0.0	.	.	.	.	X	458;490;464	.	ENSP00000267012:Q490X	Q	-	1	0	BIN2	49971689	0.001000	0.12720	0.000000	0.03702	0.016000	0.09150	0.885000	0.28227	0.245000	0.21373	0.455000	0.32223	CAG			0.403	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000469800.1			
RP11-146E13.4	0	broad.mit.edu	37	14	19850732	19850733	+	lincRNA	INS	-	-	A	rs369218058		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr14:19850732_19850733insA	ENST00000548109.1	+	0	72																											AAATTAGACATAAAAGTAAAAA	0.332																																					.													.	.			0			.																																											0	.			TAGACATAAAAGT																													14.37:g.19850736_19850736dupA			Somatic	16	0.1875	3		WXS	Illumina HiSeq	Phase_I	12	0.50	6	.	0		0		RNA	INS	ENST00000548109.1	37																																																																																						0.332	RP11-146E13.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409408.1			
DHRS2	10202	broad.mit.edu	37	14	24108495	24108495	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr14:24108495A>G	ENST00000250383.6	+	3	724	c.248A>G	c.(247-249)gAg>gGg	p.E83G	DHRS2_ENST00000344777.7_Missense_Mutation_p.E83G|DHRS2_ENST00000553896.1_3'UTR	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	83					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		CTGCAGGGGGAGGGGCTGAGT	0.687																																					p.E83G													.	DHRS2	78		0			c.A248G												35.0	39.0	37.0					14																	24108495		2202	4299	6501	SO:0001583	missense	10202	exon3			AGGGGGAGGGGCT		CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.248A>G	14.37:g.24108495A>G	ENSP00000250383:p.Glu83Gly		Somatic	122	0.0081967213	1		WXS	Illumina HiSeq	Phase_I	115	0.04	5	NM_182908	0		0	D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	ENST00000250383.6	37	CCDS9604.1	.	.	.	.	.	.	.	.	.	.	.	14.01	2.407473	0.42715	.	.	ENSG00000100867	ENST00000432832;ENST00000250383;ENST00000344777	T;T;T	0.48836	0.8;0.8;0.8	4.95	4.95	0.65309	NAD(P)-binding domain (1);	0.323573	0.33217	N	0.005157	T	0.54367	0.1854	N	0.26092	0.79	0.53688	D	0.999972	B;D;D;P	0.89917	0.208;0.982;1.0;0.51	B;D;D;B	0.91635	0.262;0.93;0.999;0.098	T	0.56032	-0.8046	10	0.49607	T	0.09	.	12.5873	0.56424	1.0:0.0:0.0:0.0	.	61;83;83;61	Q13268;C9JZP6;D3DS54;Q13268-2	DHRS2_HUMAN;.;.;.	G	83	ENSP00000401213:E83G;ENSP00000250383:E83G;ENSP00000344674:E83G	ENSP00000250383:E83G	E	+	2	0	DHRS2	23178335	1.000000	0.71417	0.993000	0.49108	0.011000	0.07611	6.124000	0.71620	2.081000	0.62600	0.482000	0.46254	GAG			0.687	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000071842.2		NM_182908	
GOLGA6L2	283685	broad.mit.edu	37	15	23685464	23685465	+	In_Frame_Ins	INS	-	-	TCT	rs373462853		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr15:23685464_23685465insTCT	ENST00000567107.1	-	8	2209_2210	c.2157_2158insAGA	c.(2155-2160)agatca>agaAGAtca	p.719_720insR	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	575										breast(1)|endometrium(7)	8						tctgctcctgatctcctgctcc	0.574																																					.													.	.			0			.																																									SO:0001652	inframe_insertion	283685	.			CTCCTGATCTCCT	AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2155_2157dupAGA	15.37:g.23685465_23685467dupTCT	ENSP00000454407:p.Arg719_Arg719dup		Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0	A1L301	In_Frame_Ins	INS	ENST00000567107.1	37																																																																																						0.574	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000431937.1		NM_182561	
TYRO3	7301	hgsc.bcm.edu	37	15	41870083	41870083	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr15:41870083G>T	ENST00000263798.3	+	19	2506		c.e19-1		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCCACCCCAGGTATGATCTC	0.517																																					.													TYRO3_ENST00000263798,colon,carcinoma,0,4	TYRO3_ENST00000263798	0	4	0			c.2283-1G>T												40.0	43.0	42.0					15																	41870083		2198	4286	6484	SO:0001630	splice_region_variant	7301	exon19			ACCCCAGGTATGA	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2283-1G>T	15.37:g.41870083G>T			Somatic	63	0.0158730159	1		WXS	Illumina HiSeq	.	73	0.10	7	NM_006293	14	0.00	0	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801139	0.70567	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39657375	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	9.682000	0.98655	2.824000	0.97209	0.655000	0.94253	.			0.517	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252693.2			Intron
SPATA5L1	79029	mdanderson.org	37	15	45694836	45694836	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr15:45694836G>A	ENST00000305560.6	+	1	308	c.209G>A	c.(208-210)gGc>gAc	p.G70D	SPATA5L1_ENST00000559860.1_Missense_Mutation_p.G70D|GATM_ENST00000458245.5_5'Flank	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	70						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		GGAGCGGACGGCTTTGTGCAG	0.726																																					p.G70D													.	.			0			c.G209A												4.0	6.0	5.0					15																	45694836		2041	4067	6108	SO:0001583	missense	79029	exon1			CGGACGGCTTTGT	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.209G>A	15.37:g.45694836G>A	ENSP00000305494:p.Gly70Asp		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_024063	8	0.00	0	C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	ENST00000305560.6	37	CCDS10123.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899975	0.92035	.	.	ENSG00000171763	ENST00000305560	D	0.94457	-3.43	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.96207	0.8763	M	0.71581	2.175	0.50813	D	0.999893	D	0.59767	0.986	D	0.63703	0.917	D	0.94612	0.7805	10	0.21540	T	0.41	-19.7891	16.7556	0.85498	0.0:0.0:1.0:0.0	.	70	Q9BVQ7	SPA5L_HUMAN	D	70	ENSP00000305494:G70D	ENSP00000305494:G70D	G	+	2	0	SPATA5L1	43482128	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	6.910000	0.75741	2.539000	0.85634	0.557000	0.71058	GGC			0.726	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000254218.1		NM_024063	
SRRM2	23524	ucsc.edu	37	16	2817298	2817298	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr16:2817298G>T	ENST00000301740.8	+	11	7318	c.6769G>T	c.(6769-6771)Gct>Tct	p.A2257S	AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2257	Ala-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGTGAACCTGGCTGACTCTCG	0.632																																					p.A2257S													.	SRRM2	263		0			c.G6769T												67.0	70.0	69.0					16																	2817298		2198	4300	6498	SO:0001583	missense	23524	exon11			AACCTGGCTGACT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6769G>T	16.37:g.2817298G>T	ENSP00000301740:p.Ala2257Ser		Somatic	59	0	0		WXS	Illumina HiSeq		50	0.10	5	NM_016333	352	0.04	13	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	9.588	1.125326	0.20959	.	.	ENSG00000167978	ENST00000301740;ENST00000544933	T	0.80033	-1.33	5.82	4.84	0.62591	.	0.089887	0.48767	D	0.000165	T	0.71151	0.3306	L	0.34521	1.04	0.30120	N	0.805738	P	0.40970	0.734	B	0.37731	0.257	T	0.71069	-0.4699	10	0.44086	T	0.13	-6.9946	12.7961	0.57560	0.0:0.1642:0.8358:0.0	.	2257	Q9UQ35	SRRM2_HUMAN	S	2257;1509	ENSP00000301740:A2257S	ENSP00000301740:A2257S	A	+	1	0	SRRM2	2757299	1.000000	0.71417	0.976000	0.42696	0.402000	0.30811	1.924000	0.40065	1.423000	0.47198	0.655000	0.94253	GCT			0.632	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436411.1			
POLR3E	55718	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	22326410	22326410	+	Splice_Site	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr16:22326410G>A	ENST00000299853.5	+	9	690	c.523G>A	c.(523-525)Gtg>Atg	p.V175M	POLR3E_ENST00000359210.4_Splice_Site_p.V175M|POLR3E_ENST00000564209.1_Splice_Site_p.V175M|POLR3E_ENST00000418581.2_Splice_Site_p.V139M	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	175					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		CCCACCGCAGGTGCGGTTCTC	0.642																																					p.V175M													.	.			0			c.G523A												44.0	40.0	41.0					16																	22326410		2197	4300	6497	SO:0001630	splice_region_variant	55718	exon9			CCGCAGGTGCGGT	AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.523-1G>A	16.37:g.22326410G>A			Somatic	115	0	0		WXS	Illumina HiSeq	.	101	0.07	7	NM_001258033	15	0.53	8	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Missense_Mutation	SNP	ENST00000299853.5	37	CCDS10605.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.895135	0.91962	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	T;T;T	0.55760	0.5;0.5;0.5	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.76905	0.4053	M	0.85859	2.78	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.997;1.0;0.998	T	0.79042	-0.1965	9	.	.	.	-24.2847	19.3388	0.94332	0.0:0.0:1.0:0.0	.	119;139;175;175;175;175	B4DDR0;B4DL24;B4DUP6;Q9NVU0-2;Q9NVU0;Q9NVU0-3	.;.;.;.;RPC5_HUMAN;.	M	175;175;139	ENSP00000299853:V175M;ENSP00000352140:V175M;ENSP00000399254:V139M	.	V	+	1	0	POLR3E	22233911	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	9.476000	0.97823	2.553000	0.86117	0.655000	0.94253	GTG			0.642	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211590.1		NM_018119	Missense_Mutation
PIEZO1	9780	mdanderson.org	37	16	88788681	88788681	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr16:88788681C>A	ENST00000301015.9	-	36	5146	c.4900G>T	c.(4900-4902)Ggt>Tgt	p.G1634C	RP5-1142A6.9_ENST00000564984.1_RNA|PIEZO1_ENST00000327397.7_5'Flank	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1634					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						AGAGAGGCACCAGCCTCACGC	0.687																																					p.G1634C													.	.			0			c.G4900T												30.0	37.0	35.0					16																	88788681		692	1587	2279	SO:0001583	missense	9780	exon36			AGGCACCAGCCTC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.4900G>T	16.37:g.88788681C>A	ENSP00000301015:p.Gly1634Cys		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001142864	20	0.00	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.26|13.26	2.185456|2.185456	0.38609|0.38609	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000301015|ENST00000451779	T|.	0.72835|.	-0.69|.	3.38|3.38	-0.497|-0.497	0.12023|0.12023	.|.	2.029340|.	0.02046|.	N|.	0.049703|.	T|T	0.18002|0.18002	0.0432|0.0432	N|N	0.12182|0.12182	0.205|0.205	0.09310|0.09310	N|N	1|1	D|.	0.55800|.	0.973|.	B|.	0.43754|.	0.43|.	T|T	0.30238|0.30238	-0.9985|-0.9985	10|5	0.56958|.	D|.	0.05|.	-5.9347|-5.9347	6.3061|6.3061	0.21139|0.21139	0.0:0.3702:0.5059:0.124|0.0:0.3702:0.5059:0.124	.|.	1634|.	Q92508|.	PIEZ1_HUMAN|.	C|L	1634|1579	ENSP00000301015:G1634C|.	ENSP00000301015:G1634C|.	G|W	-|-	1|2	0|0	FAM38A|FAM38A	87316182|87316182	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.142000|0.142000	0.16096|0.16096	0.049000|0.049000	0.15920|0.15920	-0.339000|-0.339000	0.08088|0.08088	GGT|TGG			0.687	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000345699.4		NM_014745	
ZNF778	197320	hgsc.bcm.edu	37	16	89294051	89294051	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr16:89294051A>G	ENST00000433976.2	+	6	1603	c.1271A>G	c.(1270-1272)aAg>aGg	p.K424R	ZNF778_ENST00000306502.6_Missense_Mutation_p.K382R|RP11-46C24.6_ENST00000563182.1_RNA	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		TACACGTGTAAGGACTGCGGG	0.502																																					p.K452R													.	.			0			c.A1355G												105.0	110.0	108.0					16																	89294051		2179	4292	6471	SO:0001583	missense	197320	exon7			CGTGTAAGGACTG	AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.1271A>G	16.37:g.89294051A>G	ENSP00000405289:p.Lys424Arg		Somatic	128	0	0		WXS	Illumina HiSeq	.	84	0.05	4	NM_001201407	1	0.00	0	Q08AG0	Missense_Mutation	SNP	ENST00000433976.2	37	CCDS45550.1	.	.	.	.	.	.	.	.	.	.	A	14.74	2.626438	0.46840	.	.	ENSG00000170100	ENST00000433976;ENST00000306502	T;T	0.03831	3.79;3.79	1.13	1.13	0.20643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07324	0.0185	L	0.28192	0.835	0.09310	N	1	D;D	0.56521	0.97;0.976	P;P	0.59643	0.782;0.861	T	0.35276	-0.9795	9	0.48119	T	0.1	.	4.0014	0.09582	0.6176:0.3824:0.0:0.0	.	382;424	Q96MU6-2;Q96MU6	.;ZN778_HUMAN	R	424;382	ENSP00000405289:K424R;ENSP00000305203:K382R	ENSP00000305203:K382R	K	+	2	0	ZNF778	87821552	0.000000	0.05858	0.047000	0.18901	0.353000	0.29299	-3.056000	0.00625	0.769000	0.33313	0.456000	0.33151	AAG			0.502	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430383.1		NM_182531	
ZNF276	92822	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89789049	89789049	+	Missense_Mutation	SNP	C	C	A	rs202152544		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr16:89789049C>A	ENST00000443381.2	+	2	413	c.316C>A	c.(316-318)Cca>Aca	p.P106T	ZNF276_ENST00000568064.1_Missense_Mutation_p.P31T|ZNF276_ENST00000289816.5_Missense_Mutation_p.P31T|VPS9D1_ENST00000389386.3_5'Flank|ZNF276_ENST00000446326.2_5'UTR	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	106	ZAD.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CATGGAGAGGCCATCCGCAGA	0.647																																					p.P106T													.	ZNF276	70		0			c.C316A												66.0	66.0	66.0					16																	89789049		2198	4300	6498	SO:0001583	missense	92822	exon2			GAGAGGCCATCCG	AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.316C>A	16.37:g.89789049C>A	ENSP00000415836:p.Pro106Thr		Somatic	76	0.0131578947	1		WXS	Illumina HiSeq	Phase_I	49	0.20	10	NM_001113525	9	0.00	0	Q0VGA1|Q2TBE8|Q3B7H7	Missense_Mutation	SNP	ENST00000443381.2	37	CCDS45554.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.775281	0.00640	.	.	ENSG00000158805	ENST00000289816;ENST00000443381	T;T	0.05513	3.43;3.49	5.27	-0.156	0.13391	Zinc finger, AD-type (1);	0.599501	0.17840	N	0.160259	T	0.02929	0.0087	N	0.14661	0.345	0.20307	N	0.999918	B;B	0.18461	0.028;0.003	B;B	0.15052	0.012;0.007	T	0.41893	-0.9483	10	0.28530	T	0.3	-0.3767	3.0589	0.06193	0.1237:0.5489:0.1198:0.2076	.	106;31	Q8N554;Q8N554-2	ZN276_HUMAN;.	T	31;106	ENSP00000289816:P31T;ENSP00000415836:P106T	ENSP00000289816:P31T	P	+	1	0	ZNF276	88316550	0.019000	0.18553	0.000000	0.03702	0.002000	0.02628	0.692000	0.25482	-0.241000	0.09681	-0.136000	0.14681	CCA			0.647	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000422517.1		NM_152287	
KIF1C	10749	hgsc.bcm.edu;broad.mit.edu	37	17	4925727	4925727	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr17:4925727G>T	ENST00000320785.5	+	22	2708	c.2351G>T	c.(2350-2352)cGc>cTc	p.R784L	AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	784					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						GAGCTGTGTCGCACCTATGGC	0.672																																					p.R784L	Melanoma(96;1023 1447 10250 19259 33730)												KIF1C,NS,carcinoma,0,1	KIF1C	0	1	0			c.G2351T												25.0	25.0	25.0					17																	4925727		2200	4291	6491	SO:0001583	missense	10749	exon22			TGTGTCGCACCTA	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2351G>T	17.37:g.4925727G>T	ENSP00000320821:p.Arg784Leu		Somatic	87	0	0		WXS	Illumina HiSeq	.	69	0.04	3	NM_006612	462	0.00	0	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	37	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889845	0.72524	.	.	ENSG00000129250	ENST00000320785	T	0.74106	-0.81	4.67	4.67	0.58626	.	.	.	.	.	T	0.63082	0.2481	L	0.39898	1.24	0.42364	D	0.992423	P	0.39737	0.685	B	0.30105	0.111	T	0.68988	-0.5264	9	0.49607	T	0.09	.	15.1017	0.72284	0.0:0.0:1.0:0.0	.	784	O43896	KIF1C_HUMAN	L	784	ENSP00000320821:R784L	ENSP00000320821:R784L	R	+	2	0	KIF1C	4866451	0.002000	0.14202	1.000000	0.80357	0.998000	0.95712	1.079000	0.30766	2.436000	0.82500	0.655000	0.94253	CGC			0.672	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216916.1			
LLGL1	3996	mdanderson.org	37	17	18140236	18140236	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr17:18140236G>A	ENST00000316843.4	+	13	1690	c.1594G>A	c.(1594-1596)Gct>Act	p.A532T		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	532					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					GATGGTGGTGGCTGGCACTGC	0.607																																					p.A532T													.	.			0			c.G1594A												50.0	39.0	42.0					17																	18140236		2203	4300	6503	SO:0001583	missense	3996	exon13			GTGGTGGCTGGCA		CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.1594G>A	17.37:g.18140236G>A	ENSP00000321537:p.Ala532Thr		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_004140	50	0.00	0	A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	ENST00000316843.4	37	CCDS32586.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980557	0.92982	.	.	ENSG00000131899	ENST00000316843	T	0.32272	1.46	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61924	0.2386	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.64179	-0.6468	10	0.52906	T	0.07	-19.0859	19.6222	0.95663	0.0:0.0:1.0:0.0	.	532	Q15334	L2GL1_HUMAN	T	532	ENSP00000321537:A532T	ENSP00000321537:A532T	A	+	1	0	LLGL1	18080961	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	4.404000	0.59735	2.733000	0.93635	0.591000	0.81541	GCT			0.607	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132067.3			
USP32P3	347716	broad.mit.edu	37	17	20319971	20319971	+	RNA	SNP	G	G	A	rs71263795		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr17:20319971G>A	ENST00000583574.2	+	0	300									ubiquitin specific peptidase 32 pseudogene 3																		CTCTCATTACGCTTGATTGCC	0.557																																					.													.	.			0			.																																											0	.			CATTACGCTTGAT			17p11.2	2013-02-15			ENSG00000189423	ENSG00000189423			43576	pseudogene	pseudogene							Standard	NG_002719		Approved				OTTHUMG00000179809		17.37:g.20319971G>A			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	.	0		0		RNA	SNP	ENST00000583574.2	37																																																																																						0.557	USP32P3-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000467714.1		NG_002719	
DNAH17	8632	mdanderson.org	37	17	76457693	76457693	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr17:76457693G>T	ENST00000585328.1	-	58	9381	c.9257C>A	c.(9256-9258)gCc>gAc	p.A3086D	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.A3077D	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3077	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GACCTTCTCGGCCTCGATGCC	0.537																																					p.A3091D													.	.			0			c.C9272A												111.0	75.0	87.0					17																	76457693		2203	4300	6503	SO:0001583	missense	8632	exon58			TTCTCGGCCTCGA	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.9257C>A	17.37:g.76457693G>T	ENSP00000465516:p.Ala3086Asp		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_173628	1	0.00	0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	G	11.47	1.649287	0.29336	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.76578	-1.03	4.35	4.35	0.52113	.	0.255042	0.27311	N	0.019955	T	0.71668	0.3367	L	0.35854	1.095	0.25541	N	0.987176	B	0.13594	0.008	B	0.22601	0.04	T	0.67217	-0.5726	10	0.72032	D	0.01	.	16.4756	0.84131	0.0:0.0:1.0:0.0	.	3086	E7EUM8	.	D	3086;3077	ENSP00000374490:A3077D	ENSP00000300671:A3086D	A	-	2	0	DNAH17	73969288	1.000000	0.71417	0.789000	0.31954	0.313000	0.28021	6.199000	0.72112	1.960000	0.56953	0.563000	0.77884	GCC			0.537	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000318962.2		NM_173628	
WDR7	23335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	54424172	54424172	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr18:54424172G>A	ENST00000254442.3	+	15	2559	c.2348G>A	c.(2347-2349)aGc>aAc	p.S783N	WDR7_ENST00000357574.3_Missense_Mutation_p.S783N|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	783					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TATCGGTCCAGCAAATCAAAG	0.423																																					p.S783N													.	.			0			c.G2348A												97.0	91.0	93.0					18																	54424172		2203	4300	6503	SO:0001583	missense	23335	exon15			GGTCCAGCAAATC	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2348G>A	18.37:g.54424172G>A	ENSP00000254442:p.Ser783Asn		Somatic	167	0	0		WXS	Illumina HiSeq	.	102	0.15	15	NM_052834	0		0	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	G	8.094	0.775215	0.16051	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.66638	-0.2;-0.22	5.78	5.78	0.91487	.	0.066526	0.64402	D	0.000005	T	0.48295	0.1492	N	0.08118	0	0.36787	D	0.884649	B;B	0.19200	0.005;0.034	B;B	0.16289	0.009;0.015	T	0.49283	-0.8956	10	0.13853	T	0.58	.	19.5941	0.95527	0.0:0.0:1.0:0.0	.	783;783	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	N	783;783;108;783	ENSP00000254442:S783N;ENSP00000350187:S783N	ENSP00000254442:S783N	S	+	2	0	WDR7	52575170	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	4.769000	0.62300	2.724000	0.93272	0.655000	0.94253	AGC			0.423	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256062.1			
C19orf24	55009	mdanderson.org	37	19	1277209	1277209	+	Silent	SNP	C	C	T	rs138739305	byFrequency	TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr19:1277209C>T	ENST00000409293.4	+	2	832	c.309C>T	c.(307-309)taC>taT	p.Y103Y	C19orf24_ENST00000469144.1_5'UTR|C19orf24_ENST00000590269.1_3'UTR	NM_017914.3	NP_060384.3	Q9BVV8	CS024_HUMAN	chromosome 19 open reading frame 24	103						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)							Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGGCGATACGGCCTCCTCG	0.622													C|||	4	0.000798722	0.0	0.0	5008	,	,		17126	0.0		0.004	False		,,,				2504	0.0				p.Y103Y													.	.			0			c.C309T												46.0	50.0	48.0					19																	1277209		692	1589	2281	SO:0001819	synonymous_variant	55009	exon2			GCGATACGGCCTC	BC000890	CCDS12060.2	19p13.3	2012-10-24			ENSG00000228300	ENSG00000228300			26073	protein-coding gene	gene with protein product						16847563	Standard	NM_017914		Approved	FLJ20640	uc002lrw.4	Q9BVV8	OTTHUMG00000153928	ENST00000409293.4:c.309C>T	19.37:g.1277209C>T			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_017914	260	0.00	0	Q9NWS2	Silent	SNP	ENST00000409293.4	37	CCDS12060.2																																																																																			0.001		0.622	C19orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333049.2		NM_017914	
MAG	4099	mdanderson.org	37	19	35786622	35786622	+	Silent	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr19:35786622G>T	ENST00000392213.3	+	4	312	c.153G>T	c.(151-153)cgG>cgT	p.R51R	MAG_ENST00000597035.1_Silent_p.R51R|MAG_ENST00000361922.4_Silent_p.R51R|MAG_ENST00000537831.2_Silent_p.R26R	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	51	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ATGAGCTGCGGCCCGCTGTGG	0.627																																					p.R51R													MAG_ENST00000392213,caecum,carcinoma,+1,4	MAG_ENST00000392213	1	4	0			c.G153T												76.0	79.0	78.0					19																	35786622		2203	4300	6503	SO:0001819	synonymous_variant	4099	exon4			GCTGCGGCCCGCT	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.153G>T	19.37:g.35786622G>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_080600	0		0	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	CCDS12455.1																																																																																					0.627	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466071.1		NM_080600	
KMT2B	9757	broad.mit.edu;bcgsc.ca	37	19	36213928	36213928	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr19:36213928delC	ENST00000222270.7	+	6	2754	c.2754delC	c.(2752-2754)gtcfs	p.V918fs	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Frame_Shift_Del_p.V918fs	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	918					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CTGAGAGTGTCCCGTCACGGT	0.642																																					p.V918fs													.	MLL4	229		0			c.2754delC												23.0	29.0	27.0					19																	36213928		2026	4162	6188	SO:0001589	frameshift_variant	0	exon6			GAGTGTCCCGTCA	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.2754delC	19.37:g.36213928delC	ENSP00000222270:p.Val918fs		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	68	0.12	8	NM_014727	11	0.00	0	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Frame_Shift_Del	DEL	ENST00000222270.7	37	CCDS46055.1																																																																																					0.642	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_014727	
DPF1	8193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38709684	38709684	+	Silent	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr19:38709684G>A	ENST00000420980.2	-	4	420	c.394C>T	c.(394-396)Ctg>Ttg	p.L132L	DPF1_ENST00000416611.1_Silent_p.L106L|DPF1_ENST00000456296.1_Silent_p.L106L|DPF1_ENST00000355526.4_Silent_p.L132L|DPF1_ENST00000414789.1_Silent_p.L50L|DPF1_ENST00000412732.1_Silent_p.L50L	NM_004647.2	NP_004638.2	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1	132					apoptotic process (GO:0006915)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TCCTTCTTCAGGGGTGCTTCA	0.612																																					p.L132L													.	.			0			c.C394T												79.0	86.0	84.0					19																	38709684		2203	4300	6503	SO:0001819	synonymous_variant	8193	exon4			TCTTCAGGGGTGC	U43843	CCDS33008.2, CCDS46064.1, CCDS46065.1	19q13.12	2013-01-28			ENSG00000011332	ENSG00000011332		"""Zinc fingers, PHD-type"""	20225	protein-coding gene	gene with protein product		601670				8812431	Standard	XM_005259288		Approved	neuro-d4, NEUD4, BAF45b	uc002ohm.3	Q92782	OTTHUMG00000157164	ENST00000420980.2:c.394C>T	19.37:g.38709684G>A			Somatic	68	0	0		WXS	Illumina HiSeq	.	67	0.12	8	NM_001135155	43	0.19	8	B3KSY8|Q08AJ0	Silent	SNP	ENST00000420980.2	37	CCDS33008.2	.	.	.	.	.	.	.	.	.	.	G	9.546	1.114586	0.20795	.	.	ENSG00000011332	ENST00000355526	.	.	.	4.28	2.14	0.27477	.	.	.	.	.	T	0.48447	0.1500	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20505	-1.0273	5	0.20046	T	0.44	-10.2041	6.711	0.23276	0.1133:0.0:0.7298:0.157	.	.	.	.	L	124	.	ENSP00000347716:P124L	P	-	2	0	DPF1	43401524	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	1.367000	0.34204	0.437000	0.26423	0.467000	0.42956	CCT			0.612	DPF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000347721.1			
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	38976839	38976839	+	Silent	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr19:38976839G>T	ENST00000359596.3	+	34	5544	c.5544G>T	c.(5542-5544)ctG>ctT	p.L1848L	RYR1_ENST00000360985.3_Silent_p.L1848L|RYR1_ENST00000355481.4_Silent_p.L1848L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1848	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGTCCACCCTGCTGGTAATGG	0.582																																					p.L1848L													.	.			0			c.G5544T												165.0	158.0	161.0					19																	38976839		2123	4222	6345	SO:0001819	synonymous_variant	6261	exon34			CACCCTGCTGGTA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5544G>T	19.37:g.38976839G>T			Somatic	153	0	0		WXS	Illumina HiSeq	.	124	0.04	5	NM_001042723	0		0	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																					0.582	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000462137.1			
EGLN2	112398	mdanderson.org	37	19	41306775	41306775	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr19:41306775G>T	ENST00000593726.1	+	1	1326	c.298G>T	c.(298-300)Gtc>Ttc	p.V100F	EGLN2_ENST00000594140.1_5'Flank|RAB4B-EGLN2_ENST00000594136.1_3'UTR|CTC-490E21.12_ENST00000601627.1_5'Flank|EGLN2_ENST00000406058.2_Missense_Mutation_p.V100F|EGLN2_ENST00000303961.4_Missense_Mutation_p.V100F			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	100	Bipartite nuclear localization signal.				cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	TGCAGCGCTGGTCACCAAGGG	0.672																																					p.V100F													.	.			0			c.G298T												14.0	16.0	15.0					19																	41306775		2199	4293	6492	SO:0001583	missense	112398	exon2			GCGCTGGTCACCA	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.298G>T	19.37:g.41306775G>T	ENSP00000469686:p.Val100Phe		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_080732	157	0.00	0	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680699	0.47886	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.26810	1.71;1.71	4.04	3.0	0.34707	.	0.291939	0.25414	N	0.030856	T	0.14743	0.0356	N	0.14661	0.345	0.40621	D	0.981762	P	0.44877	0.845	B	0.39379	0.298	T	0.07947	-1.0746	10	0.59425	D	0.04	-23.6118	11.2985	0.49292	0.098:0.0:0.902:0.0	.	100	Q96KS0	EGLN2_HUMAN	F	100	ENSP00000307080:V100F;ENSP00000385253:V100F	ENSP00000307080:V100F	V	+	1	0	EGLN2	45998615	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	2.251000	0.43187	2.250000	0.74265	0.491000	0.48974	GTC			0.672	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463218.1			
FAM110C	642273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	45630	45630	+	Silent	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr2:45630G>A	ENST00000327669.4	-	1	755	c.756C>T	c.(754-756)agC>agT	p.S252S	FAM110C_ENST00000460464.1_5'Flank	NM_001077710.2	NP_001071178.2	Q1W6H9	F110C_HUMAN	family with sequence similarity 110, member C	252					positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell projection assembly (GO:0060491)	cell cortex (GO:0005938)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|kidney(1)|lung(2)	4	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		AGGTGGCGACGCTCACGCTGC	0.697																																					p.S252S													.	.			0			c.C756T												17.0	23.0	21.0					2																	45630		2125	4232	6357	SO:0001819	synonymous_variant	642273	exon1			GGCGACGCTCACG	DQ431183	CCDS42645.1	2p25.3	2011-12-01			ENSG00000184731	ENSG00000184731			33340	protein-coding gene	gene with protein product		611395				17499476, 19698782	Standard	NM_001077710		Approved		uc010yim.2	Q1W6H9	OTTHUMG00000151321	ENST00000327669.4:c.756C>T	2.37:g.45630G>A			Somatic	101	0	0		WXS	Illumina HiSeq	.	66	0.17	11	NM_001077710	0		0		Silent	SNP	ENST00000327669.4	37	CCDS42645.1																																																																																					0.697	FAM110C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322220.1		NM_001077710	
GDF7	151449	broad.mit.edu	37	2	20870840	20870840	+	Silent	SNP	C	C	G			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr2:20870840C>G	ENST00000272224.3	+	2	1584	c.1008C>G	c.(1006-1008)ggC>ggG	p.G336G		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	336					activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					gcggcgggggcgcgggccggg	0.751																																					p.G336G													.	GDF7	21		0			c.C1008G												4.0	5.0	5.0					2																	20870840		1879	3708	5587	SO:0001819	synonymous_variant	151449	exon2			CGGGGGCGCGGGC	AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.1008C>G	2.37:g.20870840C>G			Somatic	27	0.1111111111	3		WXS	Illumina HiSeq	Phase_I	31	0.26	8	NM_182828	0		0		Silent	SNP	ENST00000272224.3	37	CCDS1701.1																																																																																					0.751	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207563.2		NM_182828	
DRC1	92749	mdanderson.org	37	2	26672887	26672887	+	Silent	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr2:26672887G>A	ENST00000288710.2	+	12	1607	c.1533G>A	c.(1531-1533)ctG>ctA	p.L511L		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	511					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											AGAGCAAGCTGCTGAGCCTTC	0.612																																					p.L511L													.	.			0			c.G1533A												69.0	62.0	64.0					2																	26672887		2203	4300	6503	SO:0001819	synonymous_variant	92749	exon12			CAAGCTGCTGAGC	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.1533G>A	2.37:g.26672887G>A			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_145038	3	0.00	0	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Silent	SNP	ENST00000288710.2	37	CCDS1723.1																																																																																					0.612	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246862.1		NM_145038	
GPAT2	150763	mdanderson.org	37	2	96690240	96690240	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr2:96690240C>T	ENST00000434632.1	-	16	2063	c.1604G>A	c.(1603-1605)gGc>gAc	p.G535D	GPAT2_ENST00000377137.3_Missense_Mutation_p.G535D|GPAT2_ENST00000453542.1_Missense_Mutation_p.G464D|GPAT2_ENST00000359548.4_Missense_Mutation_p.G535D|FAHD2CP_ENST00000607780.1_RNA			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	535					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						GTGTGTGAGGCCTGGGCCAGG	0.672																																					p.G535D													.	.			0			c.G1604A												53.0	59.0	57.0					2																	96690240		2155	4239	6394	SO:0001583	missense	150763	exon15			GTGAGGCCTGGGC	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1604G>A	2.37:g.96690240C>T	ENSP00000389395:p.Gly535Asp		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_207328	12	0.00	0	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	37	CCDS42714.1	.	.	.	.	.	.	.	.	.	.	c	14.39	2.520245	0.44866	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542;ENST00000377137	T;T;T;T	0.76578	-1.02;-1.02;-0.03;-1.03	4.63	3.72	0.42706	.	0.278204	0.34777	N	0.003696	T	0.80003	0.4544	L	0.44542	1.39	0.30050	N	0.811829	D;D;D;D;D	0.89917	1.0;0.972;0.981;0.996;0.996	D;P;P;P;D	0.73708	0.964;0.673;0.765;0.866;0.981	T	0.72014	-0.4418	10	0.21014	T	0.42	-8.852	9.8026	0.40773	0.0:0.7719:0.2281:0.0	.	464;535;541;535;464	E9PE95;Q6NUI2-3;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;.;GPAT2_HUMAN;.	D	535;535;464;535	ENSP00000352547:G535D;ENSP00000389395:G535D;ENSP00000393770:G464D;ENSP00000366341:G535D	ENSP00000352547:G535D	G	-	2	0	GPAT2	96053967	0.379000	0.25123	0.994000	0.49952	0.209000	0.24338	2.509000	0.45459	2.418000	0.82041	0.637000	0.83480	GGC			0.672	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338786.1		NM_207328	
SCN7A	6332	broad.mit.edu	37	2	167328934	167328934	+	Silent	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr2:167328934G>A	ENST00000409855.1	-	5	591	c.465C>T	c.(463-465)taC>taT	p.Y155Y		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	155					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TTTCAAATGTGTAAATTCCAA	0.348																																					p.Y155Y													.	SCN7A	410		0			c.C465T												46.0	45.0	45.0					2																	167328934		1841	4096	5937	SO:0001819	synonymous_variant	6332	exon5			AAATGTGTAAATT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.465C>T	2.37:g.167328934G>A			Somatic	626	0.0047923323	3		WXS	Illumina HiSeq	Phase_I	449	0.02	10	NM_002976	0		0		Silent	SNP	ENST00000409855.1	37	CCDS46442.1																																																																																					0.348	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333745.1			
SMARCAL1	50485	broad.mit.edu	37	2	217297481	217297481	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr2:217297481G>T	ENST00000357276.4	+	8	1705	c.1375G>T	c.(1375-1377)Gac>Tac	p.D459Y	SMARCAL1_ENST00000479008.1_3'UTR|SMARCAL1_ENST00000358207.5_Missense_Mutation_p.D459Y	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	459	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GCTCGCTGACGACATGGGCCT	0.597									Schimke Immuno-Osseous Dysplasia																												p.D459Y													.	SMARCAL1	93		0			c.G1375T												79.0	68.0	72.0					2																	217297481		2203	4300	6503	SO:0001583	missense	50485	exon8	Familial Cancer Database	SIOD	GCTGACGACATGG	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1375G>T	2.37:g.217297481G>T	ENSP00000349823:p.Asp459Tyr		Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	172	0.03	5	NM_014140	69	0.00	0	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	31	5.087139	0.94100	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;D	0.94537	-3.45;-3.45;-3.45	5.5	5.5	0.81552	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98457	0.9486	H	0.97783	4.075	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99308	1.0903	10	0.87932	D	0	-26.9701	18.1332	0.89608	0.0:0.0:1.0:0.0	.	459	Q9NZC9	SMAL1_HUMAN	Y	459;459;323	ENSP00000349823:D459Y;ENSP00000350940:D459Y;ENSP00000375974:D323Y	ENSP00000349823:D459Y	D	+	1	0	SMARCAL1	217005726	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	9.412000	0.97347	2.861000	0.98227	0.655000	0.94253	GAC			0.597	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256671.2			
VIL1	7429	mdanderson.org	37	2	219289058	219289058	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr2:219289058G>A	ENST00000248444.5	+	3	222	c.134G>A	c.(133-135)tGc>tAc	p.C45Y	VIL1_ENST00000440053.1_Missense_Mutation_p.C45Y|VIL1_ENST00000392114.2_Intron	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	45	Core.|Necessary for homodimerization.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GATGGTGACTGCTACATCATC	0.607																																					p.C45Y													.	.			0			c.G134A												88.0	82.0	84.0					2																	219289058		2203	4300	6503	SO:0001583	missense	7429	exon3			GTGACTGCTACAT	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.134G>A	2.37:g.219289058G>A	ENSP00000248444:p.Cys45Tyr		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_007127	0		0	B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	ENST00000248444.5	37	CCDS2417.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600243	0.66332	.	.	ENSG00000127831	ENST00000248444;ENST00000454069;ENST00000440053	T;T;T	0.58940	0.3;0.3;0.3	4.16	4.16	0.48862	Gelsolin domain (1);	0.068296	0.64402	D	0.000013	T	0.81861	0.4912	H	0.95151	3.63	0.53005	D	0.999967	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	D	0.87150	0.2208	10	0.87932	D	0	-23.3795	13.3092	0.60370	0.0:0.1596:0.8404:0.0	.	45;45	Q96AC8;P09327	.;VILI_HUMAN	Y	45	ENSP00000248444:C45Y;ENSP00000412657:C45Y;ENSP00000409270:C45Y	ENSP00000248444:C45Y	C	+	2	0	VIL1	218997302	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.464000	0.80887	2.163000	0.67991	0.313000	0.20887	TGC			0.607	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256778.3		NM_007127	
BPIFA1	51297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31827688	31827688	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr20:31827688C>G	ENST00000354297.4	+	4	471	c.400C>G	c.(400-402)Cct>Gct	p.P134A	BPIFA1_ENST00000375413.4_Missense_Mutation_p.P134A|BPIFA1_ENST00000375422.2_Missense_Mutation_p.P134A	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	134					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										TGTCACCATCCCTCTCGGCAT	0.552																																					p.P134A													.	.			0			c.C400G												145.0	134.0	138.0					20																	31827688		2203	4300	6503	SO:0001583	missense	51297	exon4			ACCATCCCTCTCG	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.400C>G	20.37:g.31827688C>G	ENSP00000346251:p.Pro134Ala		Somatic	125	0	0		WXS	Illumina HiSeq	.	92	0.12	11	NM_016583	0		0	A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	ENST00000354297.4	37	CCDS13217.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.036194	0.75617	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.04119	3.7;3.7;3.7	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000007	T	0.23133	0.0559	M	0.82823	2.61	0.35420	D	0.793143	D	0.89917	1.0	D	0.87578	0.998	T	0.06356	-1.0831	10	0.45353	T	0.12	-23.2166	14.6416	0.68729	0.0:1.0:0.0:0.0	.	134	Q9NP55	BPIA1_HUMAN	A	134;134;134;120	ENSP00000364571:P134A;ENSP00000346251:P134A;ENSP00000364562:P134A	ENSP00000346251:P134A	P	+	1	0	BPIFA1	31291349	0.999000	0.42202	0.995000	0.50966	0.859000	0.49053	3.291000	0.51764	2.837000	0.97791	0.655000	0.94253	CCT			0.552	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078667.2		NM_130852	
TGM2	7052	ucsc.edu;mdanderson.org	37	20	36775125	36775125	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr20:36775125A>G	ENST00000361475.2	-	6	1026	c.853T>C	c.(853-855)Tgc>Cgc	p.C285R	TGM2_ENST00000536724.1_Missense_Mutation_p.C225R|TGM2_ENST00000536701.1_Missense_Mutation_p.C204R	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	285					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	TCACCTGTGCAGGCCACGGCG	0.652																																					p.C285R													.	TGM2	88		0			c.T853C												29.0	26.0	27.0					20																	36775125		2202	4297	6499	SO:0001583	missense	7052	exon6			CTGTGCAGGCCAC	M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.853T>C	20.37:g.36775125A>G	ENSP00000355330:p.Cys285Arg		Somatic	78	0	0		WXS	Illumina HiSeq		45	0.09	4	NM_198951	27	0.00	0	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Missense_Mutation	SNP	ENST00000361475.2	37	CCDS13302.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.250152	0.80024	.	.	ENSG00000198959	ENST00000361475;ENST00000536701;ENST00000536724	D;D;D	0.95918	-3.85;-3.85;-3.85	5.67	5.67	0.87782	Transglutaminase, conserved site (1);Transglutaminase-like (2);	0.000000	0.85682	D	0.000000	D	0.97955	0.9327	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.998;0.999;0.999	D	0.98832	1.0751	10	0.72032	D	0.01	-4.4116	15.1024	0.72292	1.0:0.0:0.0:0.0	.	225;204;285;285;225;285	F5H6P0;B4DIT7;P21980-3;P21980-2;B4DTN7;P21980	.;.;.;.;.;TGM2_HUMAN	R	285;204;225	ENSP00000355330:C285R;ENSP00000444701:C204R;ENSP00000437479:C225R	ENSP00000355330:C285R	C	-	1	0	TGM2	36208539	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.257000	0.78362	2.155000	0.67459	0.460000	0.39030	TGC			0.652	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079151.2		NM_198951	
PTPN1	5770	bcgsc.ca;mdanderson.org	37	20	49177939	49177939	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr20:49177939G>A	ENST00000371621.3	+	2	277	c.103G>A	c.(103-105)Gcc>Acc	p.A35T	Y_RNA_ENST00000364631.1_RNA|PTPN1_ENST00000541713.1_Intron	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	35	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	ATGTAGAGTGGCCAAGCTTCC	0.468																																					p.A35T													.	PTPN1	36		0			c.G103A												130.0	106.0	114.0					20																	49177939		2203	4300	6503	SO:0001583	missense	5770	exon2			AGAGTGGCCAAGC		CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.103G>A	20.37:g.49177939G>A	ENSP00000360683:p.Ala35Thr		Somatic	156	0	0		WXS	Illumina HiSeq	Phase_1	99	0.05	5	NM_002827	30	0.00	0	Q5TGD8|Q9BQV9|Q9NQQ4	Missense_Mutation	SNP	ENST00000371621.3	37	CCDS13430.1	.	.	.	.	.	.	.	.	.	.	G	35	5.548056	0.96488	.	.	ENSG00000196396	ENST00000371621	T	0.03663	3.85	5.02	5.02	0.67125	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.64402	D	0.000014	T	0.25269	0.0614	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.08391	-1.0724	10	0.87932	D	0	.	17.2684	0.87093	0.0:0.0:1.0:0.0	.	35	P18031	PTN1_HUMAN	T	35	ENSP00000360683:A35T	ENSP00000360683:A35T	A	+	1	0	PTPN1	48611346	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.128000	0.94424	2.602000	0.87976	0.650000	0.86243	GCC			0.468	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079694.2			
FAM65C	140876	mdanderson.org	37	20	49226132	49226132	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr20:49226132C>T	ENST00000327979.2	-	7	953	c.542G>A	c.(541-543)cGc>cAc	p.R181H	FAM65C_ENST00000045083.2_Missense_Mutation_p.R181H|FAM65C_ENST00000535356.1_Missense_Mutation_p.R185H			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	181										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GTGCAGGCTGCGGCCCAGCTC	0.756																																					p.R181H													.	.			0			c.G542A												3.0	3.0	3.0					20																	49226132		1677	3389	5066	SO:0001583	missense	140876	exon7			AGGCTGCGGCCCA	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.542G>A	20.37:g.49226132C>T	ENSP00000332663:p.Arg181His		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_080829	1	0.00	0	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	37	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753467	0.89753	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02369	4.32;4.32;4.32	5.2	4.26	0.50523	.	0.134378	0.53938	D	0.000053	T	0.10594	0.0259	M	0.72118	2.19	0.46654	D	0.999142	D;D	0.89917	0.999;1.0	D;D	0.72625	0.939;0.978	T	0.00192	-1.1935	10	0.72032	D	0.01	-30.6442	5.998	0.19505	0.0:0.7447:0.0:0.2553	.	185;181	F5H0X2;Q96MK2	.;FA65C_HUMAN	H	181;181;185	ENSP00000332663:R181H;ENSP00000045083:R181H;ENSP00000439802:R185H	ENSP00000045083:R181H	R	-	2	0	FAM65C	48659539	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	2.032000	0.41127	2.423000	0.82170	0.555000	0.69702	CGC			0.756	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257962.1			
KCNQ2	3785	mdanderson.org	37	20	62038606	62038606	+	Nonsense_Mutation	SNP	G	G	T	rs574774458		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr20:62038606G>T	ENST00000359125.2	-	17	2184	c.2010C>A	c.(2008-2010)taC>taA	p.Y670*	KCNQ2_ENST00000360480.3_Nonsense_Mutation_p.Y642*|KCNQ2_ENST00000344462.4_Nonsense_Mutation_p.Y639*|KCNQ2_ENST00000370224.1_Nonsense_Mutation_p.Y678*|KCNQ2_ENST00000354587.3_Nonsense_Mutation_p.Y678*|KCNQ2_ENST00000357249.2_Nonsense_Mutation_p.Y652*|KCNQ2_ENST00000359689.1_Nonsense_Mutation_p.Y670*	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	670					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CCGGGCTGTGGTACGGCGGCG	0.637																																					p.Y670X													.	.			0			c.C2010A												15.0	19.0	17.0					20																	62038606		2187	4280	6467	SO:0001587	stop_gained	3785	exon17			GCTGTGGTACGGC	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.2010C>A	20.37:g.62038606G>T	ENSP00000352035:p.Tyr670*		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_172107	1	0.00	0	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Nonsense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	G	35	5.582567	0.96578	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224	.	.	.	5.06	4.11	0.48088	.	0.218263	0.40385	N	0.001104	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4843	10.3714	0.44055	0.159:0.0:0.841:0.0	.	.	.	.	X	652;670;640;678;670;639;642;666;678	.	ENSP00000339611:Y666X	Y	-	3	2	KCNQ2	61509050	1.000000	0.71417	0.998000	0.56505	0.083000	0.17756	3.299000	0.51826	1.133000	0.42147	0.491000	0.48974	TAC			0.637	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000080353.1		NM_172109	
BCRP7	100133163	broad.mit.edu	37	22	18846113	18846113	+	3'UTR	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr22:18846113C>T	ENST00000412938.1	+	0	3471																											ATCTCCTCCACGCACTGGCGC	0.612																																					.													.	.			0			.																																									SO:0001624	3_prime_UTR_variant	0	.			CCTCCACGCACTG																												ENST00000412938.1:c.*3468C>T	22.37:g.18846113C>T			Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	93	0.04	4	.	3	0.00	0		RNA	SNP	ENST00000412938.1	37																																																																																						0.612	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000471615.1			
RAB36	9609	mdanderson.org	37	22	23503703	23503703	+	Silent	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr22:23503703G>T	ENST00000263116.2	+	11	994	c.954G>T	c.(952-954)ccG>ccT	p.P318P	RAB36_ENST00000341989.4_Silent_p.P296P	NM_004914.2	NP_004905.2	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	318					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		AAGGGAGTCCGCCCGAGACCC	0.602																																					p.P318P													.	.			0			c.G954T												44.0	42.0	42.0					22																	23503703		2203	4300	6503	SO:0001819	synonymous_variant	9609	exon11			GAGTCCGCCCGAG	AB023061	CCDS13805.1	22q11.22	2008-06-11			ENSG00000100228	ENSG00000100228		"""RAB, member RAS oncogene"""	9775	protein-coding gene	gene with protein product		605662				9920784, 10591208	Standard	NM_004914		Approved		uc002zwv.1	O95755	OTTHUMG00000150601	ENST00000263116.2:c.954G>T	22.37:g.23503703G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_004914	9	0.00	0	Q2M390|Q7Z4A9|Q9UHP5	Silent	SNP	ENST00000263116.2	37	CCDS13805.1																																																																																					0.602	RAB36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319046.1		NM_004914	
GGT1	2678	mdanderson.org	37	22	24981891	24981891	+	Intron	SNP	C	C	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr22:24981891C>A	ENST00000248923.4	+	1	59				FAM211B_ENST00000318753.8_Missense_Mutation_p.G304V|FAM211B_ENST00000495297.1_5'Flank	NM_013430.2	NP_038347.2	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1						arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	GGGTCCCAGCCCAGCAGCTGT	0.657																																					p.G304V													.	.			0			c.G911T												9.0	13.0	12.0					22																	24981891		1957	4123	6080	SO:0001627	intron_variant	388886	exon4			CCCAGCCCAGCAG	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000248923.4:c.-429+2115C>A	22.37:g.24981891C>A			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_207644	21	0.00	0	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000248923.4	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467756	0.43839	.	.	ENSG00000178026	ENST00000318753	T	0.44881	0.91	4.24	-2.53	0.06326	.	0.788750	0.10300	U	0.691277	T	0.30448	0.0765	L	0.44542	1.39	0.09310	N	1	B	0.30281	0.275	B	0.33196	0.159	T	0.31861	-0.9928	10	0.41790	T	0.15	-20.1459	5.0597	0.14551	0.0:0.2437:0.3063:0.45	.	304	Q2VPJ9	LRC6X_HUMAN	V	304	ENSP00000320520:G304V	ENSP00000320520:G304V	G	-	2	0	C22orf36	23311891	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.805000	0.04530	-0.232000	0.09811	0.655000	0.94253	GGG			0.657	GGT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319110.1		NM_013430	
RPL3	6122	mdanderson.org	37	22	39709644	39709644	+	Missense_Mutation	SNP	G	G	T	rs375229574		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr22:39709644G>T	ENST00000216146.4	-	8	1215	c.1042C>A	c.(1042-1044)Cgc>Agc	p.R348S	SNORD83A_ENST00000386747.1_RNA|SNORD83B_ENST00000386745.1_RNA|RPL3_ENST00000465618.1_5'UTR|RPL3_ENST00000401609.1_Missense_Mutation_p.R296S	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3	348					cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	CTCACCTTGCGGAGGGTGAGC	0.572																																					p.R348S													.	.			0			c.C1042A												221.0	222.0	222.0					22																	39709644		2203	4300	6503	SO:0001583	missense	6122	exon8			CCTTGCGGAGGGT	AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.1042C>A	22.37:g.39709644G>T	ENSP00000346001:p.Arg348Ser		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_000967	2419	0.00	1	B2RDV9|Q15548|Q5I0G0	Missense_Mutation	SNP	ENST00000216146.4	37	CCDS13988.1	.	.	.	.	.	.	.	.	.	.	G	34	5.400681	0.96030	.	.	ENSG00000100316	ENST00000401609;ENST00000216146	T;T	0.28895	1.59;1.59	5.45	5.45	0.79879	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	M	0.88181	2.935	0.80722	D	1	D;D;P;P	0.63046	0.992;0.991;0.798;0.905	D;D;P;D	0.69479	0.964;0.955;0.548;0.912	T	0.70898	-0.4747	10	0.87932	D	0	.	19.2895	0.94093	0.0:0.0:1.0:0.0	.	319;296;348;299	Q8TBW1;G5E9G0;P39023;B3KS36	.;.;RL3_HUMAN;.	S	296;348	ENSP00000386101:R296S;ENSP00000346001:R348S	ENSP00000346001:R348S	R	-	1	0	RPL3	38039590	1.000000	0.71417	0.941000	0.38009	0.979000	0.70002	7.897000	0.87356	2.566000	0.86566	0.561000	0.74099	CGC			0.572	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321196.1		NM_000967	
STAC	6769	mdanderson.org	37	3	36587768	36587768	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr3:36587768T>C	ENST00000273183.3	+	11	1496	c.1196T>C	c.(1195-1197)cTa>cCa	p.L399P	STAC_ENST00000457375.2_Missense_Mutation_p.L338P	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	399					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						CTTGATGTACTAGAAAACATC	0.493																																					p.L399P													.	.			0			c.T1196C												151.0	131.0	138.0					3																	36587768		2203	4300	6503	SO:0001583	missense	6769	exon11			ATGTACTAGAAAA	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.1196T>C	3.37:g.36587768T>C	ENSP00000273183:p.Leu399Pro		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_003149	1	0.00	0	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.003038	0.74932	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687	T;T	0.10960	2.82;2.82	5.17	5.17	0.71159	Src homology-3 domain (1);Variant SH3 (1);	0.074155	0.56097	D	0.000036	T	0.33904	0.0879	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.10200	-1.0640	10	0.87932	D	0	.	13.5546	0.61751	0.0:0.0:0.0:1.0	.	338;399	E9PEA7;Q99469	.;STAC_HUMAN	P	399;338;331	ENSP00000273183:L399P;ENSP00000393713:L338P	ENSP00000273183:L399P	L	+	2	0	STAC	36562772	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.936000	0.70153	2.074000	0.62210	0.533000	0.62120	CTA			0.493	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253338.2		NM_003149	
CTDSPL	10217	mdanderson.org	37	3	38010898	38010898	+	Intron	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr3:38010898G>T	ENST00000273179.5	+	5	452				CTDSPL_ENST00000310189.3_Intron|CTDSPL_ENST00000443503.2_Intron|MIR26A1_ENST00000362205.1_RNA	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like							extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		GAAGGCCGTGGCCTCGTTCAA	0.607																																					.													.	.			0			.												41.0	50.0	47.0					3																	38010898		1568	3582	5150	SO:0001627	intron_variant	407015	.			GCCGTGGCCTCGT	D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.426+1525G>T	3.37:g.38010898G>T			Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	.	0		0	Q3ZTU0|Q70KI4|Q7Z5Q2	RNA	SNP	ENST00000273179.5	37	CCDS33734.1																																																																																					0.607	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342392.1		NM_005808	
TWF2	11344	mdanderson.org	37	3	52264021	52264021	+	Silent	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr3:52264021C>T	ENST00000305533.5	-	7	918	c.675G>A	c.(673-675)ctG>ctA	p.L225L	TWF2_ENST00000499914.2_Silent_p.L225L|TLR9_ENST00000494383.1_Missense_Mutation_p.A86T|TLR9_ENST00000597542.1_5'UTR	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	225	ADF-H 2. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CCCGGGAGGGCAGCTGGGCCA	0.632																																					p.L225L													.	.			0			c.G675A												47.0	53.0	51.0					3																	52264021		2203	4300	6503	SO:0001819	synonymous_variant	11344	exon7			GGAGGGCAGCTGG	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.675G>A	3.37:g.52264021C>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_007284	343	0.00	0	Q9Y3F5	Silent	SNP	ENST00000305533.5	37	CCDS2849.1	.	.	.	.	.	.	.	.	.	.	C	8.156	0.788352	0.16258	.	.	ENSG00000173366	ENST00000494383	.	.	.	5.17	2.3	0.28687	.	.	.	.	.	T	0.54062	0.1835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45145	-0.9281	4	.	.	.	.	6.0492	0.19777	0.0:0.6437:0.1352:0.2211	.	.	.	.	T	86	.	.	A	-	1	0	RP11-330H6.5	52239061	0.977000	0.34250	0.999000	0.59377	0.714000	0.41099	0.239000	0.18023	0.589000	0.29677	-0.258000	0.10820	GCC			0.632	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350199.2			
FLNB	2317	ucsc.edu	37	3	58145363	58145363	+	Missense_Mutation	SNP	A	A	C	rs202222289		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr3:58145363A>C	ENST00000295956.4	+	42	7136	c.6971A>C	c.(6970-6972)cAc>cCc	p.H2324P	FLNB-AS1_ENST00000488720.1_RNA|FLNB_ENST00000357272.4_3'UTR|FLNB_ENST00000348383.5_Missense_Mutation_p.H2283P|FLNB_ENST00000490882.1_Missense_Mutation_p.H2355P|FLNB_ENST00000429972.2_Missense_Mutation_p.H2313P|FLNB_ENST00000493452.1_Missense_Mutation_p.H2131P|FLNB_ENST00000419752.2_Missense_Mutation_p.H2144P|FLNB_ENST00000358537.3_Missense_Mutation_p.H2300P	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	2324	Interaction with INPPL1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.H2324P(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GCAAAGGTGCACAGCCCCTCT	0.537																																					p.H2355P													FLNB,NS,carcinoma,0,1	FLNB	430	1	1	Substitution - Missense(1)	large_intestine(1)	c.A7064C												36.0	37.0	37.0					3																	58145363		2203	4300	6503	SO:0001583	missense	2317	exon43			AGGTGCACAGCCC	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.6971A>C	3.37:g.58145363A>C	ENSP00000295956:p.His2324Pro		Somatic	31	0.0967741935	3		RNA-Seq	Illumina HiSeq		26	0.12	3	NM_001164317	116	0.16	18	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.232823	0.58777	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.86	5.86	0.93980	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85452	0.5700	L	0.57130	1.785	0.80722	D	1	B;B;B;B;B;B	0.22080	0.002;0.064;0.002;0.004;0.002;0.002	B;B;B;B;B;B	0.34242	0.012;0.178;0.042;0.013;0.042;0.042	T	0.81519	-0.0896	10	0.34782	T	0.22	.	16.3159	0.82928	1.0:0.0:0.0:0.0	.	2300;2355;2131;2144;2313;2324	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	P	2324;2355;2300;2313;2283;2131;2144	ENSP00000295956:H2324P;ENSP00000420213:H2355P;ENSP00000351339:H2300P;ENSP00000415599:H2313P;ENSP00000232447:H2283P;ENSP00000418510:H2131P;ENSP00000414532:H2144P	ENSP00000295956:H2324P	H	+	2	0	FLNB	58120403	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.247000	0.74100	0.524000	0.50904	CAC			0.537	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000353569.1		NM_001457	
LRRC66	339977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	52883329	52883329	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr4:52883329T>A	ENST00000343457.3	-	1	457	c.451A>T	c.(451-453)Aag>Tag	p.K151*		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	151						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						ATGAGCACCTTCAGCAATGGA	0.443																																					p.K151X													.	.			0			c.A451T												158.0	146.0	150.0					4																	52883329		1921	4137	6058	SO:0001587	stop_gained	339977	exon1			GCACCTTCAGCAA	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.451A>T	4.37:g.52883329T>A	ENSP00000341944:p.Lys151*		Somatic	270	0	0		WXS	Illumina HiSeq	.	157	0.28	44	NM_001024611	0		0		Nonsense_Mutation	SNP	ENST00000343457.3	37	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098519	0.56183	.	.	ENSG00000188993	ENST00000343457	.	.	.	5.75	3.24	0.37175	.	0.300747	0.24122	N	0.041342	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.1515	11.292	0.49256	0.0:0.0:0.2899:0.7101	.	.	.	.	X	151	.	ENSP00000341944:K151X	K	-	1	0	LRRC66	52578086	0.990000	0.36364	0.769000	0.31535	0.046000	0.14306	2.216000	0.42871	0.402000	0.25451	0.528000	0.53228	AAG			0.443	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361473.1		NM_001024611	
KIT	3815	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599338	55599338	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr4:55599338A>T	ENST00000288135.5	+	17	2561	c.2464A>T	c.(2464-2466)Aat>Tat	p.N822Y		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	822	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> K (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N822Y(5)|p.N822H(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAATGATTCTAATTATGTGGT	0.378		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.N822Y			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,0,44	KIT	7396	44	6	Substitution - Missense(6)	genital_tract(2)|testis(1)|haematopoietic_and_lymphoid_tissue(1)|soft_tissue(1)|skin(1)	c.A2464T	GRCh37	CM087050	KIT	M								146.0	149.0	148.0					4																	55599338		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GATTCTAATTATG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2464A>T	4.37:g.55599338A>T	ENSP00000288135:p.Asn822Tyr		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	83	0.23	19	NM_000222	83	0.70	58	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.416486	0.83449	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82255	-1.59;-1.59	5.47	5.47	0.80525	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000009	D	0.85080	0.5615	N	0.20445	0.575	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.92;1.0	D	0.87693	0.2555	10	0.87932	D	0	.	15.5485	0.76129	1.0:0.0:0.0:0.0	.	818;822	P10721-2;P10721	.;KIT_HUMAN	Y	822;818	ENSP00000288135:N822Y;ENSP00000390987:N818Y	ENSP00000288135:N822Y	N	+	1	0	KIT	55294095	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.138000	0.94501	2.084000	0.62774	0.477000	0.44152	AAT			0.378	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
JADE2	23338	mdanderson.org	37	5	133914249	133914249	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr5:133914249C>T	ENST00000282605.4	+	12	1833	c.1747C>T	c.(1747-1749)Cag>Tag	p.Q583*	PHF15_ENST00000361895.2_Nonsense_Mutation_p.Q540*|PHF15_ENST00000395003.1_Nonsense_Mutation_p.Q539*|PHF15_ENST00000402835.1_3'UTR																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACAGTCGGTGCAGATCACAGC	0.607																																					p.Q539X													.	.			0			c.C1615T												109.0	105.0	106.0					5																	133914249		2203	4300	6503	SO:0001587	stop_gained	23338	exon11			TCGGTGCAGATCA																												ENST00000282605.4:c.1747C>T	5.37:g.133914249C>T	ENSP00000282605:p.Gln583*		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_015288	77	0.00	0		Nonsense_Mutation	SNP	ENST00000282605.4	37		.	.	.	.	.	.	.	.	.	.	c	38	7.137059	0.98088	.	.	ENSG00000043143	ENST00000413974;ENST00000448712;ENST00000282605;ENST00000361895;ENST00000432594;ENST00000395003	.	.	.	5.34	5.34	0.76211	.	0.519603	0.19238	N	0.119257	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	19.0378	0.92986	0.0:1.0:0.0:0.0	.	.	.	.	X	583;599;583;540;540;539	.	ENSP00000282605:Q583X	Q	+	1	0	PHF15	133942148	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.217000	0.77982	2.517000	0.84864	0.306000	0.20318	CAG			0.607	PHF15-003	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000251170.1			
CD14	929	mdanderson.org	37	5	140011945	140011945	+	Silent	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr5:140011945G>A	ENST00000302014.6	-	2	1253	c.624C>T	c.(622-624)ggC>ggT	p.G208G	CD14_ENST00000401743.2_Silent_p.G208G	NM_000591.3	NP_000582.1	P08571	CD14_HUMAN	CD14 molecule	208					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|phagocytosis (GO:0006909)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endocytosis (GO:0045807)|positive regulation of tumor necrosis factor production (GO:0032760)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to magnesium ion (GO:0032026)|response to tumor necrosis factor (GO:0034612)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|opsonin receptor activity (GO:0001847)|peptidoglycan receptor activity (GO:0016019)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCGCGTTCGCCCAGTCCAG	0.617																																					p.G208G													.	.			0			c.C624T												56.0	61.0	59.0					5																	140011945		2203	4300	6503	SO:0001819	synonymous_variant	929	exon3			GCGTTCGCCCAGT		CCDS4232.1	5q31.3	2012-09-20	2006-03-28		ENSG00000170458	ENSG00000170458		"""CD molecules"""	1628	protein-coding gene	gene with protein product		158120	"""CD14 antigen"""			2472171, 2462937	Standard	NM_000591		Approved		uc003lgi.2	P08571	OTTHUMG00000129507	ENST00000302014.6:c.624C>T	5.37:g.140011945G>A			Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001174105	830	0.00	0	Q53XT5|Q96FR6|Q96L99|Q9UNS3	Silent	SNP	ENST00000302014.6	37	CCDS4232.1																																																																																					0.617	CD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251681.2		NM_000591	
TULP1	7287	mdanderson.org	37	6	35471611	35471611	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr6:35471611C>A	ENST00000229771.6	-	12	1206	c.1127G>T	c.(1126-1128)gGg>gTg	p.G376V	TULP1_ENST00000322263.4_Missense_Mutation_p.G323V	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	376					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						GAAGCGGTTCCCCAGGAGGTT	0.597																																					p.G376V	GBM(55;1027 1091 11115 23439)												.	.			0			c.G1127T												41.0	36.0	38.0					6																	35471611		2203	4300	6503	SO:0001583	missense	7287	exon12			CGGTTCCCCAGGA	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.1127G>T	6.37:g.35471611C>A	ENSP00000229771:p.Gly376Val		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_003322	0		0	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	ENST00000229771.6	37	CCDS4807.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675829	0.88445	.	.	ENSG00000112041	ENST00000229771;ENST00000322263	D;D	0.92446	-3.04;-3.04	4.95	4.95	0.65309	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.98009	0.9344	H	0.99117	4.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99885	1.1120	10	0.87932	D	0	-4.3509	18.2016	0.89840	0.0:1.0:0.0:0.0	.	323;376	O00294-2;O00294	.;TULP1_HUMAN	V	376;323	ENSP00000229771:G376V;ENSP00000319414:G323V	ENSP00000229771:G376V	G	-	2	0	TULP1	35579589	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.685000	0.84117	2.287000	0.76781	0.491000	0.48974	GGG			0.597	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040307.2			
TDRD6	221400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46661672	46661672	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr6:46661672G>A	ENST00000316081.6	+	1	5807	c.5807G>A	c.(5806-5808)tGt>tAt	p.C1936Y	TDRD6_ENST00000544460.1_Missense_Mutation_p.C1936Y	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1936					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GAATCCATGTGTACTGAGGAC	0.433																																					p.C1936Y													.	.			0			c.G5807A												153.0	147.0	149.0					6																	46661672		2203	4300	6503	SO:0001583	missense	221400	exon1			CCATGTGTACTGA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.5807G>A	6.37:g.46661672G>A	ENSP00000346065:p.Cys1936Tyr		Somatic	258	0	0		WXS	Illumina HiSeq	.	184	0.10	19	NM_001168359	7	0.14	1	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	G	1.321	-0.599441	0.03744	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.16743	2.32;2.33	5.56	1.71	0.24356	.	0.619922	0.15419	N	0.263338	T	0.04003	0.0112	L	0.47716	1.5	0.09310	N	1	B;B	0.14438	0.01;0.006	B;B	0.14023	0.01;0.005	T	0.41716	-0.9493	10	0.25751	T	0.34	-1.5168	3.7218	0.08459	0.3207:0.0:0.5154:0.1639	.	1936;1936	F5H5M3;O60522	.;TDRD6_HUMAN	Y	1936	ENSP00000443299:C1936Y;ENSP00000346065:C1936Y	ENSP00000346065:C1936Y	C	+	2	0	TDRD6	46769631	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.346000	0.19997	0.269000	0.21961	0.557000	0.71058	TGT			0.433	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040800.1		XM_166443	
RADIL	55698	mdanderson.org	37	7	4845284	4845284	+	Silent	SNP	G	G	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr7:4845284G>A	ENST00000399583.3	-	10	2390	c.2203C>T	c.(2203-2205)Ctg>Ttg	p.L735L	RADIL_ENST00000536091.1_3'UTR|RADIL_ENST00000538469.1_Silent_p.L495L	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	735	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		TAGTGAGTCAGCAGCCGGTGC	0.667																																					p.L735L													.	.			0			c.C2203T												21.0	27.0	25.0					7																	4845284		2102	4268	6370	SO:0001819	synonymous_variant	55698	exon10			GAGTCAGCAGCCG	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.2203C>T	7.37:g.4845284G>A			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_018059	14	0.00	0	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	37	CCDS43544.1																																																																																					0.667	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323769.2		NM_018059	
HOXA11	3207	broad.mit.edu	37	7	27224964	27224964	+	5'Flank	DEL	C	C	-			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr7:27224964delC	ENST00000006015.3	-	0	0				HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000479766.1_RNA|RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000520360.1_RNA|HOXA11-AS_ENST00000522674.1_RNA|HOXA11-AS_ENST00000522863.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11						anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						CGGGCCTTTTCCCCCCCCCTT	0.527			T	NUP98	CML						OREG0003746|OREG0003747	type=REGULATORY REGION|Gene=BC025338|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=HOXA11|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									.				Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	.	HOXA11	29		0			.																																									SO:0001631	upstream_gene_variant	0	.			CCTTTTCCCCCCC		CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437		7.37:g.27224964delC	Exception_encountered		Somatic	10	0	0	792	WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A4D190	RNA	DEL	ENST00000006015.3	37	CCDS5411.1																																																																																					0.527	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000358754.1			
DDC	1644	broad.mit.edu	37	7	50611732	50611732	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr7:50611732C>T	ENST00000444124.2	-	2	252	c.52G>A	c.(52-54)Gcc>Acc	p.A18T	AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000380984.4_Missense_Mutation_p.A18T|DDC_ENST00000426377.1_Missense_Mutation_p.A18T|DDC_ENST00000431062.1_Missense_Mutation_p.A18T|DDC_ENST00000357936.5_Missense_Mutation_p.A18T	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	18					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	ATGTAGTTGGCCATGTAATCC	0.562																																					p.A18T													.	DDC	100		0			c.G52A												269.0	207.0	228.0					7																	50611732		2203	4300	6503	SO:0001583	missense	1644	exon2			AGTTGGCCATGTA		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.52G>A	7.37:g.50611732C>T	ENSP00000403644:p.Ala18Thr		Somatic	345	0.0028985507	1		WXS	Illumina HiSeq	Phase_I	272	0.02	5	NM_001082971	0		0	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	37	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966936	0.92855	.	.	ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000426377;ENST00000444124;ENST00000380984;ENST00000420203	T;T;T;T;T;T	0.69175	1.08;1.08;1.08;1.08;1.08;-0.38	5.92	5.92	0.95590	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.75788	0.3897	M	0.85197	2.74	0.80722	D	1	D;D	0.54964	0.969;0.969	P;P	0.45138	0.471;0.471	T	0.79266	-0.1874	10	0.51188	T	0.08	0.3276	20.3248	0.98698	0.0:1.0:0.0:0.0	.	18;18	Q53Y41;P20711	.;DDC_HUMAN	T	18	ENSP00000350616:A18T;ENSP00000399184:A18T;ENSP00000395069:A18T;ENSP00000403644:A18T;ENSP00000370371:A18T;ENSP00000408626:A18T	ENSP00000350616:A18T	A	-	1	0	DDC	50579226	1.000000	0.71417	0.916000	0.36221	0.628000	0.37860	4.838000	0.62803	2.818000	0.97014	0.655000	0.94253	GCC			0.562	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342593.1			
COBL	23242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	51096848	51096848	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr7:51096848C>G	ENST00000265136.7	-	10	2110	c.1945G>C	c.(1945-1947)Gac>Cac	p.D649H	COBL_ENST00000395542.2_Missense_Mutation_p.D731H	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	649					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TACACTTTGTCTTTCACTTTT	0.458																																					p.D649H	NSCLC(189;2119 2138 12223 30818 34679)												.	.			0			c.G1945C												143.0	128.0	133.0					7																	51096848		2203	4300	6503	SO:0001583	missense	23242	exon10			CTTTGTCTTTCAC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.1945G>C	7.37:g.51096848C>G	ENSP00000265136:p.Asp649His		Somatic	248	0	0		WXS	Illumina HiSeq	.	197	0.22	43	NM_015198	0		0	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314671	0.40996	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542;ENST00000457306	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	5.51	1.26	0.21427	.	2.197360	0.01696	N	0.026931	T	0.34337	0.0894	L	0.34521	1.04	0.09310	N	1	P;P;P;P;D	0.59357	0.911;0.911;0.855;0.911;0.985	P;P;B;P;P	0.57468	0.562;0.562;0.359;0.66;0.821	T	0.12760	-1.0535	10	0.46703	T	0.11	.	5.9149	0.19050	0.0:0.4817:0.2917:0.2266	.	649;706;649;731;191	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	H	649;541;534;731;147	ENSP00000265136:D649H;ENSP00000401204:D541H;ENSP00000413498:D534H;ENSP00000378912:D731H	ENSP00000265136:D649H	D	-	1	0	COBL	51064342	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.578000	0.05841	0.232000	0.21100	0.655000	0.94253	GAC			0.458	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000342682.1		NM_015198	
MAGI2	9863	broad.mit.edu	37	7	77797419	77797419	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr7:77797419T>A	ENST00000354212.4	-	15	2663	c.2410A>T	c.(2410-2412)Att>Ttt	p.I804F	MAGI2_ENST00000522391.1_Missense_Mutation_p.I804F|MAGI2_ENST00000419488.1_Missense_Mutation_p.I790F	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	804	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ACAGCTCCAATCAAAATCTAG	0.463																																					p.I804F													.	MAGI2	246		0			c.A2410T												83.0	80.0	81.0					7																	77797419		2203	4300	6503	SO:0001583	missense	9863	exon15			CTCCAATCAAAAT	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2410A>T	7.37:g.77797419T>A	ENSP00000346151:p.Ile804Phe		Somatic	206	0.0631067961	13		WXS	Illumina HiSeq	Phase_I	172	0.07	12	NM_012301	0		0	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.035756	0.75617	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.58358	0.34;0.47;0.47	5.96	5.96	0.96718	PDZ/DHR/GLGF (4);	0.000000	0.36665	U	0.002476	T	0.69780	0.3149	H	0.95917	3.74	0.80722	D	1	B;P;B	0.34892	0.008;0.474;0.026	B;B;B	0.36989	0.015;0.238;0.015	T	0.77437	-0.2588	10	0.87932	D	0	.	15.6258	0.76855	0.0:0.0:0.0:1.0	.	804;790;804	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	F	790;804;804;804	ENSP00000405766:I790F;ENSP00000346151:I804F;ENSP00000428389:I804F	ENSP00000346151:I804F	I	-	1	0	MAGI2	77635355	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.284000	0.76573	0.528000	0.53228	ATT			0.463	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253197.3		NM_012301	
PPAPDC1B	84513	hgsc.bcm.edu;mdanderson.org	37	8	38124886	38124886	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr8:38124886C>T	ENST00000424479.2	-	5	382	c.362G>A	c.(361-363)cGc>cAc	p.R121H	PPAPDC1B_ENST00000422581.2_Missense_Mutation_p.R121H|PPAPDC1B_ENST00000531823.1_5'UTR|PPAPDC1B_ENST00000530588.1_5'Flank|PPAPDC1B_ENST00000529359.1_Missense_Mutation_p.R80H|PPAPDC1B_ENST00000419686.2_Missense_Mutation_p.R121H	NM_001102559.1	NP_001096029.1	Q8NEB5	PPC1B_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1B	121					phospholipid dephosphorylation (GO:0046839)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			kidney(1)|lung(1)	2	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)	BRCA - Breast invasive adenocarcinoma(5;3.04e-26)|COAD - Colon adenocarcinoma(9;0.188)			AGGGAAGCAGCGGTAGAAGAA	0.468																																					p.R121H													.	.			0			c.G362A												91.0	87.0	89.0					8																	38124886		1957	4152	6109	SO:0001583	missense	84513	exon5			AAGCAGCGGTAGA	AF212238	CCDS47841.1, CCDS47842.1, CCDS47843.1	8p12	2005-08-09			ENSG00000147535	ENSG00000147535			25026	protein-coding gene	gene with protein product		610626					Standard	NM_032483		Approved	HTPAP	uc003xlf.4	Q8NEB5	OTTHUMG00000165104	ENST00000424479.2:c.362G>A	8.37:g.38124886C>T	ENSP00000392553:p.Arg121His		Somatic	188	0	0		WXS	Illumina HiSeq	.	122	0.04	5	NM_032483	54	0.00	0	C9JKF5|Q3KQX6|Q9BY45	Missense_Mutation	SNP	ENST00000424479.2	37	CCDS47841.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.397062|5.397062	0.96009|0.96009	.|.	.|.	ENSG00000147535|ENSG00000147535	ENST00000534339|ENST00000529359;ENST00000424479;ENST00000524616;ENST00000422581;ENST00000419686	.|T;T;T;T;T	.|0.76316	.|-1.01;-1.01;-1.01;-1.01;-1.01	5.01|5.01	5.01|5.01	0.66863|0.66863	.|Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91123|0.91123	0.7205|0.7205	M|M	0.93420|0.93420	3.415|3.415	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;0.999;1.0	D|D	0.93384|0.93384	0.6746|0.6746	5|10	.|0.87932	.|D	.|0	-22.6925|-22.6925	17.2215|17.2215	0.86958|0.86958	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|121;121;121	.|C9JKF5;Q8NEB5-2;Q8NEB5	.|.;.;PPC1B_HUMAN	T|H	115|80;121;102;121;121	.|ENSP00000434916:R80H;ENSP00000392553:R121H;ENSP00000432122:R102H;ENSP00000390622:R121H;ENSP00000414522:R121H	.|ENSP00000414522:R121H	A|R	-|-	1|2	0|0	PPAPDC1B|PPAPDC1B	38244043|38244043	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.597000|7.597000	0.82733|0.82733	2.475000|2.475000	0.83589|0.83589	0.557000|0.557000	0.71058|0.71058	GCT|CGC			0.468	PPAPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381832.2		NM_032483	
MAFA	389692	broad.mit.edu	37	8	144511954	144511959	+	In_Frame_Del	DEL	TGGTGG	TGGTGG	-	rs552049497|rs141816879		TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	TGGTGG	TGGTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr8:144511954_144511959delTGGTGG	ENST00000333480.2	-	1	617_622	c.618_623delCCACCA	c.(616-624)caccaccat>cat	p.206_208HHH>H	MAFA_ENST00000528185.1_5'UTR	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	206	His-rich.				insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H208delH(3)		breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggtggt	0.748										HNSCC(29;0.082)																											p.206_208del													.	MAFA	9		3	Deletion - In frame(3)	upper_aerodigestive_tract(2)|breast(1)	c.618_623del																																									SO:0001651	inframe_deletion	389692	exon1			CCGCCATGGTGGT	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.618_623delCCACCA	8.37:g.144511960_144511965delTGGTGG	ENSP00000328364:p.His206_His207del		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_201589	1	0.00	0		In_Frame_Del	DEL	ENST00000333480.2	37	CCDS34955.1																																																																																					0.748	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381511.2		NM_201589	
MLLT3	4300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	20414230	20414230	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr9:20414230T>A	ENST00000380338.4	-	5	900	c.614A>T	c.(613-615)gAa>gTa	p.E205V	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Missense_Mutation_p.E202V|MIR4473_ENST00000583731.1_RNA	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	205					anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		AGAAGGTTTTTCCTTGTGCTC	0.443			T	MLL	ALL																																p.E205V				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	.			0			c.A614T												196.0	205.0	202.0					9																	20414230		2203	4300	6503	SO:0001583	missense	4300	exon5			GGTTTTTCCTTGT	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.614A>T	9.37:g.20414230T>A	ENSP00000369695:p.Glu205Val		Somatic	271	0	0		WXS	Illumina HiSeq	.	185	0.19	36	NM_004529	3	1.00	3	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	ENST00000380338.4	37	CCDS6494.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.373779	0.61624	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.48	5.48	0.80851	.	0.203478	0.50627	D	0.000112	T	0.63698	0.2533	M	0.71036	2.16	0.80722	D	1	D;D	0.54397	0.966;0.966	P;P	0.47299	0.543;0.543	T	0.67465	-0.5664	9	0.46703	T	0.11	-17.4468	15.5535	0.76173	0.0:0.0:0.0:1.0	.	202;205	B7Z755;P42568	.;AF9_HUMAN	V	205;202;244	.	ENSP00000369695:E205V	E	-	2	0	MLLT3	20404230	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.887000	0.63156	2.077000	0.62373	0.482000	0.46254	GAA			0.443	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051872.1		NM_004529	
FAM205B	389715	broad.mit.edu	37	9	34834814	34834814	+	RNA	SNP	C	C	G			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr9:34834814C>G	ENST00000455647.2	-	0	1579							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		CCCAATTTGGCGAAAGTGGGG	0.522																																					.													.	FAM205B	10		0			.																																											0	.			ATTTGGCGAAAGT			9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34834814C>G			Somatic	132	0.0075757576	1		WXS	Illumina HiSeq	Phase_I	100	0.05	5	.	0		0	Q6ZRJ7	RNA	SNP	ENST00000455647.2	37																																																																																						0.522	FAM205B-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000052246.5		NR_024481	
COL27A1	85301	mdanderson.org	37	9	117002739	117002739	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr9:117002739C>T	ENST00000356083.3	+	21	3198	c.2807C>T	c.(2806-2808)cCg>cTg	p.P936L		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	936	Collagen-like 6.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CGAGGCCTGCCGGGACCCCGT	0.672																																					p.P936L													.	.			0			c.C2807T												74.0	84.0	81.0					9																	117002739		2203	4300	6503	SO:0001583	missense	85301	exon21			GCCTGCCGGGACC	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.2807C>T	9.37:g.117002739C>T	ENSP00000348385:p.Pro936Leu		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_032888	2	0.00	0	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870594	0.72065	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.96136	-3.92	5.91	5.91	0.95273	.	.	.	.	.	D	0.97698	0.9245	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97680	1.0172	9	0.54805	T	0.06	.	15.7986	0.78433	0.0:1.0:0.0:0.0	.	936	Q8IZC6	CORA1_HUMAN	L	936	ENSP00000348385:P936L	ENSP00000348385:P936L	P	+	2	0	COL27A1	116042560	0.993000	0.37304	0.994000	0.49952	0.995000	0.86356	3.357000	0.52277	2.793000	0.96121	0.655000	0.94253	CCG			0.672	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053763.1		NM_032888	
PIP5KL1	138429	mdanderson.org	37	9	130689596	130689596	+	Silent	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chr9:130689596G>T	ENST00000388747.4	-	6	618	c.574C>A	c.(574-576)Cgg>Agg	p.R192R	PIP5KL1_ENST00000490773.1_5'UTR|PIP5KL1_ENST00000300432.3_5'UTR	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	192	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						CGGTCCACCCGCAGACTGTGC	0.711																																					p.R192R													.	.			0			c.C574A												18.0	20.0	20.0					9																	130689596		1568	3580	5148	SO:0001819	synonymous_variant	138429	exon6			CCACCCGCAGACT	BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.574C>A	9.37:g.130689596G>T			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001135219	0		0	Q8IVS3	Silent	SNP	ENST00000388747.4	37	CCDS48030.1																																																																																					0.711	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054289.2		NM_173492	
OTUD5	55593	mdanderson.org	37	X	48781269	48781269	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chrX:48781269C>T	ENST00000156084.4	-	7	1399	c.1339G>A	c.(1339-1341)Gag>Aag	p.E447K	OTUD5_ENST00000396743.3_Missense_Mutation_p.E442K|OTUD5_ENST00000484499.1_5'Flank|OTUD5_ENST00000428668.2_Missense_Mutation_p.E225K|OTUD5_ENST00000376488.3_Missense_Mutation_p.E442K	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	447					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						CTAGTCCACTCCTCCAGGCCA	0.647																																					p.E447K													.	.			0			c.G1339A												26.0	25.0	25.0					X																	48781269		2201	4297	6498	SO:0001583	missense	55593	exon7			TCCACTCCTCCAG		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.1339G>A	X.37:g.48781269C>T	ENSP00000156084:p.Glu447Lys		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_017602	121	0.00	0	B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Missense_Mutation	SNP	ENST00000156084.4	37	CCDS14313.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171087	0.57584	.	.	ENSG00000068308	ENST00000396743;ENST00000453548;ENST00000455452;ENST00000156084;ENST00000376488;ENST00000428668	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	4.38	4.38	0.52667	.	0.072165	0.53938	D	0.000042	T	0.32882	0.0844	L	0.36672	1.1	0.58432	D	0.99999	B;P;P	0.40731	0.067;0.608;0.728	B;B;B	0.38616	0.017;0.143;0.277	T	0.07328	-1.0778	10	0.28530	T	0.3	-15.0101	13.5481	0.61715	0.0:1.0:0.0:0.0	.	225;447;442	B4DGG7;Q96G74;G5E9D7	.;OTUD5_HUMAN;.	K	442;418;320;447;442;225	ENSP00000379969:E442K;ENSP00000390767:E320K;ENSP00000156084:E447K;ENSP00000365671:E442K;ENSP00000401629:E225K	ENSP00000156084:E447K	E	-	1	0	OTUD5	48666213	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	6.219000	0.72231	2.434000	0.82447	0.523000	0.50628	GAG			0.647	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000060799.1		NM_017602	
SLC25A5	292	mdanderson.org	37	X	118603654	118603654	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chrX:118603654G>T	ENST00000317881.8	+	2	258	c.142G>T	c.(142-144)Gat>Tat	p.D48Y	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	48					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	GATCACTGCAGATAAGCAATA	0.502																																					p.D48Y													.	.			0			c.G142T												244.0	240.0	241.0					X																	118603654		2203	4300	6503	SO:0001583	missense	292	exon2			ACTGCAGATAAGC	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.142G>T	X.37:g.118603654G>T	ENSP00000360671:p.Asp48Tyr		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001152	301	0.00	0	B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	37	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923061	0.73213	.	.	ENSG00000005022	ENST00000317881	T	0.79554	-1.28	4.18	4.18	0.49190	Mitochondrial carrier domain (2);	0.047678	0.85682	D	0.000000	D	0.86883	0.6040	M	0.89287	3.02	0.80722	D	1	B	0.26147	0.143	B	0.39339	0.297	D	0.88373	0.2996	10	0.87932	D	0	.	15.4079	0.74893	0.0:0.0:1.0:0.0	.	48	P05141	ADT2_HUMAN	Y	48	ENSP00000360671:D48Y	ENSP00000360671:D48Y	D	+	1	0	SLC25A5	118487682	1.000000	0.71417	0.995000	0.50966	0.978000	0.69477	9.473000	0.97714	2.019000	0.59389	0.529000	0.55759	GAT			0.502	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058952.2		NM_001152	
ATP6AP1	537	mdanderson.org	37	X	153661316	153661316	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAHN-01A-11D-A42Y-10	TCGA-2G-AAHN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eda3025-76bf-4914-a2a7-afad6491006b	23de8c57-d3d5-4159-b0d5-283a67238ac3	g.chrX:153661316C>T	ENST00000369762.2	+	5	658	c.597C>T	c.(595-597)aaC>aaT	p.N199N	ATP6AP1_ENST00000484908.1_3'UTR	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	199					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCACAGGCAACGGTGAGTAGA	0.617																																					p.N199N													.	.			0			c.C597T												144.0	108.0	120.0					X																	153661316		2203	4300	6503	SO:0001630	splice_region_variant	537	exon5			AGGCAACGGTGAG	D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.598+1C>T	X.37:g.153661316C>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001183	274	0.00	0	A6ZKI4|Q8NBT4|Q9H0C7	Silent	SNP	ENST00000369762.2	37	CCDS35451.1																																																																																					0.617	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000081639.4		NM_001183	Silent
