#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MXRA8	54587	mdanderson.org	37	1	1290395	1290395	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:1290395G>T	ENST00000309212.6	-	5	646	c.616C>A	c.(616-618)Cac>Aac	p.H206N	MXRA8_ENST00000445648.2_Missense_Mutation_p.H206N|MXRA8_ENST00000342753.4_Missense_Mutation_p.H105N|MXRA8_ENST00000477278.2_Missense_Mutation_p.H197N	NM_001282582.1|NM_032348.2	NP_001269511.1|NP_115724.1	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8	206	Ig-like V-type 2.				establishment of glial blood-brain barrier (GO:0060857)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CGGTCCCAGTGCACCACCTGT	0.746																																					p.H206N													.	.			0			c.C616A												7.0	8.0	8.0					1																	1290395		1974	3931	5905	SO:0001583	missense	54587	exon5			CCCAGTGCACCAC	BC006213	CCDS24.1, CCDS59950.1, CCDS59951.1, CCDS59952.1	1p36.33	2013-01-11			ENSG00000162576	ENSG00000162576		"""Immunoglobulin superfamily / V-set domain containing"""	7542	protein-coding gene	gene with protein product	"""limitrin"""					14603461	Standard	XM_005244758		Approved	DKFZp586E2023	uc001aew.3	Q9BRK3	OTTHUMG00000002973	ENST00000309212.6:c.616C>A	1.37:g.1290395G>T	ENSP00000307887:p.His206Asn		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_032348	5	0.00	0	B3KTR6|B4DE34|Q5TA39|Q96KC3	Missense_Mutation	SNP	ENST00000309212.6	37	CCDS24.1	.	.	.	.	.	.	.	.	.	.	.	17.89	3.498793	0.64298	.	.	ENSG00000162576	ENST00000309212;ENST00000378864;ENST00000342753;ENST00000445648	T;T;T	0.65549	-0.16;-0.16;-0.16	3.88	3.88	0.44766	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.77301	0.4110	M	0.71581	2.175	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;0.999;0.997;0.999;1.0	D;D;D;D;D	0.85130	0.986;0.997;0.992;0.976;0.986	T	0.80786	-0.1227	10	0.66056	D	0.02	-21.9829	14.9137	0.70778	0.0:0.0:1.0:0.0	.	197;105;184;206;206	B3KTR6;B4DE34;B4E385;Q9BRK3-2;Q9BRK3	.;.;.;.;MXRA8_HUMAN	N	206;197;105;206	ENSP00000307887:H206N;ENSP00000344998:H105N;ENSP00000399229:H206N	ENSP00000307887:H206N	H	-	1	0	MXRA8	1280258	1.000000	0.71417	0.997000	0.53966	0.233000	0.25261	9.355000	0.97087	1.714000	0.51371	0.291000	0.19559	CAC			0.746	MXRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008282.2		NM_032348	
PTCHD2	57540	broad.mit.edu	37	1	11584023	11584023	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:11584023G>T	ENST00000294484.6	+	11	2525	c.2387G>T	c.(2386-2388)aGc>aTc	p.S796I	PTCHD2_ENST00000389575.3_Missense_Mutation_p.S796I	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	796					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.S1013N(1)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		AAGCCCCACAGCCTGCAGAAC	0.662																																					p.S796I													PTCHD2,NS,carcinoma,0,2	PTCHD2	193	2	1	Substitution - Missense(1)	lung(1)	c.G2387T												36.0	43.0	41.0					1																	11584023		1935	4134	6069	SO:0001583	missense	57540	exon11			CCCACAGCCTGCA	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2387G>T	1.37:g.11584023G>T	ENSP00000294484:p.Ser796Ile		Somatic	198	0.0050505051	1		WXS	Illumina HiSeq	Phase_I	150	0.06	9	NM_020780	2	0.00	0	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.849718	0.71603	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.90900	-2.75;-2.75	5.25	4.33	0.51752	.	0.254256	0.45606	D	0.000353	D	0.85248	0.5653	L	0.27053	0.805	0.46149	D	0.998897	P	0.51351	0.944	B	0.44044	0.439	D	0.86814	0.2000	10	0.62326	D	0.03	-38.1978	12.3556	0.55174	0.0808:0.0:0.9192:0.0	.	796	Q9P2K9	PTHD2_HUMAN	I	796	ENSP00000294484:S796I;ENSP00000374226:S796I	ENSP00000294484:S796I	S	+	2	0	PTCHD2	11506610	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	1.933000	0.40153	2.455000	0.83008	0.561000	0.74099	AGC			0.662	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000005770.2		XM_052561	
C1orf228	339541	ucsc.edu	37	1	45191012	45191012	+	Silent	SNP	G	G	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:45191012G>C	ENST00000458657.2	+	13	1567	c.1260G>C	c.(1258-1260)tcG>tcC	p.S420S	C1orf228_ENST00000535358.1_Silent_p.S420S			Q6PIY5	CA228_HUMAN	chromosome 1 open reading frame 228	420										central_nervous_system(1)	1						TCTATGGCTCGCGCGATTCGG	0.622																																					p.S420S													.	C1orf228	15		0			c.G1260C												40.0	39.0	39.0					1																	45191012		692	1591	2283	SO:0001819	synonymous_variant	339541	exon12			TGGCTCGCGCGAT	AL122004, AY254217, BC026115	CCDS53311.1	1p34.1	2011-02-22	2009-03-17	2009-03-17	ENSG00000198520	ENSG00000198520			34345	protein-coding gene	gene with protein product			"""non-protein coding RNA 82"""	NCRNA00082		12477932	Standard	NM_001145636		Approved	MGC33556, p40	uc001cmf.2	Q6PIY5	OTTHUMG00000007834	ENST00000458657.2:c.1260G>C	1.37:g.45191012G>C			Somatic	319	0.0501567398	16		RNA-Seq	Illumina HiSeq		277	0.10	27	NM_001145636	37	0.19	7	A1KXE5	Silent	SNP	ENST00000458657.2	37	CCDS53311.1																																																																																					0.622	C1orf228-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000023125.2		NM_001145636	
DAP3	7818	mdanderson.org	37	1	155679576	155679576	+	Missense_Mutation	SNP	G	G	T	rs372811843		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:155679576G>T	ENST00000368336.5	+	2	130	c.6G>T	c.(4-6)atG>atT	p.M2I	DAP3_ENST00000471642.2_Missense_Mutation_p.M2I|DAP3_ENST00000535183.1_Missense_Mutation_p.M2I|DAP3_ENST00000496863.1_3'UTR|DAP3_ENST00000465375.1_Missense_Mutation_p.M2I|DAP3_ENST00000421487.2_Missense_Mutation_p.M2I|MSTO1_ENST00000538143.1_Intron|MSTO1_ENST00000452804.2_Intron|RP11-243J18.2_ENST00000432858.1_RNA|DAP3_ENST00000343043.3_Missense_Mutation_p.M2I	NM_001199849.1|NM_004632.3	NP_001186778.1|NP_004623.1	P51398	RT29_HUMAN	death associated protein 3	2					apoptotic mitochondrial changes (GO:0008637)|apoptotic signaling pathway (GO:0097190)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	24	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CAAGGATGATGCTGAAAGGAA	0.388																																					p.M2I													.	.			0			c.G6T												156.0	137.0	143.0					1																	155679576		2203	4300	6503	SO:0001583	missense	7818	exon2			GATGATGCTGAAA	X83544	CCDS1120.1, CCDS55646.1, CCDS55647.1	1q22	2012-11-14			ENSG00000132676	ENSG00000132676		"""Mitochondrial ribosomal proteins / small subunits"""	2673	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S29"""	602074				7499268, 9284927	Standard	NM_004632		Approved	MRPS29, DAP-3, MRP-S29, bMRP-10, MGC126058, MGC126059, DKFZp686G12159	uc001flr.3	P51398	OTTHUMG00000035439	ENST00000368336.5:c.6G>T	1.37:g.155679576G>T	ENSP00000357320:p.Met2Ile		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	50	0.08	4	NM_033657	118	0.00	0	B4DP59|B4DY62|E7EM60|Q13044|Q68CT7|Q96Q20	Missense_Mutation	SNP	ENST00000368336.5	37	CCDS1120.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458767	0.63401	.	.	ENSG00000132676	ENST00000368336;ENST00000343043;ENST00000421487;ENST00000535183	T;T;T;T	0.50548	0.98;0.98;0.76;0.74	4.02	4.02	0.46733	.	0.131884	0.45867	D	0.000335	T	0.32346	0.0826	L	0.33485	1.01	0.28704	N	0.903932	P;B;B;B	0.35872	0.525;0.001;0.001;0.001	P;B;B;B	0.45428	0.48;0.003;0.003;0.003	T	0.28870	-1.0030	10	0.87932	D	0	-5.7101	13.5056	0.61481	0.0:0.0:1.0:0.0	.	2;2;2;2	B4DP59;B4DY62;E7EM60;P51398	.;.;.;RT29_HUMAN	I	2	ENSP00000357320:M2I;ENSP00000341692:M2I;ENSP00000412605:M2I;ENSP00000445003:M2I	ENSP00000341692:M2I	M	+	3	0	DAP3	153946200	1.000000	0.71417	0.999000	0.59377	0.735000	0.41995	4.375000	0.59549	2.214000	0.71695	0.591000	0.81541	ATG			0.388	DAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086042.1		NM_004632	
CACNA1E	777	bcgsc.ca	37	1	181765833	181765833	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:181765833G>A	ENST00000367573.2	+	47	6238	c.6238G>A	c.(6238-6240)Ggc>Agc	p.G2080S	CACNA1E_ENST00000360108.3_Missense_Mutation_p.G2061S|CACNA1E_ENST00000367567.4_Missense_Mutation_p.G1644S|CACNA1E_ENST00000357570.5_Missense_Mutation_p.G2031S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.G2037S|CACNA1E_ENST00000526775.1_Missense_Mutation_p.G2018S|CACNA1E_ENST00000358338.5_Missense_Mutation_p.G1969S	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2080					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCGCTCAGGGGGCAGGGAGCG	0.542																																					p.G2080S													.	CACNA1E	778		0			c.G6238A												45.0	47.0	47.0					1																	181765833		1958	4160	6118	SO:0001583	missense	777	exon47			TCAGGGGGCAGGG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6238G>A	1.37:g.181765833G>A	ENSP00000356545:p.Gly2080Ser		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_1	96	0.01	1	NM_001205293	0		0	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.194043	0.58017	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.95918	-3.78;-3.78;-3.74;-3.78;-3.85;-3.74;-3.74	5.91	5.91	0.95273	.	0.632802	0.16303	N	0.220369	D	0.90345	0.6979	N	0.08118	0	0.51233	D	0.999912	B;B	0.29136	0.234;0.1	B;B	0.32289	0.143;0.068	D	0.86345	0.1707	10	0.16420	T	0.52	.	19.8936	0.96942	0.0:0.0:1.0:0.0	.	2018;2037	Q15878-2;Q15878-3	.;.	S	2037;2018;2031;1969;1644;2061;2080	ENSP00000356542:G2037S;ENSP00000434814:G2018S;ENSP00000350183:G2031S;ENSP00000351101:G1969S;ENSP00000356539:G1644S;ENSP00000353222:G2061S;ENSP00000356545:G2080S	ENSP00000350183:G2031S	G	+	1	0	CACNA1E	180032456	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.472000	0.66768	2.793000	0.96121	0.655000	0.94253	GGC			0.542	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000090793.2		NM_000721	
NAV1	89796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	201778383	201778383	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:201778383C>G	ENST00000367296.4	+	21	4719	c.4299C>G	c.(4297-4299)atC>atG	p.I1433M	NAV1_ENST00000367297.4_Missense_Mutation_p.I1425M|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000367302.1_Missense_Mutation_p.I1386M|NAV1_ENST00000295624.6_Missense_Mutation_p.I1430M|NAV1_ENST00000367295.1_Missense_Mutation_p.I1039M|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367300.3_Missense_Mutation_p.I1373M	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1433					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						AGCACATCATCAAAGGGGTAA	0.517																																					p.I1433M													.	.			0			c.C4299G												98.0	96.0	96.0					1																	201778383		2203	4300	6503	SO:0001583	missense	89796	exon21			CATCATCAAAGGG	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4299C>G	1.37:g.201778383C>G	ENSP00000356265:p.Ile1433Met		Somatic	400	0	0		WXS	Illumina HiSeq	.	406	0.13	51	NM_020443	42	0.24	10	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543324	0.65198	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	T;T;T;T;T;T	0.07114	3.24;3.22;3.22;3.22;3.24;3.23	5.57	5.57	0.84162	.	0.181162	0.48286	D	0.000188	T	0.12092	0.0294	L	0.29908	0.895	0.43214	D	0.995088	P;P	0.50443	0.935;0.935	P;P	0.52856	0.711;0.52	T	0.05338	-1.0891	10	0.34782	T	0.22	-35.5935	12.5291	0.56104	0.0:0.923:0.0:0.077	.	1039;1430	Q8NEY1-5;Q8NEY1-3	.;.	M	1386;1433;1430;1425;1373;1039	ENSP00000356271:I1386M;ENSP00000356265:I1433M;ENSP00000295624:I1430M;ENSP00000356266:I1425M;ENSP00000356269:I1373M;ENSP00000356264:I1039M	ENSP00000295624:I1430M	I	+	3	3	NAV1	200045006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.532000	0.53553	2.620000	0.88729	0.563000	0.77884	ATC			0.517	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000087013.1		NM_020443	
ACTN2	88	broad.mit.edu	37	1	236907951	236907951	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:236907951G>T	ENST00000366578.4	+	12	1447	c.1281G>T	c.(1279-1281)aaG>aaT	p.K427N	ACTN2_ENST00000546208.1_5'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.K427N|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	427					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGCTGCAGAAGGATTACGAGT	0.592																																					p.K427N													ACTN2,NS,carcinoma,0,1	ACTN2	191	1	0			c.G1281T												51.0	47.0	48.0					1																	236907951		2203	4300	6503	SO:0001583	missense	88	exon12			GCAGAAGGATTAC	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1281G>T	1.37:g.236907951G>T	ENSP00000355537:p.Lys427Asn		Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	150	0.03	5	NM_001103	2	0.00	0	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117100	0.37339	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.50548	0.74;0.74	5.17	4.24	0.50183	.	0.263564	0.36932	N	0.002340	T	0.43077	0.1231	N	0.17723	0.515	0.80722	D	1	B;B;P;P	0.40197	0.408;0.0;0.706;0.555	P;B;P;P	0.50162	0.633;0.004;0.633;0.621	T	0.18555	-1.0333	10	0.27082	T	0.32	.	13.4388	0.61101	0.0761:0.0:0.9239:0.0	.	212;427;197;427	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	N	427;427;196	ENSP00000443495:K427N;ENSP00000355537:K427N	ENSP00000355537:K427N	K	+	3	2	ACTN2	234974574	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	2.783000	0.47766	2.546000	0.85860	0.563000	0.77884	AAG			0.592	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000096628.1		NM_001103	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	237789007	237789007	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr1:237789007A>C	ENST00000366574.2	+	40	6386	c.6069A>C	c.(6067-6069)ttA>ttC	p.L2023F	RYR2_ENST00000542537.1_Missense_Mutation_p.L2007F|RYR2_ENST00000360064.6_Missense_Mutation_p.L2021F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2023	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACAGTGATTTAACAATTAGAG	0.393																																					p.L2023F													.	.			0			c.A6069C												127.0	119.0	121.0					1																	237789007		1840	4091	5931	SO:0001583	missense	6262	exon40			TGATTTAACAATT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6069A>C	1.37:g.237789007A>C	ENSP00000355533:p.Leu2023Phe		Somatic	65	0	0		WXS	Illumina HiSeq	.	73	0.14	10	NM_001035	1	0.00	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	7.281	0.609083	0.14066	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.72942	-0.7;-0.7;-0.7	5.61	-1.25	0.09405	.	0.124078	0.31577	U	0.007406	T	0.37571	0.1008	N	0.04959	-0.14	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07654	-1.0761	10	0.09843	T	0.71	.	5.1162	0.14834	0.523:0.2642:0.2127:0.0	.	2023	Q92736	RYR2_HUMAN	F	2023;2021;2007	ENSP00000355533:L2023F;ENSP00000353174:L2021F;ENSP00000443798:L2007F	ENSP00000353174:L2021F	L	+	3	2	RYR2	235855630	0.996000	0.38824	0.986000	0.45419	0.974000	0.67602	0.535000	0.23114	-0.144000	0.11314	-0.256000	0.11100	TTA			0.393	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095402.2		NM_001035	
TUBB8	347688	broad.mit.edu	37	10	93576	93576	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:93576C>A	ENST00000309812.4	-	4	818	c.756G>T	c.(754-756)aaG>aaT	p.K252N	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.K180N|TUBB8_ENST00000413237.3_5'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	252					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TCACGGCCAGCTTCCGCAGGT	0.637																																					p.K252N	Pancreas(192;2041 3010 9013 18103)												.	TUBB8	62		0			c.G756T																																									SO:0001583	missense	347688	exon4			GGCCAGCTTCCGC	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.756G>T	10.37:g.93576C>A	ENSP00000311042:p.Lys252Asn		Somatic	56	0.0535714286	3		WXS	Illumina HiSeq	Phase_I	56	0.20	11	NM_177987	34	0.12	4	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	C	9.162	1.018933	0.19355	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	D	0.84730	-1.89	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (1);Tubulin/FtsZ, GTPase domain (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	U	0.000005	D	0.91855	0.7422	H	0.95470	3.675	0.30273	N	0.792117	D;P	0.57899	0.981;0.913	D;P	0.67231	0.95;0.651	D	0.85771	0.1355	9	0.87932	D	0	.	2.6649	0.05041	0.0:0.5123:0.0:0.4877	.	215;252	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	N	180;218;215;252	ENSP00000403895:K180N	ENSP00000272035:K218N	K	-	3	2	RP11-631M21.2	83576	0.976000	0.34144	0.273000	0.24645	0.277000	0.26821	-0.046000	0.11983	0.119000	0.18210	0.121000	0.15741	AAG			0.637	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467795.1		NM_177987	
DDIT4	54541	mdanderson.org	37	10	74034708	74034708	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:74034708G>T	ENST00000307365.3	+	3	662	c.461G>T	c.(460-462)gGc>gTc	p.G154V	RP11-442H21.2_ENST00000491934.2_RNA	NM_019058.2	NP_061931.1	Q9NX09	DDIT4_HUMAN	DNA-damage-inducible transcript 4	154					brain development (GO:0007420)|cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of glycolytic process (GO:0045820)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of TOR signaling (GO:0032007)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron death (GO:1901216)|protein complex disassembly (GO:0043241)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|lung(5)|pancreas(1)|prostate(2)|urinary_tract(1)	12						GTGGAGCAGGGCAAGAGCTGC	0.687											OREG0020262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G154V													.	.			0			c.G461T												26.0	29.0	28.0					10																	74034708		2203	4299	6502	SO:0001583	missense	54541	exon3			AGCAGGGCAAGAG	AK000507	CCDS7315.1	10q22.1	2008-05-14			ENSG00000168209	ENSG00000168209			24944	protein-coding gene	gene with protein product	"""HIF-1 responsive RTP801"""	607729				11884613	Standard	NM_019058		Approved	RTP801, FLJ20500, REDD-1, REDD1, Dig2	uc001jsx.1	Q9NX09	OTTHUMG00000018435	ENST00000307365.3:c.461G>T	10.37:g.74034708G>T	ENSP00000307305:p.Gly154Val		Somatic	55	0	0	1149	WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_019058	269	0.00	0	Q9H0S3	Missense_Mutation	SNP	ENST00000307365.3	37	CCDS7315.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197986	0.79015	.	.	ENSG00000168209	ENST00000307365	T	0.44881	0.91	5.21	5.21	0.72293	.	0.051267	0.85682	D	0.000000	T	0.62913	0.2467	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.65549	-0.6141	10	0.72032	D	0.01	-38.9917	18.7735	0.91901	0.0:0.0:1.0:0.0	.	154	Q9NX09	DDIT4_HUMAN	V	154	ENSP00000307305:G154V	ENSP00000307305:G154V	G	+	2	0	DDIT4	73704714	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.201000	0.72124	2.419000	0.82065	0.563000	0.77884	GGC			0.687	DDIT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048577.1		NM_019058	
NKX1-2	390010	mdanderson.org	37	10	126136245	126136245	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr10:126136245G>T	ENST00000451024.3	-	2	926	c.686C>A	c.(685-687)gCg>gAg	p.A229E	NKX1-2_ENST00000440536.2_Missense_Mutation_p.A251E|RP13-238F13.5_ENST00000602332.1_lincRNA|RP13-238F13.3_ENST00000604581.1_RNA	NM_001146340.1	NP_001139812.1	Q9UD57	NKX12_HUMAN	NK1 homeobox 2	229	Gly-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)										ccccacctgcgccgcgccgTC	0.741																																					p.A229E													.	.			0			c.C686A												16.0	13.0	14.0					10																	126136245		692	1587	2279	SO:0001583	missense	390010	exon2			ACCTGCGCCGCGC	CN285329	CCDS59221.1	10q26.13	2012-03-09	2007-07-09	2006-06-29		ENSG00000229544		"""Homeoboxes / ANTP class : NKL subclass"""	31652	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 121"", ""NK1 transcription factor related, locus 2 (Drosophila)"""	C10orf121		10681422	Standard	NM_001146340		Approved	bB238F13.2	uc010quf.2	Q9UD57		ENST00000451024.3:c.686C>A	10.37:g.126136245G>T	ENSP00000451945:p.Ala229Glu		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001146340	2	0.00	0		Missense_Mutation	SNP	ENST00000451024.3	37	CCDS59221.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827878	0.50845	.	.	ENSG00000229544	ENST00000451024;ENST00000440536	D;D	0.91068	-2.71;-2.78	3.72	1.79	0.24919	Homeodomain-like (1);	.	.	.	.	D	0.89061	0.6608	L	0.31845	0.965	0.22648	N	0.998898	D	0.58970	0.984	P	0.56398	0.797	T	0.79271	-0.1872	8	.	.	.	.	8.5868	0.33664	0.2002:0.0:0.7998:0.0	.	229	Q9UD57	NKX12_HUMAN	E	229;251	ENSP00000451945:A229E;ENSP00000450924:A251E	.	A	-	2	0	NKX1-2	126126235	0.000000	0.05858	0.980000	0.43619	0.213000	0.24496	-0.115000	0.10741	0.356000	0.24157	0.455000	0.32223	GCG			0.741	NKX1-2-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050861.3		XM_372331	
CEND1	51286	mdanderson.org	37	11	788334	788334	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:788334G>T	ENST00000330106.4	-	2	418	c.243C>A	c.(241-243)gcC>gcA	p.A81A	CEND1_ENST00000524587.1_5'UTR	NM_016564.3	NP_057648.2	Q8N111	CEND_HUMAN	cell cycle exit and neuronal differentiation 1	81					adult walking behavior (GO:0007628)|cerebellar granular layer maturation (GO:0021686)|cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|radial glia guided migration of cerebellar granule cell (GO:0021933)	integral component of membrane (GO:0016021)				prostate(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGACCGTGGGGGCTGGCTTCA	0.701																																					p.A81A													.	.			0			c.C243A												37.0	41.0	39.0					11																	788334		2203	4299	6502	SO:0001819	synonymous_variant	51286	exon2			CGTGGGGGCTGGC	AK074547	CCDS7714.1	11p15.5	2006-06-14			ENSG00000184524	ENSG00000184524			24153	protein-coding gene	gene with protein product		608213				11311134	Standard	NM_016564		Approved	FLJ90066, BM88	uc001lrh.1	Q8N111	OTTHUMG00000133308	ENST00000330106.4:c.243C>A	11.37:g.788334G>T			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_016564	9	0.00	0	Q9NYM6	Silent	SNP	ENST00000330106.4	37	CCDS7714.1																																																																																					0.701	CEND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257105.1		NM_016564	
TSPAN4	7106	mdanderson.org	37	11	864455	864455	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:864455C>G	ENST00000397404.1	+	5	533	c.274C>G	c.(274-276)Ctg>Gtg	p.L92V	TSPAN4_ENST00000346501.4_Missense_Mutation_p.L92V|TSPAN4_ENST00000397397.2_Missense_Mutation_p.L92V|TSPAN4_ENST00000409531.1_Missense_Mutation_p.L111V|TSPAN4_ENST00000397396.1_Missense_Mutation_p.L28V|TSPAN4_ENST00000397411.2_Missense_Mutation_p.L92V|TSPAN4_ENST00000525201.1_Missense_Mutation_p.L28V|TSPAN4_ENST00000397406.1_Missense_Mutation_p.L92V|TSPAN4_ENST00000409543.2_Missense_Mutation_p.L92V|TSPAN4_ENST00000397408.1_Missense_Mutation_p.L92V	NM_001025237.1	NP_001020408.1	O14817	TSN4_HUMAN	tetraspanin 4	92					protein complex assembly (GO:0006461)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	antigen binding (GO:0003823)|integrin binding (GO:0005178)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)	3		all_cancers(49;2.64e-08)|all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)		all cancers(45;4.32e-25)|Epithelial(43;3.29e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGCTGCTGCTGGTGTTCCT	0.672																																					p.L92V													TSPAN4,NS,carcinoma,0,1	TSPAN4	0	1	0			c.C274G												98.0	95.0	96.0					11																	864455		2203	4299	6502	SO:0001583	missense	7106	exon5			CTGCTGCTGGTGT	AF022813	CCDS7721.1, CCDS41589.1	11p15.5	2013-02-14	2005-03-21	2005-03-21	ENSG00000214063	ENSG00000214063		"""Tetraspanins"""	11859	protein-coding gene	gene with protein product		602644	"""transmembrane 4 superfamily member 7"""	TM4SF7		9360996	Standard	XM_005253102		Approved	NAG-2, TSPAN-4, TETRASPAN	uc001lsf.1	O14817	OTTHUMG00000133305	ENST00000397404.1:c.274C>G	11.37:g.864455C>G	ENSP00000380553:p.Leu92Val		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001025237	121	0.00	0	Q6IAP6	Missense_Mutation	SNP	ENST00000397404.1	37	CCDS7721.1	.	.	.	.	.	.	.	.	.	.	C	7.339	0.620549	0.14193	.	.	ENSG00000214063	ENST00000397397;ENST00000397411;ENST00000397396;ENST00000397408;ENST00000525334;ENST00000397406;ENST00000409543;ENST00000525201;ENST00000397404;ENST00000532375;ENST00000346501;ENST00000409531;ENST00000527644	T;T;T;T;T;T;T;T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	3.04	1.98	0.26296	.	0.388801	0.23310	N	0.049564	T	0.54431	0.1858	N	0.04508	-0.205	0.32506	N	0.538191	B	0.12013	0.005	B	0.15870	0.014	T	0.53493	-0.8431	10	0.17369	T	0.5	.	6.829	0.23898	0.4405:0.5595:0.0:0.0	.	92	O14817	TSN4_HUMAN	V	92;92;28;92;28;92;92;28;92;28;92;111;92	ENSP00000380552:L92V;ENSP00000380558:L92V;ENSP00000380551:L28V;ENSP00000380555:L92V;ENSP00000433980:L28V;ENSP00000380554:L92V;ENSP00000386513:L92V;ENSP00000431943:L28V;ENSP00000380553:L92V;ENSP00000434818:L28V;ENSP00000324304:L92V;ENSP00000386899:L111V;ENSP00000436260:L92V	ENSP00000324304:L92V	L	+	1	2	TSPAN4	854455	0.162000	0.22906	1.000000	0.80357	0.819000	0.46315	0.131000	0.15870	1.557000	0.49525	0.313000	0.20887	CTG			0.672	TSPAN4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257102.2			
MUC2	4583	mdanderson.org	37	11	1093324	1093324	+	Missense_Mutation	SNP	G	G	A	rs201143282		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:1093324G>A	ENST00000441003.2	+	30	5170	c.5143G>A	c.(5143-5145)Ggc>Agc	p.G1715S	MUC2_ENST00000359061.5_Missense_Mutation_p.G1682S|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.G3S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																					p.G1715S													MUC2_ENST00000441003,uveal_tract,malignant_melanoma,0,2	MUC2_ENST00000441003	0	2	0			c.G5143A												178.0	224.0	208.0					11																	1093324		1930	3651	5581	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5143G>A	11.37:g.1093324G>A	ENSP00000415183:p.Gly1715Ser		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	7.149	0.583420	0.13749	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.11;3.17;2.32	1.64	0.221	0.15283	.	155.122000	0.02480	U	0.088379	T	0.09686	0.0238	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22556	-1.0213	9	0.19147	T	0.46	.	3.4701	0.07563	0.7575:0.0:0.2425:0.0	.	1715	E7EUV1	.	S	1715;1682;3	ENSP00000415183:G1715S;ENSP00000351956:G1682S;ENSP00000331373:G3S	ENSP00000331373:G3S	G	+	1	0	MUC2	1083324	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.131000	0.10482	-0.042000	0.13535	-1.076000	0.02234	GGC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
MRVI1	10335	mdanderson.org	37	11	10651257	10651257	+	Splice_Site	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:10651257G>A	ENST00000436272.1	-	4	453	c.375C>T	c.(373-375)gaC>gaT	p.D125D	MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000423302.2_Splice_Site_p.D134D|MRVI1_ENST00000527509.2_Splice_Site_p.D43D|MRVI1_ENST00000421747.1_Splice_Site_p.D125D|MRVI1_ENST00000531107.1_Splice_Site_p.D125D|MRVI1_ENST00000532037.1_5'UTR|MRVI1_ENST00000552103.1_Splice_Site_p.D43D|MRVI1_ENST00000541483.1_Splice_Site_p.D134D|MRVI1_ENST00000547195.1_Splice_Site_p.D43D			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	125					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GCCCCGCGGGGTCTGCAGAAG	0.592																																					p.D134D													.	.			0			c.C402T												46.0	50.0	49.0					11																	10651257		2090	4216	6306	SO:0001630	splice_region_variant	10335	exon5			CGCGGGGTCTGCA	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.374-1C>T	11.37:g.10651257G>A			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001206880	7	0.00	0	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	ENST00000436272.1	37																																																																																						0.592	MRVI1-203	KNOWN	basic	protein_coding	protein_coding				NM_001098579	Silent
KCNJ11	3767	mdanderson.org	37	11	17409142	17409142	+	Missense_Mutation	SNP	C	C	T	rs80356618		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:17409142C>T	ENST00000339994.4	-	1	1064	c.497G>A	c.(496-498)tGc>tAc	p.C166Y	KCNJ11_ENST00000528731.1_Missense_Mutation_p.C79Y|KCNJ11_ENST00000526747.1_5'Flank	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	166			C -> Y (in PNDM; individual also diagnosed with West syndrome). {ECO:0000269|PubMed:16609879}.		cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	CATGAAGATGCAGCCAAGCAT	0.602											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C166Y													.	.			0			c.G497A	GRCh37	CM056351|CM061828	KCNJ11	M	rs80356618							82.0	66.0	71.0					11																	17409142		2200	4293	6493	SO:0001583	missense	3767	exon1			AAGATGCAGCCAA	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.497G>A	11.37:g.17409142C>T	ENSP00000345708:p.Cys166Tyr		Somatic	49	0	0	717	WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_000525	3	0.00	0	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Missense_Mutation	SNP	ENST00000339994.4	37	CCDS31436.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893034	0.72524	.	.	ENSG00000187486	ENST00000339994;ENST00000528731;ENST00000526912	D;D;D	0.94184	-3.37;-3.37;-3.37	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.97167	0.9074	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97807	1.0248	10	0.72032	D	0.01	.	18.6357	0.91378	0.0:1.0:0.0:0.0	.	166	B2RC52	.	Y	166;79;79	ENSP00000345708:C166Y;ENSP00000434755:C79Y;ENSP00000432729:C79Y	ENSP00000345708:C166Y	C	-	2	0	KCNJ11	17365718	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.398000	0.81561	0.462000	0.41574	TGC			0.602	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387037.1		NM_000525	
KCNA4	3739	bcgsc.ca	37	11	30032345	30032347	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:30032345_30032347delCTC	ENST00000328224.6	-	2	3112_3114	c.1879_1881delGAG	c.(1879-1881)gagdel	p.E627del	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	627					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCTGACACTTCTCCTCCTTTGCA	0.458																																					p.627_627del													KCNA4,NS,carcinoma,-2,1	KCNA4	158	1	0			c.1879_1881del																																									SO:0001651	inframe_deletion	3739	exon2			ACACTTCTCCTCC	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1879_1881delGAG	11.37:g.30032348_30032350delCTC	ENSP00000328511:p.Glu627del		Somatic	169	0	0		WXS	Illumina HiSeq	Phase_1	139	0.00	0	NM_002233	0		0		In_Frame_Del	DEL	ENST00000328224.6	37	CCDS41629.1																																																																																					0.458	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388074.2		NM_002233	
ACCSL	390110	bcgsc.ca	37	11	44074956	44074956	+	Splice_Site	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:44074956G>A	ENST00000378832.1	+	8	1005	c.949G>A	c.(949-951)Ggg>Agg	p.G317R		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	317					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						TTTTTCTTAGGGGAAAAAGGT	0.438																																					p.G317R													.	ACCSL	57		0			c.G949A												102.0	95.0	97.0					11																	44074956		1829	4081	5910	SO:0001630	splice_region_variant	390110	exon8			TCTTAGGGGAAAA		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.949-1G>A	11.37:g.44074956G>A			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_1	47	0.00	0	NM_001031854	0		0		Missense_Mutation	SNP	ENST00000378832.1	37	CCDS41636.1	.	.	.	.	.	.	.	.	.	.	G	7.031	0.560683	0.13498	.	.	ENSG00000205126	ENST00000378832	D	0.90444	-2.67	4.45	0.255	0.15561	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.429342	0.27143	N	0.020733	D	0.90007	0.6880	M	0.85777	2.775	0.51012	D	0.999907	B	0.31054	0.306	B	0.41202	0.35	T	0.82116	-0.0616	9	.	.	.	-0.4123	2.6466	0.04986	0.1716:0.1452:0.5336:0.1495	.	317	Q4AC99	1A1L2_HUMAN	R	317	ENSP00000368109:G317R	.	G	+	1	0	ACCSL	44031532	1.000000	0.71417	0.124000	0.21820	0.014000	0.08584	1.105000	0.31086	-0.032000	0.13758	0.655000	0.94253	GGG			0.438	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389717.1		NM_001031854	Missense_Mutation
EML3	256364	mdanderson.org	37	11	62374520	62374520	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:62374520C>A	ENST00000394773.2	-	12	1721	c.1414G>T	c.(1414-1416)Gac>Tac	p.D472Y	EML3_ENST00000531557.1_Missense_Mutation_p.D255Y|EML3_ENST00000438258.1_5'UTR|RP11-831H9.3_ENST00000532626.1_RNA|EML3_ENST00000494176.2_Missense_Mutation_p.D444Y|EML3_ENST00000278845.4_Missense_Mutation_p.D473Y|EML3_ENST00000529309.1_Missense_Mutation_p.D472Y	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	472						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GTGAGAATGTCTCCATCCGGA	0.537																																					p.D472Y													EML3,NS,carcinoma,+2,1	EML3	2	1	0			c.G1414T												84.0	87.0	86.0					11																	62374520		2202	4299	6501	SO:0001583	missense	256364	exon12			GAATGTCTCCATC	AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.1414G>T	11.37:g.62374520C>A	ENSP00000378254:p.Asp472Tyr		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_153265	73	0.00	0	Q6ZQW7|Q8NA55	Missense_Mutation	SNP	ENST00000394773.2	37	CCDS8023.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.998942|3.998942	0.74818|0.74818	.|.	.|.	ENSG00000149499|ENSG00000149499	ENST00000394773;ENST00000278845;ENST00000531557;ENST00000494176;ENST00000529309|ENST00000394776	T;T;T;T;T|.	0.44881|.	0.91;0.91;1.48;1.48;1.48|.	5.22|5.22	3.32|3.32	0.38043|0.38043	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.161221|.	0.52532|.	D|.	0.000075|.	T|T	0.69815|0.69815	0.3153|0.3153	M|M	0.76574|0.76574	2.34|2.34	0.53005|0.53005	D|D	0.999965|0.999965	D;D;D;D;D|.	0.76494|.	0.999;0.997;0.962;0.995;0.999|.	D;D;P;P;D|.	0.72625|.	0.978;0.926;0.684;0.733;0.91|.	T|T	0.67201|0.67201	-0.5730|-0.5730	10|5	0.87932|.	D|.	0|.	-6.9317|-6.9317	9.6384|9.6384	0.39824|0.39824	0.0:0.8264:0.0:0.1736|0.0:0.8264:0.0:0.1736	.|.	472;472;255;473;444|.	Q32P44-2;Q32P44;G3V195;B7WPE2;G3V1D0|.	.;EMAL3_HUMAN;.;.;.|.	Y|I	472;473;255;444;472|466	ENSP00000378254:D472Y;ENSP00000278845:D473Y;ENSP00000433417:D255Y;ENSP00000435064:D444Y;ENSP00000434513:D472Y|.	ENSP00000278845:D473Y|.	D|R	-|-	1|2	0|0	EML3|EML3	62131096|62131096	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	3.861000|3.861000	0.56002|0.56002	0.578000|0.578000	0.29487|0.29487	0.467000|0.467000	0.42956|0.42956	GAC|AGA			0.537	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000313432.1		NM_153265	
SUV420H1	51111	broad.mit.edu;mdanderson.org	37	11	67926224	67926224	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:67926224T>C	ENST00000304363.4	-	11	1942	c.1589A>G	c.(1588-1590)gAg>gGg	p.E530G		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	530					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						GGGCGAGCTCTCCCCCTGCGA	0.562																																					p.E530G													.	SUV420H1	125		0			c.A1589G												96.0	98.0	97.0					11																	67926224		2200	4294	6494	SO:0001583	missense	51111	exon11			GAGCTCTCCCCCT	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1589A>G	11.37:g.67926224T>C	ENSP00000305899:p.Glu530Gly		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	91	0.04	4	NM_017635	15	0.00	0	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.067716	0.36470	.	.	ENSG00000110066	ENST00000304363	T	0.49139	0.79	5.07	2.71	0.32032	.	0.645274	0.17162	N	0.184647	T	0.31104	0.0786	N	0.24115	0.695	0.31918	N	0.613781	B	0.02656	0.0	B	0.01281	0.0	T	0.29181	-1.0020	10	0.31617	T	0.26	-7.7404	9.6767	0.40045	0.0:0.22:0.0:0.78	.	530	Q4FZB7	SV421_HUMAN	G	530	ENSP00000305899:E530G	ENSP00000305899:E530G	E	-	2	0	SUV420H1	67682800	0.985000	0.35326	0.007000	0.13788	0.955000	0.61496	2.886000	0.48578	0.952000	0.37798	0.402000	0.26972	GAG			0.562	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318319.1		NM_017635	
MAML2	84441	broad.mit.edu;mdanderson.org	37	11	95825413	95825413	+	Silent	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:95825413C>T	ENST00000524717.1	-	2	3066	c.1782G>A	c.(1780-1782)caG>caA	p.Q594Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	594					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgctgct	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q594Q				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2	94		0			c.G1782A												39.0	45.0	43.0					11																	95825413		2140	4209	6349	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1782G>A	11.37:g.95825413C>T			Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	72	0.06	4	NM_032427	7	0.00	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																					0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395540.1			
CNTN5	53942	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	99944948	99944948	+	Missense_Mutation	SNP	T	T	C	rs200782641	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr11:99944948T>C	ENST00000524871.1	+	13	1792	c.1502T>C	c.(1501-1503)aTa>aCa	p.I501T	CNTN5_ENST00000418526.2_Missense_Mutation_p.I427T|CNTN5_ENST00000279463.3_Missense_Mutation_p.I501T|CNTN5_ENST00000528682.1_Missense_Mutation_p.I501T|CNTN5_ENST00000527185.1_Missense_Mutation_p.I501T	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	501	Ig-like C2-type 5.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GAAGTTGTCATAGAGTGCAAA	0.358													T|||	3	0.000599042	0.0023	0.0	5008	,	,		17463	0.0		0.0	False		,,,				2504	0.0				p.I501T													.	CNTN5	324		0			c.T1502C							T	THR/ILE,THR/ILE	1,3683		0,1,1841	63.0	63.0	63.0		1502,1280	5.5	1.0	11		63	0,8168		0,0,4084	no	missense,missense	CNTN5	NM_014361.3,NM_175566.2	89,89	0,1,5925	CC,CT,TT		0.0,0.0271,0.0084	possibly-damaging,possibly-damaging	501/1101,427/1027	99944948	1,11851	1842	4084	5926	SO:0001583	missense	53942	exon12			TTGTCATAGAGTG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1502T>C	11.37:g.99944948T>C	ENSP00000435637:p.Ile501Thr		Somatic	503	0	0		WXS	Illumina HiSeq	Phase_I	442	0.15	68	NM_001243270	0		0	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	19.98	3.927043	0.73327	2.71E-4	0.0	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.51	5.51	0.81932	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.224852	0.46145	D	0.000306	T	0.77857	0.4193	M	0.91300	3.195	0.48236	D	0.999614	P;P;P	0.38863	0.65;0.454;0.65	B;B;B	0.43155	0.41;0.234;0.41	T	0.82798	-0.0279	10	0.87932	D	0	.	14.8585	0.70359	0.0:0.0:0.0:1.0	.	501;427;501	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	T	501;501;501;427;501	ENSP00000433575:I501T;ENSP00000436185:I501T;ENSP00000435637:I501T;ENSP00000393229:I427T;ENSP00000279463:I501T	ENSP00000279463:I501T	I	+	2	0	CNTN5	99450158	1.000000	0.71417	0.959000	0.39883	0.920000	0.55202	7.662000	0.83803	2.095000	0.63458	0.456000	0.33151	ATA			0.358	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395148.2		NM_014361	
PDE3A	5139	broad.mit.edu;mdanderson.org	37	12	20522511	20522511	+	Missense_Mutation	SNP	C	C	A	rs200052001		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:20522511C>A	ENST00000359062.3	+	1	333	c.293C>A	c.(292-294)gCg>gAg	p.A98E	RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	98	Poly-Ala.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.A98V(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GCGGCGGCGGCGGAGGAGGAG	0.741													A|||	1	0.000199681	0.0	0.0	5008	,	,		11314	0.0		0.001	False		,,,				2504	0.0				p.A98E													PDE3A,colon,NS,0,1	PDE3A	184	1	1	Substitution - Missense(1)	large_intestine(1)	c.C293A							A	GLU/ALA	0,4082		0,0,2041	4.0	4.0	4.0		293	-5.4	0.0	12		4	2,8076		0,2,4037	no	missense	PDE3A	NM_000921.4	107	0,2,6078	AA,AC,CC		0.0248,0.0,0.0164	benign	98/1142	20522511	2,12158	2041	4039	6080	SO:0001583	missense	5139	exon1			CGGCGGCGGAGGA		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.293C>A	12.37:g.20522511C>A	ENSP00000351957:p.Ala98Glu		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	52	0.08	4	NM_000921	1	0.00	0	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.464469	0.01053	0.0	2.48E-4	ENSG00000172572	ENST00000359062	T	0.61627	0.09	4.4	-5.38	0.02673	.	1.144360	0.06539	N	0.742936	T	0.33206	0.0855	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42120	-0.9470	10	0.02654	T	1	.	9.2036	0.37275	0.6781:0.2354:0.0:0.0865	.	98	Q14432	PDE3A_HUMAN	E	98	ENSP00000351957:A98E	ENSP00000351957:A98E	A	+	2	0	PDE3A	20413778	0.000000	0.05858	0.003000	0.11579	0.068000	0.16541	-1.510000	0.02262	-1.958000	0.01019	-3.067000	0.00067	GCG			0.741	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401756.2			
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	25380275	25380275	+	Missense_Mutation	SNP	T	T	A	rs17851045		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:25380275T>A	ENST00000256078.4	-	3	246	c.183A>T	c.(181-183)caA>caT	p.Q61H	AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61H(153)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGTACTCCTCTTGACCTGCTG	0.423	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.Q61H	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,colon,carcinoma,0,429	KRAS_ENST00000256078	0	429	153	Substitution - Missense(153)	large_intestine(74)|lung(26)|pancreas(18)|haematopoietic_and_lymphoid_tissue(9)|endometrium(7)|soft_tissue(3)|biliary_tract(3)|liver(3)|cervix(2)|skin(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)|NS(1)	c.A183T												109.0	98.0	102.0					12																	25380275		2203	4300	6503	SO:0001583	missense	3845	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CTCCTCTTGACCT	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.183A>T	12.37:g.25380275T>A	ENSP00000256078:p.Gln61His		Somatic	126	0	0		WXS	Illumina HiSeq	.	165	0.19	32	NM_004985	51	0.25	13	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243092	0.79912	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.84146	-1.81;-1.81	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.87265	0.6134	M	0.91140	3.18	0.80722	D	1	B;B	0.33413	0.411;0.09	B;B	0.32724	0.092;0.151	D	0.87829	0.2643	10	0.72032	D	0.01	.	9.9836	0.41828	0.0:0.0752:0.0:0.9248	rs17851045	61;61	P01116-2;P01116	.;RASK_HUMAN	H	61	ENSP00000308495:Q61H;ENSP00000256078:Q61H	ENSP00000256078:Q61H	Q	-	3	2	KRAS	25271542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.240000	0.43088	2.326000	0.78906	0.533000	0.62120	CAA			0.423	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
NELL2	4753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	45173782	45173782	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:45173782C>T	ENST00000429094.2	-	4	863	c.359G>A	c.(358-360)gGc>gAc	p.G120D	NELL2_ENST00000551601.1_Missense_Mutation_p.G119D|NELL2_ENST00000452445.2_Missense_Mutation_p.G120D|NELL2_ENST00000549027.1_Missense_Mutation_p.G119D|NELL2_ENST00000437801.2_Missense_Mutation_p.G170D|NELL2_ENST00000333837.4_Missense_Mutation_p.G143D|NELL2_ENST00000395487.2_Missense_Mutation_p.G119D|NELL2_ENST00000547172.1_5'UTR	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	120	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ATTCCGATGGCCACTACTTTC	0.468																																					p.G170D													NELL2_ENST00000437801,NS,carcinoma,-1,2	NELL2_ENST00000437801	-1	2	0			c.G509A												138.0	128.0	131.0					12																	45173782		2203	4300	6503	SO:0001583	missense	4753	exon5			CGATGGCCACTAC	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.359G>A	12.37:g.45173782C>T	ENSP00000390680:p.Gly120Asp		Somatic	177	0	0		WXS	Illumina HiSeq	.	187	0.09	16	NM_001145107	28	0.25	7	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	C	33	5.224369	0.95139	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684;ENST00000552993;ENST00000553120	T;T;T;T;T;T;T;T;T	0.02682	4.2;4.2;4.2;4.2;4.2;4.2;4.2;4.2;4.2	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.098980	0.64402	D	0.000001	T	0.18257	0.0438	M	0.79926	2.475	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.997;0.991;1.0;0.99;0.995	T	0.00133	-1.2010	10	0.87932	D	0	-20.8972	19.4004	0.94627	0.0:1.0:0.0:0.0	.	143;170;119;120;120;119	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.;.;.;.;NELL2_HUMAN;.	D	119;120;119;120;119;143;170;119;120;117	ENSP00000378866:G119D;ENSP00000390680:G120D;ENSP00000449332:G119D;ENSP00000394612:G120D;ENSP00000447927:G119D;ENSP00000327988:G143D;ENSP00000416341:G170D;ENSP00000447085:G120D;ENSP00000447384:G117D	ENSP00000327988:G143D	G	-	2	0	NELL2	43460049	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.771000	0.85420	2.577000	0.86979	0.655000	0.94253	GGC			0.468	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404180.1		NM_006159	
SLC4A8	9498	broad.mit.edu;mdanderson.org	37	12	51818775	51818775	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:51818775C>T	ENST00000453097.2	+	1	221	c.4C>T	c.(4-6)Ccg>Tcg	p.P2S	SLC4A8_ENST00000514353.3_5'Flank|RP11-607P23.1_ENST00000604939.1_RNA|SLC4A8_ENST00000358657.3_Intron|SLC4A8_ENST00000535225.2_Intron|SLC4A8_ENST00000394856.1_5'UTR	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		CTCCGCCATGCCGGCCGCCGG	0.716											OREG0021822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P2S													.	SLC4A8	292		0			c.C4T												8.0	9.0	9.0					12																	51818775		2092	4124	6216	SO:0001583	missense	9498	exon1			GCCATGCCGGCCG	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.4C>T	12.37:g.51818775C>T	ENSP00000405812:p.Pro2Ser		Somatic	79	0	0	980	WXS	Illumina HiSeq	Phase_I	74	0.05	4	NM_001039960	3	0.00	0		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411254	0.42817	.	.	ENSG00000050438	ENST00000453097;ENST00000319957	T	0.76060	-0.99	3.74	3.74	0.42951	.	.	.	.	.	T	0.58192	0.2105	N	0.14661	0.345	0.80722	D	1	B;B;B	0.27732	0.003;0.048;0.187	B;B;B	0.28011	0.002;0.005;0.085	T	0.61969	-0.6953	9	0.66056	D	0.02	.	11.201	0.48741	0.0:1.0:0.0:0.0	.	2;2;2	Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	S4A8_HUMAN;.;.	S	2	ENSP00000405812:P2S	ENSP00000315789:P2S	P	+	1	0	SLC4A8	50105042	0.994000	0.37717	0.992000	0.48379	0.693000	0.40251	3.366000	0.52343	2.099000	0.63709	0.305000	0.20034	CCG			0.716	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404356.1		NM_004858	
MYO1A	4640	bcgsc.ca	37	12	57432204	57432204	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:57432204G>T	ENST00000442789.2	-	18	2039	c.1752C>A	c.(1750-1752)aaC>aaA	p.N584K	MYO1A_ENST00000544473.1_Missense_Mutation_p.N422K|MYO1A_ENST00000300119.3_Missense_Mutation_p.N584K|MYO1A_ENST00000476795.1_5'Flank	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	584	Actin-binding. {ECO:0000255}.|Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						ACCTGATGTAGTTGGGGCTCT	0.547																																					p.N584K													.	MYO1A	122		0			c.C1752A												51.0	47.0	48.0					12																	57432204		2203	4300	6503	SO:0001583	missense	4640	exon17			GATGTAGTTGGGG	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.1752C>A	12.37:g.57432204G>T	ENSP00000393392:p.Asn584Lys		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_1	68	0.00	0	NM_005379	2	0.00	0	Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	37	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767321	0.69878	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.71341	-0.56;-0.56;-0.56	4.94	3.11	0.35812	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.83128	0.5187	M	0.84511	2.7	0.46499	D	0.999073	D	0.89917	1.0	D	0.87578	0.998	T	0.82504	-0.0424	10	0.52906	T	0.07	.	9.8519	0.41061	0.1714:0.0:0.8286:0.0	.	584	Q9UBC5	MYO1A_HUMAN	K	584;584;422	ENSP00000300119:N584K;ENSP00000393392:N584K;ENSP00000440514:N422K	ENSP00000300119:N584K	N	-	3	2	MYO1A	55718471	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.581000	0.53914	0.621000	0.30232	0.561000	0.74099	AAC			0.547	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313833.2		NM_005379	
FRS2	10818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	69964184	69964184	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:69964184T>C	ENST00000550389.1	+	4	386	c.140T>C	c.(139-141)tTa>tCa	p.L47S	FRS2_ENST00000397997.2_Missense_Mutation_p.L47S|FRS2_ENST00000549921.1_Missense_Mutation_p.L47S|FRS2_ENST00000299293.2_Missense_Mutation_p.L47S	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	47	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GAACTGATTTTATACACCCGC	0.423																																					p.L47S													.	.			0			c.T140C												164.0	155.0	158.0					12																	69964184		2003	4177	6180	SO:0001583	missense	10818	exon7			TGATTTTATACAC	AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.140T>C	12.37:g.69964184T>C	ENSP00000447241:p.Leu47Ser		Somatic	179	0	0		WXS	Illumina HiSeq	.	193	0.12	24	NM_001042555	10	0.30	3	B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	ENST00000550389.1	37	CCDS41809.1	.	.	.	.	.	.	.	.	.	.	T	31	5.090819	0.94149	.	.	ENSG00000166225	ENST00000299293;ENST00000549921;ENST00000547414;ENST00000550389;ENST00000550937;ENST00000397997;ENST00000551325	D;D;D;D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88	5.77	5.77	0.91146	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.96614	0.8895	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97042	0.9758	9	.	.	.	-12.1411	16.0903	0.81086	0.0:0.0:0.0:1.0	.	47	Q8WU20	FRS2_HUMAN	S	47;47;10;47;47;47;47	ENSP00000299293:L47S;ENSP00000450048:L47S;ENSP00000447007:L10S;ENSP00000447241:L47S;ENSP00000447804:L47S;ENSP00000381083:L47S;ENSP00000449432:L47S	.	L	+	2	0	FRS2	68250451	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.994000	0.88315	2.202000	0.70862	0.459000	0.35465	TTA			0.423	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403760.1		NM_006654	
E2F7	144455	bcgsc.ca	37	12	77449732	77449732	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:77449732A>C	ENST00000322886.7	-	3	507	c.272T>G	c.(271-273)aTt>aGt	p.I91S	E2F7_ENST00000416496.2_Missense_Mutation_p.I91S	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	91					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						GGCAGCACTAATGAGCATCTT	0.438																																					p.I91S													.	E2F7	201		0			c.T272G												156.0	151.0	152.0					12																	77449732		2203	4300	6503	SO:0001583	missense	144455	exon3			GCACTAATGAGCA	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.272T>G	12.37:g.77449732A>C	ENSP00000323246:p.Ile91Ser		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_1	170	0.00	0	NM_203394	3	0.00	0	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	37	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.781295	0.90282	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669;ENST00000547316	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.92861	0.7729	M	0.78456	2.415	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.68192	0.956;0.905	D	0.93132	0.6534	10	0.52906	T	0.07	-19.2963	15.1519	0.72706	1.0:0.0:0.0:0.0	.	91;91	F8VSE7;Q96AV8	.;E2F7_HUMAN	S	91	ENSP00000323246:I91S;ENSP00000393639:I91S;ENSP00000448245:I91S;ENSP00000449033:I91S	ENSP00000323246:I91S	I	-	2	0	E2F7	75973863	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.167000	0.68274	0.528000	0.53228	ATT			0.438	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406716.1		XM_084871	
ANKRD13A	88455	mdanderson.org	37	12	110468480	110468480	+	Missense_Mutation	SNP	G	G	T	rs149017101		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:110468480G>T	ENST00000261739.4	+	12	1431	c.1265G>T	c.(1264-1266)cGg>cTg	p.R422L	C12orf76_ENST00000546651.2_Intron	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	422						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						TTAAATGCACGGATTACATTT	0.303																																					p.R422L													.	.			0			c.G1265T												58.0	55.0	56.0					12																	110468480		2203	4300	6503	SO:0001583	missense	88455	exon12			ATGCACGGATTAC	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.1265G>T	12.37:g.110468480G>T	ENSP00000261739:p.Arg422Leu		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_033121	42	0.00	0	O60736	Missense_Mutation	SNP	ENST00000261739.4	37	CCDS9140.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.9|27.9	4.875094|4.875094	0.91664|0.91664	.|.	.|.	ENSG00000076513|ENSG00000076513	ENST00000547639;ENST00000551491|ENST00000261739;ENST00000547419;ENST00000553251;ENST00000549826	.|T	.|0.42131	.|0.98	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.047975	.|0.85682	.|D	.|0.000000	.|T	.|0.67543	.|0.2904	M|M	0.85197|0.85197	2.74|2.74	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.991;0.997	.|D;D	.|0.65443	.|0.927;0.935	.|T	.|0.63941	.|-0.6523	.|10	.|0.25751	.|T	.|0.34	-19.9008|-19.9008	19.3618|19.3618	0.94442|0.94442	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|421;422	.|B4DYP5;Q8IZ07	.|.;AN13A_HUMAN	X|L	275;3|422;60;60;60	.|ENSP00000261739:R422L	.|ENSP00000261739:R422L	G|R	+|+	1|2	0|0	ANKRD13A|ANKRD13A	108952863|108952863	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.419000|6.419000	0.73345|0.73345	2.820000|2.820000	0.97059|0.97059	0.650000|0.650000	0.86243|0.86243	GGA|CGG			0.303	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403430.1		NM_033121	
HECTD4	283450	broad.mit.edu;mdanderson.org	37	12	112717169	112717169	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:112717169G>A	ENST00000430131.2	-	9	1513	c.368C>T	c.(367-369)cCt>cTt	p.P123L	HECTD4_ENST00000377560.5_Missense_Mutation_p.P373L|HECTD4_ENST00000550722.1_Missense_Mutation_p.P373L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	123					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CATTTTTAGAGGCAGCCCACA	0.443																																					p.P373L													.	.			0			c.C1118T												103.0	98.0	100.0					12																	112717169		1852	4098	5950	SO:0001583	missense	283450	exon9			TTTAGAGGCAGCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.368C>T	12.37:g.112717169G>A	ENSP00000404379:p.Pro123Leu		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001109662	1	1.00	1	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	G	34	5.406804	0.96051	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.47177	0.89;0.87;0.85	5.45	5.45	0.79879	.	.	.	.	.	T	0.31949	0.0813	N	0.08118	0	0.80722	D	1	P	0.37781	0.608	B	0.34346	0.18	T	0.38564	-0.9655	9	0.87932	D	0	.	19.2699	0.94004	0.0:0.0:1.0:0.0	.	123	Q9Y4D8	K0614_HUMAN	L	373;123;373	ENSP00000366783:P373L;ENSP00000404379:P123L;ENSP00000449784:P373L	ENSP00000366783:P373L	P	-	2	0	C12orf51	111201552	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	9.388000	0.97237	2.570000	0.86706	0.591000	0.81541	CCT			0.443	HECTD4-202	KNOWN	basic	protein_coding	protein_coding				NM_173813	
C12orf65	91574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	123741505	123741505	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr12:123741505A>C	ENST00000253233.1	+	3	1072	c.428A>C	c.(427-429)aAa>aCa	p.K143T	RP11-282O18.3_ENST00000541002.3_RNA|RP11-282O18.3_ENST00000542427.2_RNA|RP11-282O18.3_ENST00000543217.2_RNA|C12orf65_ENST00000429587.2_Missense_Mutation_p.K143T|C12orf65_ENST00000366329.2_Missense_Mutation_p.K143T|RP11-282O18.3_ENST00000544890.1_RNA	NM_152269.4	NP_689482.1	Q9H3J6	CL065_HUMAN	chromosome 12 open reading frame 65	143					cell death (GO:0008219)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000595)|Epithelial(86;0.00199)		gaaaggaaaaaaagagcaaag	0.363																																					p.K143T													.	.			0			c.A428C												50.0	58.0	56.0					12																	123741505		2203	4300	6503	SO:0001583	missense	91574	exon3			GGAAAAAAAGAGC	AK095982	CCDS9244.1	12q24.31	2013-01-07			ENSG00000130921	ENSG00000130921			26784	protein-coding gene	gene with protein product		613541				20598281, 22688947, 23188110	Standard	NM_152269		Approved	FLJ38663, SPG55	uc001uen.3	Q9H3J6	OTTHUMG00000168852	ENST00000253233.1:c.428A>C	12.37:g.123741505A>C	ENSP00000253233:p.Lys143Thr		Somatic	199	0	0		WXS	Illumina HiSeq	.	234	0.11	26	NM_001194995	160	0.27	43	Q8WUC6	Missense_Mutation	SNP	ENST00000253233.1	37	CCDS9244.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.566371	0.45694	.	.	ENSG00000130921	ENST00000253233;ENST00000366329;ENST00000429587	T;T;T	0.11495	2.77;2.77;2.77	5.86	0.954	0.19595	Peptide chain release factor class I/class II (1);	0.319616	0.38217	N	0.001765	T	0.18087	0.0434	L	0.60067	1.865	0.23813	N	0.996772	D	0.54601	0.967	P	0.54759	0.76	T	0.04140	-1.0974	10	0.87932	D	0	-11.88	8.2243	0.31560	0.6735:0.0:0.3265:0.0	.	143	Q9H3J6	CL065_HUMAN	T	143	ENSP00000253233:K143T;ENSP00000390647:K143T;ENSP00000391513:K143T	ENSP00000253233:K143T	K	+	2	0	C12orf65	122307458	0.991000	0.36638	0.791000	0.31998	0.897000	0.52465	0.723000	0.25939	0.140000	0.18849	-0.262000	0.10625	AAA			0.363	C12orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401375.1		NM_152269	
N4BP2L2	10443	ucsc.edu	37	13	33092109	33092109	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr13:33092109T>C	ENST00000267068.3	-	6	1746	c.1582A>G	c.(1582-1584)Att>Gtt	p.I528V	N4BP2L2_ENST00000504114.1_Missense_Mutation_p.I84V|N4BP2L2_ENST00000446957.2_Missense_Mutation_p.I528V|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.I99V|N4BP2L2_ENST00000357505.6_Missense_Mutation_p.I84V	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	528					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		ATCTGAGCAATCTTCTTTCGA	0.363																																					p.I528V													.	N4BP2L2	90		0			c.A1582G												124.0	113.0	117.0					13																	33092109		2203	4300	6503	SO:0001583	missense	10443	exon6			GAGCAATCTTCTT	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.1582A>G	13.37:g.33092109T>C	ENSP00000267068:p.Ile528Val		Somatic	73	0	0		RNA-Seq	Illumina HiSeq		45	0.04	2	NM_014887	107	0.29	31	A3KME8	Missense_Mutation	SNP	ENST00000267068.3	37	CCDS9346.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137954	0.56936	.	.	ENSG00000244754	ENST00000504114;ENST00000357505;ENST00000399396;ENST00000446957;ENST00000505213;ENST00000267068	T;T;T;T;T;T	0.44482	1.19;1.19;1.19;0.92;0.92;0.92	5.34	5.34	0.76211	.	.	.	.	.	T	0.57272	0.2042	L	0.45285	1.41	0.32616	N	0.523967	D;D;P;D	0.76494	0.986;0.999;0.809;0.996	D;D;P;D	0.80764	0.951;0.994;0.639;0.994	T	0.66586	-0.5886	9	0.56958	D	0.05	-6.8204	15.3218	0.74126	0.0:0.0:0.0:1.0	.	84;99;528;528	B4DPY1;Q92802-3;Q92802;Q92802-2	.;.;N42L2_HUMAN;.	V	84;84;99;528;528;528	ENSP00000427477:I84V;ENSP00000350104:I84V;ENSP00000382328:I99V;ENSP00000394239:I528V;ENSP00000423362:I528V;ENSP00000267068:I528V	ENSP00000267068:I528V	I	-	1	0	N4BP2L2	31990109	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.922000	0.75811	2.030000	0.59900	0.383000	0.25322	ATT			0.363	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044421.1		NM_014887	
NAA16	79612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	41894924	41894924	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr13:41894924G>T	ENST00000379406.3	+	4	690	c.366G>T	c.(364-366)ctG>ctT	p.L122L	NAA16_ENST00000403412.3_Silent_p.L122L|NAA16_ENST00000379367.3_Silent_p.L122L	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	122					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						ATCTCTCACTGTTGCAGATCC	0.343																																					p.L122L													.	.			0			c.G366T												63.0	63.0	63.0					13																	41894924		2203	4300	6503	SO:0001819	synonymous_variant	79612	exon4			CTCACTGTTGCAG	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.366G>T	13.37:g.41894924G>T			Somatic	96	0	0		WXS	Illumina HiSeq	.	86	0.20	17	NM_001110798	12	0.08	1	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Silent	SNP	ENST00000379406.3	37	CCDS9379.1																																																																																					0.343	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044672.2		NM_018527	
RP11-146E13.4	0	broad.mit.edu	37	14	19850732	19850733	+	lincRNA	INS	-	-	A	rs369218058		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr14:19850732_19850733insA	ENST00000548109.1	+	0	72																											AAATTAGACATAAAAGTAAAAA	0.332																																					.													.	.			0			.																																											0	.			TAGACATAAAAGT																													14.37:g.19850736_19850736dupA			Somatic	14	0.1428571429	2		WXS	Illumina HiSeq	Phase_I	11	0.45	5	.	0		0		RNA	INS	ENST00000548109.1	37																																																																																						0.332	RP11-146E13.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409408.1			
CPNE6	9362	mdanderson.org	37	14	24543965	24543965	+	Silent	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr14:24543965G>A	ENST00000397016.2	+	8	944	c.633G>A	c.(631-633)ctG>ctA	p.L211L	CPNE6_ENST00000537691.1_Silent_p.L266L|CPNE6_ENST00000216775.2_Silent_p.L211L	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	211	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GCCTGTCCCTGCATTCCCTAT	0.552																																					p.L211L													.	.			0			c.G633A												77.0	72.0	73.0					14																	24543965		2203	4300	6503	SO:0001819	synonymous_variant	9362	exon7			GTCCCTGCATTCC	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.633G>A	14.37:g.24543965G>A			Somatic	79	0.0126582278	1		WXS	Illumina HiSeq	Phase_I	67	0.07	5	NM_006032	0		0	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Silent	SNP	ENST00000397016.2	37	CCDS9607.1																																																																																					0.552	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071869.5			
PML	5371	mdanderson.org	37	15	74327689	74327689	+	Intron	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr15:74327689G>T	ENST00000268058.3	+	7	1806				PML_ENST00000564428.1_Intron|PML_ENST00000395132.2_Intron|PML_ENST00000565898.1_Intron|PML_ENST00000436891.3_3'UTR|PML_ENST00000354026.6_Missense_Mutation_p.E581D|PML_ENST00000569965.1_Intron|PML_ENST00000563500.1_3'UTR|PML_ENST00000359928.4_Intron|PML_ENST00000569477.1_3'UTR|PML_ENST00000435786.2_3'UTR|PML_ENST00000395135.3_Intron|PML_ENST00000268059.6_Missense_Mutation_p.E629D	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						AGCCCGCTGAGCAGGCTGCCA	0.662			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.E629D				Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	.			0			c.G1887T												50.0	55.0	53.0					15																	74327689		2197	4297	6494	SO:0001627	intron_variant	5371	exon8			CGCTGAGCAGGCT	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1710+818G>T	15.37:g.74327689G>T			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_033239	96	0.00	0	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	37	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890994	0.52014	.	.	ENSG00000140464	ENST00000268059;ENST00000354026	.	.	.	2.93	2.01	0.26516	.	.	.	.	.	T	0.17109	0.0411	N	0.08118	0	0.09310	N	0.999998	P;P	0.44139	0.827;0.827	B;B	0.43386	0.418;0.418	T	0.08066	-1.0740	8	0.87932	D	0	.	5.8806	0.18854	0.1472:0.0:0.8528:0.0	.	581;629	P29590-13;P29590-8	.;.	D	629;581	.	ENSP00000268059:E629D	E	+	3	2	PML	72114742	0.000000	0.05858	0.030000	0.17652	0.071000	0.16799	-0.232000	0.09055	0.797000	0.33971	0.491000	0.48974	GAG			0.662	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269021.3		NM_002675	
ADAMTS17	170691	mdanderson.org	37	15	100636619	100636619	+	Silent	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr15:100636619G>A	ENST00000268070.4	-	15	2184	c.2079C>T	c.(2077-2079)agC>agT	p.S693S		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	693	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TGCCGTCCCCGCTGCAGACCC	0.582																																					p.S693S													.	.			0			c.C2079T												93.0	101.0	98.0					15																	100636619		2203	4300	6503	SO:0001819	synonymous_variant	170691	exon15			GTCCCCGCTGCAG	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2079C>T	15.37:g.100636619G>A			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_139057	1	0.00	0	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	37	CCDS10383.1																																																																																					0.582	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313595.1		NM_139057	
AXIN1	8312	mdanderson.org	37	16	396604	396604	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:396604G>A	ENST00000262320.3	-	2	793	c.422C>T	c.(421-423)gCg>gTg	p.A141V	AXIN1_ENST00000481769.1_Intron|AXIN1_ENST00000354866.3_Missense_Mutation_p.A141V	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	141	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GATGGCTCTCGCCAGCTTCAG	0.552											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.A141V													.	.			0			c.C422T												84.0	81.0	82.0					16																	396604		2203	4300	6503	SO:0001583	missense	8312	exon2			GCTCTCGCCAGCT	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.422C>T	16.37:g.396604G>A	ENSP00000262320:p.Ala141Val		Somatic	68	0	0	588	WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_003502	41	0.00	0	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	37	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	G	32	5.137290	0.94517	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.28454	1.61;1.61	5.75	5.75	0.90469	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.101043	0.64402	D	0.000002	T	0.62417	0.2426	M	0.83312	2.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66011	-0.6029	10	0.87932	D	0	-26.4194	19.9396	0.97154	0.0:0.0:1.0:0.0	.	141;141	O15169-2;O15169	.;AXIN1_HUMAN	V	141	ENSP00000262320:A141V;ENSP00000346935:A141V	ENSP00000262320:A141V	A	-	2	0	AXIN1	336605	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	9.726000	0.98782	2.720000	0.93068	0.655000	0.94253	GCG			0.552	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000139441.3			
CREBBP	1387	mdanderson.org	37	16	3900862	3900862	+	Silent	SNP	G	G	A	rs145925174		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:3900862G>A	ENST00000262367.5	-	2	1043	c.234C>T	c.(232-234)agC>agT	p.S78S	CREBBP_ENST00000382070.3_Silent_p.S78S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	78					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TACTAGAGCCGCTGCCTCCTC	0.542			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.S78S				Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	CREBBP,NS,carcinoma,0,1	CREBBP	0	1	0			c.C234T							G	,	0,4394		0,0,2197	66.0	63.0	64.0		234,234	-6.2	0.3	16	dbSNP_134	64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CREBBP	NM_001079846.1,NM_004380.2	,	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	,	78/2405,78/2443	3900862	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	1387	exon2			AGAGCCGCTGCCT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.234C>T	16.37:g.3900862G>A			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001079846	20	0.00	0	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																			0		0.542	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251591.2		NM_004380	
ZC3H7A	29066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	11859005	11859005	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:11859005C>G	ENST00000396516.2	-	14	1921	c.1724G>C	c.(1723-1725)tGt>tCt	p.C575S	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.C575S			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	575						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						ATGATCAAAACATTTCTGGAA	0.269																																					p.C575S													.	.			0			c.G1724C												58.0	58.0	58.0					16																	11859005		2197	4294	6491	SO:0001583	missense	29066	exon15			TCAAAACATTTCT	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1724G>C	16.37:g.11859005C>G	ENSP00000379773:p.Cys575Ser		Somatic	112	0	0		WXS	Illumina HiSeq	.	119	0.17	20	NM_014153	15	0.27	4	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637210	0.87760	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.66815	-0.23;-0.23	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.82332	0.5014	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.83925	0.0303	10	0.87932	D	0	.	18.5622	0.91104	0.0:1.0:0.0:0.0	.	296;575	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	S	575	ENSP00000347999:C575S;ENSP00000379773:C575S	ENSP00000347999:C575S	C	-	2	0	ZC3H7A	11766506	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.687000	0.84139	2.689000	0.91719	0.591000	0.81541	TGT			0.269	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437066.1		NM_014153	
GPT2	84706	broad.mit.edu;mdanderson.org	37	16	46918656	46918656	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:46918656G>C	ENST00000340124.4	+	2	141	c.29G>C	c.(28-30)cGg>cCg	p.R10P	GPT2_ENST00000440783.2_5'Flank	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	10					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	CTGGTCCGGCGGGGCTGTGGT	0.721																																					p.R10P													.	GPT2	40		0			c.G29C												14.0	18.0	17.0					16																	46918656		1389	3029	4418	SO:0001583	missense	84706	exon2			TCCGGCGGGGCTG		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.29G>C	16.37:g.46918656G>C	ENSP00000345282:p.Arg10Pro		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	30	0.13	4	NM_133443	4	0.25	1	Q8N9E2	Missense_Mutation	SNP	ENST00000340124.4	37	CCDS10725.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563643	0.45694	.	.	ENSG00000166123	ENST00000340124	D	0.82984	-1.67	4.9	3.93	0.45458	.	0.512331	0.17159	N	0.184779	T	0.70868	0.3273	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.65113	-0.6247	10	0.44086	T	0.13	.	8.7685	0.34717	0.0:0.2197:0.6294:0.151	.	10	Q8TD30	ALAT2_HUMAN	P	10	ENSP00000345282:R10P	ENSP00000345282:R10P	R	+	2	0	GPT2	45476157	0.999000	0.42202	1.000000	0.80357	0.773000	0.43773	0.638000	0.24674	1.160000	0.42584	0.297000	0.19635	CGG			0.721	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255741.2			
ZFPM1	161882	mdanderson.org	37	16	88601271	88601271	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr16:88601271C>T	ENST00000319555.3	+	10	3227	c.2905C>T	c.(2905-2907)Ccc>Tcc	p.P969S		NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	969					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCGCCGCTGCCCAACGGCAA	0.697																																					p.P969S	Pancreas(49;850 1106 29641 32847 38344)												.	.			0			c.C2905T												33.0	39.0	37.0					16																	88601271		2189	4285	6474	SO:0001583	missense	161882	exon10			CCGCTGCCCAACG	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.2905C>T	16.37:g.88601271C>T	ENSP00000326630:p.Pro969Ser		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_153813	14	0.00	0		Missense_Mutation	SNP	ENST00000319555.3	37	CCDS32502.1	.	.	.	.	.	.	.	.	.	.	c	10.51	1.370908	0.24771	.	.	ENSG00000179588	ENST00000319555	T	0.07688	3.17	3.4	3.4	0.38934	.	1.424740	0.05497	U	0.557743	T	0.11239	0.0274	L	0.52573	1.65	0.35646	D	0.811374	B	0.33694	0.421	B	0.30646	0.118	T	0.26538	-1.0100	10	0.25751	T	0.34	-12.7723	13.4244	0.61018	0.0:1.0:0.0:0.0	.	969	Q8IX07	FOG1_HUMAN	S	969	ENSP00000326630:P969S	ENSP00000326630:P969S	P	+	1	0	ZFPM1	87128772	0.795000	0.28851	0.406000	0.26421	0.071000	0.16799	2.387000	0.44389	1.470000	0.48102	0.503000	0.49774	CCC			0.697	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000422270.2			
MNT	4335	mdanderson.org	37	17	2291156	2291156	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:2291156G>T	ENST00000174618.4	-	5	1400	c.995C>A	c.(994-996)gCc>gAc	p.A332D	RP1-59D14.1_ENST00000571775.1_RNA|MNT_ENST00000575374.1_5'UTR	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	332					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		CTCACCAGAGGCGGTGGAGGT	0.637																																					p.A332D													.	.			0			c.C995A												23.0	23.0	23.0					17																	2291156		2200	4294	6494	SO:0001583	missense	4335	exon5			CCAGAGGCGGTGG	Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.995C>A	17.37:g.2291156G>T	ENSP00000174618:p.Ala332Asp		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_020310	23	0.00	0	A8K6D1|D3DTI7|Q1ED38	Missense_Mutation	SNP	ENST00000174618.4	37	CCDS11018.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.763210	0.89932	.	.	ENSG00000070444	ENST00000174618;ENST00000404961	D	0.85339	-1.97	4.16	4.16	0.48862	.	0.000000	0.49916	U	0.000135	D	0.90971	0.7161	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.92194	0.5762	10	0.72032	D	0.01	-12.9701	15.4213	0.75015	0.0:0.0:1.0:0.0	.	332	Q99583	MNT_HUMAN	D	332	ENSP00000174618:A332D	ENSP00000174618:A332D	A	-	2	0	MNT	2237906	1.000000	0.71417	0.951000	0.38953	0.811000	0.45836	9.834000	0.99428	1.870000	0.54199	0.313000	0.20887	GCC			0.637	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207158.1		NM_020310	
CAMTA2	23125	mdanderson.org	37	17	4873299	4873299	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:4873299G>T	ENST00000348066.3	-	18	3210	c.3087C>A	c.(3085-3087)ggC>ggA	p.G1029G	SPAG7_ENST00000206020.3_5'Flank|CAMTA2_ENST00000361571.5_Silent_p.G1028G|SPAG7_ENST00000575142.1_5'Flank|SPAG7_ENST00000573366.1_5'Flank|CAMTA2_ENST00000414043.3_Silent_p.G1052G|RP5-1050D4.2_ENST00000430920.1_RNA|CAMTA2_ENST00000572543.1_Silent_p.G1034G|RP5-1050D4.3_ENST00000576752.1_RNA|SPAG7_ENST00000571023.1_5'Flank|CAMTA2_ENST00000358183.4_Silent_p.G1029G|CAMTA2_ENST00000381311.5_Silent_p.G1031G	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	1029					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TTTCCATCTTGCCACTGGTGG	0.567																																					p.G1052G													.	.			0			c.C3156A												143.0	133.0	136.0					17																	4873299		2203	4300	6503	SO:0001819	synonymous_variant	23125	exon18			CATCTTGCCACTG	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.3087C>A	17.37:g.4873299G>T			Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_001171167	39	0.00	0	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Silent	SNP	ENST00000348066.3	37	CCDS11063.1																																																																																					0.567	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000216876.1		NM_015099	
NLRP1	22861	mdanderson.org	37	17	5436143	5436143	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:5436143G>T	ENST00000572272.1	-	11	3294	c.3295C>A	c.(3295-3297)Cga>Aga	p.R1099R	NLRP1_ENST00000269280.4_Splice_Site_p.R1099R|NLRP1_ENST00000354411.3_Splice_Site_p.R1069R|NLRP1_ENST00000262467.5_Splice_Site_p.R1103R|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000345221.3_Splice_Site_p.R1099R|NLRP1_ENST00000577119.1_Splice_Site_p.R1069R			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1099					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CTCACTCACCGGTACAAGTTC	0.627																																					p.R1103R													.	.			0			c.C3307A												61.0	57.0	58.0					17																	5436143		2203	4300	6503	SO:0001630	splice_region_variant	22861	exon11			CTCACCGGTACAA	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3296+1C>A	17.37:g.5436143G>T			Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_001033053	23	0.00	0	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Silent	SNP	ENST00000572272.1	37	CCDS42246.1																																																																																					0.627	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000439517.1		NM_033004	Silent
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		Somatic	230	0.0782608696	18		RNA-Seq	Illumina HiSeq		177	0.04	7	NM_145301	18	0.61	11	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2	rescued with RNA-seq	NM_145301	
LRRC48	83450	mdanderson.org	37	17	17881062	17881062	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:17881062G>T	ENST00000399187.1	+	3	368	c.150G>T	c.(148-150)ctG>ctT	p.L50L	LRRC48_ENST00000399182.1_Silent_p.L50L|LRRC48_ENST00000313838.8_Silent_p.L50L|LRRC48_ENST00000584166.1_Silent_p.L50L|LRRC48_ENST00000411504.2_Silent_p.L50L	NM_031294.3	NP_112584.3	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48	50						cytoplasm (GO:0005737)				breast(1)|large_intestine(2)|lung(2)|pancreas(1)|urinary_tract(1)	7	all_neural(463;0.228)					CCCTGCAGCTGGACTTTCGGA	0.627																																					p.L50L													.	.			0			c.G150T												38.0	43.0	41.0					17																	17881062		1988	4150	6138	SO:0001819	synonymous_variant	83450	exon3			GCAGCTGGACTTT	AK093317	CCDS45622.1, CCDS45623.1	17p11.2	2014-07-18			ENSG00000171962	ENSG00000171962			25384	protein-coding gene	gene with protein product						11997338, 23354437	Standard	NM_001130090		Approved	DKFZP586M1120	uc021trk.1	Q9H069	OTTHUMG00000059355	ENST00000399187.1:c.150G>T	17.37:g.17881062G>T			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	45	0.09	4	NM_001130092	1	0.00	0	A8KAE6|Q86SF9|Q86W73|Q8IWG0	Silent	SNP	ENST00000399187.1	37	CCDS45622.1																																																																																					0.627	LRRC48-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131945.3		NM_031294	
LRRC37BP1	147172	broad.mit.edu	37	17	28960991	28960991	+	RNA	DEL	C	C	-	rs375551118|rs373494507|rs57752761|rs543292747	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:28960991delC	ENST00000417404.1	+	0	1269									leucine rich repeat containing 37B pseudogene 1																		tttcttttttctttttttttt	0.299																																					.													.	.			0			.																																											0	.			TTTTTTCTTTTTT	BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28960991delC			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	106	0.14	15	.	1	0.00	0		RNA	DEL	ENST00000417404.1	37																																																																																						0.299	LRRC37BP1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000256203.1		NR_015341	
BRIP1	83990	bcgsc.ca	37	17	59870967	59870967	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:59870967G>T	ENST00000259008.2	-	10	1731	c.1464C>A	c.(1462-1464)ccC>ccA	p.P488P	BRIP1_ENST00000577598.1_Silent_p.P488P	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	488					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						CCTGCAAAATGGGAAAAGTAG	0.333			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.P488P			yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	BRIP1	237		0			c.C1464A												85.0	82.0	83.0					17																	59870967		2202	4299	6501	SO:0001819	synonymous_variant	83990	exon10			CAAAATGGGAAAA	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1464C>A	17.37:g.59870967G>T			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_1	96	0.00	0	NM_032043	20	0.00	0	Q3MJE2|Q8NCI5	Silent	SNP	ENST00000259008.2	37	CCDS11631.1																																																																																					0.333	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445362.1		NM_032043	
ST6GALNAC1	55808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	74623260	74623260	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:74623260C>T	ENST00000156626.7	-	4	1260	c.1061G>A	c.(1060-1062)aGc>aAc	p.S354N	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	354					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						AGCGGGGAGGCTGGCCAGGAG	0.642																																					p.S354N													.	.			0			c.G1061A												52.0	46.0	48.0					17																	74623260		2203	4300	6503	SO:0001583	missense	55808	exon4			GGGAGGCTGGCCA	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.1061G>A	17.37:g.74623260C>T	ENSP00000156626:p.Ser354Asn		Somatic	69	0	0		WXS	Illumina HiSeq	.	57	0.12	7	NM_018414	99	0.28	28	Q6UW90|Q9NSC6	Missense_Mutation	SNP	ENST00000156626.7	37	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	C	5.307	0.241958	0.10077	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.32023	1.47;1.47	4.65	-0.673	0.11373	.	0.927660	0.09242	N	0.829016	T	0.23611	0.0571	L	0.43152	1.355	0.09310	N	1	B	0.23128	0.08	B	0.30029	0.11	T	0.37842	-0.9688	10	0.22706	T	0.39	-7.311	5.6418	0.17569	0.0:0.3591:0.3379:0.303	.	354	Q9NSC7	SIA7A_HUMAN	N	354	ENSP00000156626:S354N;ENSP00000351991:S354N	ENSP00000156626:S354N	S	-	2	0	ST6GALNAC1	72134855	0.000000	0.05858	0.027000	0.17364	0.061000	0.15899	-0.087000	0.11215	0.128000	0.18479	-0.237000	0.12165	AGC			0.642	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450974.1		NM_018414	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	78321501	78321501	+	Silent	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:78321501C>T	ENST00000582970.1	+	29	9509	c.9366C>T	c.(9364-9366)caC>caT	p.H3122H	RNF213_ENST00000508628.2_Silent_p.H3171H|RNF213_ENST00000336301.6_Silent_p.H1195H	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3122					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACTACGTCCACCTCGGCGGCC	0.552																																					p.H3122H													.	.			0			c.C9366T												77.0	78.0	77.0					17																	78321501		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon29			CGTCCACCTCGGC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9366C>T	17.37:g.78321501C>T			Somatic	161	0	0		WXS	Illumina HiSeq	.	156	0.17	26	NM_001256071	29	0.10	3	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																					0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000443298.1		NM_020914	
CHMP6	79643	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	78971136	78971136	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr17:78971136A>T	ENST00000325167.5	+	6	568	c.490A>T	c.(490-492)Act>Tct	p.T164S	CTD-2561B21.7_ENST00000576215.1_RNA|CTD-2561B21.7_ENST00000577061.2_RNA	NM_024591.4	NP_078867.2	Q96FZ7	CHMP6_HUMAN	charged multivesicular body protein 6	164					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein N-terminus binding (GO:0047485)			lung(2)|ovary(1)	3	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GAGCGCAATCACTCAGGTAAC	0.617																																					p.T164S													.	.			0			c.A490T												36.0	32.0	33.0					17																	78971136		2203	4300	6503	SO:0001583	missense	79643	exon6			GCAATCACTCAGG	BC010108	CCDS11774.1	17q25.3	2014-08-13	2011-09-21		ENSG00000176108	ENSG00000176108		"""Charged multivesicular body proteins"""	25675	protein-coding gene	gene with protein product		610901	"""chromatin modifying protein 6"""			11559748, 15511219	Standard	NM_024591		Approved	FLJ11749, VPS20	uc002jyw.4	Q96FZ7	OTTHUMG00000177645	ENST00000325167.5:c.490A>T	17.37:g.78971136A>T	ENSP00000317468:p.Thr164Ser		Somatic	127	0	0		WXS	Illumina HiSeq	.	90	0.06	5	NM_024591	19	0.11	2	A8K7U0|Q53FU4|Q9HAE8	Missense_Mutation	SNP	ENST00000325167.5	37	CCDS11774.1	.	.	.	.	.	.	.	.	.	.	A	12.90	2.077086	0.36662	.	.	ENSG00000176108	ENST00000325167	T	0.71698	-0.59	4.35	4.35	0.52113	.	0.058943	0.64402	D	0.000003	T	0.79257	0.4415	M	0.86028	2.79	0.41607	D	0.988884	D	0.55605	0.972	P	0.54100	0.742	T	0.78952	-0.2001	10	0.16420	T	0.52	-28.4656	13.5577	0.61770	1.0:0.0:0.0:0.0	.	164	Q96FZ7	CHMP6_HUMAN	S	164	ENSP00000317468:T164S	ENSP00000317468:T164S	T	+	1	0	CHMP6	76585731	1.000000	0.71417	0.970000	0.41538	0.154000	0.21943	5.543000	0.67225	1.593000	0.50029	0.459000	0.35465	ACT			0.617	CHMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438215.1		NM_024591	
LOC644669	644669	broad.mit.edu	37	18	15322956	15322962	+	RNA	DEL	TTTATAC	TTTATAC	-	rs146209657|rs368482408		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	TTTATAC	TTTATAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr18:15322956_15322962delTTTATAC	ENST00000455308.2	-	0	594				RNU6-721P_ENST00000410155.1_RNA	NR_027417.1																						AAACTAAAAATTTATACTTCTTAAAAC	0.208																																					.													.	.			0			.																																											0	.			TAAAAATTTATAC																													18.37:g.15322956_15322962delTTTATAC			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	DEL	ENST00000455308.2	37																																																																																						0.208	AP005901.1-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000373635.1			
TSHZ1	10194	mdanderson.org	37	18	72999035	72999035	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr18:72999035C>T	ENST00000580243.1	+	2	2021	c.1673C>T	c.(1672-1674)aCc>aTc	p.T558I	TSHZ1_ENST00000322038.5_Missense_Mutation_p.T513I			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	558					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		CTGGAGAATACCGTCTCCACG	0.607																																					p.T513I													.	.			0			c.C1538T												82.0	80.0	80.0					18																	72999035		2203	4299	6502	SO:0001583	missense	10194	exon2			AGAATACCGTCTC	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1673C>T	18.37:g.72999035C>T	ENSP00000464391:p.Thr558Ile		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_005786	1	0.00	0	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	37		.	.	.	.	.	.	.	.	.	.	C	12.44	1.937353	0.34189	.	.	ENSG00000179981	ENST00000322038	T	0.46819	0.86	5.42	5.42	0.78866	.	0.053119	0.85682	D	0.000000	T	0.70430	0.3223	M	0.83483	2.645	0.37254	D	0.906697	D	0.63880	0.993	P	0.58721	0.844	T	0.71364	-0.4615	10	0.87932	D	0	-28.6268	19.2126	0.93763	0.0:1.0:0.0:0.0	.	558	Q6ZSZ6	TSH1_HUMAN	I	513	ENSP00000323584:T513I	ENSP00000323584:T513I	T	+	2	0	TSHZ1	71128023	1.000000	0.71417	0.918000	0.36340	0.984000	0.73092	7.487000	0.81328	-0.984000	0.03507	0.561000	0.74099	ACC			0.607	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000444913.1		NM_005786	
DNMT1	1786	bcgsc.ca	37	19	10254526	10254526	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:10254526C>T	ENST00000340748.4	-	28	3219	c.2984G>A	c.(2983-2985)cGg>cAg	p.R995Q	DNMT1_ENST00000359526.4_Missense_Mutation_p.R1011Q|DNMT1_ENST00000589538.1_5'UTR|DNMT1_ENST00000540357.1_Missense_Mutation_p.R995Q			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	995	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CTCTTTGATCCGGCCAATTCG	0.542																																					p.R1011Q													.	DNMT1	148		0			c.G3032A												251.0	238.0	243.0					19																	10254526		2203	4300	6503	SO:0001583	missense	1786	exon29			TTGATCCGGCCAA	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2984G>A	19.37:g.10254526C>T	ENSP00000345739:p.Arg995Gln		Somatic	277	0	0		WXS	Illumina HiSeq	Phase_1	217	0.00	0	NM_001130823	88	0.00	0	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999526	0.74818	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	D;D;D	0.86865	-2.18;-2.18;-2.18	5.91	3.78	0.43462	Bromo adjacent homology (BAH) domain (3);	0.051434	0.85682	D	0.000000	D	0.85366	0.5680	M	0.65498	2.005	0.54753	D	0.999988	P;P;P	0.52061	0.938;0.87;0.95	B;B;P	0.44732	0.329;0.245;0.459	T	0.83099	-0.0129	10	0.22706	T	0.39	-22.2465	12.2361	0.54516	0.0:0.8576:0.0:0.1424	.	995;1011;995	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	Q	1011;995;995;863	ENSP00000352516:R1011Q;ENSP00000440457:R995Q;ENSP00000345739:R995Q	ENSP00000345739:R995Q	R	-	2	0	DNMT1	10115526	1.000000	0.71417	0.839000	0.33178	0.948000	0.59901	6.005000	0.70716	1.509000	0.48786	0.655000	0.94253	CGG			0.542	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451166.1		NM_001379	
ANKLE1	126549	broad.mit.edu	37	19	17397498	17397501	+	3'UTR	DEL	TGTT	TGTT	-	rs71180380|rs563327402|rs534658778|rs1465582	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	TGTT	TGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:17397498_17397501delTGTT	ENST00000394458.3	+	0	2261_2264				ANKLE1_ENST00000594072.1_3'UTR|ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000598347.1_Frame_Shift_Del_p.CL590fs	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtgtttgtgtgtgtg	0.529																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTGTTTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TGTT>-	19.37:g.17397498_17397501delTGTT			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	14	0.64	9	.	2	0.00	0	A8VU82|Q8N8J8	Frame_Shift_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.529	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
UBE2S	27338	mdanderson.org	37	19	55912870	55912870	+	Silent	SNP	G	G	T	rs565116762		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr19:55912870G>T	ENST00000264552.9	-	4	790	c.603C>A	c.(601-603)ggC>ggA	p.G201G	UBE2S_ENST00000592570.1_5'Flank|CTD-2105E13.13_ENST00000589101.1_lincRNA|RPL28_ENST00000560055.1_Intron	NM_014501.2	NP_055316.2	Q16763	UBE2S_HUMAN	ubiquitin-conjugating enzyme E2S	201					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular protein modification process (GO:0006464)|exit from mitosis (GO:0010458)|free ubiquitin chain polymerization (GO:0010994)|protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)	anaphase-promoting complex (GO:0005680)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			lung(1)	1	Breast(117;0.155)		LUSC - Lung squamous cell carcinoma(43;0.13)|BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.11)		TATCGCGCTCGCCAGCATGCT	0.672																																					p.G201G													.	.			0			c.C603A												16.0	19.0	18.0					19																	55912870		1784	3734	5518	SO:0001819	synonymous_variant	27338	exon4			GCGCTCGCCAGCA	BC004236	CCDS33114.1	19q13.43	2008-02-05				ENSG00000108106		"""Ubiquitin-conjugating enzymes E2"""	17895	protein-coding gene	gene with protein product	"""ubiquitin carrier protein"", ""ubiquitin-conjugating enzyme E2-24 kD"", ""ubiquitin-protein ligase"""	610309				1379239	Standard	NM_014501		Approved	E2-EPF	uc002qkx.1	Q16763		ENST00000264552.9:c.603C>A	19.37:g.55912870G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_014501	453	0.00	0	Q9BTC1	Silent	SNP	ENST00000264552.9	37	CCDS33114.1																																																																																					0.672	UBE2S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453088.1		NM_014501	
MYT1L	23040	mdanderson.org	37	2	1946773	1946773	+	Silent	SNP	C	C	T	rs148009982	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:1946773C>T	ENST00000399161.2	-	9	1233	c.486G>A	c.(484-486)gaG>gaA	p.E162E	MYT1L_ENST00000428368.2_Silent_p.E162E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	162	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		cttcctcttcctcctcctcct	0.483																																					p.E162E													.	.			0			c.G486A												53.0	54.0	54.0					2																	1946773		2039	3950	5989	SO:0001819	synonymous_variant	23040	exon9			CTCTTCCTCCTCC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.486G>A	2.37:g.1946773C>T			Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_015025	0		0	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37																																																																																						0.483	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000322493.1		NM_015025	
EHBP1	23301	mdanderson.org	37	2	63175395	63175395	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:63175395G>T	ENST00000263991.5	+	14	2001	c.1519G>T	c.(1519-1521)Gca>Tca	p.A507S	EHBP1_ENST00000354487.3_Splice_Site_p.A472S|EHBP1_ENST00000405289.1_Splice_Site_p.A472S|EHBP1_ENST00000431489.1_Splice_Site_p.A472S|EHBP1_ENST00000405015.3_Splice_Site_p.A472S	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	507	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TCCTTTGAAGGCATACGATGG	0.313																																					p.A507S													.	.			0			c.G1519T												70.0	73.0	72.0					2																	63175395		2203	4300	6503	SO:0001630	splice_region_variant	23301	exon14			TTGAAGGCATACG	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.1519-1G>T	2.37:g.63175395G>T			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_015252	25	0.00	0	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	37	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319525	0.81469	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84	5.76	5.76	0.90799	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98764	0.9584	H	0.97564	4.03	0.80722	D	1	D;D;D	0.62365	0.984;0.991;0.978	D;D;D	0.87578	0.997;0.996;0.998	D	0.99246	1.0886	9	.	.	.	.	19.9601	0.97247	0.0:0.0:1.0:0.0	.	472;472;507	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	S	472;472;507;472;472	ENSP00000384143:A472S;ENSP00000403783:A472S;ENSP00000263991:A507S;ENSP00000346482:A472S;ENSP00000385524:A472S	.	A	+	1	0	EHBP1	63028899	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.720000	0.93068	0.655000	0.94253	GCA			0.313	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251616.1		NM_015252	Missense_Mutation
CROCC2	728763	bcgsc.ca	37	2	241922506	241922506	+	RNA	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:241922506G>A	ENST00000425110.1	-	0	770																											CAGGCCTACAGGGAAGAGGCC	0.627																																					.													.	.			0			.																																											0	.			CCTACAGGGAAGA																													2.37:g.241922506G>A			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_1	55	0.00	0	.	0		0		RNA	SNP	ENST00000425110.1	37																																																																																						0.627	AC104809.2-001	KNOWN	basic|exp_conf	antisense	antisense		OTTHUMT00000324139.1			
HDLBP	3069	bcgsc.ca	37	2	242189261	242189261	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr2:242189261G>A	ENST00000391975.1	-	12	1734	c.1507C>T	c.(1507-1509)Cgc>Tgc	p.R503C	HDLBP_ENST00000391976.2_Missense_Mutation_p.R503C|HDLBP_ENST00000476807.1_5'UTR|HDLBP_ENST00000427183.2_Missense_Mutation_p.R470C|HDLBP_ENST00000310931.4_Missense_Mutation_p.R503C	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	503	KH 5. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CTTACCATGCGAGATGCAAGC	0.602																																					p.R503C													.	HDLBP	118		0			c.C1507T												96.0	78.0	84.0					2																	242189261		2203	4300	6503	SO:0001583	missense	3069	exon12			CCATGCGAGATGC		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1507C>T	2.37:g.242189261G>A	ENSP00000375836:p.Arg503Cys		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_1	41	0.00	0	NM_005336	323	0.00	0	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.101438|4.101438	0.76983|0.76983	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183|ENST00000373292	T;T;T;T|T	0.44083|0.41400	0.93;0.93;0.93;0.93|1.0	5.57|5.57	4.7|4.7	0.59300|0.59300	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51466|0.51466	0.1676|0.1676	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.77557|.	0.962;0.99|.	T|T	0.44967|0.44967	-0.9293|-0.9293	10|7	0.87932|0.21540	D|T	0|0.41	-14.4239|-14.4239	14.7226|14.7226	0.69317|0.69317	0.0696:0.0:0.9303:0.0|0.0696:0.0:0.9303:0.0	.|.	470;503|.	E7EM71;Q00341|.	.;VIGLN_HUMAN|.	C|L	503;503;503;470|311	ENSP00000375836:R503C;ENSP00000375837:R503C;ENSP00000312042:R503C;ENSP00000399139:R470C|ENSP00000362389:S311L	ENSP00000312042:R503C|ENSP00000362389:S311L	R|S	-|-	1|2	0|0	HDLBP|HDLBP	241837934|241837934	1.000000|1.000000	0.71417|0.71417	0.855000|0.855000	0.33649|0.33649	0.478000|0.478000	0.33099|0.33099	9.722000|9.722000	0.98770|0.98770	1.497000|1.497000	0.48584|0.48584	0.655000|0.655000	0.94253|0.94253	CGC|TCG			0.602	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257245.5		NM_203346	
PROCR	10544	mdanderson.org	37	20	33762717	33762717	+	Missense_Mutation	SNP	G	G	T	rs139714129		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr20:33762717G>T	ENST00000216968.4	+	2	365	c.283G>T	c.(283-285)Ggc>Tgc	p.G95C	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	95					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	CCAGTTCCACGGCCTCGTGCG	0.706																																					p.G95C													.	.			0			c.G283T							G	CYS/GLY	0,4394		0,0,2197	28.0	22.0	24.0		283	-5.2	0.0	20	dbSNP_134	24	1,8597		0,1,4298	no	missense	PROCR	NM_006404.3	159	0,1,6495	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	95/239	33762717	1,12991	2197	4299	6496	SO:0001583	missense	10544	exon2			TTCCACGGCCTCG	L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.283G>T	20.37:g.33762717G>T	ENSP00000216968:p.Gly95Cys		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_006404	37	0.00	0	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	ENST00000216968.4	37	CCDS13248.1	.	.	.	.	.	.	.	.	.	.	g	26.5	4.744770	0.89663	0.0	1.16E-4	ENSG00000101000	ENST00000374477;ENST00000216968	D	0.82984	-1.67	5.22	-5.15	0.02866	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.993065	0.08179	N	0.985711	D	0.85075	0.5614	L	0.60455	1.87	0.09310	N	1	D	0.89917	1.0	D	0.71870	0.975	T	0.76231	-0.3035	10	0.42905	T	0.14	-7.0059	6.0567	0.19815	0.4124:0.3727:0.2149:0.0	.	95	Q9UNN8	EPCR_HUMAN	C	95	ENSP00000216968:G95C	ENSP00000216968:G95C	G	+	1	0	PROCR	33226378	0.000000	0.05858	0.000000	0.03702	0.848000	0.48234	-1.320000	0.02700	-0.970000	0.03569	0.556000	0.70494	GGC	0		0.706	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078843.3			
LAMA5	3911	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	20	60886012	60886012	+	Silent	SNP	C	C	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr20:60886012C>A	ENST00000252999.3	-	74	10293	c.10227G>T	c.(10225-10227)ggG>ggT	p.G3409G	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3409	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGAGCCGAGTCCCGAGGCCTT	0.701																																					p.G3409G													.	.			0			c.G10227T												14.0	18.0	17.0					20																	60886012		2161	4238	6399	SO:0001819	synonymous_variant	3911	exon74			CCGAGTCCCGAGG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.10227G>T	20.37:g.60886012C>A			Somatic	74	0	0		WXS	Illumina HiSeq	.	53	0.23	12	NM_005560	117	0.27	32	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																					0.701	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
BRWD1	54014	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	21	40582800	40582800	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr21:40582800T>C	ENST00000333229.2	-	35	4283	c.3956A>G	c.(3955-3957)aAg>aGg	p.K1319R	BRWD1_ENST00000380800.3_Missense_Mutation_p.K1319R|BRWD1_ENST00000342449.3_Missense_Mutation_p.K1319R	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1319					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ACACTGTTTCTTCCAGTTGCT	0.348																																					p.K1319R	Melanoma(170;988 1986 4794 16843 39731)												.	.			0			c.A3956G												118.0	108.0	112.0					21																	40582800		2203	4300	6503	SO:0001583	missense	54014	exon35			TGTTTCTTCCAGT	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3956A>G	21.37:g.40582800T>C	ENSP00000330753:p.Lys1319Arg		Somatic	145	0	0		WXS	Illumina HiSeq	.	127	0.07	9	NM_018963	25	0.24	6	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.956248	0.34565	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.18502	2.21;2.21;2.21	5.36	1.69	0.24217	Bromodomain (3);	0.331353	0.28572	N	0.014875	T	0.09992	0.0245	L	0.37850	1.14	0.36369	D	0.861171	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.26292	-1.0107	10	0.15499	T	0.54	-2.779	4.126	0.10128	0.1398:0.227:0.0:0.6332	.	1319;1319	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	R	1319	ENSP00000330753:K1319R;ENSP00000344333:K1319R;ENSP00000370178:K1319R	ENSP00000330753:K1319R	K	-	2	0	BRWD1	39504670	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.374000	0.44274	0.104000	0.17725	0.477000	0.44152	AAG			0.348	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000141398.3		NM_033656	
COL6A1	1291	mdanderson.org	37	21	47423322	47423322	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr21:47423322G>A	ENST00000361866.3	+	35	2596	c.2482G>A	c.(2482-2484)Gct>Act	p.A828T	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	828	C-terminal globular domain.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CTCCTCCCCGGCTGACATCAC	0.677																																					p.A828T													.	.			0			c.G2482A												23.0	26.0	25.0					21																	47423322		2166	4203	6369	SO:0001583	missense	1291	exon35			TCCCCGGCTGACA	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2482G>A	21.37:g.47423322G>A	ENSP00000355180:p.Ala828Thr		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_001848	248	0.00	0	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	G	9.621	1.133714	0.21123	.	.	ENSG00000142156	ENST00000361866	T	0.79033	-1.23	4.84	-4.13	0.03904	von Willebrand factor, type A (1);	0.628220	0.15568	N	0.255590	T	0.52901	0.1763	N	0.17082	0.46	0.28973	N	0.889136	B	0.06786	0.001	B	0.06405	0.002	T	0.43278	-0.9401	10	0.14252	T	0.57	-0.0858	7.9701	0.30122	0.4852:0.0:0.4122:0.1026	.	828	P12109	CO6A1_HUMAN	T	828	ENSP00000355180:A828T	ENSP00000355180:A828T	A	+	1	0	COL6A1	46247750	0.000000	0.05858	0.792000	0.32020	0.620000	0.37586	0.108000	0.15396	-0.426000	0.07360	0.530000	0.56133	GCT			0.677	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206877.1		NM_001848	
ZDHHC8P1	150244	hgsc.bcm.edu	37	22	23742934	23742934	+	RNA	SNP	T	T	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr22:23742934T>C	ENST00000255890.4	-	0	439									zinc finger, DHHC-type containing 8 pseudogene 1																		TGAGCATCCATGGCTGAGGGG	0.657																																					.													.	.			0			.																																											150244	.			CATCCATGGCTGA			22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23742934T>C			Somatic	14	0	0		WXS	Illumina HiSeq	.	20	0.20	4	.	0		0		RNA	SNP	ENST00000255890.4	37																																																																																						0.657	ZDHHC8P1-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319397.1		NR_003950	
ZNF70	7621	broad.mit.edu	37	22	24086211	24086211	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr22:24086211A>G	ENST00000341976.3	-	2	1577	c.1117T>C	c.(1117-1119)Ttt>Ctt	p.F373L		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						CTGTGGCAAAAGGCCTTGCCA	0.602																																					p.F373L													.	ZNF70	49		0			c.T1117C												101.0	89.0	93.0					22																	24086211		2203	4300	6503	SO:0001583	missense	7621	exon2			GGCAAAAGGCCTT	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.1117T>C	22.37:g.24086211A>G	ENSP00000339314:p.Phe373Leu		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	120	0.03	4	NM_021916	2	0.00	0		Missense_Mutation	SNP	ENST00000341976.3	37	CCDS13812.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.302247	0.81136	.	.	ENSG00000187792	ENST00000341976	T	0.46063	0.88	2.93	2.93	0.34026	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.61602	0.2360	M	0.78916	2.43	0.36703	D	0.8802	D	0.89917	1.0	D	0.85130	0.997	T	0.70274	-0.4917	9	0.87932	D	0	-25.0061	9.6446	0.39859	1.0:0.0:0.0:0.0	.	373	Q9UC06	ZNF70_HUMAN	L	373	ENSP00000339314:F373L	ENSP00000339314:F373L	F	-	1	0	ZNF70	22416211	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.471000	0.90403	1.599000	0.50093	0.454000	0.30748	TTT			0.602	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319881.1		NM_021916	
PRR34	55267	broad.mit.edu	37	22	46449890	46449890	+	Frame_Shift_Del	DEL	G	G	-	rs374981205	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr22:46449890delG	ENST00000396008.2	-	1	134	c.84delC	c.(82-84)cccfs	p.P28fs	RP6-109B7.3_ENST00000445441.1_RNA|FLJ27365_ENST00000381051.2_Intron|C22orf26_ENST00000333761.1_Frame_Shift_Del_p.P28fs|RP6-109B7.3_ENST00000416202.1_RNA|RP6-109B7.3_ENST00000451166.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA|RP6-109B7.5_ENST00000608644.1_RNA			Q9NV39	PRR34_HUMAN		28	Pro-rich.		P -> L (in dbSNP:rs12159707).										Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		TTGCGGGGTTGGGGGGGGAGG	0.751																																					p.P28fs													.	C22orf26	1		0			c.84delC									54,25,3479		10,0,34,1,23,1711	5.0	5.0	5.0			-3.8	0.0	22		5	41,55,7048		5,0,31,4,47,3485	no	codingComplex	C22orf26	NM_018280.2		15,0,65,5,70,5196	A1A1,A1A2,A1R,A2A2,A2R,RR		1.3438,2.2203,1.6352			46449890	95,80,10527	1914	3875	5789	SO:0001589	frameshift_variant	55267	exon1			GGGGTTGGGGGGG																												ENST00000396008.2:c.84delC	22.37:g.46449890delG	ENSP00000379329:p.Pro28fs		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	NM_018280	0		0	B0QZ24	Frame_Shift_Del	DEL	ENST00000396008.2	37	CCDS14071.1																																																																																					0.751	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317994.1			
TUBGCP6	85378	mdanderson.org	37	22	50660245	50660245	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr22:50660245G>T	ENST00000248846.5	-	16	2647	c.2543C>A	c.(2542-2544)gCa>gAa	p.A848E	TUBGCP6_ENST00000491449.1_5'UTR|TUBGCP6_ENST00000439308.2_Missense_Mutation_p.A848E			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	848					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GTGTTGCTCTGCAGACCCAGA	0.642																																					p.A848E													.	.			0			c.C2543A												39.0	44.0	42.0					22																	50660245		2203	4300	6503	SO:0001583	missense	85378	exon16			TGCTCTGCAGACC	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.2543C>A	22.37:g.50660245G>T	ENSP00000248846:p.Ala848Glu		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_020461	17	0.00	0	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665252	0.29604	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.12672	3.05;2.66	4.28	-0.348	0.12613	.	2.847890	0.02244	N	0.066046	T	0.09024	0.0223	L	0.29908	0.895	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.12156	0.007;0.007	T	0.23048	-1.0199	10	0.11485	T	0.65	.	2.1332	0.03755	0.1872:0.1605:0.4945:0.1577	.	840;848	B2RWN4;Q96RT7	.;GCP6_HUMAN	E	848	ENSP00000248846:A848E;ENSP00000397387:A848E	ENSP00000248846:A848E	A	-	2	0	TUBGCP6	49002372	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.914000	0.28624	0.161000	0.19458	-0.311000	0.09066	GCA			0.642	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075004.3		NM_020461	
LAMB2	3913	mdanderson.org	37	3	49168584	49168584	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:49168584G>T	ENST00000418109.1	-	8	878	c.714C>A	c.(712-714)aaC>aaA	p.N238K	LAMB2_ENST00000305544.4_Splice_Site_p.N238K	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	238	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCTTCAACAGGTCTGAGGCGG	0.592																																					p.N238K													.	.			0			c.C714A												61.0	60.0	60.0					3																	49168584		2203	4300	6503	SO:0001630	splice_region_variant	3913	exon7			CAACAGGTCTGAG		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.713-1C>A	3.37:g.49168584G>T			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_002292	23	0.00	0	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	g	16.93	3.257207	0.59321	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000494831	T;T;T	0.76709	-1.04;-1.04;-1.04	5.27	2.5	0.30297	Laminin, N-terminal (3);	0.178585	0.49916	D	0.000132	T	0.76040	0.3932	M	0.71581	2.175	0.50467	D	0.999875	P	0.40534	0.72	B	0.43867	0.434	T	0.71497	-0.4575	10	0.46703	T	0.11	.	7.6998	0.28617	0.41:0.0:0.59:0.0	.	238	P55268	LAMB2_HUMAN	K	238;238;89	ENSP00000388325:N238K;ENSP00000307156:N238K;ENSP00000444751:N89K	ENSP00000307156:N238K	N	-	3	2	LAMB2	49143588	1.000000	0.71417	0.983000	0.44433	0.966000	0.64601	0.836000	0.27545	0.313000	0.23062	0.651000	0.88453	AAC			0.592	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345939.1		NM_002292	Missense_Mutation
USP4	7375	mdanderson.org	37	3	49377394	49377394	+	Missense_Mutation	SNP	G	G	T	rs199503897	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:49377394G>T	ENST00000265560.4	-	1	110	c.64C>A	c.(64-66)Ccc>Acc	p.P22T	USP4_ENST00000416417.1_Missense_Mutation_p.P22T|USP4_ENST00000415188.1_Missense_Mutation_p.P22T|USP4_ENST00000351842.4_Missense_Mutation_p.P22T	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	22	DUSP. {ECO:0000255|PROSITE- ProRule:PRU00613}.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CTCATTAAGGGTCCAAGCTCG	0.662																																					p.P22T													.	.			0			c.C64A												64.0	68.0	67.0					3																	49377394		2203	4300	6503	SO:0001583	missense	7375	exon1			TTAAGGGTCCAAG	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.64C>A	3.37:g.49377394G>T	ENSP00000265560:p.Pro22Thr		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_003363	24	0.00	0	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.742567	0.00675	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.29655	2.1;2.22;1.56	4.76	3.87	0.44632	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (1);	0.144833	0.44285	D	0.000479	T	0.12689	0.0308	N	0.02721	-0.515	0.22787	N	0.998738	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.24941	-1.0146	10	0.11485	T	0.65	-7.2073	12.8904	0.58068	0.0:0.6869:0.3131:0.0	.	22;22	Q13107-2;Q13107	.;UBP4_HUMAN	T	22	ENSP00000341028:P22T;ENSP00000265560:P22T;ENSP00000400623:P22T	ENSP00000265560:P22T	P	-	1	0	USP4	49352398	0.993000	0.37304	0.994000	0.49952	0.188000	0.23474	1.091000	0.30915	0.593000	0.29745	-0.357000	0.07601	CCC			0.662	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346069.1		NM_199443	
RNF123	63891	mdanderson.org	37	3	49724400	49724400	+	5'Flank	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:49724400C>T	ENST00000327697.6	+	0	0				MST1_ENST00000383728.3_Silent_p.Q161Q|MST1_ENST00000545762.1_3'UTR|RNF123_ENST00000432042.1_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'UTR|MST1_ENST00000449682.2_Silent_p.Q236Q	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CGAAGGGGTGCTGGTGCGGGT	0.697																																					p.Q236Q													.	.			0			c.G708A												14.0	17.0	16.0					3																	49724400		2025	4019	6044	SO:0001631	upstream_gene_variant	4485	exon6			GGGGTGCTGGTGC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49724400C>T	Exception_encountered		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_020998	4	0.00	0	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	ENST00000327697.6	37	CCDS33758.1																																																																																					0.697	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346475.2		NM_022064	
GLYCTK	132158	mdanderson.org	37	3	52325061	52325061	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:52325061G>A	ENST00000436784.2	+	3	523	c.463G>A	c.(463-465)Gca>Aca	p.A155T	GLYCTK_ENST00000473032.1_Missense_Mutation_p.A155T|GLYCTK_ENST00000461183.1_Missense_Mutation_p.A71T|GLYCTK_ENST00000305690.8_Missense_Mutation_p.A155T|GLYCTK_ENST00000471180.1_Missense_Mutation_p.A28T|GLYCTK_ENST00000354773.4_Missense_Mutation_p.A155T|GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000477382.1_Missense_Mutation_p.A155T			Q8IVS8	GLCTK_HUMAN	glycerate kinase	155					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		GCTGCGGGCTGCACTGGCCAT	0.617																																					p.A155T													.	.			0			c.G463A												89.0	69.0	76.0					3																	52325061		2203	4300	6503	SO:0001583	missense	132158	exon3			CGGGCTGCACTGG		CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.463G>A	3.37:g.52325061G>A	ENSP00000389175:p.Ala155Thr		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	22	0.14	3	NM_145262	32	0.00	0	Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	ENST00000436784.2	37	CCDS2852.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611079	0.46631	.	.	ENSG00000168237	ENST00000461183;ENST00000473032;ENST00000305690;ENST00000354773;ENST00000471180;ENST00000436784;ENST00000477382	T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;0.55	5.38	3.53	0.40419	.	0.051927	0.85682	D	0.000000	T	0.60612	0.2282	L	0.39898	1.24	0.58432	D	0.999999	P;D;P	0.89917	0.946;1.0;0.938	P;D;P	0.97110	0.636;1.0;0.735	T	0.53578	-0.8419	10	0.25751	T	0.34	-13.1716	12.2171	0.54412	0.0:0.1299:0.7348:0.1352	.	155;155;155	Q8IVS8-2;Q8IVS8-4;Q8IVS8	.;.;GLCTK_HUMAN	T	71;155;155;155;28;155;155	ENSP00000417264:A71T;ENSP00000418951:A155T;ENSP00000301965:A155T;ENSP00000346825:A155T;ENSP00000417526:A28T;ENSP00000389175:A155T;ENSP00000419008:A155T	ENSP00000301965:A155T	A	+	1	0	GLYCTK	52300101	1.000000	0.71417	0.530000	0.27963	0.005000	0.04900	7.309000	0.78937	0.591000	0.29711	0.655000	0.94253	GCA			0.617	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350835.1		NM_145262	
BAP1	8314	mdanderson.org	37	3	52436392	52436392	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:52436392C>T	ENST00000460680.1	-	17	2573	c.2102G>A	c.(2101-2103)cGc>cAc	p.R701H	BAP1_ENST00000296288.5_Missense_Mutation_p.R683H	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q694fs*14(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GACCCCTTGGCGCCGCCGCAC	0.662			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.R701H	GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,NS,carcinoma,-1,1	BAP1	-1	1	1	Deletion - Frameshift(1)	eye(1)	c.G2102A												20.0	21.0	20.0					3																	52436392		2192	4288	6480	SO:0001583	missense	8314	exon17			CCTTGGCGCCGCC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.2102G>A	3.37:g.52436392C>T	ENSP00000417132:p.Arg701His		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_004656	52	0.00	0	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.621166|4.621166	0.87460|0.87460	.|.	.|.	ENSG00000163930|ENSG00000163930	ENST00000469613|ENST00000460680;ENST00000296288;ENST00000478368	.|T;T;T	.|0.41758	.|0.99;0.99;0.99	5.52|5.52	5.52|5.52	0.82312|0.82312	.|Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	.|0.054864	.|0.85682	.|D	.|0.000000	T|T	0.48429|0.48429	0.1499|0.1499	L|L	0.38838|0.38838	1.175|1.175	0.80722|0.80722	D|D	1|1	.|D	.|0.65815	.|0.995	.|P	.|0.53146	.|0.719	T|T	0.32241|0.32241	-0.9914|-0.9914	5|10	.|0.35671	.|T	.|0.21	.|.	19.4196|19.4196	0.94715|0.94715	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|701	.|Q92560	.|BAP1_HUMAN	T|H	101|701;683;225	.|ENSP00000417132:R701H;ENSP00000296288:R683H;ENSP00000420647:R225H	.|ENSP00000296288:R683H	A|R	-|-	1|2	0|0	BAP1|BAP1	52411432|52411432	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.764000|7.764000	0.85297|0.85297	2.590000|2.590000	0.87494|0.87494	0.561000|0.561000	0.74099|0.74099	GCC|CGC			0.662	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350895.1			
PLXND1	23129	bcgsc.ca	37	3	129324383	129324383	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr3:129324383C>A	ENST00000324093.4	-	1	1278	c.1100G>T	c.(1099-1101)cGg>cTg	p.R367L	PLXND1_ENST00000393239.1_Missense_Mutation_p.R367L	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	367	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						AGCAAAGAGCCGCTCCCGGGC	0.736																																					p.R367L	Ovarian(97;366 1484 3738 22084 39045)												.	PLXND1	149		0			c.G1100T												1.0	1.0	1.0					3																	129324383		1048	2263	3311	SO:0001583	missense	23129	exon1			AAGAGCCGCTCCC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.1100G>T	3.37:g.129324383C>A	ENSP00000317128:p.Arg367Leu		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_1	13	0.00	0	NM_015103	2	0.00	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	c	3.249	-0.153752	0.06585	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.08546	3.08;3.08	4.59	-3.13	0.05266	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	1.705740	0.04537	N	0.387372	T	0.02688	0.0081	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43065	-0.9414	10	0.28530	T	0.3	.	6.3201	0.21213	0.3814:0.3908:0.0:0.2278	.	367	Q9Y4D7	PLXD1_HUMAN	L	367	ENSP00000317128:R367L;ENSP00000376931:R367L	ENSP00000317128:R367L	R	-	2	0	PLXND1	130807073	0.000000	0.05858	0.205000	0.23548	0.069000	0.16628	-0.287000	0.08388	-0.915000	0.03823	0.299000	0.19835	CGG			0.736	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356132.4		NM_015103	
PDS5A	23244	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	39839559	39839559	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:39839559C>G	ENST00000303538.8	-	32	4466	c.3927G>C	c.(3925-3927)ttG>ttC	p.L1309F		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TACCTGCTTCCAAACCCCCAG	0.448																																					p.L1309F													.	PDS5A	114		0			c.G3927C												95.0	94.0	94.0					4																	39839559		1909	4127	6036	SO:0001583	missense	23244	exon32			TGCTTCCAAACCC	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.3927G>C	4.37:g.39839559C>G	ENSP00000303427:p.Leu1309Phe		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	133	0.12	16	NM_001100399	70	0.10	7		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804407	0.50315	.	.	ENSG00000121892	ENST00000303538	.	.	.	5.31	5.31	0.75309	.	0.365653	0.24705	N	0.036276	T	0.30070	0.0753	N	0.08118	0	0.80722	D	1	B	0.27068	0.167	B	0.27715	0.082	T	0.17167	-1.0378	8	.	.	.	-5.662	10.1833	0.42982	0.0:0.8772:0.0:0.1228	.	1309	Q29RF7	PDS5A_HUMAN	F	1309	.	.	L	-	3	2	PDS5A	39515954	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.740000	0.38228	2.477000	0.83638	0.655000	0.94253	TTG			0.448	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361287.1		NM_015200	
ARHGAP24	83478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	86491797	86491797	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:86491797A>G	ENST00000395184.1	+	2	569	c.103A>G	c.(103-105)Act>Gct	p.T35A	ARHGAP24_ENST00000506421.1_3'UTR|ARHGAP24_ENST00000503995.1_Missense_Mutation_p.T35A	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	35	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		CTTTGTCAAGACTTGGCATAC	0.502																																					p.T35A													.	.			0			c.A103G												122.0	102.0	109.0					4																	86491797		2203	4300	6503	SO:0001583	missense	83478	exon2			GTCAAGACTTGGC	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.103A>G	4.37:g.86491797A>G	ENSP00000378611:p.Thr35Ala		Somatic	141	0	0		WXS	Illumina HiSeq	.	118	0.14	16	NM_001025616	2	0.00	0	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.004902	0.74932	.	.	ENSG00000138639	ENST00000395184;ENST00000503995	T;T	0.76839	-1.05;-1.05	5.81	5.81	0.92471	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.82628	0.5078	L	0.43598	1.365	0.80722	D	1	D;B;D	0.69078	0.977;0.317;0.997	P;B;P	0.61800	0.817;0.228;0.894	D	0.83917	0.0299	10	0.59425	D	0.04	.	15.8314	0.78757	1.0:0.0:0.0:0.0	.	35;35;180	Q8N264;Q8N264-4;Q8N264-5	RHG24_HUMAN;.;.	A	35	ENSP00000378611:T35A;ENSP00000423206:T35A	ENSP00000378611:T35A	T	+	1	0	ARHGAP24	86710821	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.270000	0.95690	2.217000	0.71921	0.533000	0.62120	ACT			0.502	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252815.2		NM_031305	
ANKRD50	57182	bcgsc.ca	37	4	125592523	125592523	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:125592523C>T	ENST00000504087.1	-	4	2946	c.1909G>A	c.(1909-1911)Gtg>Atg	p.V637M	ANKRD50_ENST00000515641.1_Missense_Mutation_p.V458M	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	637										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GCACAATCCACTTTTACGCCA	0.458																																					p.V637M													.	ANKRD50	136		0			c.G1909A												136.0	121.0	126.0					4																	125592523		2203	4300	6503	SO:0001583	missense	57182	exon4			AATCCACTTTTAC	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1909G>A	4.37:g.125592523C>T	ENSP00000425658:p.Val637Met		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_1	100	0.00	0	NM_020337	4	0.00	0	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.690012	0.68271	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.69040	-0.37;-0.32	5.21	5.21	0.72293	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.80939	0.4720	M	0.76170	2.325	0.80722	D	1	D	0.59357	0.985	P	0.61874	0.895	T	0.82701	-0.0327	10	0.72032	D	0.01	.	18.9425	0.92610	0.0:1.0:0.0:0.0	.	637	Q9ULJ7	ANR50_HUMAN	M	637;458	ENSP00000425658:V637M;ENSP00000425355:V458M	ENSP00000425658:V637M	V	-	1	0	ANKRD50	125811973	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	7.133000	0.77259	2.714000	0.92807	0.585000	0.79938	GTG			0.458	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364775.1		NM_020337	
INPP4B	8821	mdanderson.org	37	4	143326460	143326460	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr4:143326460C>A	ENST00000513000.1	-	7	587	c.154G>T	c.(154-156)Gct>Tct	p.A52S	INPP4B_ENST00000506217.1_Missense_Mutation_p.A52S|INPP4B_ENST00000508116.1_Missense_Mutation_p.A52S|INPP4B_ENST00000262992.4_Missense_Mutation_p.A52S|INPP4B_ENST00000308502.4_Missense_Mutation_p.A52S|INPP4B_ENST00000509777.1_Missense_Mutation_p.A52S	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	52	C2.				cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CGGACAGGAGCCACGAGATCC	0.502																																					p.A52S													.	.			0			c.G154T												98.0	87.0	91.0					4																	143326460		2203	4300	6503	SO:0001583	missense	8821	exon7			CAGGAGCCACGAG	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.154G>T	4.37:g.143326460C>A	ENSP00000425487:p.Ala52Ser		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_003866	2	0.00	0	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	37	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404131	0.62288	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000508116;ENST00000509777;ENST00000510812;ENST00000506217;ENST00000506788	T;T;T;T;T;T	0.30981	1.93;1.93;1.93;1.93;1.93;1.51	6.16	6.16	0.99307	C2 calcium/lipid-binding domain, CaLB (1);	0.059567	0.64402	D	0.000003	T	0.29256	0.0728	L	0.42245	1.32	0.48696	D	0.999694	P	0.51537	0.946	P	0.45639	0.488	T	0.01935	-1.1244	10	0.11182	T	0.66	.	13.9788	0.64291	0.0:0.9314:0.0:0.0686	.	52	O15327	INP4B_HUMAN	S	52	ENSP00000425487:A52S;ENSP00000262992:A52S;ENSP00000308441:A52S;ENSP00000423954:A52S;ENSP00000422793:A52S;ENSP00000427250:A52S	ENSP00000262992:A52S	A	-	1	0	INPP4B	143545910	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.966000	0.40481	2.937000	0.99478	0.650000	0.86243	GCT			0.502	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364587.1		NM_003866	
PCDHA10	56139	mdanderson.org	37	5	140237643	140237643	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr5:140237643G>T	ENST00000307360.5	+	1	2010	c.2010G>T	c.(2008-2010)gaG>gaT	p.E670D	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	670	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTTGTGGAGGGCAGCCAGG	0.662																																					p.E670D													.	.			0			c.G2010T												19.0	21.0	20.0					5																	140237643		1322	2287	3609	SO:0001583	missense	56139	exon1			TGTGGAGGGCAGC	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.2010G>T	5.37:g.140237643G>T	ENSP00000304234:p.Glu670Asp		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_031859	0		0	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	G	5.020	0.189314	0.09547	.	.	ENSG00000250120	ENST00000307360	T	0.49432	0.78	3.6	-2.21	0.06973	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.19886	0.0478	N	0.11064	0.09	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.12837	0.008;0.005	T	0.26710	-1.0095	9	0.07325	T	0.83	.	4.6198	0.12444	0.1589:0.5037:0.2206:0.1168	.	670;670	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	D	670	ENSP00000304234:E670D	ENSP00000304234:E670D	E	+	3	2	PCDHA10	140217827	0.002000	0.14202	0.057000	0.19452	0.017000	0.09413	-0.097000	0.11042	-0.684000	0.05183	-0.479000	0.04858	GAG			0.662	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372895.2		NM_018901	
PCDHB2	56133	hgsc.bcm.edu	37	5	140476082	140476082	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr5:140476082G>A	ENST00000194155.4	+	1	1856	c.1708G>A	c.(1708-1710)Ggc>Agc	p.G570S		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	570	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N569>?(1)|p.G570S(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGCAGAACGGCTCCGCGCC	0.726																																					p.G570S													PCDHB2,trunk,malignant_melanoma,0,1	PCDHB2	0	1	2	Substitution - Missense(1)|Complex(1)	NS(1)|skin(1)	c.G1708A												8.0	11.0	10.0					5																	140476082		2102	4037	6139	SO:0001583	missense	56133	exon1			CAGAACGGCTCCG	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1708G>A	5.37:g.140476082G>A	ENSP00000194155:p.Gly570Ser		Somatic	42	0	0		WXS	Illumina HiSeq	.	20	0.15	3	NM_018936	0		0	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.832507	0.32421	.	.	ENSG00000112852	ENST00000194155	T	0.60797	0.16	4.5	2.68	0.31781	Cadherin-like (1);	.	.	.	.	T	0.36608	0.0973	N	0.20807	0.61	0.25394	N	0.988505	B	0.27559	0.181	B	0.15870	0.014	T	0.19289	-1.0310	9	0.45353	T	0.12	.	5.3872	0.16224	0.2147:0.0:0.6312:0.1541	.	570	Q9Y5E7	PCDB2_HUMAN	S	570	ENSP00000194155:G570S	ENSP00000194155:G570S	G	+	1	0	PCDHB2	140456266	0.023000	0.18921	0.991000	0.47740	0.982000	0.71751	1.056000	0.30480	0.439000	0.26476	0.556000	0.70494	GGC			0.726	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251801.2		NM_018936	
PCDHB16	57717	hgsc.bcm.edu	37	5	140563835	140563836	+	Missense_Mutation	DNP	CG	CG	TA	rs370851835|rs535302272	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr5:140563835_140563836CG>TA	ENST00000361016.2	+	1	2856_2857	c.1701_1702CG>TA	c.(1699-1704)aaCGgc>aaTAgc	p.G568S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	568	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTGCAGAACGGCTCCGCGCC	0.713																																					p.G568S													PCDHB16,NS,carcinoma,0,1	PCDHB16	0	1	0			c.G1702A																																									SO:0001583	missense	57717	exon1			GCAGAACGGCTCC	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	Exception_encountered	5.37:g.140563835_140563836delinsTA	ENSP00000354293:p.Gly568Ser		Somatic	8	0	0		WXS	Illumina HiSeq	.	8	0.50	4	NM_020957	0		0	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	DNP	ENST00000361016.2	37	CCDS4251.1																																																																																					0.713	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251800.1		NM_020957	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	176636782	176636782	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr5:176636782C>G	ENST00000439151.2	+	5	1427	c.1382C>G	c.(1381-1383)aCa>aGa	p.T461R	NSD1_ENST00000354179.4_Missense_Mutation_p.T192R|NSD1_ENST00000361032.4_Missense_Mutation_p.T358R|NSD1_ENST00000347982.4_Missense_Mutation_p.T192R	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	461					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GAAGACTGCACAAATGATCCT	0.418			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.T461R				Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	.			0			c.C1382G												138.0	127.0	131.0					5																	176636782		2203	4300	6503	SO:0001583	missense	64324	exon5	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	ACTGCACAAATGA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.1382C>G	5.37:g.176636782C>G	ENSP00000395929:p.Thr461Arg		Somatic	199	0	0		WXS	Illumina HiSeq	.	144	0.20	29	NM_022455	9	0.78	7	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	9.876	1.200289	0.22121	.	.	ENSG00000165671	ENST00000354179;ENST00000355783;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93426	-3.11;-3.12;-3.11;-3.22	5.5	4.64	0.57946	.	0.404314	0.23922	N	0.043223	D	0.87974	0.6313	N	0.24115	0.695	0.25797	N	0.98455	P;P;P	0.49559	0.925;0.493;0.664	P;B;B	0.45712	0.491;0.277;0.296	T	0.80544	-0.1335	9	.	.	.	.	8.2319	0.31603	0.1549:0.765:0.0:0.08	.	192;358;461	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	R	192;192;461;192;358	ENSP00000346111:T192R;ENSP00000395929:T461R;ENSP00000343209:T192R;ENSP00000354310:T358R	.	T	+	2	0	NSD1	176569388	0.643000	0.27269	0.985000	0.45067	0.507000	0.33981	1.232000	0.32636	1.333000	0.45449	-0.229000	0.12294	ACA			0.418	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253412.2		NM_172349	
RNF5	6048	mdanderson.org	37	6	32148102	32148102	+	Nonstop_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:32148102G>T	ENST00000375094.3	+	6	700	c.542G>T	c.(541-543)tGa>tTa	p.*181L	RNF5_ENST00000427134.2_Intron|AGPAT1_ENST00000336984.6_5'Flank|AGPAT1_ENST00000395497.1_5'Flank|AGPAT1_ENST00000490711.1_5'Flank|AGPAT1_ENST00000375104.2_5'Flank	NM_006913.3	NP_008844.1	Q99942	RNF5_HUMAN	ring finger protein 5, E3 ubiquitin protein ligase	0					cellular protein catabolic process (GO:0044257)|ER-associated misfolded protein catabolic process (GO:0071712)|negative regulation of autophagy (GO:0010507)|protein destabilization (GO:0031648)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of autophagic vacuole assembly (GO:2000785)|response to bacterium (GO:0009617)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|lung(7)|urinary_tract(2)	10						CTCAGTATTTGAGCTATGTCT	0.542																																					p.X181L													.	.			0			c.G542T												106.0	116.0	113.0					6																	32148102		1510	2709	4219	SO:0001578	stop_lost	6048	exon6			GTATTTGAGCTAT	U89336	CCDS4745.1	6p21.31	2013-01-09	2012-02-23			ENSG00000204308		"""RING-type (C3HC4) zinc fingers"""	10068	protein-coding gene	gene with protein product		602677	"""ring finger protein 5"""			9533025	Standard	NM_006913		Approved	NG2, G16, RING5, RMA1	uc031snv.1	Q99942	OTTHUMG00000031093	ENST00000375094.3:c.542G>T	6.37:g.32148102G>T	ENSP00000364235:p.*181Leuext*37		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_006913	308	0.00	0	A2BFI6|B2R4K3|Q0VDB7|Q9UMQ2	Missense_Mutation	SNP	ENST00000375094.3	37	CCDS4745.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.501949	0.44455	.	.	ENSG00000204308	ENST00000375094	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3374	0.43858	0.0896:0.0:0.9104:0.0	.	.	.	.	L	181	.	.	X	+	2	2	RNF5	32256080	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.649000	0.54417	2.644000	0.89710	0.561000	0.74099	TGA			0.542	RNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076133.2		NM_006913	
RNF8	9025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	37358600	37358600	+	3'UTR	SNP	T	T	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:37358600T>A	ENST00000373479.4	+	0	1717				RNF8_ENST00000469731.1_Missense_Mutation_p.F440Y	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						TCTGGAGGATTCTCTCTAGCC	0.507																																					p.F440Y													.	.			0			c.T1319A												111.0	98.0	103.0					6																	37358600		2203	4300	6503	SO:0001624	3_prime_UTR_variant	9025	exon7			GAGGATTCTCTCT	AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.*66T>A	6.37:g.37358600T>A			Somatic	88	0	0		WXS	Illumina HiSeq	.	73	0.15	11	NM_183078	189	0.27	51	A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	Missense_Mutation	SNP	ENST00000373479.4	37	CCDS4834.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.537226	0.45176	.	.	ENSG00000112130	ENST00000469731	T	0.47528	0.84	3.84	3.84	0.44239	.	.	.	.	.	T	0.35856	0.0946	.	.	.	0.29032	N	0.885653	.	.	.	.	.	.	T	0.26643	-1.0097	6	0.87932	D	0	.	9.3102	0.37900	0.0:0.0:0.0:1.0	.	.	.	.	Y	440	ENSP00000418879:F440Y	ENSP00000418879:F440Y	F	+	2	0	RNF8	37466578	0.004000	0.15560	0.004000	0.12327	0.094000	0.18550	1.063000	0.30567	1.969000	0.57287	0.533000	0.62120	TTC			0.507	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040403.2			
FRS3	10817	mdanderson.org	37	6	41743177	41743177	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:41743177C>A	ENST00000373018.3	-	4	484	c.233G>T	c.(232-234)cGc>cTc	p.R78L	FRS3_ENST00000259748.2_Missense_Mutation_p.R78L|FRS3_ENST00000466420.1_5'Flank	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	78	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTGACATCGGCGGCCACTCTC	0.597																																					p.R78L													.	.			0			c.G233T												28.0	30.0	29.0					6																	41743177		2203	4298	6501	SO:0001583	missense	10817	exon4			CATCGGCGGCCAC	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.233G>T	6.37:g.41743177C>A	ENSP00000362109:p.Arg78Leu		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_006653	33	0.00	0	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	37	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	C	36	5.779423	0.96929	.	.	ENSG00000137218	ENST00000373018;ENST00000259748;ENST00000426290	D;D;D	0.86030	-2.06;-2.06;-2.06	5.77	5.77	0.91146	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.94026	0.8086	M	0.91717	3.235	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.94234	0.7479	10	0.87932	D	0	-40.4063	19.9422	0.97170	0.0:1.0:0.0:0.0	.	78	O43559	FRS3_HUMAN	L	78;78;102	ENSP00000362109:R78L;ENSP00000259748:R78L;ENSP00000396715:R102L	ENSP00000259748:R78L	R	-	2	0	FRS3	41851155	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.890000	0.99128	0.650000	0.86243	CGC			0.597	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040532.2		NM_006653	
POU3F2	5454	mdanderson.org	37	6	99283412	99283412	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr6:99283412G>T	ENST00000328345.5	+	1	833	c.663G>T	c.(661-663)gaG>gaT	p.E221D		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	221					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		CGCACGACGAGCCACACCATG	0.766																																					p.E221D													.	.			0			c.G663T												5.0	6.0	5.0					6																	99283412		1819	3631	5450	SO:0001583	missense	5454	exon1			CGACGAGCCACAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.663G>T	6.37:g.99283412G>T	ENSP00000329170:p.Glu221Asp		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_005604	0		0	Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	ENST00000328345.5	37	CCDS5040.1	.	.	.	.	.	.	.	.	.	.	G	1.983	-0.433624	0.04669	.	.	ENSG00000184486	ENST00000328345	T	0.54675	0.56	3.07	2.14	0.27477	.	0.209202	0.28214	U	0.016174	T	0.20536	0.0494	L	0.50333	1.59	0.30586	N	0.762054	B	0.02656	0.0	B	0.01281	0.0	T	0.16867	-1.0388	10	0.15499	T	0.54	.	8.6126	0.33811	0.0:0.0:0.7695:0.2305	.	221	P20265	PO3F2_HUMAN	D	221	ENSP00000329170:E221D	ENSP00000329170:E221D	E	+	3	2	POU3F2	99390133	0.815000	0.29118	0.946000	0.38457	0.445000	0.32107	0.441000	0.21611	0.576000	0.29452	0.195000	0.17529	GAG			0.766	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041586.2			
TRGC2	6967	broad.mit.edu	37	7	38284884	38284885	+	RNA	INS	-	-	GG	rs138091320|rs200076851|rs377514954		TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:38284884_38284885insGG	ENST00000436911.2	-	0	330							P03986	TRGC2_HUMAN	T cell receptor gamma constant 2						immune response (GO:0006955)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)										TTATTTGTCAAGgtgtgtgtgt	0.391																																					.													.	.			0			.																																											0	.			TTGTCAAGGTGTG	M15002		7p14	2012-02-07			ENSG00000227191	ENSG00000227191		"""T cell receptors / TRG locus"""	12276	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C2"""	615450		TCRGC2		3458221	Standard	NG_001336		Approved	TRGC2(2X), TRGC2(3X)		P03986	OTTHUMG00000155215		7.37:g.38284885_38284886dupGG			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	9	0.56	5	.	0		0		RNA	INS	ENST00000436911.2	37																																																																																						0.391	TRGC2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TR_C_gene		OTTHUMT00000338821.2		NG_001336	
MUC17	140453	bcgsc.ca	37	7	100681474	100681474	+	Silent	SNP	A	A	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:100681474A>G	ENST00000306151.4	+	3	6841	c.6777A>G	c.(6775-6777)tcA>tcG	p.S2259S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2259	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AAGCCACTTCATCTCCTACAA	0.502																																					p.S2259S													.	MUC17	804		0			c.A6777G												283.0	287.0	285.0					7																	100681474		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CACTTCATCTCCT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6777A>G	7.37:g.100681474A>G			Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_1	86	0.03	3	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																					0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
COL26A1	136227	broad.mit.edu	37	7	101063621	101063624	+	RNA	DEL	GACA	GACA	-	rs71517170|rs34669537	byFrequency	TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	GACA	GACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:101063621_101063624delGACA	ENST00000397927.3	+	0	494				COL26A1_ENST00000528707.1_RNA|COL26A1_ENST00000313669.7_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											GTGGGTGTTTGACAGACAGAAGAC	0.529														603	0.120407	0.0287	0.1398	5008	,	,		17743	0.004		0.2704	False		,,,				2504	0.1963				.													.	.			0			.																																											136227	.			GTGTTTGACAGAC	AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101063625_101063628delGACA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	Q32M90	RNA	DEL	ENST00000397927.3	37																																																																																						0.529	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000315898.2		NM_133457	
COG5	10466	bcgsc.ca	37	7	106888937	106888937	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr7:106888937T>C	ENST00000347053.3	-	16	1837	c.1787A>G	c.(1786-1788)cAt>cGt	p.H596R	COG5_ENST00000297135.3_Missense_Mutation_p.H617R|COG5_ENST00000393603.2_Missense_Mutation_p.H617R	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	596					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						CATAAGAGCATGAATAGCCTa	0.363																																					p.H617R													.	COG5	78		0			c.A1850G												89.0	86.0	87.0					7																	106888937		2203	4300	6503	SO:0001583	missense	10466	exon17			AGAGCATGAATAG	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1787A>G	7.37:g.106888937T>C	ENSP00000334703:p.His596Arg		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_1	43	0.00	0	NM_006348	28	0.00	0	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	37	CCDS5743.1	.	.	.	.	.	.	.	.	.	.	T	8.673	0.903297	0.17760	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.55234	0.53;0.53;0.53	5.83	4.7	0.59300	.	0.274240	0.43579	D	0.000556	T	0.29355	0.0731	N	0.15975	0.35	0.21967	N	0.99945	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10405	-1.0631	10	0.16420	T	0.52	-7.0683	6.3588	0.21417	0.1411:0.0742:0.0:0.7847	.	596;617	Q9UP83;Q9UP83-2	COG5_HUMAN;.	R	596;617;617	ENSP00000334703:H596R;ENSP00000297135:H617R;ENSP00000377228:H617R	ENSP00000297135:H617R	H	-	2	0	COG5	106676173	0.999000	0.42202	0.019000	0.16419	0.194000	0.23727	3.156000	0.50708	2.231000	0.72958	0.460000	0.39030	CAT			0.363	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000060216.4			
PTGR1	22949	bcgsc.ca	37	9	114356535	114356535	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:114356535T>G	ENST00000407693.2	-	3	381	c.119A>C	c.(118-120)gAa>gCa	p.E40A	PTGR1_ENST00000309195.5_Missense_Mutation_p.E40A|PTGR1_ENST00000538962.1_Missense_Mutation_p.E40A|PTGR1_ENST00000238248.3_5'UTR	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	40					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						GAACAAAGCTTCAAGCAGGAC	0.428																																					p.E40A	Ovarian(200;132 2151 7551 19220 46064)												.	PTGR1	23		0			c.A119C												103.0	91.0	95.0					9																	114356535		2203	4300	6503	SO:0001583	missense	22949	exon3			AAAGCTTCAAGCA	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.119A>C	9.37:g.114356535T>G	ENSP00000385763:p.Glu40Ala		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_1	104	0.00	0	NM_001146108	68	0.00	0	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Missense_Mutation	SNP	ENST00000407693.2	37	CCDS6779.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.220917	0.39201	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000333580;ENST00000422125;ENST00000374313;ENST00000374308	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.56	4.56	0.56223	GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.77820	2.39	0.80722	D	1	D;D;P	0.71674	0.998;0.997;0.627	D;D;B	0.68353	0.957;0.927;0.211	T	0.72450	-0.4290	10	0.72032	D	0.01	0.2091	13.5711	0.61847	0.0:0.0:0.0:1.0	.	40;40;40	F5GY50;B4DPK3;Q14914	.;.;PTGR1_HUMAN	A	40	ENSP00000440281:E40A;ENSP00000311572:E40A;ENSP00000385763:E40A;ENSP00000395965:E40A	ENSP00000311572:E40A	E	-	2	0	PTGR1	113396356	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.672000	0.61597	1.995000	0.58328	0.460000	0.39030	GAA			0.428	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053647.2			
ATP6V1G1	9550	mdanderson.org	37	9	117359967	117359967	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:117359967G>T	ENST00000374050.3	+	3	394	c.301G>T	c.(301-303)Gct>Tct	p.A101S		NM_004888.3	NP_004879.1	O75348	VATG1_HUMAN	ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1	101					cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase binding (GO:0051117)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(1)|lung(2)|prostate(1)|skin(1)	5						CAACCTCTTGGCTTTTGTCTG	0.488																																					p.A101S													.	.			0			c.G301T												107.0	94.0	98.0					9																	117359967		2203	4300	6503	SO:0001583	missense	9550	exon3			CTCTTGGCTTTTG	AF038954	CCDS6807.1	9q33.1	2010-04-21	2006-01-13	2002-05-10	ENSG00000136888	ENSG00000136888		"""ATPases / V-type"""	864	protein-coding gene	gene with protein product		607296	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), member J"", ""ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1"""	ATP6J, ATP6G1		9653160	Standard	NM_004888		Approved	ATP6GL, Vma10, ATP6G, DKFZp547P234	uc004bjc.3	O75348	OTTHUMG00000021023	ENST00000374050.3:c.301G>T	9.37:g.117359967G>T	ENSP00000363162:p.Ala101Ser		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_004888	819	0.00	2	Q6IB33	Missense_Mutation	SNP	ENST00000374050.3	37	CCDS6807.1	.	.	.	.	.	.	.	.	.	.	G	3.701	-0.061537	0.07317	.	.	ENSG00000136888	ENST00000374050	T	0.39406	1.08	6.17	4.3	0.51218	.	0.607478	0.18852	N	0.129375	T	0.14570	0.0352	N	0.03983	-0.305	0.27195	N	0.960329	B	0.18013	0.025	B	0.16722	0.016	T	0.33471	-0.9867	10	0.02654	T	1	.	4.0467	0.09776	0.2474:0.0:0.4875:0.2651	.	101	O75348	VATG1_HUMAN	S	101	ENSP00000363162:A101S	ENSP00000363162:A101S	A	+	1	0	ATP6V1G1	116399788	0.292000	0.24362	1.000000	0.80357	0.996000	0.88848	0.511000	0.22739	0.873000	0.35799	0.655000	0.94253	GCT			0.488	ATP6V1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055454.1		NM_004888	
GPR144	347088	mdanderson.org	37	9	127215853	127215853	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:127215853T>C	ENST00000334810.1	+	4	877	c.877T>C	c.(877-879)Tgc>Cgc	p.C293R				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	293	Pentaxin.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GGCACGGGCCTGCGCGCCGCC	0.736																																					p.C293R													.	.			0			c.T877C												3.0	4.0	4.0					9																	127215853		649	1503	2152	SO:0001583	missense	347088	exon4			CGGGCCTGCGCGC	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.877T>C	9.37:g.127215853T>C	ENSP00000335156:p.Cys293Arg		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	13	0.23	3	NM_001161808	0		0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759573	0.31137	.	.	ENSG00000180264	ENST00000334810;ENST00000439837	T	0.06608	3.28	4.01	2.86	0.33363	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.26268	0.0641	M	0.90483	3.12	0.48830	D	0.999713	D	0.69078	0.997	D	0.68621	0.959	T	0.01440	-1.1354	9	0.87932	D	0	.	9.0287	0.36245	0.165:0.0:0.0:0.835	.	293	Q7Z7M1	GP144_HUMAN	R	293;22	ENSP00000335156:C293R	ENSP00000335156:C293R	C	+	1	0	GPR144	126255674	0.997000	0.39634	0.011000	0.14972	0.001000	0.01503	3.156000	0.50708	0.423000	0.26033	-0.877000	0.02976	TGC			0.736	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054026.2		NM_182611	
LAMC3	10319	broad.mit.edu	37	9	133928053	133928053	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:133928053G>T	ENST00000361069.4	+	10	1939	c.1806G>T	c.(1804-1806)gaG>gaT	p.E602D	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	602	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		ATCCCAGGGAGGTAGAGCTCA	0.617											OREG0019556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E602D													.	LAMC3	167		0			c.G1806T												21.0	22.0	22.0					9																	133928053		2203	4297	6500	SO:0001583	missense	10319	exon10			CAGGGAGGTAGAG	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1806G>T	9.37:g.133928053G>T	ENSP00000354360:p.Glu602Asp		Somatic	74	0	0	1606	WXS	Illumina HiSeq	Phase_I	63	0.05	3	NM_006059	5	0.00	0	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933063	0.34096	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.36878	1.23	5.26	3.33	0.38152	Laminin B type IV (2);	0.973087	0.08515	N	0.934314	T	0.34919	0.0914	L	0.55834	1.745	0.09310	N	1	B	0.16603	0.018	B	0.29077	0.098	T	0.40059	-0.9583	10	0.19590	T	0.45	.	7.5539	0.27812	0.0916:0.1672:0.7413:0.0	.	602	Q9Y6N6	LAMC3_HUMAN	D	602	ENSP00000354360:E602D	ENSP00000347156:E602D	E	+	3	2	LAMC3	132917874	0.571000	0.26659	0.050000	0.19076	0.014000	0.08584	0.413000	0.21148	0.644000	0.30656	0.655000	0.94253	GAG			0.617	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054717.3		NM_006059	
NUP214	8021	broad.mit.edu	37	9	134073760	134073760	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:134073760G>T	ENST00000359428.5	+	29	5023	c.4879G>T	c.(4879-4881)Ggc>Tgc	p.G1627C	NUP214_ENST00000411637.2_Missense_Mutation_p.G1617C|NUP214_ENST00000483497.2_Missense_Mutation_p.G453C|NUP214_ENST00000451030.1_Missense_Mutation_p.G1628C			P35658	NU214_HUMAN	nucleoporin 214kDa	1627	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TGTTGCTCCCGGCCCATCTGC	0.572			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.G1627C	Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	NUP214,NS,carcinoma,-2,1	NUP214	166	1	0			c.G4879T												131.0	113.0	119.0					9																	134073760		2203	4300	6503	SO:0001583	missense	8021	exon29			GCTCCCGGCCCAT	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4879G>T	9.37:g.134073760G>T	ENSP00000352400:p.Gly1627Cys		Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	106	0.04	4	NM_005085	83	0.00	0	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379142	0.24944	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605;ENST00000483497;ENST00000531600;ENST00000541688	T;T;T;T;T	0.46819	1.52;0.92;0.92;0.92;0.86	5.81	0.97	0.19692	.	0.791110	0.10903	N	0.621371	T	0.44307	0.1287	N	0.08118	0	0.09310	N	1	D;D;D;D;D	0.76494	0.999;0.997;0.999;0.989;0.995	D;P;P;P;P	0.63597	0.916;0.881;0.881;0.686;0.767	T	0.45877	-0.9231	10	0.66056	D	0.02	-0.5365	10.3635	0.44010	0.583:0.0:0.417:0.0	.	453;1056;1221;1617;1627	B7ZAV2;F5H131;Q5JUP9;P35658-4;P35658	.;.;.;.;NU214_HUMAN	C	1627;1617;1628;1606;1221;1056;453;404;404	ENSP00000352400:G1627C;ENSP00000396576:G1617C;ENSP00000405014:G1628C;ENSP00000436793:G453C;ENSP00000435364:G404C	ENSP00000352400:G1627C	G	+	1	0	NUP214	133063581	0.024000	0.19004	0.006000	0.13384	0.003000	0.03518	0.642000	0.24735	-0.294000	0.08973	-1.598000	0.00824	GGC			0.572	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000054694.2		NM_005085	
NELFB	25920	mdanderson.org	37	9	140157489	140157489	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chr9:140157489G>T	ENST00000343053.4	+	5	935	c.598G>T	c.(598-600)Gtg>Ttg	p.V200L		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	200					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CTTGCTGCAGGTGGTGCAGCG	0.652																																					p.V200L													.	.			0			c.G598T												112.0	86.0	95.0					9																	140157489		2203	4300	6503	SO:0001630	splice_region_variant	25920	exon5			CTGCAGGTGGTGC	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.598-1G>T	9.37:g.140157489G>T			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_015456	180	0.00	0	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027904	0.93518	.	.	ENSG00000188986	ENST00000343053	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.79499	0.4456	M	0.77820	2.39	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.80578	-0.1320	8	.	.	.	-37.2641	17.1805	0.86853	0.0:0.0:1.0:0.0	.	200	Q8WX92	NELFB_HUMAN	L	200	.	.	V	+	1	0	COBRA1	139277310	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	9.520000	0.98027	2.375000	0.81037	0.484000	0.47621	GTG			0.652	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254710.1		NM_015456	Missense_Mutation
CNKSR2	22866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	21519642	21519642	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:21519642C>T	ENST00000379510.3	+	8	782	c.746C>T	c.(745-747)cCt>cTt	p.P249L	CNKSR2_ENST00000543067.1_Missense_Mutation_p.P249L|CNKSR2_ENST00000279451.4_Missense_Mutation_p.P249L|CNKSR2_ENST00000425654.2_Missense_Mutation_p.P249L	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	249	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ATTCAGTCACCTGCAGATCGG	0.348																																					p.P249L													.	.			0			c.C746T												47.0	44.0	45.0					X																	21519642		2202	4299	6501	SO:0001583	missense	22866	exon8			AGTCACCTGCAGA	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.746C>T	X.37:g.21519642C>T	ENSP00000368824:p.Pro249Leu		Somatic	206	0	0		WXS	Illumina HiSeq	.	255	0.20	51	NM_001168647	0		0	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667907	0.67814	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.98	5.09	0.68999	PDZ/DHR/GLGF (4);	0.057904	0.64402	D	0.000001	T	0.59128	0.2171	H	0.95437	3.67	0.80722	D	1	B;B;B	0.32128	0.105;0.151;0.357	B;B;P	0.44921	0.211;0.168;0.464	T	0.67417	-0.5676	10	0.56958	D	0.05	-18.6417	15.6383	0.76973	0.1375:0.8625:0.0:0.0	.	249;249;249	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	L	249	ENSP00000397906:P249L;ENSP00000444633:P249L;ENSP00000279451:P249L;ENSP00000368824:P249L	ENSP00000279451:P249L	P	+	2	0	CNKSR2	21429563	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.174000	0.58256	2.524000	0.85096	0.544000	0.68410	CCT			0.348	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056019.1		NM_014927	
AMOT	154796	mdanderson.org	37	X	112021840	112021840	+	Silent	SNP	G	G	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:112021840G>T	ENST00000524145.1	-	12	3284	c.3210C>A	c.(3208-3210)atC>atA	p.I1070I	MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000371962.1_Silent_p.I838I|AMOT_ENST00000304758.1_Silent_p.I661I|AMOT_ENST00000371959.3_Silent_p.I1070I			Q4VCS5	AMOT_HUMAN	angiomotin	1070					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						CTTGTCCCAGGATCTGAATGG	0.408																																					p.I1070I													.	.			0			c.C3210A												232.0	216.0	221.0					X																	112021840		2203	4300	6503	SO:0001819	synonymous_variant	154796	exon11			TCCCAGGATCTGA	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.3210C>A	X.37:g.112021840G>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001113490	0		0	Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	37	CCDS48154.1																																																																																					0.408	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000378570.1		NM_133265	
DOCK11	139818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	117680026	117680026	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:117680026C>G	ENST00000276202.7	+	6	568	c.505C>G	c.(505-507)Caa>Gaa	p.Q169E	DOCK11_ENST00000276204.6_Missense_Mutation_p.Q169E	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	169	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGTGATAAAACAAGGCTGGTT	0.348																																					p.Q169E													.	.			0			c.C505G												147.0	123.0	131.0					X																	117680026		2203	4300	6503	SO:0001583	missense	139818	exon6			ATAAAACAAGGCT	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.505C>G	X.37:g.117680026C>G	ENSP00000276202:p.Gln169Glu		Somatic	73	0	0		WXS	Illumina HiSeq	.	41	0.22	9	NM_144658	16	0.31	5	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	C	11.64	1.699608	0.30142	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.72835	-0.69;-0.69	5.24	5.24	0.73138	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.56396	0.1982	N	0.17564	0.495	0.58432	D	0.999998	B	0.33583	0.418	B	0.39617	0.305	T	0.55360	-0.8153	10	0.02654	T	1	-0.3626	16.5446	0.84426	0.0:1.0:0.0:0.0	.	169	Q5JSL3	DOC11_HUMAN	E	169	ENSP00000276204:Q169E;ENSP00000276202:Q169E	ENSP00000276202:Q169E	Q	+	1	0	DOCK11	117564054	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.970000	0.76099	2.162000	0.67917	0.600000	0.82982	CAA			0.348	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000356002.1		NM_144658	
GABRQ	55879	mdanderson.org	37	X	151808849	151808849	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:151808849G>A	ENST00000370306.2	+	2	180	c.160G>A	c.(160-162)Gca>Aca	p.A54T		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	54					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAAAAATTGTGCAAATGAAGC	0.483																																					p.A54T													.	.			0			c.G160A												165.0	149.0	154.0					X																	151808849		2203	4300	6503	SO:0001583	missense	55879	exon2			AATTGTGCAAATG	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.160G>A	X.37:g.151808849G>A	ENSP00000359329:p.Ala54Thr		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_018558	6	0.00	0	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018841	0.54576	.	.	ENSG00000147402	ENST00000370306;ENST00000333733	T	0.79454	-1.27	4.23	3.34	0.38264	.	0.707560	0.12304	N	0.480840	T	0.68128	0.2967	L	0.29908	0.895	0.34259	D	0.679621	P	0.43094	0.799	B	0.43889	0.435	T	0.73739	-0.3888	10	0.51188	T	0.08	.	7.2436	0.26109	0.1284:0.0:0.8716:0.0	.	54	Q9UN88	GBRT_HUMAN	T	54;49	ENSP00000359329:A54T	ENSP00000331410:A49T	A	+	1	0	GABRQ	151559505	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.129000	0.57957	1.947000	0.56498	0.529000	0.55759	GCA			0.483	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058763.2		NM_018558	
MAGEA12	4111	hgsc.bcm.edu	37	X	151896817	151896817	+	IGR	SNP	C	C	T			TCGA-2G-AAHP-05A-11D-A42Y-10	TCGA-2G-AAHP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e5dab1ce-fa7a-4dda-8d9a-fdc3a104a2e1	6cc28f85-5c08-46da-89e5-536025497482	g.chrX:151896817C>T	ENST00000357916.4	-	0	1664				CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12											breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					tgaggcctatccacattatgg	0.363																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100130935	.			GCCTATCCACATT		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650		X.37:g.151896817C>T			Somatic	226	0	0		WXS	Illumina HiSeq	.	227	0.29	66	.	0		0	Q9NSD3	RNA	SNP	ENST00000357916.4	37	CCDS14710.1																																																																																					0.363	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058764.1		NM_005367	
