#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	mdanderson.org	37	1	8421286	8421286	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:8421286G>T	ENST00000337907.3	-	19	2915	c.2281C>A	c.(2281-2283)Ctg>Atg	p.L761M	RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.L761M|RERE_ENST00000476556.1_Missense_Mutation_p.L207M|RERE_ENST00000377464.1_Missense_Mutation_p.L493M	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	761	Pro-rich.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GGCGTGGGCAGCTGAGGGGTC	0.721																																					p.L761M													.	.			0			c.C2281A												15.0	18.0	17.0					1																	8421286		2188	4288	6476	SO:0001583	missense	473	exon19			TGGGCAGCTGAGG	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.2281C>A	1.37:g.8421286G>T	ENSP00000338629:p.Leu761Met		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_012102	26	0.00	0	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.302282	0.23736	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T	0.45276	0.93;0.9;0.93	5.6	4.68	0.58851	.	.	.	.	.	T	0.46619	0.1402	L	0.51422	1.61	0.33300	D	0.564748	P;P	0.43938	0.822;0.801	P;P	0.48524	0.549;0.58	T	0.58429	-0.7638	9	0.33940	T	0.23	-10.0446	13.6352	0.62219	0.0744:0.0:0.9256:0.0	.	493;761	B1AKN3;Q9P2R6	.;RERE_HUMAN	M	761;493;207;761	ENSP00000338629:L761M;ENSP00000366684:L493M;ENSP00000383700:L761M	ENSP00000338629:L761M	L	-	1	2	RERE	8343873	0.354000	0.24912	0.756000	0.31282	0.114000	0.19823	1.841000	0.39240	1.384000	0.46424	0.561000	0.74099	CTG			0.721	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004916.1			
HIVEP3	59269	mdanderson.org	37	1	42046701	42046701	+	Silent	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:42046701G>A	ENST00000372583.1	-	4	4653	c.3768C>T	c.(3766-3768)agC>agT	p.S1256S	HIVEP3_ENST00000429157.2_Silent_p.S1256S|HIVEP3_ENST00000372584.1_Silent_p.S1256S|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Silent_p.S1256S	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1256					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GGGGCAGATGGCTTTCCACAT	0.587																																					p.S1256S													.	.			0			c.C3768T												51.0	54.0	53.0					1																	42046701		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon4			CAGATGGCTTTCC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.3768C>T	1.37:g.42046701G>A			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_024503	2	0.00	0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																					0.587	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000016978.1		NM_024503	
KLF17	128209	mdanderson.org	37	1	44595437	44595437	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:44595437G>T	ENST00000372299.3	+	2	552	c.494G>T	c.(493-495)gGa>gTa	p.G165V	KLF17_ENST00000476802.1_Intron	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	165					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					GCTTCCACTGGAATCCCAATA	0.572																																					p.G165V													.	.			0			c.G494T												36.0	40.0	39.0					1																	44595437		2203	4300	6503	SO:0001583	missense	128209	exon2			CCACTGGAATCCC	BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.494G>T	1.37:g.44595437G>T	ENSP00000361373:p.Gly165Val		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_173484	0		0	Q86VQ7|Q8N805	Missense_Mutation	SNP	ENST00000372299.3	37	CCDS508.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468441	0.43839	.	.	ENSG00000171872	ENST00000372299	T	0.11277	2.79	4.43	2.52	0.30459	.	0.268702	0.26903	N	0.021917	T	0.08980	0.0222	L	0.36672	1.1	0.19945	N	0.999941	P	0.37781	0.608	B	0.38225	0.268	T	0.17107	-1.0380	10	0.66056	D	0.02	.	7.1981	0.25864	0.0:0.2248:0.5945:0.1807	.	165	Q5JT82	KLF17_HUMAN	V	165	ENSP00000361373:G165V	ENSP00000361373:G165V	G	+	2	0	KLF17	44368024	0.207000	0.23482	0.001000	0.08648	0.009000	0.06853	0.955000	0.29188	0.774000	0.33427	0.650000	0.86243	GGA			0.572	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026646.1		NM_173484	
DENND2D	79961	mdanderson.org	37	1	111739831	111739831	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:111739831G>T	ENST00000357640.4	-	5	700	c.471C>A	c.(469-471)atC>atA	p.I157I	DENND2D_ENST00000473682.1_5'UTR|DENND2D_ENST00000369752.5_Silent_p.I154I	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	157	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CGATGCAGCTGATGATGCAGT	0.622																																					p.I157I													.	.			0			c.C471A												48.0	42.0	44.0					1																	111739831		2203	4300	6503	SO:0001819	synonymous_variant	79961	exon5			GCAGCTGATGATG		CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.471C>A	1.37:g.111739831G>T			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_024901	6	0.00	0	Q5T5V6|Q9BSU0	Silent	SNP	ENST00000357640.4	37	CCDS831.1																																																																																					0.622	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000034456.1		NM_024901	
MTX1	4580	broad.mit.edu	37	1	155185875	155185876	+	IGR	INS	-	-	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:155185875_155185876insT	ENST00000368376.3	+	0	1632				RP11-263K19.6_ENST00000455788.1_RNA|GBAP1_ENST00000486869.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			taacttttctattttttttttt	0.48																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTTTCTATTTTTT		CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708		1.37:g.155185886_155185886dupT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	1	0.00	0	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	RNA	INS	ENST00000368376.3	37	CCDS1100.1																																																																																					0.480	MTX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000086844.1		NM_198883	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	181765833	181765833	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:181765833G>A	ENST00000367573.2	+	47	6238	c.6238G>A	c.(6238-6240)Ggc>Agc	p.G2080S	CACNA1E_ENST00000360108.3_Missense_Mutation_p.G2061S|CACNA1E_ENST00000358338.5_Missense_Mutation_p.G1969S|CACNA1E_ENST00000367567.4_Missense_Mutation_p.G1644S|CACNA1E_ENST00000526775.1_Missense_Mutation_p.G2018S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.G2037S|CACNA1E_ENST00000357570.5_Missense_Mutation_p.G2031S	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2080					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCGCTCAGGGGGCAGGGAGCG	0.542																																					p.G2080S													.	.			0			c.G6238A												45.0	47.0	47.0					1																	181765833		1958	4160	6118	SO:0001583	missense	777	exon47			TCAGGGGGCAGGG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6238G>A	1.37:g.181765833G>A	ENSP00000356545:p.Gly2080Ser		Somatic	124	0	0		WXS	Illumina HiSeq	.	125	0.30	38	NM_001205293	2	0.50	1	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.194043	0.58017	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.95918	-3.78;-3.78;-3.74;-3.78;-3.85;-3.74;-3.74	5.91	5.91	0.95273	.	0.632802	0.16303	N	0.220369	D	0.90345	0.6979	N	0.08118	0	0.51233	D	0.999912	B;B	0.29136	0.234;0.1	B;B	0.32289	0.143;0.068	D	0.86345	0.1707	10	0.16420	T	0.52	.	19.8936	0.96942	0.0:0.0:1.0:0.0	.	2018;2037	Q15878-2;Q15878-3	.;.	S	2037;2018;2031;1969;1644;2061;2080	ENSP00000356542:G2037S;ENSP00000434814:G2018S;ENSP00000350183:G2031S;ENSP00000351101:G1969S;ENSP00000356539:G1644S;ENSP00000353222:G2061S;ENSP00000356545:G2080S	ENSP00000350183:G2031S	G	+	1	0	CACNA1E	180032456	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.472000	0.66768	2.793000	0.96121	0.655000	0.94253	GGC			0.542	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000090793.2		NM_000721	
PRG4	10216	broad.mit.edu	37	1	186276585	186276585	+	Silent	SNP	A	A	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:186276585A>C	ENST00000445192.2	+	7	1779	c.1734A>C	c.(1732-1734)ccA>ccC	p.P578P	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367483.4_Silent_p.P537P|PRG4_ENST00000367485.4_Silent_p.P485P|PRG4_ENST00000367486.3_Silent_p.P535P	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	578	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AGCCTGCCCCAACTACCCCCA	0.642																																					p.P578P													.	PRG4	259		0			c.A1734C												89.0	92.0	91.0					1																	186276585		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			TGCCCCAACTACC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1734A>C	1.37:g.186276585A>C			Somatic	74	0.0540540541	4		WXS	Illumina HiSeq	Phase_I	96	0.22	21	NM_005807	0		0	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																					0.642	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000086346.1		NM_005807	
NAV1	89796	bcgsc.ca	37	1	201778383	201778383	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:201778383C>G	ENST00000367296.4	+	21	4719	c.4299C>G	c.(4297-4299)atC>atG	p.I1433M	MIR1231_ENST00000408101.1_RNA|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367297.4_Missense_Mutation_p.I1425M|NAV1_ENST00000367302.1_Missense_Mutation_p.I1386M|NAV1_ENST00000295624.6_Missense_Mutation_p.I1430M|NAV1_ENST00000367300.3_Missense_Mutation_p.I1373M|NAV1_ENST00000367295.1_Missense_Mutation_p.I1039M	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1433					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						AGCACATCATCAAAGGGGTAA	0.517																																					p.I1433M													.	NAV1	143		0			c.C4299G												98.0	96.0	96.0					1																	201778383		2203	4300	6503	SO:0001583	missense	89796	exon21			CATCATCAAAGGG	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4299C>G	1.37:g.201778383C>G	ENSP00000356265:p.Ile1433Met		Somatic	400	0	0		WXS	Illumina HiSeq	Phase_1	312	0.00	0	NM_020443	19	0.00	0	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543324	0.65198	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	T;T;T;T;T;T	0.07114	3.24;3.22;3.22;3.22;3.24;3.23	5.57	5.57	0.84162	.	0.181162	0.48286	D	0.000188	T	0.12092	0.0294	L	0.29908	0.895	0.43214	D	0.995088	P;P	0.50443	0.935;0.935	P;P	0.52856	0.711;0.52	T	0.05338	-1.0891	10	0.34782	T	0.22	-35.5935	12.5291	0.56104	0.0:0.923:0.0:0.077	.	1039;1430	Q8NEY1-5;Q8NEY1-3	.;.	M	1386;1433;1430;1425;1373;1039	ENSP00000356271:I1386M;ENSP00000356265:I1433M;ENSP00000295624:I1430M;ENSP00000356266:I1425M;ENSP00000356269:I1373M;ENSP00000356264:I1039M	ENSP00000295624:I1430M	I	+	3	3	NAV1	200045006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.532000	0.53553	2.620000	0.88729	0.563000	0.77884	ATC			0.517	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000087013.1		NM_020443	
SYT2	127833	broad.mit.edu	37	1	202566020	202566020	+	Missense_Mutation	SNP	G	G	T	rs139376371		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:202566020G>T	ENST00000367267.1	-	9	1317	c.1125C>A	c.(1123-1125)ttC>ttA	p.F375L	SYT2_ENST00000367268.4_Missense_Mutation_p.F375L	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	375	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	TGCTGCCCACGAAGATCTTGC	0.612																																					p.F375L													.	SYT2	51		0			c.C1125A												103.0	83.0	90.0					1																	202566020		2203	4300	6503	SO:0001583	missense	127833	exon9			GCCCACGAAGATC	AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.1125C>A	1.37:g.202566020G>T	ENSP00000356236:p.Phe375Leu		Somatic	101	0.0099009901	1		WXS	Illumina HiSeq	Phase_I	115	0.05	6	NM_001136504	8	0.00	0	Q496K5|Q8NBE5	Missense_Mutation	SNP	ENST00000367267.1	37	CCDS1427.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.958750	0.34565	.	.	ENSG00000143858	ENST00000367268;ENST00000367267	T;T	0.70869	-0.52;-0.52	5.2	-7.88	0.01178	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.169047	0.52532	D	0.000079	T	0.46367	0.1389	N	0.17594	0.5	0.42120	D	0.991427	B	0.26708	0.157	B	0.29716	0.106	T	0.40059	-0.9583	10	0.09590	T	0.72	.	15.5348	0.75993	0.6211:0.0:0.3789:0.0	.	375	Q8N9I0	SYT2_HUMAN	L	375	ENSP00000356237:F375L;ENSP00000356236:F375L	ENSP00000356236:F375L	F	-	3	2	SYT2	200832643	0.022000	0.18835	0.382000	0.26119	0.927000	0.56198	-0.962000	0.03841	-2.380000	0.00594	-1.608000	0.00805	TTC			0.612	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000099157.1		NM_177402	
RYR2	6262	bcgsc.ca	37	1	237789007	237789007	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:237789007A>C	ENST00000366574.2	+	40	6386	c.6069A>C	c.(6067-6069)ttA>ttC	p.L2023F	RYR2_ENST00000360064.6_Missense_Mutation_p.L2021F|RYR2_ENST00000542537.1_Missense_Mutation_p.L2007F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2023	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACAGTGATTTAACAATTAGAG	0.393																																					p.L2023F													.	RYR2	1273		0			c.A6069C												127.0	119.0	121.0					1																	237789007		1840	4091	5931	SO:0001583	missense	6262	exon40			TGATTTAACAATT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6069A>C	1.37:g.237789007A>C	ENSP00000355533:p.Leu2023Phe		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_1	73	0.00	0	NM_001035	0		0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	7.281	0.609083	0.14066	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.72942	-0.7;-0.7;-0.7	5.61	-1.25	0.09405	.	0.124078	0.31577	U	0.007406	T	0.37571	0.1008	N	0.04959	-0.14	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07654	-1.0761	10	0.09843	T	0.71	.	5.1162	0.14834	0.523:0.2642:0.2127:0.0	.	2023	Q92736	RYR2_HUMAN	F	2023;2021;2007	ENSP00000355533:L2023F;ENSP00000353174:L2021F;ENSP00000443798:L2007F	ENSP00000353174:L2021F	L	+	3	2	RYR2	235855630	0.996000	0.38824	0.986000	0.45419	0.974000	0.67602	0.535000	0.23114	-0.144000	0.11314	-0.256000	0.11100	TTA			0.393	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095402.2		NM_001035	
ZNF672	79894	broad.mit.edu	37	1	249141630	249141630	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:249141630C>T	ENST00000306562.3	+	4	903	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W		NM_024836.1	NP_079112.1	Q499Z4	ZN672_HUMAN	zinc finger protein 672	53					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(1)	5	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GCGCTGTGCACGGGCTGCTGA	0.632																																					p.R53W													.	ZNF672	32		0			c.C157T												34.0	25.0	28.0					1																	249141630		2199	4298	6497	SO:0001583	missense	79894	exon4			TGTGCACGGGCTG	AK027476	CCDS1638.1	1q44	2013-01-08			ENSG00000171161	ENSG00000171161		"""Zinc fingers, C2H2-type"""	26179	protein-coding gene	gene with protein product	"""hypothetical protein FLJ22301"""					12477932	Standard	NM_024836		Approved	FLJ22301	uc001iex.3	Q499Z4	OTTHUMG00000040377	ENST00000306562.3:c.157C>T	1.37:g.249141630C>T	ENSP00000421915:p.Arg53Trp		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	98	0.03	3	NM_024836	19	0.00	0	Q96H65|Q96IM3|Q9H6G5	Missense_Mutation	SNP	ENST00000306562.3	37	CCDS1638.1	.	.	.	.	.	.	.	.	.	.	C	8.857	0.945992	0.18356	.	.	ENSG00000171161	ENST00000306562;ENST00000428515;ENST00000306576	T;T	0.58210	1.53;0.35	4.16	-3.36	0.04913	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	2.136130	0.03384	U	0.200824	T	0.36908	0.0984	L	0.43646	1.37	0.09310	N	1	P	0.51537	0.946	B	0.33799	0.17	T	0.47471	-0.9115	10	0.48119	T	0.1	.	6.5107	0.22220	0.1251:0.3073:0.4896:0.078	.	53	Q499Z4	ZN672_HUMAN	W	53	ENSP00000421915:R53W;ENSP00000427021:R53W	ENSP00000421915:R53W	R	+	1	2	ZNF672	247108253	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.375000	0.01071	-0.803000	0.04415	-0.150000	0.13652	CGG			0.632	ZNF672-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097125.2		NM_024836	
ADARB2	105	hgsc.bcm.edu	37	10	1578121	1578121	+	Intron	SNP	G	G	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:1578121G>C	ENST00000381312.1	-	2	426				ADARB2-AS1_ENST00000381301.3_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)						mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TCTCGTCCCAGTCTTTTCCTT	0.532																																					.													.	.			0			.																																									SO:0001627	intron_variant	642394	.			GTCCCAGTCTTTT	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.101-156766C>G	10.37:g.1578121G>C			Somatic	53	0	0		WXS	Illumina HiSeq	.	65	0.11	7	.	0		0	B2RPJ5|Q5VUT6|Q5VW42	RNA	SNP	ENST00000381312.1	37	CCDS7058.1																																																																																					0.532	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046426.1		NM_018702	
EXOSC1	51013	mdanderson.org	37	10	99196205	99196205	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:99196205G>T	ENST00000370902.3	-	8	616	c.585C>A	c.(583-585)acC>acA	p.T195T	EXOSC1_ENST00000370886.5_Silent_p.T178T|EXOSC1_ENST00000370885.4_Silent_p.T170T|EXOSC1_ENST00000471049.1_5'Flank|EXOSC1_ENST00000485122.2_3'UTR	NM_016046.3	NP_057130.1	Q9Y3B2	EXOS1_HUMAN	exosome component 1	195					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|lung(5)	7		Renal(717;0.000147)|Colorectal(252;0.00205)|Ovarian(717;0.00965)		all cancers(201;8.29e-42)|Epithelial(162;5.7e-33)|BRCA - Breast invasive adenocarcinoma(275;0.000315)|Kidney(138;0.000832)|KIRC - Kidney renal clear cell carcinoma(50;0.00269)|STAD - Stomach adenocarcinoma(243;0.202)		TGGCTTCTTAGGTCTGCAAGA	0.493																																					p.T195T													.	.			0			c.C585A												112.0	113.0	113.0					10																	99196205		2203	4300	6503	SO:0001819	synonymous_variant	51013	exon8			TTCTTAGGTCTGC	AF151866	CCDS7459.1	10q24	2004-03-26			ENSG00000171311	ENSG00000171311			17286	protein-coding gene	gene with protein product	"""CSL4 exosomal core protein homolog (yeast)"""	606493				11812149, 11719186	Standard	XR_246092		Approved	hCsl4p, Csl4p, CSL4, Ski4p, SKI4, CGI-108, p13	uc001kni.3	Q9Y3B2	OTTHUMG00000018854	ENST00000370902.3:c.585C>A	10.37:g.99196205G>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	75	0.07	5	NM_016046	170	0.00	0	B2R9B3|Q5JTH3	Silent	SNP	ENST00000370902.3	37	CCDS7459.1																																																																																					0.493	EXOSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049680.1			
LZTS2	84445	broad.mit.edu	37	10	102766682	102766682	+	Silent	SNP	T	T	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:102766682T>G	ENST00000370220.1	+	4	4830	c.1767T>G	c.(1765-1767)ggT>ggG	p.G589G	LZTS2_ENST00000370223.3_Silent_p.G589G					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GGCGGCGGGGTGAGGAGCAGC	0.682																																					p.G589G	Esophageal Squamous(8;38 437 13604 19902 37640)												.	LZTS2	57		0			c.T1767G												21.0	13.0	16.0					10																	102766682		2080	4135	6215	SO:0001819	synonymous_variant	84445	exon5			GCGGGGTGAGGAG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.1767T>G	10.37:g.102766682T>G			Somatic	83	0.1084337349	9		WXS	Illumina HiSeq	Phase_I	58	0.16	9	NM_032429	30	0.03	1		Silent	SNP	ENST00000370220.1	37	CCDS7507.1																																																																																					0.682	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049872.1		XM_046743	
COL17A1	1308	mdanderson.org	37	10	105810657	105810657	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:105810657G>T	ENST00000353479.5	-	26	2331	c.2041C>A	c.(2041-2043)Cct>Act	p.P681T	COL17A1_ENST00000369733.3_Missense_Mutation_p.P681T|MIR936_ENST00000401264.1_RNA	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	681	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AGACCTACAGGACCTGCCCGG	0.532																																					p.P681T													.	.			0			c.C2041A												94.0	83.0	87.0					10																	105810657		2203	4300	6503	SO:0001583	missense	1308	exon26			CTACAGGACCTGC	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2041C>A	10.37:g.105810657G>T	ENSP00000340937:p.Pro681Thr		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_000494	10	0.00	0	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899487	0.33535	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.96651	-4.08;-4.08	4.95	-9.89	0.00464	.	1.154430	0.06607	N	0.754895	D	0.92047	0.7480	L	0.55481	1.735	0.19300	N	0.999973	B	0.24823	0.112	B	0.22386	0.039	T	0.78196	-0.2298	10	0.17369	T	0.5	0.9497	11.2088	0.48786	0.1121:0.4517:0.4362:0.0	.	681	Q9UMD9	COHA1_HUMAN	T	681	ENSP00000340937:P681T;ENSP00000358748:P681T	ENSP00000340937:P681T	P	-	1	0	COL17A1	105800647	0.000000	0.05858	0.000000	0.03702	0.282000	0.26991	-1.308000	0.02730	-1.884000	0.01119	-0.302000	0.09304	CCT			0.532	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050181.1		NM_130778, NM_000494	
RBM20	282996	mdanderson.org	37	10	112404242	112404242	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:112404242C>A	ENST00000369519.3	+	1	88	c.30C>A	c.(28-30)gaC>gaA	p.D10E	Y_RNA_ENST00000411370.1_RNA	NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	10					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						TGAGCCAGGACGCGGACCCCA	0.756																																					p.D10E													.	.			0			c.C30A												4.0	8.0	7.0					10																	112404242		560	1445	2005	SO:0001583	missense	282996	exon1			CCAGGACGCGGAC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.30C>A	10.37:g.112404242C>A	ENSP00000358532:p.Asp10Glu		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_001134363	0		0	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059852	0.55325	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.89485	-2.52	4.23	3.25	0.37280	.	1.799340	0.03021	N	0.150725	T	0.82010	0.4944	N	0.14661	0.345	0.23528	N	0.997483	B	0.06786	0.001	B	0.06405	0.002	T	0.66988	-0.5784	10	0.33940	T	0.23	.	10.7698	0.46316	0.0:0.7867:0.2133:0.0	.	10	Q5T481	RBM20_HUMAN	E	10	ENSP00000358532:D10E	ENSP00000358532:D10E	D	+	3	2	RBM20	112394232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.125000	0.42016	1.889000	0.54706	0.561000	0.74099	GAC			0.756	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050339.2		NM_001134363	
KCNA4	3739	hgsc.bcm.edu;broad.mit.edu	37	11	30032345	30032347	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:30032345_30032347delCTC	ENST00000328224.6	-	2	3112_3114	c.1879_1881delGAG	c.(1879-1881)gagdel	p.E627del	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	627					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCTGACACTTCTCCTCCTTTGCA	0.458																																					p.627_628del													.	KCNA4	158		0			c.1880_1882del																																									SO:0001651	inframe_deletion	3739	exon2			ACACTTCTCCTCC	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1879_1881delGAG	11.37:g.30032348_30032350delCTC	ENSP00000328511:p.Glu627del		Somatic	169	0	0		WXS	Illumina HiSeq	.	88	0.48	42	NM_002233	0		0		In_Frame_Del	DEL	ENST00000328224.6	37	CCDS41629.1																																																																																					0.458	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388074.2		NM_002233	
FOLH1	2346	bcgsc.ca	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																					p.Y277Y													.	FOLH1	141		0			c.T831C												61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346	exon7			ATAAGCATATTCT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			Somatic	191	0.0104712042	2		WXS	Illumina HiSeq	Phase_1	134	0.02	3	NM_004476	0		0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																					0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390896.1		NM_004476	
TMEM258	746	mdanderson.org	37	11	61563052	61563052	+	5'Flank	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:61563052C>T	ENST00000537328.1	-	0	0				FADS2_ENST00000574708.1_Intron|FEN1_ENST00000305885.2_Silent_p.R73R|TMEM258_ENST00000543510.1_5'Flank	NM_014206.3	NP_055021.1	P61165	TM258_HUMAN	transmembrane protein 258							integral component of membrane (GO:0016021)											GCACCATTCGCATGATGGAGA	0.587																																					p.R73R													.	.			0			c.C219T												82.0	74.0	76.0					11																	61563052		2202	4299	6501	SO:0001631	upstream_gene_variant	2237	exon2			CATTCGCATGATG		CCDS8009.1	11q12.2	2012-12-03	2012-12-03	2012-12-03	ENSG00000134825	ENSG00000134825			1164	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 10"""	C11orf10		12427278	Standard	NM_014206		Approved		uc001nsf.3	P61165	OTTHUMG00000168172		11.37:g.61563052C>T	Exception_encountered		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_004111	108	0.00	0	A8K6L8|Q9D953|Q9Y2Q7	Silent	SNP	ENST00000537328.1	37	CCDS8009.1																																																																																					0.587	TMEM258-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398577.1		NM_014206	
ZBTB3	79842	mdanderson.org	37	11	62520426	62520426	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:62520426G>T	ENST00000394807.3	-	2	986	c.861C>A	c.(859-861)ggC>ggA	p.G287G		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	287	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						CTGCTGAGATGCCAGAAGAGA	0.542																																					p.G287G													.	.			0			c.C861A												63.0	58.0	60.0					11																	62520426		2202	4299	6501	SO:0001819	synonymous_variant	79842	exon2			TGAGATGCCAGAA	AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.861C>A	11.37:g.62520426G>T			Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_024784	7	0.00	0		Silent	SNP	ENST00000394807.3	37	CCDS8034.1																																																																																					0.542	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395342.1		NM_024784	
C11orf95	65998	mdanderson.org	37	11	63533337	63533337	+	lincRNA	SNP	C	C	T	rs373116664		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:63533337C>T	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							cctcttcttcctcctcctcct	0.667																																					p.E193E													.	.			0			c.G579A												23.0	19.0	20.0					11																	63533337		692	1591	2283			65998	exon2			TTCTTCCTCCTCC																													11.37:g.63533337C>T			Somatic	38	0.0263157895	1		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_001144936	0		0		Silent	SNP	ENST00000546282.2	37																																																																																						0.667	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000396567.2			
ANKRD13D	338692	mdanderson.org	37	11	67058987	67058987	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:67058987G>T	ENST00000447274.2	+	4	1306	c.131G>T	c.(130-132)aGc>aTc	p.S44I	ANKRD13D_ENST00000511455.2_Missense_Mutation_p.S131I|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.S44I|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.S44I			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	44						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GAGTTCACCAGCTGGGGTGAG	0.622																																					p.S131I													.	.			0			c.G392T												64.0	69.0	67.0					11																	67058987		2200	4295	6495	SO:0001583	missense	338692	exon4			TCACCAGCTGGGG	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.131G>T	11.37:g.67058987G>T	ENSP00000402616:p.Ser44Ile		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_207354	45	0.00	0	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	37		.	.	.	.	.	.	.	.	.	.	G	24.7	4.558018	0.86231	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.60672	0.17;0.43;0.17;0.17	4.48	3.48	0.39840	.	0.000000	0.85682	D	0.000000	T	0.78272	0.4257	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.74348	0.983;0.983	D	0.83365	0.0004	10	0.87932	D	0	-27.2285	13.1322	0.59389	0.0:0.0:0.8393:0.1606	.	131;44	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	I	44;131;44;44	ENSP00000402616:S44I;ENSP00000427130:S131I;ENSP00000310874:S44I;ENSP00000444404:S44I	ENSP00000310874:S44I	S	+	2	0	ANKRD13D	66815563	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.602000	0.98312	2.226000	0.72624	0.561000	0.74099	AGC			0.622	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000371067.2		NM_207354	
CNTN5	53942	bcgsc.ca	37	11	99944948	99944948	+	Missense_Mutation	SNP	T	T	C	rs200782641	byFrequency	TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:99944948T>C	ENST00000524871.1	+	13	1792	c.1502T>C	c.(1501-1503)aTa>aCa	p.I501T	CNTN5_ENST00000528682.1_Missense_Mutation_p.I501T|CNTN5_ENST00000279463.3_Missense_Mutation_p.I501T|CNTN5_ENST00000418526.2_Missense_Mutation_p.I427T|CNTN5_ENST00000527185.1_Missense_Mutation_p.I501T	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	501	Ig-like C2-type 5.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GAAGTTGTCATAGAGTGCAAA	0.358													T|||	3	0.000599042	0.0023	0.0	5008	,	,		17463	0.0		0.0	False		,,,				2504	0.0				p.I501T													.	CNTN5	324		0			c.T1502C							T	THR/ILE,THR/ILE	1,3683		0,1,1841	63.0	63.0	63.0		1502,1280	5.5	1.0	11		63	0,8168		0,0,4084	no	missense,missense	CNTN5	NM_014361.3,NM_175566.2	89,89	0,1,5925	CC,CT,TT		0.0,0.0271,0.0084	possibly-damaging,possibly-damaging	501/1101,427/1027	99944948	1,11851	1842	4084	5926	SO:0001583	missense	53942	exon12			TTGTCATAGAGTG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1502T>C	11.37:g.99944948T>C	ENSP00000435637:p.Ile501Thr		Somatic	503	0	0		WXS	Illumina HiSeq	Phase_1	178	0.00	0	NM_001243270	0		0	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	19.98	3.927043	0.73327	2.71E-4	0.0	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.51	5.51	0.81932	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.224852	0.46145	D	0.000306	T	0.77857	0.4193	M	0.91300	3.195	0.48236	D	0.999614	P;P;P	0.38863	0.65;0.454;0.65	B;B;B	0.43155	0.41;0.234;0.41	T	0.82798	-0.0279	10	0.87932	D	0	.	14.8585	0.70359	0.0:0.0:0.0:1.0	.	501;427;501	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	T	501;501;501;427;501	ENSP00000433575:I501T;ENSP00000436185:I501T;ENSP00000435637:I501T;ENSP00000393229:I427T;ENSP00000279463:I501T	ENSP00000279463:I501T	I	+	2	0	CNTN5	99450158	1.000000	0.71417	0.959000	0.39883	0.920000	0.55202	7.662000	0.83803	2.095000	0.63458	0.456000	0.33151	ATA			0.358	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395148.2		NM_014361	
NNMT	4837	mdanderson.org	37	11	114168839	114168839	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:114168839G>T	ENST00000535401.1	+	4	585	c.321G>T	c.(319-321)tgG>tgT	p.W107C	RP11-64D24.2_ENST00000544925.1_RNA|NNMT_ENST00000545255.1_5'Flank|NNMT_ENST00000299964.3_Missense_Mutation_p.W107C|NNMT_ENST00000542647.1_5'UTR|NNMT_ENST00000541754.1_5'UTR			P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	107					methylation (GO:0032259)|organ regeneration (GO:0031100)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	nicotinamide N-methyltransferase activity (GO:0008112)			kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	CCTTTGACTGGTCCCCAGTGG	0.493																																					p.W107C													.	.			0			c.G321T												119.0	123.0	122.0					11																	114168839		2201	4296	6497	SO:0001583	missense	4837	exon2			TGACTGGTCCCCA	U08021	CCDS8368.1	11q23.1	2007-08-15					2.1.1.1		7861	protein-coding gene	gene with protein product		600008				8575745	Standard	NM_006169		Approved		uc001pos.1	P40261		ENST00000535401.1:c.321G>T	11.37:g.114168839G>T	ENSP00000441434:p.Trp107Cys		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_006169	20	0.00	0		Missense_Mutation	SNP	ENST00000535401.1	37	CCDS8368.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397318	0.83120	.	.	ENSG00000166741	ENST00000535401;ENST00000299964	T;T	0.17054	2.3;2.3	5.53	5.53	0.82687	.	0.092204	0.47455	D	0.000225	T	0.51109	0.1655	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60342	-0.7282	10	0.87932	D	0	-6.7927	16.9627	0.86277	0.0:0.0:1.0:0.0	.	107	P40261	NNMT_HUMAN	C	107	ENSP00000441434:W107C;ENSP00000299964:W107C	ENSP00000299964:W107C	W	+	3	0	NNMT	113674049	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	6.583000	0.74053	2.604000	0.88044	0.557000	0.71058	TGG			0.493	NNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398951.1		NM_006169	
UBE4A	9354	mdanderson.org	37	11	118252157	118252157	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:118252157C>T	ENST00000431736.2	+	12	2021	c.1949C>T	c.(1948-1950)gCc>gTc	p.A650V	UBE4A_ENST00000545354.1_Missense_Mutation_p.A115V|UBE4A_ENST00000252108.3_Missense_Mutation_p.A643V					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CGCCGCTTTGCCGATGACATT	0.398																																					p.A650V													.	.			0			c.C1949T												196.0	184.0	188.0					11																	118252157		2200	4296	6496	SO:0001583	missense	9354	exon12			GCTTTGCCGATGA	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.1949C>T	11.37:g.118252157C>T	ENSP00000387362:p.Ala650Val		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_004788	0		0		Missense_Mutation	SNP	ENST00000431736.2	37	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	C	32	5.126076	0.94429	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	T;T;T	0.65916	-0.18;-0.18;0.93	6.17	6.17	0.99709	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.73953	0.3653	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.993;0.999	P;D	0.68943	0.824;0.961	T	0.63834	-0.6547	10	0.13853	T	0.58	-10.6547	20.8794	0.99867	0.0:1.0:0.0:0.0	.	643;650	Q14139;Q14139-2	UBE4A_HUMAN;.	V	643;650;115	ENSP00000252108:A643V;ENSP00000387362:A650V;ENSP00000438918:A115V	ENSP00000252108:A643V	A	+	2	0	UBE4A	117757367	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCC			0.398	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000398143.1		NM_004788	
NTM	50863	broad.mit.edu	37	11	132180057	132180057	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:132180057A>G	ENST00000374786.1	+	5	1192	c.713A>G	c.(712-714)aAg>aGg	p.K238R	NTM_ENST00000374791.3_Missense_Mutation_p.K238R|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374784.1_Missense_Mutation_p.K238R|NTM_ENST00000427481.2_Missense_Mutation_p.K229R|NTM_ENST00000539799.1_Missense_Mutation_p.K238R|NTM_ENST00000425719.2_Missense_Mutation_p.K238R	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	238	Ig-like C2-type 3.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GTGGGACAAAAGGGGACACTG	0.493																																					p.K238R													.	NTM	253		0			c.A713G												149.0	148.0	148.0					11																	132180057		2201	4297	6498	SO:0001583	missense	50863	exon5			GACAAAAGGGGAC	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.713A>G	11.37:g.132180057A>G	ENSP00000363918:p.Lys238Arg		Somatic	307	0	0		WXS	Illumina HiSeq	Phase_I	105	0.04	4	NM_001144059	0		0	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	A	13.43	2.234499	0.39498	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	6.07	4.93	0.64822	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.043596	0.85682	D	0.000000	T	0.45438	0.1342	N	0.11756	0.17	0.46499	D	0.999077	B;B;B;B;B;B	0.18013	0.025;0.025;0.002;0.009;0.003;0.004	B;B;B;B;B;B	0.18263	0.021;0.012;0.007;0.012;0.007;0.007	T	0.30794	-0.9966	10	0.31617	T	0.26	-17.7856	8.1243	0.30988	0.7969:0.1363:0.0669:0.0	.	238;229;238;238;238;238	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	R	238;238;229;238;238;238	ENSP00000363923:K238R;ENSP00000437668:K238R;ENSP00000416320:K229R;ENSP00000363918:K238R;ENSP00000396722:K238R;ENSP00000363916:K238R	ENSP00000363916:K238R	K	+	2	0	NTM	131685267	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	4.196000	0.58407	1.096000	0.41439	0.533000	0.62120	AAG			0.493	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000141937.1		NM_016522	
KRAS	3845	bcgsc.ca	37	12	25380275	25380275	+	Missense_Mutation	SNP	T	T	A	rs17851045		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:25380275T>A	ENST00000256078.4	-	3	246	c.183A>T	c.(181-183)caA>caT	p.Q61H	KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61H(153)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGTACTCCTCTTGACCTGCTG	0.423	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.Q61H	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,colon,carcinoma,0,429	KRAS	30930	429	153	Substitution - Missense(153)	large_intestine(74)|lung(26)|pancreas(18)|haematopoietic_and_lymphoid_tissue(9)|endometrium(7)|soft_tissue(3)|biliary_tract(3)|liver(3)|cervix(2)|skin(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)|NS(1)	c.A183T												109.0	98.0	102.0					12																	25380275		2203	4300	6503	SO:0001583	missense	3845	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CTCCTCTTGACCT	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.183A>T	12.37:g.25380275T>A	ENSP00000256078:p.Gln61His		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_1	193	0.00	0	NM_004985	115	0.00	0	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243092	0.79912	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.84146	-1.81;-1.81	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.87265	0.6134	M	0.91140	3.18	0.80722	D	1	B;B	0.33413	0.411;0.09	B;B	0.32724	0.092;0.151	D	0.87829	0.2643	10	0.72032	D	0.01	.	9.9836	0.41828	0.0:0.0752:0.0:0.9248	rs17851045	61;61	P01116-2;P01116	.;RASK_HUMAN	H	61	ENSP00000308495:Q61H;ENSP00000256078:Q61H	ENSP00000256078:Q61H	Q	-	3	2	KRAS	25271542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.240000	0.43088	2.326000	0.78906	0.533000	0.62120	CAA			0.423	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
BICD1	636	broad.mit.edu	37	12	32369349	32369349	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:32369349G>A	ENST00000281474.5	+	2	485	c.382G>A	c.(382-384)Gca>Aca	p.A128T	BICD1_ENST00000548411.1_Missense_Mutation_p.A128T	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	128					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TAATGTACAGGCAGAAAACGA	0.478																																					p.A128T													.	BICD1	89		0			c.G382A												94.0	85.0	88.0					12																	32369349		2203	4300	6503	SO:0001583	missense	636	exon2			GTACAGGCAGAAA	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.382G>A	12.37:g.32369349G>A	ENSP00000281474:p.Ala128Thr		Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	205	0.02	4	NM_001714	123	0.00	0	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508414	0.85282	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.27890	1.64;1.64	5.58	4.69	0.59074	.	0.061362	0.64402	N	0.000004	T	0.43277	0.1240	L	0.59436	1.845	0.80722	D	1	P;P	0.52842	0.705;0.956	B;P	0.55545	0.439;0.778	T	0.21484	-1.0244	10	0.23302	T	0.38	.	14.1968	0.65677	0.0714:0.0:0.9286:0.0	.	128;128	F8W113;Q96G01	.;BICD1_HUMAN	T	128	ENSP00000446793:A128T;ENSP00000281474:A128T	ENSP00000281474:A128T	A	+	1	0	BICD1	32260616	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	5.304000	0.65744	1.359000	0.45940	0.655000	0.94253	GCA			0.478	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403380.1		NM_001714	
FGD4	121512	bcgsc.ca	37	12	32786595	32786599	+	Frame_Shift_Del	DEL	AAGAA	AAGAA	-	rs139663812		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	AAGAA	AAGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:32786595_32786599delAAGAA	ENST00000427716.2	+	15	2298_2302	c.1874_1878delAAGAA	c.(1873-1878)gaagaafs	p.EE625fs	FGD4_ENST00000534526.2_Frame_Shift_Del_p.EE762fs|FGD4_ENST00000266482.3_Frame_Shift_Del_p.EE377fs|FGD4_ENST00000525053.1_Frame_Shift_Del_p.EE737fs|FGD4_ENST00000546442.1_Frame_Shift_Del_p.EE532fs|FGD4_ENST00000531134.1_Frame_Shift_Del_p.EE710fs	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	625					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					ACAGACAGTGAAGAAAAGAAAAGAA	0.341																																					p.625_626del													.	FGD4	86		0			c.1874_1878del																																									SO:0001589	frameshift_variant	121512	exon15			ACAGTGAAGAAAA	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1874_1878delAAGAA	12.37:g.32786605_32786609delAAGAA	ENSP00000394487:p.Glu625fs		Somatic	116	0	0		WXS	Illumina HiSeq	Phase_1	215	0.00	0	NM_139241	38	0.00	0	Q6ULS2|Q8TCP6	Frame_Shift_Del	DEL	ENST00000427716.2	37	CCDS8727.1																																																																																					0.341	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268017.1		NM_139241	
NELL2	4753	bcgsc.ca	37	12	45173782	45173782	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:45173782C>T	ENST00000429094.2	-	4	863	c.359G>A	c.(358-360)gGc>gAc	p.G120D	NELL2_ENST00000549027.1_Missense_Mutation_p.G119D|NELL2_ENST00000547172.1_5'UTR|NELL2_ENST00000395487.2_Missense_Mutation_p.G119D|NELL2_ENST00000333837.4_Missense_Mutation_p.G143D|NELL2_ENST00000551601.1_Missense_Mutation_p.G119D|NELL2_ENST00000437801.2_Missense_Mutation_p.G170D|NELL2_ENST00000452445.2_Missense_Mutation_p.G120D	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	120	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ATTCCGATGGCCACTACTTTC	0.468																																					p.G170D													NELL2_ENST00000437801,NS,carcinoma,-1,2	NELL2	286	2	0			c.G509A												138.0	128.0	131.0					12																	45173782		2203	4300	6503	SO:0001583	missense	4753	exon5			CGATGGCCACTAC	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.359G>A	12.37:g.45173782C>T	ENSP00000390680:p.Gly120Asp		Somatic	177	0	0		WXS	Illumina HiSeq	Phase_1	217	0.00	0	NM_001145107	1	0.00	0	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	C	33	5.224369	0.95139	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684;ENST00000552993;ENST00000553120	T;T;T;T;T;T;T;T;T	0.02682	4.2;4.2;4.2;4.2;4.2;4.2;4.2;4.2;4.2	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.098980	0.64402	D	0.000001	T	0.18257	0.0438	M	0.79926	2.475	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.997;0.991;1.0;0.99;0.995	T	0.00133	-1.2010	10	0.87932	D	0	-20.8972	19.4004	0.94627	0.0:1.0:0.0:0.0	.	143;170;119;120;120;119	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.;.;.;.;NELL2_HUMAN;.	D	119;120;119;120;119;143;170;119;120;117	ENSP00000378866:G119D;ENSP00000390680:G120D;ENSP00000449332:G119D;ENSP00000394612:G120D;ENSP00000447927:G119D;ENSP00000327988:G143D;ENSP00000416341:G170D;ENSP00000447085:G120D;ENSP00000447384:G117D	ENSP00000327988:G143D	G	-	2	0	NELL2	43460049	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.771000	0.85420	2.577000	0.86979	0.655000	0.94253	GGC			0.468	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404180.1		NM_006159	
MYO1A	4640	mdanderson.org	37	12	57432204	57432204	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:57432204G>T	ENST00000442789.2	-	18	2039	c.1752C>A	c.(1750-1752)aaC>aaA	p.N584K	MYO1A_ENST00000476795.1_5'Flank|MYO1A_ENST00000544473.1_Missense_Mutation_p.N422K|MYO1A_ENST00000300119.3_Missense_Mutation_p.N584K	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	584	Actin-binding. {ECO:0000255}.|Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						ACCTGATGTAGTTGGGGCTCT	0.547																																					p.N584K													.	.			0			c.C1752A												51.0	47.0	48.0					12																	57432204		2203	4300	6503	SO:0001583	missense	4640	exon17			GATGTAGTTGGGG	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.1752C>A	12.37:g.57432204G>T	ENSP00000393392:p.Asn584Lys		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	79	0.06	5	NM_005379	2	0.00	0	Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	37	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767321	0.69878	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.71341	-0.56;-0.56;-0.56	4.94	3.11	0.35812	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.83128	0.5187	M	0.84511	2.7	0.46499	D	0.999073	D	0.89917	1.0	D	0.87578	0.998	T	0.82504	-0.0424	10	0.52906	T	0.07	.	9.8519	0.41061	0.1714:0.0:0.8286:0.0	.	584	Q9UBC5	MYO1A_HUMAN	K	584;584;422	ENSP00000300119:N584K;ENSP00000393392:N584K;ENSP00000440514:N422K	ENSP00000300119:N584K	N	-	3	2	MYO1A	55718471	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.581000	0.53914	0.621000	0.30232	0.561000	0.74099	AAC			0.547	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313833.2		NM_005379	
FRS2	10818	bcgsc.ca	37	12	69964184	69964184	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:69964184T>C	ENST00000550389.1	+	4	386	c.140T>C	c.(139-141)tTa>tCa	p.L47S	FRS2_ENST00000397997.2_Missense_Mutation_p.L47S|FRS2_ENST00000299293.2_Missense_Mutation_p.L47S|FRS2_ENST00000549921.1_Missense_Mutation_p.L47S	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	47	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GAACTGATTTTATACACCCGC	0.423																																					p.L47S													.	FRS2	88		0			c.T140C												164.0	155.0	158.0					12																	69964184		2003	4177	6180	SO:0001583	missense	10818	exon7			TGATTTTATACAC	AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.140T>C	12.37:g.69964184T>C	ENSP00000447241:p.Leu47Ser		Somatic	179	0	0		WXS	Illumina HiSeq	Phase_1	228	0.00	0	NM_001042555	18	0.00	0	B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	ENST00000550389.1	37	CCDS41809.1	.	.	.	.	.	.	.	.	.	.	T	31	5.090819	0.94149	.	.	ENSG00000166225	ENST00000299293;ENST00000549921;ENST00000547414;ENST00000550389;ENST00000550937;ENST00000397997;ENST00000551325	D;D;D;D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88	5.77	5.77	0.91146	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.96614	0.8895	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97042	0.9758	9	.	.	.	-12.1411	16.0903	0.81086	0.0:0.0:0.0:1.0	.	47	Q8WU20	FRS2_HUMAN	S	47;47;10;47;47;47;47	ENSP00000299293:L47S;ENSP00000450048:L47S;ENSP00000447007:L10S;ENSP00000447241:L47S;ENSP00000447804:L47S;ENSP00000381083:L47S;ENSP00000449432:L47S	.	L	+	2	0	FRS2	68250451	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.994000	0.88315	2.202000	0.70862	0.459000	0.35465	TTA			0.423	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403760.1		NM_006654	
E2F7	144455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	77449732	77449732	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:77449732A>C	ENST00000322886.7	-	3	507	c.272T>G	c.(271-273)aTt>aGt	p.I91S	E2F7_ENST00000416496.2_Missense_Mutation_p.I91S	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	91					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						GGCAGCACTAATGAGCATCTT	0.438																																					p.I91S													.	.			0			c.T272G												156.0	151.0	152.0					12																	77449732		2203	4300	6503	SO:0001583	missense	144455	exon3			GCACTAATGAGCA	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.272T>G	12.37:g.77449732A>C	ENSP00000323246:p.Ile91Ser		Somatic	151	0	0		WXS	Illumina HiSeq	.	224	0.19	43	NM_203394	7	0.43	3	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	37	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.781295	0.90282	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669;ENST00000547316	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.92861	0.7729	M	0.78456	2.415	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.68192	0.956;0.905	D	0.93132	0.6534	10	0.52906	T	0.07	-19.2963	15.1519	0.72706	1.0:0.0:0.0:0.0	.	91;91	F8VSE7;Q96AV8	.;E2F7_HUMAN	S	91	ENSP00000323246:I91S;ENSP00000393639:I91S;ENSP00000448245:I91S;ENSP00000449033:I91S	ENSP00000323246:I91S	I	-	2	0	E2F7	75973863	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.167000	0.68274	0.528000	0.53228	ATT			0.438	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406716.1		XM_084871	
C12orf65	91574	bcgsc.ca	37	12	123741505	123741505	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:123741505A>C	ENST00000253233.1	+	3	1072	c.428A>C	c.(427-429)aAa>aCa	p.K143T	C12orf65_ENST00000429587.2_Missense_Mutation_p.K143T|RP11-282O18.3_ENST00000543217.2_RNA|RP11-282O18.3_ENST00000544890.1_RNA|RP11-282O18.3_ENST00000541002.3_RNA|RP11-282O18.3_ENST00000542427.2_RNA|C12orf65_ENST00000366329.2_Missense_Mutation_p.K143T	NM_152269.4	NP_689482.1	Q9H3J6	CL065_HUMAN	chromosome 12 open reading frame 65	143					cell death (GO:0008219)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000595)|Epithelial(86;0.00199)		gaaaggaaaaaaagagcaaag	0.363																																					p.K143T													.	C12orf65	15		0			c.A428C												50.0	58.0	56.0					12																	123741505		2203	4300	6503	SO:0001583	missense	91574	exon3			GGAAAAAAAGAGC	AK095982	CCDS9244.1	12q24.31	2013-01-07			ENSG00000130921	ENSG00000130921			26784	protein-coding gene	gene with protein product		613541				20598281, 22688947, 23188110	Standard	NM_152269		Approved	FLJ38663, SPG55	uc001uen.3	Q9H3J6	OTTHUMG00000168852	ENST00000253233.1:c.428A>C	12.37:g.123741505A>C	ENSP00000253233:p.Lys143Thr		Somatic	199	0	0		WXS	Illumina HiSeq	Phase_1	207	0.00	0	NM_001194995	127	0.00	0	Q8WUC6	Missense_Mutation	SNP	ENST00000253233.1	37	CCDS9244.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.566371	0.45694	.	.	ENSG00000130921	ENST00000253233;ENST00000366329;ENST00000429587	T;T;T	0.11495	2.77;2.77;2.77	5.86	0.954	0.19595	Peptide chain release factor class I/class II (1);	0.319616	0.38217	N	0.001765	T	0.18087	0.0434	L	0.60067	1.865	0.23813	N	0.996772	D	0.54601	0.967	P	0.54759	0.76	T	0.04140	-1.0974	10	0.87932	D	0	-11.88	8.2243	0.31560	0.6735:0.0:0.3265:0.0	.	143	Q9H3J6	CL065_HUMAN	T	143	ENSP00000253233:K143T;ENSP00000390647:K143T;ENSP00000391513:K143T	ENSP00000253233:K143T	K	+	2	0	C12orf65	122307458	0.991000	0.36638	0.791000	0.31998	0.897000	0.52465	0.723000	0.25939	0.140000	0.18849	-0.262000	0.10625	AAA			0.363	C12orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401375.1		NM_152269	
SCARB1	949	mdanderson.org	37	12	125270941	125270941	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:125270941G>T	ENST00000415380.2	-	11	1488	c.1363C>A	c.(1363-1365)Ctg>Atg	p.L455M	SCARB1_ENST00000376788.1_Missense_Mutation_p.L355M|SCARB1_ENST00000546215.1_Intron|SCARB1_ENST00000339570.5_Missense_Mutation_p.L455M|SCARB1_ENST00000540495.1_Missense_Mutation_p.L418M|SCARB1_ENST00000544327.1_Missense_Mutation_p.L401M|SCARB1_ENST00000261693.6_Missense_Mutation_p.L455M|SCARB1_ENST00000541205.1_Missense_Mutation_p.L414M|SCARB1_ENST00000535005.1_5'UTR			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	455					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	ACCAGCAGCAGGACGCAGCCC	0.612																																					p.L455M													.	.			0			c.C1363A												151.0	129.0	137.0					12																	125270941		2203	4300	6503	SO:0001583	missense	949	exon11			GCAGCAGGACGCA	Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.1363C>A	12.37:g.125270941G>T	ENSP00000414979:p.Leu455Met		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_005505	35	0.00	0	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	ENST00000415380.2	37		.	.	.	.	.	.	.	.	.	.	G	10.01	1.234007	0.22626	.	.	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000541205;ENST00000544327;ENST00000540495	T;T;T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	5.35	4.26	0.50523	.	0.356351	0.30890	N	0.008669	T	0.80571	0.4648	L	0.58969	1.84	0.33185	D	0.550042	D;D;D;D;D	0.67145	0.996;0.996;0.996;0.996;0.98	D;D;D;D;P	0.65010	0.93;0.93;0.93;0.931;0.837	T	0.82892	-0.0232	10	0.35671	T	0.21	-31.2887	11.8949	0.52652	0.0986:0.0:0.9014:0.0	.	414;455;455;455;455	B3KW46;B4E3I1;Q8WTV0;F8W8N0;Q8WTV0-2	.;.;SCRB1_HUMAN;.;.	M	455;455;455;355;414;401;418	ENSP00000343795:L455M;ENSP00000414979:L455M;ENSP00000261693:L455M;ENSP00000365984:L355M;ENSP00000446107:L414M;ENSP00000444851:L401M;ENSP00000443286:L418M	ENSP00000261693:L455M	L	-	1	2	SCARB1	123836894	0.967000	0.33354	0.962000	0.40283	0.013000	0.08279	1.800000	0.38833	2.509000	0.84616	0.555000	0.69702	CTG			0.612	SCARB1-006	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000400165.1		NM_005505	
NAA16	79612	bcgsc.ca	37	13	41894924	41894924	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr13:41894924G>T	ENST00000379406.3	+	4	690	c.366G>T	c.(364-366)ctG>ctT	p.L122L	NAA16_ENST00000379367.3_Silent_p.L122L|NAA16_ENST00000403412.3_Silent_p.L122L	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	122					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						ATCTCTCACTGTTGCAGATCC	0.343																																					p.L122L													.	NAA16	74		0			c.G366T												63.0	63.0	63.0					13																	41894924		2203	4300	6503	SO:0001819	synonymous_variant	79612	exon4			CTCACTGTTGCAG	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.366G>T	13.37:g.41894924G>T			Somatic	96	0	0		WXS	Illumina HiSeq	Phase_1	75	0.01	1	NM_001110798	5	0.00	0	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Silent	SNP	ENST00000379406.3	37	CCDS9379.1																																																																																					0.343	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044672.2		NM_018527	
SCEL	8796	mdanderson.org	37	13	78142455	78142455	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr13:78142455G>T	ENST00000349847.3	+	7	469	c.385G>T	c.(385-387)Gaa>Taa	p.E129*	SCEL_ENST00000535157.1_Nonsense_Mutation_p.E129*|SCEL_ENST00000377246.3_Nonsense_Mutation_p.E129*	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	129					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TAGATCACTGGAAGTAACAAA	0.323																																					p.E129X													.	.			0			c.G385T												134.0	128.0	130.0					13																	78142455		2203	4299	6502	SO:0001587	stop_gained	8796	exon7			TCACTGGAAGTAA	AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.385G>T	13.37:g.78142455G>T	ENSP00000302579:p.Glu129*		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001160706	0		0	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Nonsense_Mutation	SNP	ENST00000349847.3	37	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.589011	0.46110	.	.	ENSG00000136155	ENST00000348770;ENST00000535157;ENST00000377246;ENST00000349847	.	.	.	5.64	3.87	0.44632	.	0.866460	0.10111	N	0.714687	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-3.6796	12.8667	0.57944	0.0:0.3115:0.6885:0.0	.	.	.	.	X	106;129;129;129	.	ENSP00000315127:E106X	E	+	1	0	SCEL	77040456	0.399000	0.25287	0.014000	0.15608	0.018000	0.09664	2.982000	0.49337	0.704000	0.31869	0.650000	0.86243	GAA			0.323	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000045339.2		NM_144777	
EFNB2	1948	mdanderson.org	37	13	107145463	107145463	+	Silent	SNP	G	G	T	rs7995379		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr13:107145463G>T	ENST00000245323.4	-	5	1076	c.927C>A	c.(925-927)ggC>ggA	p.G309G		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	309					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					GCCCGTAGTCGCCGCTGACCT	0.602																																					p.G309G													EFNB2,NS,carcinoma,-2,2	EFNB2	-2	2	0			c.C927A												90.0	73.0	79.0					13																	107145463		2203	4300	6503	SO:0001819	synonymous_variant	1948	exon5			GTAGTCGCCGCTG	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.927C>A	13.37:g.107145463G>T			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	46	0.04	2	NM_004093	3	0.00	0	Q5JV56	Silent	SNP	ENST00000245323.4	37	CCDS9507.1																																																																																					0.602	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045733.4		NM_004093	
UNC79	57578	broad.mit.edu	37	14	94120138	94120138	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr14:94120138G>A	ENST00000393151.2	+	37	6251	c.6251G>A	c.(6250-6252)tGc>tAc	p.C2084Y	UNC79_ENST00000555664.1_Missense_Mutation_p.C2045Y|UNC79_ENST00000256339.4_Missense_Mutation_p.C1907Y|UNC79_ENST00000553484.1_Missense_Mutation_p.C2106Y			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2084					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TTCCTGCGCTGCATCTTCCAT	0.557																																					p.C1907Y													.	UNC79	366		0			c.G5720A												182.0	185.0	184.0					14																	94120138		2203	4300	6503	SO:0001583	missense	57578	exon37			TGCGCTGCATCTT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6251G>A	14.37:g.94120138G>A	ENSP00000376858:p.Cys2084Tyr		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	142	0.04	5	NM_020818	2	0.00	0	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	G	25.7	4.668160	0.88348	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.18	5.18	0.71444	.	0.045927	0.85682	D	0.000000	T	0.57315	0.2045	M	0.71036	2.16	0.58432	D	0.999994	D	0.69078	0.997	D	0.81914	0.995	T	0.60835	-0.7184	10	0.87932	D	0	-12.2687	19.0903	0.93224	0.0:0.0:1.0:0.0	.	2106	C9JQL1	.	Y	1907;2045;2106;2084;2106	ENSP00000256339:C1907Y;ENSP00000450868:C2045Y;ENSP00000451360:C2106Y;ENSP00000376858:C2084Y	ENSP00000256339:C1907Y	C	+	2	0	KIAA1409	93189891	1.000000	0.71417	0.991000	0.47740	0.956000	0.61745	9.813000	0.99286	2.572000	0.86782	0.655000	0.94253	TGC			0.557	UNC79-006	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000412766.1		XM_028395	
ATG2B	55102	broad.mit.edu	37	14	96781835	96781835	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr14:96781835G>T	ENST00000359933.4	-	22	4340	c.3447C>A	c.(3445-3447)tcC>tcA	p.S1149S		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1149					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CTTCTTCAGAGGAATAAATAG	0.438																																					p.S1149S													.	ATG2B	169		0			c.C3447A												46.0	47.0	47.0					14																	96781835		2203	4300	6503	SO:0001819	synonymous_variant	55102	exon22			TTCAGAGGAATAA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.3447C>A	14.37:g.96781835G>T			Somatic	346	0.0028901734	1		WXS	Illumina HiSeq	Phase_I	390	0.01	5	NM_018036	3	0.00	0	Q6ZRE7|Q96DQ3|Q9NW80	Silent	SNP	ENST00000359933.4	37	CCDS9944.2																																																																																					0.438	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314037.1		NM_018036	
ZNF592	9640	broad.mit.edu	37	15	85345188	85345188	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr15:85345188T>C	ENST00000560079.2	+	11	3656	c.3368T>C	c.(3367-3369)cTt>cCt	p.L1123P	ZNF592_ENST00000299927.3_Missense_Mutation_p.L1123P	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1123					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CACAAGTCCCTTTTTCAGTGC	0.537																																					p.L1123P													.	ZNF592	95		0			c.T3368C												64.0	62.0	63.0					15																	85345188		2203	4296	6499	SO:0001583	missense	9640	exon11			AGTCCCTTTTTCA	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3368T>C	15.37:g.85345188T>C	ENSP00000452877:p.Leu1123Pro		Somatic	393	0.0050890585	2		WXS	Illumina HiSeq	Phase_I	320	0.02	5	NM_014630	47	0.00	0	Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.510643	0.44660	.	.	ENSG00000166716	ENST00000299927	T	0.00620	6.17	5.62	5.62	0.85841	.	0.386938	0.28125	N	0.016513	T	0.00384	0.0012	N	0.00670	-1.27	0.80722	D	1	P	0.47253	0.892	B	0.43478	0.421	D	0.89295	0.3622	10	0.30078	T	0.28	-6.066	13.7759	0.63053	0.0:0.0:0.0:1.0	.	1123	Q92610	ZN592_HUMAN	P	1123	ENSP00000299927:L1123P	ENSP00000299927:L1123P	L	+	2	0	ZNF592	83146192	0.902000	0.30710	0.998000	0.56505	0.992000	0.81027	1.987000	0.40687	2.139000	0.66308	0.533000	0.62120	CTT			0.537	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418779.2		NM_014630	
ZC3H7A	29066	bcgsc.ca	37	16	11859005	11859005	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:11859005C>G	ENST00000396516.2	-	14	1921	c.1724G>C	c.(1723-1725)tGt>tCt	p.C575S	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.C575S			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	575						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						ATGATCAAAACATTTCTGGAA	0.269																																					p.C575S													.	ZC3H7A	72		0			c.G1724C												58.0	58.0	58.0					16																	11859005		2197	4294	6491	SO:0001583	missense	29066	exon15			TCAAAACATTTCT	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1724G>C	16.37:g.11859005C>G	ENSP00000379773:p.Cys575Ser		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_1	123	0.00	0	NM_014153	11	0.00	0	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637210	0.87760	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.66815	-0.23;-0.23	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.82332	0.5014	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.83925	0.0303	10	0.87932	D	0	.	18.5622	0.91104	0.0:1.0:0.0:0.0	.	296;575	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	S	575	ENSP00000347999:C575S;ENSP00000379773:C575S	ENSP00000347999:C575S	C	-	2	0	ZC3H7A	11766506	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.687000	0.84139	2.689000	0.91719	0.591000	0.81541	TGT			0.269	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437066.1		NM_014153	
HIRIP3	8479	broad.mit.edu	37	16	30005338	30005338	+	Silent	SNP	T	T	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:30005338T>C	ENST00000279392.3	-	4	1958	c.1128A>G	c.(1126-1128)ggA>ggG	p.G376G	INO80E_ENST00000567705.1_5'Flank|INO80E_ENST00000563197.1_5'Flank|HIRIP3_ENST00000566471.1_5'Flank|INO80E_ENST00000304516.7_5'Flank|HIRIP3_ENST00000564026.1_Intron|INO80E_ENST00000567254.1_5'Flank	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	376					chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						CCTGGGGGCCTCCCCCTGCCT	0.582																																					p.G376G													.	HIRIP3	45		0			c.A1128G												97.0	87.0	90.0					16																	30005338		2197	4300	6497	SO:0001819	synonymous_variant	8479	exon4			GGGGCCTCCCCCT	AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.1128A>G	16.37:g.30005338T>C			Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	120	0.05	6	NM_003609	37	0.00	0	H3BSR3|O75707|O75708	Silent	SNP	ENST00000279392.3	37	CCDS10664.1																																																																																					0.582	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255160.2		NM_003609	
GPT2	84706	bcgsc.ca	37	16	46918656	46918656	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:46918656G>C	ENST00000340124.4	+	2	141	c.29G>C	c.(28-30)cGg>cCg	p.R10P	GPT2_ENST00000440783.2_5'Flank	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	10					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	CTGGTCCGGCGGGGCTGTGGT	0.721																																					p.R10P													.	GPT2	40		0			c.G29C												14.0	18.0	17.0					16																	46918656		1389	3029	4418	SO:0001583	missense	84706	exon2			TCCGGCGGGGCTG		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.29G>C	16.37:g.46918656G>C	ENSP00000345282:p.Arg10Pro		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_1	53	0.00	0	NM_133443	9	0.00	0	Q8N9E2	Missense_Mutation	SNP	ENST00000340124.4	37	CCDS10725.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563643	0.45694	.	.	ENSG00000166123	ENST00000340124	D	0.82984	-1.67	4.9	3.93	0.45458	.	0.512331	0.17159	N	0.184779	T	0.70868	0.3273	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.65113	-0.6247	10	0.44086	T	0.13	.	8.7685	0.34717	0.0:0.2197:0.6294:0.151	.	10	Q8TD30	ALAT2_HUMAN	P	10	ENSP00000345282:R10P	ENSP00000345282:R10P	R	+	2	0	GPT2	45476157	0.999000	0.42202	1.000000	0.80357	0.773000	0.43773	0.638000	0.24674	1.160000	0.42584	0.297000	0.19635	CGG			0.721	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255741.2			
SGSM2	9905	mdanderson.org	37	17	2266157	2266157	+	Silent	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:2266157C>T	ENST00000426855.2	+	5	659	c.484C>T	c.(484-486)Ctg>Ttg	p.L162L	SGSM2_ENST00000574563.1_Silent_p.L162L|SGSM2_ENST00000268989.3_Silent_p.L162L	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	162	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		GGAGGCACTGCTGGCAGACCC	0.617																																					p.L162L													.	.			0			c.C484T												90.0	84.0	86.0					17																	2266157		2203	4300	6503	SO:0001819	synonymous_variant	9905	exon5			GCACTGCTGGCAG	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.484C>T	17.37:g.2266157C>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001098509	9	0.00	0	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	ENST00000426855.2	37	CCDS45570.1																																																																																					0.617	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438186.1		NM_014853	
PIGW	284098	mdanderson.org	37	17	34893834	34893834	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:34893834G>T	ENST00000592983.1	+	2	1464	c.884G>T	c.(883-885)cGg>cTg	p.R295L	PIGW_ENST00000328396.2_Missense_Mutation_p.R295L|MYO19_ENST00000590081.1_Intron			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	295					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGTGGCACACGGGTTGGTCTA	0.443																																					p.R295L													.	.			0			c.G884T												79.0	79.0	79.0					17																	34893834		2203	4300	6503	SO:0001583	missense	284098	exon2			GCACACGGGTTGG	AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.884G>T	17.37:g.34893834G>T	ENSP00000468778:p.Arg295Leu		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_178517	8	0.00	0	Q8N9G3	Missense_Mutation	SNP	ENST00000592983.1	37	CCDS11313.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805389	0.70682	.	.	ENSG00000184886	ENST00000328396	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	T	0.50922	0.1644	N	0.08118	0	0.44789	D	0.997794	D	0.71674	0.998	P	0.62298	0.9	T	0.53194	-0.8473	8	.	.	.	-7.4769	18.2414	0.89968	0.0:0.0:1.0:0.0	.	295	Q7Z7B1	PIGW_HUMAN	L	295	.	.	R	+	2	0	PIGW	31967947	0.998000	0.40836	0.995000	0.50966	0.952000	0.60782	3.945000	0.56637	2.619000	0.88677	0.561000	0.74099	CGG			0.443	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451318.1		NM_178517	
KRTAP4-11	653240	broad.mit.edu	37	17	39274205	39274206	+	Missense_Mutation	DNP	TC	TC	CT	rs79388709|rs80322614	byFrequency	TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:39274205_39274206TC>CT	ENST00000391413.2	-	1	400_401	c.362_363GA>AG	c.(361-363)aGA>aAG	p.R121K		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.R121K(5)|p.R121R(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcactggggtctgcagcagct	0.649																																					p.R121K													KRTAP4-11,NS,carcinoma,0,9	KRTAP4-11	94	9	6	Substitution - Missense(5)|Substitution - coding silent(1)	lung(2)|prostate(2)|kidney(1)|skin(1)	c.G362A																																									SO:0001583	missense	653240	exon1			CTGGGGTCTGCAG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.362_363delinsCT	17.37:g.39274205_39274206delinsCT	ENSP00000375232:p.Arg121Lys		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	34	0.18	6	NM_033059	0		0	A0AUY2	Missense_Mutation	DNP	ENST00000391413.2	37	CCDS45675.1																																																																																					0.649	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257690.1			
WNT3	7473	broad.mit.edu	37	17	44851046	44851046	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:44851046C>T	ENST00000225512.5	-	2	472	c.310G>A	c.(310-312)Gtc>Atc	p.V104I		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	104					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			TTGTCGAGGACGGGCCCAAAG	0.667																																					p.R104S													.	WNT3	34		0			c.C310A												27.0	31.0	29.0					17																	44851046		2203	4300	6503	SO:0001583	missense	7473	exon2			CGAGGACGGGCCC	AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.310G>A	17.37:g.44851046C>T	ENSP00000225512:p.Val104Ile		Somatic	230	0	0		WXS	Illumina HiSeq	Phase_I	156	0.03	5	NM_030753	10	0.00	0	Q2M237|Q9H1J9	Missense_Mutation	SNP	ENST00000225512.5	37	CCDS11505.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280187	0.80692	.	.	ENSG00000108379	ENST00000225512	T	0.75154	-0.91	4.42	4.42	0.53409	.	0.065505	0.64402	D	0.000011	T	0.63534	0.2519	L	0.37800	1.135	0.80722	D	1	P	0.44578	0.838	B	0.36567	0.228	T	0.64859	-0.6308	10	0.27082	T	0.32	.	17.2057	0.86917	0.0:1.0:0.0:0.0	.	104	P56703	WNT3_HUMAN	I	104	ENSP00000225512:V104I	ENSP00000225512:V104I	V	-	1	0	WNT3	42206209	1.000000	0.71417	0.960000	0.40013	0.913000	0.54294	5.830000	0.69324	2.283000	0.76528	0.462000	0.41574	GTC			0.667	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440427.1		NM_030753	
CDC27	996	mdanderson.org	37	17	45219803	45219803	+	Splice_Site	SNP	C	C	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:45219803C>A	ENST00000066544.3	-	11	1264		c.e11-1		CDC27_ENST00000531206.1_Splice_Site|CDC27_ENST00000446365.2_Splice_Site|CDC27_ENST00000527547.1_Splice_Site	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGCTATTCTCCTGTAAAAGGG	0.294																																					.													.	.			0			c.1171-1G>T												5.0	5.0	5.0					17																	45219803		2024	4065	6089	SO:0001630	splice_region_variant	996	exon12			ATTCTCCTGTAAA	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1171-1G>T	17.37:g.45219803C>A			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001256	2	0.00	0	G3V1C4|Q16349|Q96F35	Splice_Site	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973320	0.53614	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7489	0.85480	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDC27	42574802	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.729000	0.84864	2.566000	0.86566	0.460000	0.39030	.			0.294	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			Intron
SNX11	29916	mdanderson.org	37	17	46196070	46196070	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:46196070G>T	ENST00000393405.2	+	6	589	c.235G>T	c.(235-237)Gtt>Ttt	p.V79F	SNX11_ENST00000578861.1_3'UTR|SNX11_ENST00000359238.2_Missense_Mutation_p.V79F|SNX11_ENST00000439357.2_Missense_Mutation_p.V18F|SNX11_ENST00000452859.2_5'UTR|SNX11_ENST00000580219.1_Missense_Mutation_p.V71F|SNX11_ENST00000582104.1_Missense_Mutation_p.V71F	NM_152244.1	NP_689450.1	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	79	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|vesicle organization (GO:0016050)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol phosphate binding (GO:1901981)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	14						GCACAGGCCTGTTCCTGAACT	0.458																																					p.V79F													.	.			0			c.G235T												81.0	74.0	77.0					17																	46196070		2203	4300	6503	SO:0001583	missense	29916	exon5			AGGCCTGTTCCTG	AF121861	CCDS11526.1	17q21.32	2011-05-03			ENSG00000002919	ENSG00000002919		"""Sorting nexins"""	14975	protein-coding gene	gene with protein product		614906					Standard	NM_013323		Approved		uc002ing.1	Q9Y5W9		ENST00000393405.2:c.235G>T	17.37:g.46196070G>T	ENSP00000377059:p.Val79Phe		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_013323	24	0.00	0	B3KRL6|B4DPY5|D3DTV0|Q53YC0|Q9H885	Missense_Mutation	SNP	ENST00000393405.2	37	CCDS11526.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797233	0.50208	.	.	ENSG00000002919	ENST00000393405;ENST00000439357;ENST00000359238	T;T;T	0.42900	0.96;0.96;0.96	5.83	5.83	0.93111	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.65022	-0.6269	10	0.87932	D	0	.	18.8899	0.92395	0.0:0.0:1.0:0.0	.	18;71;79	B4DKH7;B4DPY5;Q9Y5W9	.;.;SNX11_HUMAN	F	79;18;79	ENSP00000377059:V79F;ENSP00000407369:V18F;ENSP00000352175:V79F	ENSP00000352175:V79F	V	+	1	0	SNX11	43551069	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.749000	0.91619	2.769000	0.95229	0.655000	0.94253	GTT			0.458	SNX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443423.1			
ST6GALNAC1	55808	bcgsc.ca	37	17	74623260	74623260	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:74623260C>T	ENST00000156626.7	-	4	1260	c.1061G>A	c.(1060-1062)aGc>aAc	p.S354N	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	354					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						AGCGGGGAGGCTGGCCAGGAG	0.642																																					p.S354N													.	ST6GALNAC1	42		0			c.G1061A												52.0	46.0	48.0					17																	74623260		2203	4300	6503	SO:0001583	missense	55808	exon4			GGGAGGCTGGCCA	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.1061G>A	17.37:g.74623260C>T	ENSP00000156626:p.Ser354Asn		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_1	53	0.00	0	NM_018414	20	0.00	0	Q6UW90|Q9NSC6	Missense_Mutation	SNP	ENST00000156626.7	37	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	C	5.307	0.241958	0.10077	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.32023	1.47;1.47	4.65	-0.673	0.11373	.	0.927660	0.09242	N	0.829016	T	0.23611	0.0571	L	0.43152	1.355	0.09310	N	1	B	0.23128	0.08	B	0.30029	0.11	T	0.37842	-0.9688	10	0.22706	T	0.39	-7.311	5.6418	0.17569	0.0:0.3591:0.3379:0.303	.	354	Q9NSC7	SIA7A_HUMAN	N	354	ENSP00000156626:S354N;ENSP00000351991:S354N	ENSP00000156626:S354N	S	-	2	0	ST6GALNAC1	72134855	0.000000	0.05858	0.027000	0.17364	0.061000	0.15899	-0.087000	0.11215	0.128000	0.18479	-0.237000	0.12165	AGC			0.642	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450974.1		NM_018414	
RNF213	57674	bcgsc.ca	37	17	78321501	78321501	+	Silent	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:78321501C>T	ENST00000582970.1	+	29	9509	c.9366C>T	c.(9364-9366)caC>caT	p.H3122H	RNF213_ENST00000508628.2_Silent_p.H3171H|RNF213_ENST00000336301.6_Silent_p.H1195H	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3122					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACTACGTCCACCTCGGCGGCC	0.552																																					p.H3122H													.	RNF213	766		0			c.C9366T												77.0	78.0	77.0					17																	78321501		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon29			CGTCCACCTCGGC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9366C>T	17.37:g.78321501C>T			Somatic	161	0	0		WXS	Illumina HiSeq	Phase_1	118	0.00	0	NM_001256071	6	0.00	0	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																					0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000443298.1		NM_020914	
CXXC1	30827	mdanderson.org	37	18	47810351	47810351	+	Silent	SNP	A	A	T	rs7228084	byFrequency	TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr18:47810351A>T	ENST00000285106.6	-	10	2040	c.1326T>A	c.(1324-1326)acT>acA	p.T442T	MBD1_ENST00000585595.1_5'Flank|MBD1_ENST00000353909.3_5'Flank|CXXC1_ENST00000589940.1_Silent_p.T442T|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000269471.5_5'Flank|CXXC1_ENST00000412036.2_Silent_p.T446T|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000590208.1_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000424334.2_5'Flank|MBD1_ENST00000591416.1_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000339998.6_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	442					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CCTGAAGGCGAGTGCGGGCAC	0.602																																					p.T446T													.	.			0			c.T1338A												107.0	97.0	100.0					18																	47810351		2203	4300	6503	SO:0001819	synonymous_variant	30827	exon10			AAGGCGAGTGCGG	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1326T>A	18.37:g.47810351A>T			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	54	0.04	2	NM_001101654	292	0.00	0	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Silent	SNP	ENST00000285106.6	37	CCDS11945.1																																																																																					0.602	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255927.2		NM_014593	
DNMT1	1786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	10254526	10254526	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:10254526C>T	ENST00000340748.4	-	28	3219	c.2984G>A	c.(2983-2985)cGg>cAg	p.R995Q	DNMT1_ENST00000540357.1_Missense_Mutation_p.R995Q|DNMT1_ENST00000589538.1_5'UTR|DNMT1_ENST00000359526.4_Missense_Mutation_p.R1011Q			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	995	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CTCTTTGATCCGGCCAATTCG	0.542																																					p.R1011Q													.	.			0			c.G3032A												251.0	238.0	243.0					19																	10254526		2203	4300	6503	SO:0001583	missense	1786	exon29			TTGATCCGGCCAA	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2984G>A	19.37:g.10254526C>T	ENSP00000345739:p.Arg995Gln		Somatic	277	0	0		WXS	Illumina HiSeq	.	337	0.21	72	NM_001130823	126	0.23	29	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999526	0.74818	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	D;D;D	0.86865	-2.18;-2.18;-2.18	5.91	3.78	0.43462	Bromo adjacent homology (BAH) domain (3);	0.051434	0.85682	D	0.000000	D	0.85366	0.5680	M	0.65498	2.005	0.54753	D	0.999988	P;P;P	0.52061	0.938;0.87;0.95	B;B;P	0.44732	0.329;0.245;0.459	T	0.83099	-0.0129	10	0.22706	T	0.39	-22.2465	12.2361	0.54516	0.0:0.8576:0.0:0.1424	.	995;1011;995	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	Q	1011;995;995;863	ENSP00000352516:R1011Q;ENSP00000440457:R995Q;ENSP00000345739:R995Q	ENSP00000345739:R995Q	R	-	2	0	DNMT1	10115526	1.000000	0.71417	0.839000	0.33178	0.948000	0.59901	6.005000	0.70716	1.509000	0.48786	0.655000	0.94253	CGG			0.542	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451166.1		NM_001379	
ANKLE1	126549	broad.mit.edu	37	19	17397494	17397501	+	3'UTR	DEL	TGTGTGTT	TGTGTGTT	-	rs534658778|rs576892988|rs563327402|rs1465582|rs56209027|rs71180380	byFrequency	TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	TGTGTGTT	TGTGTGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:17397494_17397501delTGTGTGTT	ENST00000394458.3	+	0	2257_2264				ANKLE1_ENST00000594072.1_3'UTR|ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000598347.1_Frame_Shift_Del_p.VCL589fs	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtgtgtgtttgtgtgtgtg	0.519																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTGTGTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TGTGTGTT>-	19.37:g.17397494_17397501delTGTGTGTT			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	19	0.53	10	.	3	0.00	0	A8VU82|Q8N8J8	Frame_Shift_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.519	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
CCDC124	115098	mdanderson.org	37	19	18054150	18054150	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:18054150G>T	ENST00000597436.1	+	4	537	c.430G>T	c.(430-432)Gcg>Tcg	p.A144S	CCDC124_ENST00000445755.2_Missense_Mutation_p.A144S	NM_138442.3	NP_612451.1	Q96CT7	CC124_HUMAN	coiled-coil domain containing 124	144					cell cycle (GO:0007049)|cell division (GO:0051301)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(2)	3						CAGCGTGGAGGCGCGCACCAT	0.697																																					p.A144S													.	.			0			c.G430T												19.0	19.0	19.0					19																	18054150		2188	4283	6471	SO:0001583	missense	115098	exon4			GTGGAGGCGCGCA	BC013949	CCDS12369.1	19p13.11	2014-02-20				ENSG00000007080			25171	protein-coding gene	gene with protein product						23894443	Standard	NM_138442		Approved		uc002nhs.3	Q96CT7		ENST00000597436.1:c.430G>T	19.37:g.18054150G>T	ENSP00000471455:p.Ala144Ser		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001136203	411	0.00	0		Missense_Mutation	SNP	ENST00000597436.1	37	CCDS12369.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035265	0.93630	.	.	ENSG00000007080	ENST00000445755	T	0.66460	-0.21	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.85531	0.5718	H	0.94542	3.55	0.80722	D	1	D	0.76494	0.999	D	0.66602	0.945	D	0.89961	0.4086	10	0.87932	D	0	-16.3539	15.1402	0.72604	0.0:0.0:1.0:0.0	.	144	Q96CT7	CC124_HUMAN	S	144	ENSP00000408730:A144S	ENSP00000408730:A144S	A	+	1	0	CCDC124	17915150	1.000000	0.71417	0.996000	0.52242	0.593000	0.36681	8.976000	0.93442	2.147000	0.66899	0.491000	0.48974	GCG			0.697	CCDC124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466484.1		NM_138442	
GATAD2A	54815	broad.mit.edu	37	19	19606951	19606951	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:19606951G>T	ENST00000360315.3	+	7	1159	c.847G>T	c.(847-849)Gga>Tga	p.G283*	GATAD2A_ENST00000537887.1_Intron|GATAD2A_ENST00000404158.1_Nonsense_Mutation_p.G283*|GATAD2A_ENST00000358713.3_Nonsense_Mutation_p.G283*|GATAD2A_ENST00000252577.5_Nonsense_Mutation_p.G283*|GATAD2A_ENST00000429563.2_Nonsense_Mutation_p.G110*	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	283					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						GCAGATTCAGGGACAGAGGAT	0.632																																					p.G283X													GATAD2A_ENST00000360315,right_lower_lobe,carcinoma,0,2	GATAD2A	81	2	0			c.G847T												98.0	80.0	86.0					19																	19606951		2203	4300	6503	SO:0001587	stop_gained	54815	exon7			ATTCAGGGACAGA	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.847G>T	19.37:g.19606951G>T	ENSP00000353463:p.Gly283*		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	100	0.05	5	NM_017660	238	0.00	0	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Nonsense_Mutation	SNP	ENST00000360315.3	37	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	G	41	8.654934	0.98901	.	.	ENSG00000167491	ENST00000360315;ENST00000252577;ENST00000404158;ENST00000358713;ENST00000429563	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-22.8385	18.2855	0.90113	0.0:0.0:1.0:0.0	.	.	.	.	X	283;283;302;283;110	.	ENSP00000252577:G283X	G	+	1	0	GATAD2A	19467951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.194000	0.94962	2.664000	0.90586	0.655000	0.94253	GGA			0.632	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000326671.4		NM_017660	
ZNF708	7562	mdanderson.org	37	19	21476977	21476977	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:21476977G>T	ENST00000356929.3	-	4	988	c.791C>A	c.(790-792)tCc>tAc	p.S264Y		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						AAGGTTTGAGGACCGGTTAAA	0.358																																					p.S264Y													.	.			0			c.C791A												45.0	49.0	48.0					19																	21476977		2160	4279	6439	SO:0001583	missense	7562	exon4			TTTGAGGACCGGT	X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.791C>A	19.37:g.21476977G>T	ENSP00000349401:p.Ser264Tyr		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_021269	6	0.00	0	Q6ZMR0	Missense_Mutation	SNP	ENST00000356929.3	37	CCDS32980.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.618780	0.00118	.	.	ENSG00000182141	ENST00000356929	T	0.07908	3.15	1.05	-2.1	0.07210	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06188	0.0160	M	0.71581	2.175	0.09310	N	1	B	0.31893	0.345	B	0.26310	0.068	T	0.47459	-0.9116	9	0.07325	T	0.83	.	0.621	0.00778	0.1875:0.3287:0.2088:0.2751	.	264	P17019	ZN708_HUMAN	Y	264	ENSP00000349401:S264Y	ENSP00000349401:S264Y	S	-	2	0	ZNF708	21268817	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-1.742000	0.01835	-1.500000	0.01819	-1.523000	0.00931	TCC			0.358	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463953.1		NM_021269	
LYPD3	27076	mdanderson.org	37	19	43967294	43967294	+	Silent	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:43967294G>A	ENST00000244333.3	-	4	616	c.528C>T	c.(526-528)aaC>aaT	p.N176N		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	176	UPAR/Ly6 2.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				TCAAGGTGACGTTGCCGTCGA	0.652																																					p.N176N													.	.			0			c.C528T												96.0	85.0	89.0					19																	43967294		2203	4300	6503	SO:0001819	synonymous_variant	27076	exon4			GGTGACGTTGCCG	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.528C>T	19.37:g.43967294G>A			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_014400	26	0.00	0	Q9UJ74	Silent	SNP	ENST00000244333.3	37	CCDS12620.1																																																																																					0.652	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463177.1		NM_014400	
ZNF888	388559	ucsc.edu	37	19	53418570	53418570	+	lincRNA	SNP	T	T	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:53418570T>C	ENST00000596623.1	-	0	429							P0CJ79	ZN888_HUMAN	zinc finger protein 888						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TGAATGTCAATAGACCCTGAA	0.413																																					.													.	.			0			.												108.0	129.0	122.0					19																	53418570		876	1989	2865			0	.			TGTCAATAGACCC			19q13.41	2013-02-15			ENSG00000213793	ENSG00000213793		"""Zinc fingers, C2H2-type"", ""-"""	38695	protein-coding gene	gene with protein product							Standard	XM_005275849		Approved			P0CJ79			19.37:g.53418570T>C			Somatic	73	0.095890411	7		WXS	Illumina HiSeq		50	0.22	11	.	6	0.00	0		Silent	SNP	ENST00000596623.1	37																																																																																						0.413	ZNF888-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000463875.1		XM_496322	
NEB	4703	broad.mit.edu	37	2	152382707	152382707	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:152382707G>T	ENST00000172853.10	-	121	17059	c.16912C>A	c.(16912-16914)Ctg>Atg	p.L5638M	NEB_ENST00000604864.1_Missense_Mutation_p.L7339M|NEB_ENST00000427231.2_Missense_Mutation_p.L7339M|NEB_ENST00000603639.1_Missense_Mutation_p.L7339M|NEB_ENST00000397345.3_Missense_Mutation_p.L7339M|NEB_ENST00000409198.1_Missense_Mutation_p.L5638M			P20929	NEBU_HUMAN	nebulin	5638					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCGCCAGCAGGATCTGAGGC	0.537																																					p.L7374M													.	NEB	1697		0			c.C22120A												74.0	78.0	77.0					2																	152382707		1969	4142	6111	SO:0001583	missense	4703	exon150			CCAGCAGGATCTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.16912C>A	2.37:g.152382707G>T	ENSP00000172853:p.Leu5638Met		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	155	0.03	5	NM_001271208	8	0.00	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	G	19.09	3.759402	0.69763	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	6.07	6.07	0.98685	.	0.111817	0.64402	D	0.000007	T	0.64238	0.2580	L	0.53249	1.67	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.991;0.991;0.997	T	0.60419	-0.7267	10	0.44086	T	0.13	.	15.3849	0.74691	0.0:0.0:0.8607:0.1393	.	5638;7339;2069	P20929;F8WCP0;Q14215	NEBU_HUMAN;.;.	M	5638;7339;7339;1687;2069;5638	ENSP00000386259:L5638M;ENSP00000380505:L7339M;ENSP00000416578:L7339M;ENSP00000410961:L2069M;ENSP00000172853:L5638M	ENSP00000172853:L5638M	L	-	1	2	NEB	152090953	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.582000	0.67477	2.885000	0.99019	0.655000	0.94253	CTG			0.537	NEB-201	KNOWN	basic	protein_coding	protein_coding				NM_004543	
XIRP2	129446	broad.mit.edu	37	2	168114492	168114492	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:168114492G>A	ENST00000409728.1	+	11	1624	c.1535G>A	c.(1534-1536)tGc>tAc	p.C512Y	XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409605.1_Missense_Mutation_p.C257Y|XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000409756.2_Missense_Mutation_p.C479Y|XIRP2_ENST00000409043.1_Missense_Mutation_p.C479Y|XIRP2_ENST00000420519.1_Missense_Mutation_p.C512Y|XIRP2_ENST00000409273.1_3'UTR	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGATGGAACTGCAAAAACCAA	0.338																																					p.C512Y													.	XIRP2	914		0			c.G1535A												86.0	80.0	82.0					2																	168114492		1843	4084	5927	SO:0001583	missense	129446	exon11			GGAACTGCAAAAA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1535G>A	2.37:g.168114492G>A	ENSP00000386619:p.Cys512Tyr		Somatic	264	0	0		WXS	Illumina HiSeq	Phase_I	258	0.02	5	NM_001199143	0		0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749902	0.30955	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409756;ENST00000420519;ENST00000409605	T;T;T;T;T	0.77229	-1.07;-1.07;-1.07;-1.07;-1.08	5.82	-0.596	0.11657	.	.	.	.	.	T	0.65417	0.2689	.	.	.	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.55095	-0.8194	8	0.56958	D	0.05	.	7.0227	0.24922	0.3053:0.4012:0.2935:0.0	.	479;512	A4UGR9-4;A4UGR9-6	.;.	Y	479;512;479;512;257	ENSP00000386454:C479Y;ENSP00000386619:C512Y;ENSP00000386724:C479Y;ENSP00000415541:C512Y;ENSP00000386981:C257Y	ENSP00000386454:C479Y	C	+	2	0	XIRP2	167822738	0.000000	0.05858	0.458000	0.27068	0.532000	0.34746	-0.168000	0.09925	-0.115000	0.11915	0.655000	0.94253	TGC			0.338	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000333552.1		NM_152381	
CROCC2	728763	broad.mit.edu;ucsc.edu	37	2	241922506	241922506	+	RNA	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:241922506G>A	ENST00000425110.1	-	0	770																											CAGGCCTACAGGGAAGAGGCC	0.627																																					.													.	.			0			.																																											0	.			CCTACAGGGAAGA																													2.37:g.241922506G>A			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	76	0.25	19	.	0		0		RNA	SNP	ENST00000425110.1	37																																																																																						0.627	AC104809.2-001	KNOWN	basic|exp_conf	antisense	antisense		OTTHUMT00000324139.1			
HDLBP	3069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	242189261	242189261	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:242189261G>A	ENST00000391975.1	-	12	1734	c.1507C>T	c.(1507-1509)Cgc>Tgc	p.R503C	HDLBP_ENST00000391976.2_Missense_Mutation_p.R503C|HDLBP_ENST00000310931.4_Missense_Mutation_p.R503C|HDLBP_ENST00000476807.1_5'UTR|HDLBP_ENST00000427183.2_Missense_Mutation_p.R470C	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	503	KH 5. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CTTACCATGCGAGATGCAAGC	0.602																																					p.R503C													.	.			0			c.C1507T												96.0	78.0	84.0					2																	242189261		2203	4300	6503	SO:0001583	missense	3069	exon12			CCATGCGAGATGC		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1507C>T	2.37:g.242189261G>A	ENSP00000375836:p.Arg503Cys		Somatic	44	0	0		WXS	Illumina HiSeq	.	35	0.34	12	NM_005336	186	0.30	55	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.101438|4.101438	0.76983|0.76983	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183|ENST00000373292	T;T;T;T|T	0.44083|0.41400	0.93;0.93;0.93;0.93|1.0	5.57|5.57	4.7|4.7	0.59300|0.59300	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51466|0.51466	0.1676|0.1676	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.77557|.	0.962;0.99|.	T|T	0.44967|0.44967	-0.9293|-0.9293	10|7	0.87932|0.21540	D|T	0|0.41	-14.4239|-14.4239	14.7226|14.7226	0.69317|0.69317	0.0696:0.0:0.9303:0.0|0.0696:0.0:0.9303:0.0	.|.	470;503|.	E7EM71;Q00341|.	.;VIGLN_HUMAN|.	C|L	503;503;503;470|311	ENSP00000375836:R503C;ENSP00000375837:R503C;ENSP00000312042:R503C;ENSP00000399139:R470C|ENSP00000362389:S311L	ENSP00000312042:R503C|ENSP00000362389:S311L	R|S	-|-	1|2	0|0	HDLBP|HDLBP	241837934|241837934	1.000000|1.000000	0.71417|0.71417	0.855000|0.855000	0.33649|0.33649	0.478000|0.478000	0.33099|0.33099	9.722000|9.722000	0.98770|0.98770	1.497000|1.497000	0.48584|0.48584	0.655000|0.655000	0.94253|0.94253	CGC|TCG			0.602	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257245.5		NM_203346	
RBL1	5933	broad.mit.edu	37	20	35627253	35627253	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr20:35627253G>T	ENST00000373664.3	-	22	3182	c.3116C>A	c.(3115-3117)gCa>gAa	p.A1039E		NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	1039					chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				AGGGGATTCTGCATCACTATC	0.408																																					p.A1039E													.	RBL1	114		0			c.C3116A												251.0	207.0	222.0					20																	35627253		2203	4300	6503	SO:0001583	missense	5933	exon22			GATTCTGCATCAC	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.3116C>A	20.37:g.35627253G>T	ENSP00000362768:p.Ala1039Glu		Somatic	132	0.0075757576	1		WXS	Illumina HiSeq	Phase_I	167	0.03	5	NM_002895	16	0.00	0	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	ENST00000373664.3	37	CCDS13289.1	.	.	.	.	.	.	.	.	.	.	G	9.369	1.069911	0.20147	.	.	ENSG00000080839	ENST00000373664	D	0.83591	-1.74	4.94	1.95	0.26073	Rb C-terminal (1);	0.427321	0.22562	N	0.058460	T	0.69115	0.3075	N	0.22421	0.69	0.80722	D	1	B	0.20459	0.045	B	0.29176	0.099	T	0.52563	-0.8559	10	0.13853	T	0.58	-0.419	8.1669	0.31233	0.143:0.1302:0.7268:0.0	.	1039	P28749	RBL1_HUMAN	E	1039	ENSP00000362768:A1039E	ENSP00000362768:A1039E	A	-	2	0	RBL1	35060667	1.000000	0.71417	0.980000	0.43619	0.173000	0.22820	3.959000	0.56744	0.286000	0.22352	-0.218000	0.12543	GCA			0.408	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079067.2		NM_002895	
LAMA5	3911	bcgsc.ca	37	20	60886012	60886012	+	Silent	SNP	C	C	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr20:60886012C>A	ENST00000252999.3	-	74	10293	c.10227G>T	c.(10225-10227)ggG>ggT	p.G3409G	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3409	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGAGCCGAGTCCCGAGGCCTT	0.701																																					p.G3409G													.	LAMA5	268		0			c.G10227T												14.0	18.0	17.0					20																	60886012		2161	4238	6399	SO:0001819	synonymous_variant	3911	exon74			CCGAGTCCCGAGG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.10227G>T	20.37:g.60886012C>A			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_1	91	0.00	0	NM_005560	148	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																					0.701	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
BAGE2	85319	broad.mit.edu	37	21	11065359	11065360	+	RNA	INS	-	-	T	rs57344159|rs147270665|rs397956101		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr21:11065359_11065360insT	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GATTTTTAAGATTTTTTTTTAC	0.307																																					.													.	.			0			.																																											85319	.			TTTAAGATTTTTT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11065368_11065368dupT			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	INS	ENST00000470054.1	37																																																																																						0.307	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
BRWD1	54014	bcgsc.ca	37	21	40582800	40582800	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr21:40582800T>C	ENST00000333229.2	-	35	4283	c.3956A>G	c.(3955-3957)aAg>aGg	p.K1319R	BRWD1_ENST00000380800.3_Missense_Mutation_p.K1319R|BRWD1_ENST00000342449.3_Missense_Mutation_p.K1319R	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1319					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ACACTGTTTCTTCCAGTTGCT	0.348																																					p.K1319R	Melanoma(170;988 1986 4794 16843 39731)												.	BRWD1	325		0			c.A3956G												118.0	108.0	112.0					21																	40582800		2203	4300	6503	SO:0001583	missense	54014	exon35			TGTTTCTTCCAGT	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3956A>G	21.37:g.40582800T>C	ENSP00000330753:p.Lys1319Arg		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_1	124	0.00	0	NM_018963	6	0.00	0	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.956248	0.34565	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.18502	2.21;2.21;2.21	5.36	1.69	0.24217	Bromodomain (3);	0.331353	0.28572	N	0.014875	T	0.09992	0.0245	L	0.37850	1.14	0.36369	D	0.861171	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.26292	-1.0107	10	0.15499	T	0.54	-2.779	4.126	0.10128	0.1398:0.227:0.0:0.6332	.	1319;1319	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	R	1319	ENSP00000330753:K1319R;ENSP00000344333:K1319R;ENSP00000370178:K1319R	ENSP00000330753:K1319R	K	-	2	0	BRWD1	39504670	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.374000	0.44274	0.104000	0.17725	0.477000	0.44152	AAG			0.348	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000141398.3		NM_033656	
BRD1	23774	mdanderson.org	37	22	50217264	50217264	+	Silent	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr22:50217264G>A	ENST00000216267.8	-	1	1188	c.702C>T	c.(700-702)tgC>tgT	p.C234C	BRD1_ENST00000459821.1_5'Flank|BRD1_ENST00000542442.1_5'Flank|BRD1_ENST00000404034.1_Silent_p.C234C|BRD1_ENST00000342989.5_5'Flank|BRD1_ENST00000404760.1_Silent_p.C234C|BRD1_ENST00000457780.2_Silent_p.C234C	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	234					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGCACATGTCGCAGAAGAGGA	0.652																																					p.C234C													.	.			0			c.C702T												52.0	42.0	46.0					22																	50217264		2203	4300	6503	SO:0001819	synonymous_variant	23774	exon1			CATGTCGCAGAAG	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.702C>T	22.37:g.50217264G>A			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_014577	13	0.00	0	A6ZJA4	Silent	SNP	ENST00000216267.8	37	CCDS14080.1																																																																																					0.652	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317402.1		NM_014577	
MIOX	55586	mdanderson.org	37	22	50927708	50927708	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr22:50927708G>T	ENST00000216075.6	+	7	644	c.570G>T	c.(568-570)atG>atT	p.M190I	MIOX_ENST00000395732.3_Missense_Mutation_p.M190I|MIOX_ENST00000395733.3_Missense_Mutation_p.C201F	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	190					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGGTCCTCATGTCCTGGGGCC	0.697																																					p.M190I													.	.			0			c.G570T												25.0	22.0	23.0					22																	50927708		2200	4296	6496	SO:0001583	missense	55586	exon7			CCTCATGTCCTGG	AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.570G>T	22.37:g.50927708G>T	ENSP00000216075:p.Met190Ile		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_017584	0		0	Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Missense_Mutation	SNP	ENST00000216075.6	37	CCDS14092.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	18.84|18.84	3.709057|3.709057	0.68615|0.68615	.|.	.|.	ENSG00000100253|ENSG00000100253	ENST00000395733|ENST00000216075;ENST00000395732;ENST00000451761	.|.	.|.	.|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67496|0.67496	0.2899|0.2899	L|L	0.53780|0.53780	1.695|1.695	0.58432|0.58432	D|D	0.999999|0.999999	D|P;P	0.89917|0.50443	1.0|0.935;0.714	D|P;P	0.91635|0.58928	0.999|0.848;0.482	T|T	0.68006|0.68006	-0.5523|-0.5523	8|9	0.24483|0.49607	T|T	0.36|0.09	-0.6686|-0.6686	13.7972|13.7972	0.63177|0.63177	0.0:0.1548:0.8451:0.0|0.0:0.1548:0.8451:0.0	.|.	201|190;190	Q9UGB7-2|A6PVH2;Q9UGB7	.|.;MIOX_HUMAN	F|I	201|190;190;170	.|.	ENSP00000379082:C201F|ENSP00000216075:M190I	C|M	+|+	2|3	0|0	MIOX|MIOX	49274574|49274574	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.723000|0.723000	0.41478|0.41478	6.878000|6.878000	0.75567|0.75567	2.392000|2.392000	0.81423|0.81423	0.556000|0.556000	0.70494|0.70494	TGT|ATG			0.697	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316835.1		NM_017584	
PLXND1	23129	broad.mit.edu;mdanderson.org	37	3	129324383	129324383	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:129324383C>A	ENST00000324093.4	-	1	1278	c.1100G>T	c.(1099-1101)cGg>cTg	p.R367L	PLXND1_ENST00000393239.1_Missense_Mutation_p.R367L	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	367	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						AGCAAAGAGCCGCTCCCGGGC	0.736																																					p.R367L	Ovarian(97;366 1484 3738 22084 39045)												.	PLXND1	149		0			c.G1100T												1.0	1.0	1.0					3																	129324383		1048	2263	3311	SO:0001583	missense	23129	exon1			AAGAGCCGCTCCC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.1100G>T	3.37:g.129324383C>A	ENSP00000317128:p.Arg367Leu		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	12	0.50	6	NM_015103	1	0.00	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	c	3.249	-0.153752	0.06585	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.08546	3.08;3.08	4.59	-3.13	0.05266	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	1.705740	0.04537	N	0.387372	T	0.02688	0.0081	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43065	-0.9414	10	0.28530	T	0.3	.	6.3201	0.21213	0.3814:0.3908:0.0:0.2278	.	367	Q9Y4D7	PLXD1_HUMAN	L	367	ENSP00000317128:R367L;ENSP00000376931:R367L	ENSP00000317128:R367L	R	-	2	0	PLXND1	130807073	0.000000	0.05858	0.205000	0.23548	0.069000	0.16628	-0.287000	0.08388	-0.915000	0.03823	0.299000	0.19835	CGG			0.736	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356132.4		NM_015103	
COL6A5	256076	broad.mit.edu	37	3	130134524	130134524	+	Silent	SNP	A	A	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:130134524A>G	ENST00000432398.2	+	23	5291	c.4797A>G	c.(4795-4797)aaA>aaG	p.K1599K	COL6A5_ENST00000265379.6_Silent_p.K1599K	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1599	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AAGGAGAAAAAGGAAGCCAGG	0.418																																					p.K1599K													.	COL6A5	205		0			c.A4797G												72.0	70.0	70.0					3																	130134524		692	1591	2283	SO:0001819	synonymous_variant	256076	exon23			AGAAAAAGGAAGC	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4797A>G	3.37:g.130134524A>G			Somatic	644	0.001552795	1		WXS	Illumina HiSeq	Phase_I	547	0.01	4	NM_153264	0		0	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	ENST00000432398.2	37																																																																																						0.418	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_153264	
LAMP3	27074	mdanderson.org	37	3	182841955	182841955	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:182841955C>T	ENST00000265598.3	-	6	1420	c.1165G>A	c.(1165-1167)Gcc>Acc	p.A389T	LAMP3_ENST00000466939.1_Missense_Mutation_p.A365T	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	389					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			ACCACGATGGCCCCAATCACA	0.468																																					p.A389T													.	.			0			c.G1165A												141.0	128.0	132.0					3																	182841955		2203	4300	6503	SO:0001583	missense	27074	exon6			CGATGGCCCCAAT	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.1165G>A	3.37:g.182841955C>T	ENSP00000265598:p.Ala389Thr		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	129	0.04	5	NM_014398	4	0.00	0	D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	ENST00000265598.3	37	CCDS3242.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189660	0.57909	.	.	ENSG00000078081	ENST00000265598;ENST00000466939	T;T	0.37411	1.2;1.2	5.92	3.0	0.34707	.	0.996122	0.08136	N	0.992425	T	0.39009	0.1062	L	0.54323	1.7	0.20489	N	0.999899	P	0.36354	0.549	P	0.46049	0.502	T	0.36089	-0.9762	10	0.20046	T	0.44	-5.5204	4.3107	0.10969	0.1807:0.6326:0.0:0.1866	.	389	Q9UQV4	LAMP3_HUMAN	T	389;365	ENSP00000265598:A389T;ENSP00000418912:A365T	ENSP00000265598:A389T	A	-	1	0	LAMP3	184324649	0.000000	0.05858	0.997000	0.53966	0.966000	0.64601	0.066000	0.14489	0.832000	0.34804	0.561000	0.74099	GCC			0.468	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350863.1			
PDS5A	23244	bcgsc.ca	37	4	39839559	39839559	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:39839559C>G	ENST00000303538.8	-	32	4466	c.3927G>C	c.(3925-3927)ttG>ttC	p.L1309F		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TACCTGCTTCCAAACCCCCAG	0.448																																					p.L1309F													.	PDS5A	114		0			c.G3927C												95.0	94.0	94.0					4																	39839559		1909	4127	6036	SO:0001583	missense	23244	exon32			TGCTTCCAAACCC	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.3927G>C	4.37:g.39839559C>G	ENSP00000303427:p.Leu1309Phe		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_1	96	0.00	0	NM_001100399	52	0.00	0		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804407	0.50315	.	.	ENSG00000121892	ENST00000303538	.	.	.	5.31	5.31	0.75309	.	0.365653	0.24705	N	0.036276	T	0.30070	0.0753	N	0.08118	0	0.80722	D	1	B	0.27068	0.167	B	0.27715	0.082	T	0.17167	-1.0378	8	.	.	.	-5.662	10.1833	0.42982	0.0:0.8772:0.0:0.1228	.	1309	Q29RF7	PDS5A_HUMAN	F	1309	.	.	L	-	3	2	PDS5A	39515954	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.740000	0.38228	2.477000	0.83638	0.655000	0.94253	TTG			0.448	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361287.1		NM_015200	
GSX2	170825	mdanderson.org	37	4	54966518	54966518	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:54966518C>A	ENST00000326902.2	+	1	321	c.7C>A	c.(7-9)Cgc>Agc	p.R3S	FIP1L1_ENST00000507166.1_Intron|GSX2_ENST00000503800.1_Missense_Mutation_p.R3S	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2	3					forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			CGACATGTCGCGCTCCTTCTA	0.652																																					p.R3S													.	.			0			c.C7A												51.0	38.0	42.0					4																	54966518		2202	4300	6502	SO:0001583	missense	170825	exon1			ATGTCGCGCTCCT		CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.7C>A	4.37:g.54966518C>A	ENSP00000319118:p.Arg3Ser		Somatic	70	0.0142857143	1		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_133267	0		0		Missense_Mutation	SNP	ENST00000326902.2	37	CCDS3494.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325593	0.60743	.	.	ENSG00000180613	ENST00000326902;ENST00000503800	T;T	0.79454	-1.27;-1.27	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.87374	0.6161	M	0.79926	2.475	0.51767	D	0.999937	D	0.89917	1.0	D	0.81914	0.995	D	0.88793	0.3279	10	0.87932	D	0	.	12.8625	0.57922	0.1628:0.8372:0.0:0.0	.	3	Q9BZM3	GSX2_HUMAN	S	3	ENSP00000319118:R3S;ENSP00000422213:R3S	ENSP00000319118:R3S	R	+	1	0	GSX2	54661275	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.738000	0.68613	2.436000	0.82500	0.491000	0.48974	CGC			0.652	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250595.1		NM_133267	
EPHA5	2044	mdanderson.org	37	4	66270181	66270181	+	Silent	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:66270181G>A	ENST00000273854.3	-	8	2301	c.1701C>T	c.(1699-1701)agC>agT	p.S567S	EPHA5_ENST00000354839.4_Silent_p.S567S|EPHA5_ENST00000511294.1_Silent_p.S568S|EPHA5_ENST00000432638.2_Silent_p.S404S	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	567					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GGCTTTGATCGCTGGATGCTG	0.433										TSP Lung(17;0.13)																											p.S567S													.	.			0			c.C1701T												112.0	95.0	101.0					4																	66270181		2203	4300	6503	SO:0001819	synonymous_variant	2044	exon8			TTGATCGCTGGAT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1701C>T	4.37:g.66270181G>A			Somatic	77	0.012987013	1		WXS	Illumina HiSeq	Phase_I	67	0.06	4	NM_182472	0		0	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1																																																																																					0.433	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251388.2		NM_004439	
SDAD1	55153	broad.mit.edu	37	4	76903125	76903125	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:76903125G>T	ENST00000356260.5	-	2	274	c.156C>A	c.(154-156)ccC>ccA	p.P52P	SDAD1_ENST00000395711.4_Silent_p.P52P|RP11-630D6.5_ENST00000501239.2_RNA	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	52					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GTTCTTTGCTGGGTTTATTTG	0.323																																					p.P52P													.	SDAD1	47		0			c.C156A												124.0	115.0	118.0					4																	76903125		2203	4299	6502	SO:0001819	synonymous_variant	55153	exon2			TTTGCTGGGTTTA	AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.156C>A	4.37:g.76903125G>T			Somatic	81	0.012345679	1		WXS	Illumina HiSeq	Phase_I	70	0.06	4	NM_018115	23	0.00	0	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Silent	SNP	ENST00000356260.5	37	CCDS3573.2																																																																																					0.323	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252418.3		NM_018115	
FRAS1	80144	mdanderson.org	37	4	79284696	79284696	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:79284696G>T	ENST00000325942.6	+	21	2892	c.2452G>T	c.(2452-2454)Gct>Tct	p.A818S	FRAS1_ENST00000264895.6_Missense_Mutation_p.A818S	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	818					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GCACTGTGCAGCTGATCTCCA	0.577																																					p.A818S													.	.			0			c.G2452T												42.0	42.0	42.0					4																	79284696		2125	4243	6368	SO:0001583	missense	80144	exon21			TGTGCAGCTGATC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.2452G>T	4.37:g.79284696G>T	ENSP00000326330:p.Ala818Ser		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_025074	2	0.00	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760796	0.69763	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.28454	1.61;1.69	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.43590	0.1254	N	0.25094	0.71	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.97;0.998	T	0.37430	-0.9706	10	0.42905	T	0.14	.	18.5611	0.91100	0.0:0.0:1.0:0.0	.	818;818	E9PHH6;A2RRR8	.;.	S	818	ENSP00000326330:A818S;ENSP00000264895:A818S	ENSP00000264895:A818S	A	+	1	0	FRAS1	79503720	1.000000	0.71417	0.076000	0.20297	0.433000	0.31745	7.000000	0.76290	2.393000	0.81446	0.585000	0.79938	GCT			0.577	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000362706.2			
ARHGAP24	83478	bcgsc.ca	37	4	86491797	86491797	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:86491797A>G	ENST00000395184.1	+	2	569	c.103A>G	c.(103-105)Act>Gct	p.T35A	ARHGAP24_ENST00000506421.1_3'UTR|ARHGAP24_ENST00000503995.1_Missense_Mutation_p.T35A	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	35	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		CTTTGTCAAGACTTGGCATAC	0.502																																					p.T35A													.	ARHGAP24	116		0			c.A103G												122.0	102.0	109.0					4																	86491797		2203	4300	6503	SO:0001583	missense	83478	exon2			GTCAAGACTTGGC	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.103A>G	4.37:g.86491797A>G	ENSP00000378611:p.Thr35Ala		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_1	110	0.00	0	NM_001025616	2	0.00	0	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.004902	0.74932	.	.	ENSG00000138639	ENST00000395184;ENST00000503995	T;T	0.76839	-1.05;-1.05	5.81	5.81	0.92471	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.82628	0.5078	L	0.43598	1.365	0.80722	D	1	D;B;D	0.69078	0.977;0.317;0.997	P;B;P	0.61800	0.817;0.228;0.894	D	0.83917	0.0299	10	0.59425	D	0.04	.	15.8314	0.78757	1.0:0.0:0.0:0.0	.	35;35;180	Q8N264;Q8N264-4;Q8N264-5	RHG24_HUMAN;.;.	A	35	ENSP00000378611:T35A;ENSP00000423206:T35A	ENSP00000378611:T35A	T	+	1	0	ARHGAP24	86710821	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.270000	0.95690	2.217000	0.71921	0.533000	0.62120	ACT			0.502	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252815.2		NM_031305	
ANKRD50	57182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	125592523	125592523	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:125592523C>T	ENST00000504087.1	-	4	2946	c.1909G>A	c.(1909-1911)Gtg>Atg	p.V637M	ANKRD50_ENST00000515641.1_Missense_Mutation_p.V458M	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	637										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GCACAATCCACTTTTACGCCA	0.458																																					p.V637M													.	.			0			c.G1909A												136.0	121.0	126.0					4																	125592523		2203	4300	6503	SO:0001583	missense	57182	exon4			AATCCACTTTTAC	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1909G>A	4.37:g.125592523C>T	ENSP00000425658:p.Val637Met		Somatic	121	0	0		WXS	Illumina HiSeq	.	94	0.55	52	NM_020337	2	0.00	0	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.690012	0.68271	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.69040	-0.37;-0.32	5.21	5.21	0.72293	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.80939	0.4720	M	0.76170	2.325	0.80722	D	1	D	0.59357	0.985	P	0.61874	0.895	T	0.82701	-0.0327	10	0.72032	D	0.01	.	18.9425	0.92610	0.0:1.0:0.0:0.0	.	637	Q9ULJ7	ANR50_HUMAN	M	637;458	ENSP00000425658:V637M;ENSP00000425355:V458M	ENSP00000425658:V637M	V	-	1	0	ANKRD50	125811973	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	7.133000	0.77259	2.714000	0.92807	0.585000	0.79938	GTG			0.458	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364775.1		NM_020337	
DMXL1	1657	mdanderson.org	37	5	118511022	118511022	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr5:118511022C>T	ENST00000311085.8	+	26	6828	c.6748C>T	c.(6748-6750)Cat>Tat	p.H2250Y	DMXL1_ENST00000539542.1_Missense_Mutation_p.H2250Y	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2250										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTGTGGTAGTCATAACTACAG	0.294																																					p.H2250Y													.	.			0			c.C6748T												131.0	126.0	127.0					5																	118511022		2202	4296	6498	SO:0001583	missense	1657	exon26			GGTAGTCATAACT	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.6748C>T	5.37:g.118511022C>T	ENSP00000309690:p.His2250Tyr		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_005509	5	0.00	0		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934173	0.92458	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.10099	2.91;2.91	5.96	5.96	0.96718	.	0.086452	0.85682	D	0.000000	T	0.25791	0.0628	M	0.63843	1.955	0.80722	D	1	D;P	0.61080	0.989;0.889	P;B	0.52909	0.713;0.418	T	0.00056	-1.2175	10	0.59425	D	0.04	-9.4749	19.9921	0.97370	0.0:1.0:0.0:0.0	.	2250;2250	F5H269;Q9Y485	.;DMXL1_HUMAN	Y	2250	ENSP00000309690:H2250Y;ENSP00000439479:H2250Y	ENSP00000309690:H2250Y	H	+	1	0	DMXL1	118538921	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.442000	0.80503	2.830000	0.97506	0.655000	0.94253	CAT			0.294	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250862.1		NM_005509	
NSD1	64324	bcgsc.ca	37	5	176636782	176636782	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr5:176636782C>G	ENST00000439151.2	+	5	1427	c.1382C>G	c.(1381-1383)aCa>aGa	p.T461R	NSD1_ENST00000361032.4_Missense_Mutation_p.T358R|NSD1_ENST00000354179.4_Missense_Mutation_p.T192R|NSD1_ENST00000347982.4_Missense_Mutation_p.T192R	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	461					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GAAGACTGCACAAATGATCCT	0.418			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.T461R				Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	416		0			c.C1382G												138.0	127.0	131.0					5																	176636782		2203	4300	6503	SO:0001583	missense	64324	exon5	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	ACTGCACAAATGA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.1382C>G	5.37:g.176636782C>G	ENSP00000395929:p.Thr461Arg		Somatic	199	0	0		WXS	Illumina HiSeq	Phase_1	115	0.00	0	NM_022455	9	0.00	0	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	9.876	1.200289	0.22121	.	.	ENSG00000165671	ENST00000354179;ENST00000355783;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93426	-3.11;-3.12;-3.11;-3.22	5.5	4.64	0.57946	.	0.404314	0.23922	N	0.043223	D	0.87974	0.6313	N	0.24115	0.695	0.25797	N	0.98455	P;P;P	0.49559	0.925;0.493;0.664	P;B;B	0.45712	0.491;0.277;0.296	T	0.80544	-0.1335	9	.	.	.	.	8.2319	0.31603	0.1549:0.765:0.0:0.08	.	192;358;461	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	R	192;192;461;192;358	ENSP00000346111:T192R;ENSP00000395929:T461R;ENSP00000343209:T192R;ENSP00000354310:T358R	.	T	+	2	0	NSD1	176569388	0.643000	0.27269	0.985000	0.45067	0.507000	0.33981	1.232000	0.32636	1.333000	0.45449	-0.229000	0.12294	ACA			0.418	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253412.2		NM_172349	
DEK	7913	mdanderson.org	37	6	18264096	18264096	+	Missense_Mutation	SNP	C	C	G	rs147127829	byFrequency	TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:18264096C>G	ENST00000397239.3	-	2	570	c.123G>C	c.(121-123)gaG>gaC	p.E41D	DEK_ENST00000244776.7_Missense_Mutation_p.E41D	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	41	Asp/Glu-rich (highly acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			cctcctcctcctcgtcgtcct	0.562			T	NUP214	AML								C|||	10	0.00199681	0.0068	0.0	5008	,	,		14423	0.0		0.0	False		,,,				2504	0.001				p.E41D				Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	.	.			0			c.G123C							-	ASP/GLU,ASP/GLU	8,4398	14.3+/-33.2	0,8,2195	43.0	47.0	45.0		123,123	-3.7	0.1	6	dbSNP_134	45	0,8600		0,0,4300	yes	missense,missense	DEK	NM_001134709.1,NM_003472.3	45,45	0,8,6495	GG,GC,CC		0.0,0.1816,0.0615	benign,benign	41/342,41/376	18264096	8,12998	2203	4300	6503	SO:0001583	missense	7913	exon2			CTCCTCCTCGTCG	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.123G>C	6.37:g.18264096C>G	ENSP00000380414:p.Glu41Asp		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	128	0.04	5	NM_003472	18	0.00	0	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.267	0.417416	0.11870	0.001816	0.0	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000515742	T;T;T	0.51817	0.76;0.85;0.69	4.57	-3.65	0.04502	.	0.440668	0.20131	N	0.098587	T	0.09598	0.0236	L	0.48642	1.525	0.22880	N	0.998611	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38585	-0.9654	10	0.12766	T	0.61	-5.206	1.3254	0.02124	0.2162:0.3697:0.1081:0.306	.	41;41	B4DN37;P35659	.;DEK_HUMAN	D	41;41;46	ENSP00000380414:E41D;ENSP00000244776:E41D;ENSP00000423553:E46D	ENSP00000244776:E41D	E	-	3	2	DEK	18372075	0.003000	0.15002	0.050000	0.19076	0.529000	0.34654	-2.192000	0.01245	-1.460000	0.01911	-2.294000	0.00264	GAG	0.001		0.562	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039962.4			
GUSBP2	387036	broad.mit.edu	37	6	26864090	26864091	+	RNA	INS	-	-	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:26864090_26864091insC	ENST00000463434.1	-	0	94									glucuronidase, beta pseudogene 2																		TTCCAGGGCATCCCCCAGCTCA	0.574																																					.													.	.			0			.																																											0	.			AGGGCATCCCCCA			6p21	2011-06-09	2011-06-09	2011-06-09	ENSG00000241549	ENSG00000241549			18792	pseudogene	pseudogene			"""spinal muscular atrophy candidate gene 3-like 2"", ""glucuronidase, beta-like 1"""	SMAC3L2, GUSBL1			Standard	NR_003504		Approved	bA239L20.5, bA239L20.1, SMA3-L, bGLU-Lp, SMAC3L	uc003nim.2		OTTHUMG00000014462		6.37:g.26864095_26864095dupC			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	.	0		0		RNA	INS	ENST00000463434.1	37																																																																																						0.574	GUSBP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000314060.1			
KCTD20	222658	broad.mit.edu	37	6	36454762	36454762	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:36454762A>G	ENST00000373731.2	+	8	1461	c.1070A>G	c.(1069-1071)aAg>aGg	p.K357R	KCTD20_ENST00000544295.1_Missense_Mutation_p.K111R|KCTD20_ENST00000449081.2_Missense_Mutation_p.K191R|KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000536244.1_Missense_Mutation_p.K212R	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	357					protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						TCATGGGAAAAGGAAGAAGGG	0.478																																					p.K357R													.	KCTD20	37		0			c.A1070G												115.0	117.0	116.0					6																	36454762		2203	4300	6503	SO:0001583	missense	222658	exon8			GGGAAAAGGAAGA	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.1070A>G	6.37:g.36454762A>G	ENSP00000362836:p.Lys357Arg		Somatic	145	0.0068965517	1		WXS	Illumina HiSeq	Phase_I	144	0.03	4	NM_173562	16	0.00	0	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	ENST00000373731.2	37	CCDS4821.1	.	.	.	.	.	.	.	.	.	.	A	35	5.466013	0.96257	.	.	ENSG00000112078	ENST00000373731;ENST00000544295;ENST00000449081;ENST00000536244	D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.90170	0.6928	M	0.66297	2.02	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.80764	0.994;0.985	D	0.91371	0.5119	10	0.87932	D	0	-27.0254	16.5582	0.84512	1.0:0.0:0.0:0.0	.	191;357	Q7Z5Y7-2;Q7Z5Y7	.;KCD20_HUMAN	R	357;111;191;212	ENSP00000362836:K357R;ENSP00000440150:K111R;ENSP00000412205:K191R;ENSP00000439118:K212R	ENSP00000362836:K357R	K	+	2	0	KCTD20	36562740	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.308000	0.77769	0.533000	0.62120	AAG			0.478	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040345.2		NM_173562	
RNF8	9025	bcgsc.ca	37	6	37358600	37358600	+	3'UTR	SNP	T	T	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:37358600T>A	ENST00000373479.4	+	0	1717				RNF8_ENST00000469731.1_Missense_Mutation_p.F440Y	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						TCTGGAGGATTCTCTCTAGCC	0.507																																					p.F440Y													.	RNF8	78		0			c.T1319A												111.0	98.0	103.0					6																	37358600		2203	4300	6503	SO:0001624	3_prime_UTR_variant	9025	exon7			GAGGATTCTCTCT	AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.*66T>A	6.37:g.37358600T>A			Somatic	88	0	0		WXS	Illumina HiSeq	Phase_1	65	0.00	0	NM_183078	137	0.00	0	A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	Missense_Mutation	SNP	ENST00000373479.4	37	CCDS4834.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.537226	0.45176	.	.	ENSG00000112130	ENST00000469731	T	0.47528	0.84	3.84	3.84	0.44239	.	.	.	.	.	T	0.35856	0.0946	.	.	.	0.29032	N	0.885653	.	.	.	.	.	.	T	0.26643	-1.0097	6	0.87932	D	0	.	9.3102	0.37900	0.0:0.0:0.0:1.0	.	.	.	.	Y	440	ENSP00000418879:F440Y	ENSP00000418879:F440Y	F	+	2	0	RNF8	37466578	0.004000	0.15560	0.004000	0.12327	0.094000	0.18550	1.063000	0.30567	1.969000	0.57287	0.533000	0.62120	TTC			0.507	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040403.2			
RRP36	88745	mdanderson.org	37	6	42993067	42993067	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:42993067G>T	ENST00000244496.5	+	3	355	c.345G>T	c.(343-345)aaG>aaT	p.K115N		NM_033112.2	NP_149103.1	Q96EU6	RRP36_HUMAN	ribosomal RNA processing 36 homolog (S. cerevisiae)	115					ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(5)|lung(1)|ovary(1)|prostate(1)	11						TTAGTAAAAAGGTAAGGAAGA	0.502																																					p.K115N													.	.			0			c.G345T												77.0	75.0	76.0					6																	42993067		2203	4300	6503	SO:0001630	splice_region_variant	88745	exon3			TAAAAAGGTAAGG	BC011933	CCDS34453.1	6p21.1	2010-07-06	2010-07-06	2010-07-06	ENSG00000124541	ENSG00000124541			21374	protein-coding gene	gene with protein product		613475	"""chromosome 6 open reading frame 153"""	C6orf153		20038530	Standard	NM_033112		Approved	dJ20C7.4	uc003otp.1	Q96EU6	OTTHUMG00000014715	ENST00000244496.5:c.345+1G>T	6.37:g.42993067G>T			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	62	0.05	3	NM_033112	85	0.00	0	Q9BRF6|Q9P0C8	Missense_Mutation	SNP	ENST00000244496.5	37	CCDS34453.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068302	0.76301	.	.	ENSG00000124541	ENST00000244496	T	0.49720	0.77	4.7	4.7	0.59300	.	0.498959	0.20406	N	0.092954	T	0.59101	0.2169	M	0.74467	2.265	0.58432	D	0.999998	D	0.71674	0.998	D	0.68483	0.958	T	0.54397	-0.8300	10	0.29301	T	0.29	.	15.9421	0.79763	0.0:0.0:1.0:0.0	.	115	Q96EU6	RRP36_HUMAN	N	115	ENSP00000244496:K115N	ENSP00000244496:K115N	K	+	3	2	RRP36	43101045	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	3.583000	0.53928	2.621000	0.88768	0.561000	0.74099	AAG			0.502	RRP36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040572.1		NM_033112	Missense_Mutation
CUL9	23113	mdanderson.org	37	6	43154177	43154177	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:43154177G>A	ENST00000252050.4	+	4	1319	c.1235G>A	c.(1234-1236)gGc>gAc	p.G412D	CUL9_ENST00000354495.3_Missense_Mutation_p.G412D|CUL9_ENST00000372647.2_Missense_Mutation_p.G412D	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	412					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AGCAACAACGGCATTCCCCCT	0.582																																					p.G412D													CUL9,NS,carcinoma,-1,1	CUL9	-1	1	0			c.G1235A												57.0	48.0	51.0					6																	43154177		2203	4300	6503	SO:0001583	missense	23113	exon4			ACAACGGCATTCC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1235G>A	6.37:g.43154177G>A	ENSP00000252050:p.Gly412Asp		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	72	0.06	4	NM_015089	1	0.00	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987917	0.35036	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.76448	-1.02;-0.99;-0.92	5.5	5.5	0.81552	CPH domain (1);Translation protein SH3-like, subgroup (1);	0.216150	0.47455	D	0.000237	D	0.85940	0.5814	M	0.83012	2.62	0.36462	D	0.866758	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79784	0.946;0.946;0.993	D	0.88479	0.3067	10	0.87932	D	0	-24.3826	13.1283	0.59368	0.0832:0.0:0.9168:0.0	.	412;412;412	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	D	412	ENSP00000252050:G412D;ENSP00000346490:G412D;ENSP00000361730:G412D	ENSP00000252050:G412D	G	+	2	0	CUL9	43262155	1.000000	0.71417	0.996000	0.52242	0.248000	0.25809	6.307000	0.72815	2.587000	0.87381	0.467000	0.42956	GGC			0.582	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040582.2		NM_015089	
CUL9	23113	mdanderson.org	37	6	43183047	43183047	+	Silent	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:43183047C>T	ENST00000252050.4	+	30	6003	c.5919C>T	c.(5917-5919)agC>agT	p.S1973S	CUL9_ENST00000354495.3_Silent_p.S1863S|CUL9_ENST00000372647.2_Silent_p.S1945S|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1973					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GCAGCCAGAGCGAAACCTCCA	0.617																																					p.S1973S													.	.			0			c.C5919T												40.0	40.0	40.0					6																	43183047		2202	4300	6502	SO:0001819	synonymous_variant	23113	exon30			CCAGAGCGAAACC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5919C>T	6.37:g.43183047C>T			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_015089	15	0.00	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	CCDS4890.1																																																																																					0.617	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040582.2		NM_015089	
AC004870.3	0	broad.mit.edu	37	7	47093180	47093180	+	lincRNA	DEL	C	C	-			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:47093180delC	ENST00000412996.1	-	0	52																											CGGGAGTCCTCCCCCCACATC	0.542																																					.													.	.			0			.																																											0	.			AGTCCTCCCCCCA																													7.37:g.47093180delC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	15	0.00	0		RNA	DEL	ENST00000412996.1	37																																																																																						0.542	AC004870.3-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000340615.1			
CASD1	64921	broad.mit.edu	37	7	94147626	94147626	+	Silent	SNP	A	A	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:94147626A>G	ENST00000297273.4	+	3	629	c.342A>G	c.(340-342)gaA>gaG	p.E114E		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	114						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TCAAAGAAGAAGGAAATAAGG	0.333																																					p.E114E													.	CASD1	70		0			c.A342G												90.0	102.0	98.0					7																	94147626		2201	4292	6493	SO:0001819	synonymous_variant	64921	exon3			AGAAGAAGGAAAT	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.342A>G	7.37:g.94147626A>G			Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	176	0.02	4	NM_022900	4	0.00	0	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Silent	SNP	ENST00000297273.4	37	CCDS5636.1																																																																																					0.333	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255216.1		NM_022900	
MUC17	140453	mdanderson.org	37	7	100681533	100681533	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:100681533C>A	ENST00000306151.4	+	3	6900	c.6836C>A	c.(6835-6837)aCt>aAt	p.T2279N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2279	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGGAACGACTCCATTAACA	0.478																																					p.T2279N													.	.			0			c.C6836A																																									SO:0001583	missense	140453	exon3			GAACGACTCCATT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6836C>A	7.37:g.100681533C>A	ENSP00000302716:p.Thr2279Asn		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	124	0.06	8	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	2.491	-0.317530	0.05386	.	.	ENSG00000169876	ENST00000306151	T	0.02472	4.28	0.762	0.762	0.18454	.	.	.	.	.	T	0.03390	0.0098	N	0.19112	0.55	0.09310	N	1	P	0.51933	0.949	P	0.51297	0.665	T	0.49679	-0.8914	9	0.35671	T	0.21	.	6.9517	0.24548	0.0:0.9999:0.0:1.0E-4	.	2279	Q685J3	MUC17_HUMAN	N	2279	ENSP00000302716:T2279N	ENSP00000302716:T2279N	T	+	2	0	MUC17	100468253	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.068000	0.14531	0.132000	0.18615	0.134000	0.15878	ACT			0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
COG5	10466	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	106888937	106888937	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:106888937T>C	ENST00000347053.3	-	16	1837	c.1787A>G	c.(1786-1788)cAt>cGt	p.H596R	COG5_ENST00000297135.3_Missense_Mutation_p.H617R|COG5_ENST00000393603.2_Missense_Mutation_p.H617R	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	596					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						CATAAGAGCATGAATAGCCTa	0.363																																					p.H617R													.	COG5	78		0			c.A1850G												89.0	86.0	87.0					7																	106888937		2203	4300	6503	SO:0001583	missense	0	exon17			AGAGCATGAATAG	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1787A>G	7.37:g.106888937T>C	ENSP00000334703:p.His596Arg		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	63	0.14	9	NM_006348	27	0.15	4	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	37	CCDS5743.1	.	.	.	.	.	.	.	.	.	.	T	8.673	0.903297	0.17760	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.55234	0.53;0.53;0.53	5.83	4.7	0.59300	.	0.274240	0.43579	D	0.000556	T	0.29355	0.0731	N	0.15975	0.35	0.21967	N	0.99945	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10405	-1.0631	10	0.16420	T	0.52	-7.0683	6.3588	0.21417	0.1411:0.0742:0.0:0.7847	.	596;617	Q9UP83;Q9UP83-2	COG5_HUMAN;.	R	596;617;617	ENSP00000334703:H596R;ENSP00000297135:H617R;ENSP00000377228:H617R	ENSP00000297135:H617R	H	-	2	0	COG5	106676173	0.999000	0.42202	0.019000	0.16419	0.194000	0.23727	3.156000	0.50708	2.231000	0.72958	0.460000	0.39030	CAT			0.363	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000060216.4			
TRPV6	55503	mdanderson.org	37	7	142573303	142573303	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:142573303C>T	ENST00000359396.3	-	8	1285	c.1040G>A	c.(1039-1041)tGc>tAc	p.C347Y	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	347					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					GCGGTAGATGCAGCACATGGT	0.572																																					p.C347Y													.	.			0			c.G1040A												137.0	136.0	136.0					7																	142573303		2203	4300	6503	SO:0001583	missense	55503	exon8			TAGATGCAGCACA	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1040G>A	7.37:g.142573303C>T	ENSP00000352358:p.Cys347Tyr		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_018646	0		0	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251866	0.80135	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	D	0.85955	-2.05	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.93294	0.7863	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.93070	0.6482	10	0.36615	T	0.2	-20.6288	16.8604	0.86016	0.0:1.0:0.0:0.0	.	347	Q9H1D0	TRPV6_HUMAN	Y	347;179	ENSP00000352358:C347Y	ENSP00000310825:C179Y	C	-	2	0	TRPV6	142283425	1.000000	0.71417	0.984000	0.44739	0.810000	0.45777	7.299000	0.78831	2.458000	0.83093	0.655000	0.94253	TGC			0.572	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347662.1		NM_014274	
PCMTD1	115294	bcgsc.ca	37	8	52733143	52733143	+	Missense_Mutation	SNP	A	A	G	rs111785933		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr8:52733143A>G	ENST00000360540.5	-	7	1248	c.842T>C	c.(841-843)gTt>gCt	p.V281A	PCMTD1_ENST00000522514.1_Missense_Mutation_p.V281A|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Missense_Mutation_p.V205A	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	281						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTCTGTTTAACTCTCTTTCT	0.393																																					p.V281A													.	PCMTD1	73		0			c.T842C												172.0	174.0	174.0					8																	52733143		2203	4300	6503	SO:0001583	missense	115294	exon6			TGTTTAACTCTCT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.842T>C	8.37:g.52733143A>G	ENSP00000353739:p.Val281Ala		Somatic	176	0.0227272727	4		WXS	Illumina HiSeq	Phase_1	186	0.07	13	NM_052937	43	0.00	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	4.043	0.005592	0.07866	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.46063	0.88;0.88;0.88	5.97	4.75	0.60458	.	0.260164	0.36972	N	0.002316	T	0.32556	0.0833	L	0.42245	1.32	0.29355	N	0.865105	B;B;B	0.18863	0.009;0.008;0.031	B;B;B	0.18263	0.015;0.005;0.021	T	0.15780	-1.0425	10	0.15066	T	0.55	-33.7683	11.4736	0.50284	0.6809:0.3191:0.0:0.0	.	151;205;281	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	A	281;205;281	ENSP00000353739:V281A;ENSP00000444026:V205A;ENSP00000428099:V281A	ENSP00000353739:V281A	V	-	2	0	PCMTD1	52895696	1.000000	0.71417	0.992000	0.48379	0.981000	0.71138	5.794000	0.69067	2.281000	0.76405	0.533000	0.62120	GTT			0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377909.2		NM_052937	
PRUNE2	158471	mdanderson.org	37	9	79259771	79259771	+	Missense_Mutation	SNP	G	G	A	rs559948086		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:79259771G>A	ENST00000376718.3	-	12	8735	c.8612C>T	c.(8611-8613)aCg>aTg	p.T2871M	PRUNE2_ENST00000443509.2_Missense_Mutation_p.T120M|PRUNE2_ENST00000223609.6_Missense_Mutation_p.T136M|PRUNE2_ENST00000428286.1_Missense_Mutation_p.T2513M|PRUNE2_ENST00000466266.2_5'UTR	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2871					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CTCTTCGGCCGTATATTCTGG	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		19040	0.0		0.0	False		,,,				2504	0.001				p.T2871M													.	.			0			c.C8612T												129.0	109.0	115.0					9																	79259771		1568	3582	5150	SO:0001583	missense	158471	exon12			TCGGCCGTATATT	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8612C>T	9.37:g.79259771G>A	ENSP00000365908:p.Thr2871Met		Somatic	114	0.0087719298	1		WXS	Illumina HiSeq	Phase_I	126	0.04	5	NM_015225	15	0.00	0	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620650	0.66787	.	.	ENSG00000106772	ENST00000376717;ENST00000376718;ENST00000428286;ENST00000441554;ENST00000443509;ENST00000424866;ENST00000223609;ENST00000422033	T;T;T;T;T;T	0.57273	0.79;0.69;0.7;0.8;0.41;0.81	6.06	6.06	0.98353	.	0.087072	0.85682	D	0.000000	T	0.65069	0.2656	L	0.33753	1.03	0.47547	D	0.99945	D;D;D;P;D	0.89917	0.999;0.997;0.996;0.56;1.0	D;P;P;B;D	0.68621	0.932;0.888;0.828;0.216;0.959	T	0.63510	-0.6621	10	0.54805	T	0.06	-15.5598	20.6243	0.99512	0.0:0.0:1.0:0.0	.	136;135;120;2872;2871	B4DSQ3;Q8WUY3-5;B4DJW7;Q8WUY3-3;Q8WUY3	.;.;.;.;PRUN2_HUMAN	M	136;2871;2513;89;120;41;136;2871	ENSP00000365907:T136M;ENSP00000365908:T2871M;ENSP00000397425:T2513M;ENSP00000393843:T120M;ENSP00000393657:T41M;ENSP00000223609:T136M	ENSP00000223609:T136M	T	-	2	0	PRUNE2	78449591	0.998000	0.40836	0.908000	0.35775	0.646000	0.38490	4.004000	0.57068	2.879000	0.98667	0.650000	0.86243	ACG			0.517	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052730.2		NM_138818	
PTGR1	22949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	114356535	114356535	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:114356535T>G	ENST00000407693.2	-	3	381	c.119A>C	c.(118-120)gAa>gCa	p.E40A	PTGR1_ENST00000538962.1_Missense_Mutation_p.E40A|PTGR1_ENST00000238248.3_5'UTR|PTGR1_ENST00000309195.5_Missense_Mutation_p.E40A	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	40					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						GAACAAAGCTTCAAGCAGGAC	0.428																																					p.E40A	Ovarian(200;132 2151 7551 19220 46064)												.	.			0			c.A119C												103.0	91.0	95.0					9																	114356535		2203	4300	6503	SO:0001583	missense	22949	exon3			AAAGCTTCAAGCA	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.119A>C	9.37:g.114356535T>G	ENSP00000385763:p.Glu40Ala		Somatic	132	0	0		WXS	Illumina HiSeq	.	111	0.50	55	NM_001146108	85	0.33	28	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Missense_Mutation	SNP	ENST00000407693.2	37	CCDS6779.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.220917	0.39201	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000333580;ENST00000422125;ENST00000374313;ENST00000374308	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.56	4.56	0.56223	GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.77820	2.39	0.80722	D	1	D;D;P	0.71674	0.998;0.997;0.627	D;D;B	0.68353	0.957;0.927;0.211	T	0.72450	-0.4290	10	0.72032	D	0.01	0.2091	13.5711	0.61847	0.0:0.0:0.0:1.0	.	40;40;40	F5GY50;B4DPK3;Q14914	.;.;PTGR1_HUMAN	A	40	ENSP00000440281:E40A;ENSP00000311572:E40A;ENSP00000385763:E40A;ENSP00000395965:E40A	ENSP00000311572:E40A	E	-	2	0	PTGR1	113396356	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.672000	0.61597	1.995000	0.58328	0.460000	0.39030	GAA			0.428	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053647.2			
SLC2A6	11182	mdanderson.org	37	9	136340191	136340191	+	Silent	SNP	G	G	A			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:136340191G>A	ENST00000371899.4	-	6	896	c.819C>T	c.(817-819)tgC>tgT	p.C273C	SLC2A6_ENST00000485978.1_5'UTR|SLC2A6_ENST00000371897.4_Silent_p.C273C	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	273					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		TGATGGGCCGGCACACGTGTG	0.667																																					p.C273C													.	.			0			c.C819T												23.0	18.0	20.0					9																	136340191		2189	4296	6485	SO:0001819	synonymous_variant	11182	exon6			GGGCCGGCACACG	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.819C>T	9.37:g.136340191G>A			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001145099	6	0.00	0	A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	ENST00000371899.4	37	CCDS6975.1																																																																																					0.667	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054909.1		NM_017585	
CNKSR2	22866	bcgsc.ca	37	X	21519642	21519642	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:21519642C>T	ENST00000379510.3	+	8	782	c.746C>T	c.(745-747)cCt>cTt	p.P249L	CNKSR2_ENST00000543067.1_Missense_Mutation_p.P249L|CNKSR2_ENST00000425654.2_Missense_Mutation_p.P249L|CNKSR2_ENST00000279451.4_Missense_Mutation_p.P249L	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	249	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ATTCAGTCACCTGCAGATCGG	0.348																																					p.P249L													.	CNKSR2	158		0			c.C746T												47.0	44.0	45.0					X																	21519642		2202	4299	6501	SO:0001583	missense	22866	exon8			AGTCACCTGCAGA	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.746C>T	X.37:g.21519642C>T	ENSP00000368824:p.Pro249Leu		Somatic	206	0	0		WXS	Illumina HiSeq	Phase_1	234	0.00	0	NM_001168647	0		0	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667907	0.67814	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.98	5.09	0.68999	PDZ/DHR/GLGF (4);	0.057904	0.64402	D	0.000001	T	0.59128	0.2171	H	0.95437	3.67	0.80722	D	1	B;B;B	0.32128	0.105;0.151;0.357	B;B;P	0.44921	0.211;0.168;0.464	T	0.67417	-0.5676	10	0.56958	D	0.05	-18.6417	15.6383	0.76973	0.1375:0.8625:0.0:0.0	.	249;249;249	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	L	249	ENSP00000397906:P249L;ENSP00000444633:P249L;ENSP00000279451:P249L;ENSP00000368824:P249L	ENSP00000279451:P249L	P	+	2	0	CNKSR2	21429563	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.174000	0.58256	2.524000	0.85096	0.544000	0.68410	CCT			0.348	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056019.1		NM_014927	
ZXDB	158586	mdanderson.org	37	X	57618621	57618621	+	Missense_Mutation	SNP	T	T	C	rs368802496		TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:57618621T>C	ENST00000374888.1	+	1	353	c.140T>C	c.(139-141)cTc>cCc	p.L47P		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	47					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.L47P(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CTCCTGCTGCTCCGGGGCCCC	0.786																																					p.L47P													.	.			1	Substitution - Missense(1)	skin(1)	c.T140C																																									SO:0001583	missense	158586	exon1			TGCTGCTCCGGGG	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.140T>C	X.37:g.57618621T>C	ENSP00000364023:p.Leu47Pro		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_007157	0		0	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	5.023	0.189870	0.09547	.	.	ENSG00000198455	ENST00000374888	T	0.46451	0.87	2.43	2.43	0.29744	.	0.229752	0.27966	N	0.017140	T	0.32255	0.0823	L	0.52573	1.65	0.49582	D	0.999801	B	0.02656	0.0	B	0.04013	0.001	T	0.10941	-1.0608	10	0.27082	T	0.32	.	7.9262	0.29876	0.0:0.0:0.0:1.0	.	47	P98169	ZXDB_HUMAN	P	47	ENSP00000364023:L47P	ENSP00000364023:L47P	L	+	2	0	ZXDB	57635346	0.000000	0.05858	0.900000	0.35374	0.074000	0.17049	-0.375000	0.07475	1.201000	0.43203	0.393000	0.25936	CTC			0.786	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056922.1		NM_007157	
DOCK11	139818	bcgsc.ca	37	X	117680026	117680026	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-01A-12D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1cc9688-b055-48ba-a634-7f51a8df3220	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:117680026C>G	ENST00000276202.7	+	6	568	c.505C>G	c.(505-507)Caa>Gaa	p.Q169E	DOCK11_ENST00000276204.6_Missense_Mutation_p.Q169E	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	169	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGTGATAAAACAAGGCTGGTT	0.348																																					p.Q169E													.	DOCK11	185		0			c.C505G												147.0	123.0	131.0					X																	117680026		2203	4300	6503	SO:0001583	missense	139818	exon6			ATAAAACAAGGCT	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.505C>G	X.37:g.117680026C>G	ENSP00000276202:p.Gln169Glu		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_1	59	0.00	0	NM_144658	1	0.00	0	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	C	11.64	1.699608	0.30142	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.72835	-0.69;-0.69	5.24	5.24	0.73138	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.56396	0.1982	N	0.17564	0.495	0.58432	D	0.999998	B	0.33583	0.418	B	0.39617	0.305	T	0.55360	-0.8153	10	0.02654	T	1	-0.3626	16.5446	0.84426	0.0:1.0:0.0:0.0	.	169	Q5JSL3	DOC11_HUMAN	E	169	ENSP00000276204:Q169E;ENSP00000276202:Q169E	ENSP00000276202:Q169E	Q	+	1	0	DOCK11	117564054	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.970000	0.76099	2.162000	0.67917	0.600000	0.82982	CAA			0.348	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000356002.1		NM_144658	
