#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PADI4	23569	broad.mit.edu	37	1	17690071	17690071	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:17690071G>A	ENST00000375448.4	+	16	1839	c.1813G>A	c.(1813-1815)Gtc>Atc	p.V605I		NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	605					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CTTCGGGCCCGTCATCAACGG	0.617																																					p.V605I													.	PADI4	70		0			c.G1813A												46.0	43.0	44.0					1																	17690071		2203	4300	6503	SO:0001583	missense	23569	exon16			GGGCCCGTCATCA	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1813G>A	1.37:g.17690071G>A	ENSP00000364597:p.Val605Ile		Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	199	0.02	4	NM_012387	3	0.00	0	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	37	CCDS180.1	.	.	.	.	.	.	.	.	.	.	G	6.710	0.499675	0.12762	.	.	ENSG00000159339	ENST00000375448	T	0.20463	2.07	5.03	-3.87	0.04218	Protein-arginine deiminase, C-terminal (1);	0.709311	0.13892	N	0.355567	T	0.05960	0.0155	N	0.04043	-0.29	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.36915	-0.9728	10	0.05959	T	0.93	-12.7446	6.3673	0.21461	0.3756:0.3435:0.2809:0.0	.	605	Q9UM07	PADI4_HUMAN	I	605	ENSP00000364597:V605I	ENSP00000364597:V605I	V	+	1	0	PADI4	17562658	0.000000	0.05858	0.953000	0.39169	0.838000	0.47535	-0.825000	0.04433	-0.974000	0.03550	-0.415000	0.06103	GTC			0.617	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006799.1		NM_012387	
HSPG2	3339	mdanderson.org	37	1	22149853	22149853	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:22149853G>T	ENST00000374695.3	-	97	13211	c.13132C>A	c.(13132-13134)Cac>Aac	p.H4378N	LDLRAD2_ENST00000543870.1_Intron|HSPG2_ENST00000486901.1_5'UTR|LDLRAD2_ENST00000344642.2_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	4378	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TGGGCGCGGTGCTGCAGGTCC	0.726																																					p.H4378N													.	.			0			c.C13132A												4.0	5.0	5.0					1																	22149853		2010	3923	5933	SO:0001583	missense	3339	exon97			CGCGGTGCTGCAG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.13132C>A	1.37:g.22149853G>T	ENSP00000363827:p.His4378Asn		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_005529	136	0.00	0	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202325	0.58234	.	.	ENSG00000142798	ENST00000374695	T	0.74947	-0.89	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.39083	N	0.001468	T	0.77061	0.4075	L	0.27053	0.805	0.40390	D	0.979536	B;D	0.55605	0.032;0.972	B;D	0.66716	0.024;0.946	T	0.74259	-0.3723	10	0.23302	T	0.38	.	16.2612	0.82547	0.0:0.0:1.0:0.0	.	2318;4378	Q59EG0;P98160	.;PGBM_HUMAN	N	4378	ENSP00000363827:H4378N	ENSP00000363827:H4378N	H	-	1	0	HSPG2	22022440	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	4.812000	0.62613	2.422000	0.82143	0.655000	0.94253	CAC			0.726	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007598.1		NM_005529	
BAI2	576	broad.mit.edu	37	1	32222329	32222329	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:32222329G>T	ENST00000373658.3	-	4	450	c.109C>A	c.(109-111)Ccc>Acc	p.P37T	BAI2_ENST00000373655.2_Missense_Mutation_p.P37T|BAI2_ENST00000527361.1_Missense_Mutation_p.P37T|BAI2_ENST00000398538.1_Missense_Mutation_p.P25T|MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398556.3_Missense_Mutation_p.P40T|BAI2_ENST00000398542.1_Missense_Mutation_p.P25T|BAI2_ENST00000398547.1_Missense_Mutation_p.P25T|BAI2_ENST00000257070.4_Missense_Mutation_p.P37T	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	37					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CAGGCACTGGGGGCGGGGTCG	0.652																																					p.P37T													.	BAI2	128		0			c.C109A												25.0	26.0	25.0					1																	32222329		2198	4296	6494	SO:0001583	missense	576	exon4			CACTGGGGGCGGG	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.109C>A	1.37:g.32222329G>T	ENSP00000362762:p.Pro37Thr		Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	216	0.02	4	NM_001703	1	0.00	0	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710637	0.48517	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.44083	1.6;1.82;0.98;0.98;1.98;0.93;0.93;1.03;1.58;1.44	5.35	5.35	0.76521	.	0.000000	0.42548	D	0.000692	T	0.43299	0.1241	L	0.46157	1.445	0.80722	D	1	P;P;P;P;P;P	0.47253	0.808;0.879;0.774;0.808;0.892;0.664	B;B;P;B;B;B	0.44946	0.159;0.396;0.465;0.222;0.365;0.275	T	0.14671	-1.0464	10	0.25106	T	0.35	.	18.2205	0.89899	0.0:0.0:1.0:0.0	.	25;37;25;25;37;37	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	T	40;25;37;37;25;37;37;25;30;71	ENSP00000381564:P40T;ENSP00000381555:P25T;ENSP00000362762:P37T;ENSP00000362759:P37T;ENSP00000381550:P25T;ENSP00000257070:P37T;ENSP00000435397:P37T;ENSP00000381548:P25T;ENSP00000410921:P30T;ENSP00000437219:P71T	ENSP00000257070:P37T	P	-	1	0	BAI2	31994916	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.057000	0.49931	2.677000	0.91161	0.561000	0.74099	CCC			0.652	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000381838.1		NM_001703	
ERICH3	127254	mdanderson.org	37	1	75086440	75086440	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:75086440G>T	ENST00000326665.5	-	8	1196	c.978C>A	c.(976-978)taC>taA	p.Y326*	C1orf173_ENST00000420661.2_Nonsense_Mutation_p.Y129*|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		326										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GTTTGCCTTTGTAGACACAAA	0.348																																					p.Y326X													.	.			0			c.C978A												109.0	105.0	107.0					1																	75086440		2203	4300	6503	SO:0001587	stop_gained	127254	exon8			GCCTTTGTAGACA																												ENST00000326665.5:c.978C>A	1.37:g.75086440G>T	ENSP00000322609:p.Tyr326*		Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	123	0.04	5	NM_001002912	0		0	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	37	6.114683	0.97296	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.5688	20.239	0.98366	0.0:0.0:1.0:0.0	.	.	.	.	X	326;129	.	ENSP00000322609:Y326X	Y	-	3	2	C1orf173	74859028	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.192000	0.65115	2.884000	0.98904	0.655000	0.94253	TAC			0.348	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026516.1			
LHX8	431707	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	75602877	75602877	+	Silent	SNP	C	C	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:75602877C>A	ENST00000294638.5	+	4	862	c.198C>A	c.(196-198)tcC>tcA	p.S66S	LHX8_ENST00000356261.3_Silent_p.S56S|LHX8_ENST00000559413.1_3'UTR	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	66					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CCTCGGGCTCCGGCTGCCCTC	0.677																																					p.S66S													.	.			0			c.C198A												24.0	27.0	26.0					1																	75602877		2203	4300	6503	SO:0001819	synonymous_variant	431707	exon4			GGGCTCCGGCTGC	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.198C>A	1.37:g.75602877C>A			Somatic	273	0	0		WXS	Illumina HiSeq	.	255	0.07	18	NM_001001933	13	0.08	1	E9PGE3	Silent	SNP	ENST00000294638.5	37	CCDS30756.1																																																																																					0.677	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000026700.1		NM_001001933	
AMY1C	278	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	104297234	104297234	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:104297234G>C	ENST00000370079.3	+	6	1056	c.992G>C	c.(991-993)tGg>tCg	p.W331S		NM_001008219.1	NP_001008220.1	P04745	AMY1_HUMAN	amylase, alpha 1C (salivary)	331					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)	p.W331*(1)		lung(5)|skin(3)	8		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		CTTACCTTCTGGGATGCTAGG	0.388																																					p.W331S													AMY1C,NS,carcinoma,0,1	AMY1A	2	1	1	Substitution - Nonsense(1)	lung(1)	c.G992C												246.0	248.0	248.0					1																	104297234		2191	4254	6445	SO:0001583	missense	278	exon7			CCTTCTGGGATGC		CCDS30784.1	1p21	2012-10-02	2007-05-03		ENSG00000187733	ENSG00000187733	3.2.1.1		476	protein-coding gene	gene with protein product		104702	"""amylase, alpha 1C; salivary"""	AMY1			Standard	XM_005270761		Approved			P04745	OTTHUMG00000011045	ENST00000370079.3:c.992G>C	1.37:g.104297234G>C	ENSP00000359096:p.Trp331Ser		Somatic	937	0	0		WXS	Illumina HiSeq	Phase_I	864	0.02	20	NM_001008221	0		0	A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	ENST00000370079.3	37	CCDS30784.1	.	.	.	.	.	.	.	.	.	.	G	7.823	0.718243	0.15372	.	.	ENSG00000187733	ENST00000370079	D	0.97994	-4.65	2.23	1.22	0.21188	.	0.249986	0.43747	D	0.000524	D	0.96595	0.8889	M	0.77313	2.365	0.80722	D	1	.	.	.	.	.	.	D	0.94877	0.8035	8	0.49607	T	0.09	.	8.5426	0.33402	0.0:0.0:0.5847:0.4153	.	.	.	.	S	331	ENSP00000359096:W331S	ENSP00000359096:W331S	W	+	2	0	AMY1C	104098757	1.000000	0.71417	0.988000	0.46212	0.125000	0.20455	4.274000	0.58921	0.229000	0.21039	0.184000	0.17185	TGG			0.388	AMY1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030375.1		NM_001008219	
EPS8L3	79574	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	110300123	110300123	+	Missense_Mutation	SNP	G	G	A	rs540511118		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:110300123G>A	ENST00000361965.4	-	11	1055	c.949C>T	c.(949-951)Ctc>Ttc	p.L317F	EPS8L3_ENST00000369805.3_Missense_Mutation_p.L318F|EPS8L3_ENST00000494151.1_5'Flank|EPS8L3_ENST00000361852.4_Missense_Mutation_p.L317F|RP4-735C1.4_ENST00000431955.1_RNA	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	317						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GACTTGAAGAGGATGTGTACG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18501	0.0		0.0	False		,,,				2504	0.001				p.L318F													.	.			0			c.C952T												86.0	74.0	78.0					1																	110300123		2203	4300	6503	SO:0001583	missense	79574	exon11			TGAAGAGGATGTG	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.949C>T	1.37:g.110300123G>A	ENSP00000355255:p.Leu317Phe		Somatic	123	0	0		WXS	Illumina HiSeq	.	119	0.09	11	NM_139053	0		0	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382316	0.61845	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.29917	1.55;1.55;1.55	5.25	-1.16	0.09678	.	0.452766	0.23966	N	0.042807	T	0.31420	0.0796	M	0.78049	2.395	0.45822	D	0.998691	P;P;P;D	0.56746	0.544;0.951;0.556;0.977	B;B;B;P	0.56648	0.391;0.409;0.232;0.803	T	0.26430	-1.0103	10	0.59425	D	0.04	-7.4887	9.7899	0.40699	0.0:0.1189:0.2822:0.5989	.	317;317;317;318	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	F	317;318;317	ENSP00000354551:L317F;ENSP00000358820:L318F;ENSP00000355255:L317F	ENSP00000354551:L317F	L	-	1	0	EPS8L3	110101646	0.187000	0.23238	0.044000	0.18714	0.077000	0.17291	-0.347000	0.07750	-0.564000	0.06070	0.557000	0.71058	CTC			0.577	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000032234.1		NM_024526	
NBPF14	25832	broad.mit.edu	37	1	145293269	145293269	+	Splice_Site	SNP	G	G	A	rs61350760		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:145293269G>A	ENST00000468030.1	+	5	1125		c.e5+1		NBPF10_ENST00000369338.1_Splice_Site|NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000342960.5_5'Flank																							TTTCACAACAGTAAGTTAAGA	0.423																																					.													.	NBPF10	221		0			.																																									SO:0001630	splice_region_variant	100132406	.			ACAACAGTAAGTT																												ENST00000468030.1:c.714+1G>A	1.37:g.145293269G>A			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	25	0.16	4	.	0		0		Splice_Site	SNP	ENST00000468030.1	37																																																																																						0.423	RP11-458D21.5-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding		OTTHUMT00000038553.9			Intron
APOA2	336	hgsc.bcm.edu;bcgsc.ca	37	1	161192313	161192313	+	Splice_Site	SNP	C	C	T	rs76162486		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:161192313C>T	ENST00000367990.3	-	4	243		c.e4-1		APOA2_ENST00000491350.1_Splice_Site|APOA2_ENST00000470459.2_Splice_Site|APOA2_ENST00000463812.1_Splice_Site|APOA2_ENST00000468465.1_Splice_Site|APOA2_ENST00000464492.1_Splice_Site	NM_001643.1	NP_001634.1	P02652	APOA2_HUMAN	apolipoprotein A-II						acute inflammatory response (GO:0002526)|cellular lipid metabolic process (GO:0044255)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol import (GO:0060621)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cholesterol transporter activity (GO:0060695)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of lipase activity (GO:0060192)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid catabolic process (GO:0009395)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of lipid catabolic process (GO:0050996)|protein folding (GO:0006457)|protein oxidation (GO:0018158)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein stability (GO:0031647)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|viral process (GO:0016032)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein receptor binding (GO:0034190)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(2)|skin(2)	6	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AAAGTAAGACCTGGATAGGTG	0.517																																					.													.	.			0			c.186-1G>A												174.0	165.0	168.0					1																	161192313		2203	4300	6503	SO:0001630	splice_region_variant	336	exon5			TAAGACCTGGATA		CCDS1226.1	1q23.3	2013-01-24			ENSG00000158874	ENSG00000158874		"""Apolipoproteins"""	601	protein-coding gene	gene with protein product		107670				2415515	Standard	NM_001643		Approved		uc001fzc.1	P02652	OTTHUMG00000034346	ENST00000367990.3:c.186-1G>A	1.37:g.161192313C>T			Somatic	196	0	0		WXS	Illumina HiSeq	.	161	0.05	8	NM_001643	0		0	B2R524	Splice_Site	SNP	ENST00000367990.3	37	CCDS1226.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443882	0.25987	.	.	ENSG00000158874	ENST00000367990	.	.	.	4.97	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2391	0.37484	0.0:0.9024:0.0:0.0976	.	.	.	.	.	-1	.	.	.	-	.	.	APOA2	159458937	0.998000	0.40836	0.997000	0.53966	0.318000	0.28184	2.182000	0.42556	1.320000	0.45209	0.655000	0.94253	.			0.517	APOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083037.1		NM_001643	Intron
TNR	7143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175328773	175328773	+	Silent	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:175328773G>A	ENST00000367674.2	-	15	3657	c.2949C>T	c.(2947-2949)taC>taT	p.Y983Y	TNR_ENST00000263525.2_Silent_p.Y983Y			Q92752	TENR_HUMAN	tenascin R	983	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GAACAATGACGTAGTTCTCCA	0.522																																					p.Y983Y													.	.			0			c.C2949T												139.0	120.0	127.0					1																	175328773		2203	4300	6503	SO:0001819	synonymous_variant	7143	exon15			AATGACGTAGTTC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2949C>T	1.37:g.175328773G>A			Somatic	132	0	0		WXS	Illumina HiSeq	.	113	0.10	11	NM_003285	0		0	C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	CCDS1318.1																																																																																					0.522	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084414.4		NM_003285	
C1orf35	79169	mdanderson.org	37	1	228288913	228288913	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:228288913G>T	ENST00000272139.4	-	8	945	c.711C>A	c.(709-711)tgC>tgA	p.C237*	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	237							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				TCCTCTTACAGCAGGGGGAGT	0.642																																					p.C237X													.	.			0			c.C711A												95.0	84.0	88.0					1																	228288913		2203	4300	6503	SO:0001587	stop_gained	79169	exon8			CTTACAGCAGGGG	AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.711C>A	1.37:g.228288913G>T	ENSP00000272139:p.Cys237*		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_024319	102	0.00	0	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Nonsense_Mutation	SNP	ENST00000272139.4	37	CCDS1566.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541882	0.96474	.	.	ENSG00000143793	ENST00000272139	.	.	.	3.44	2.53	0.30540	.	0.294986	0.32120	N	0.006545	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-15.563	7.6035	0.28089	0.1201:0.0:0.8799:0.0	.	.	.	.	X	237	.	ENSP00000272139:C237X	C	-	3	2	C1orf35	226355536	0.003000	0.15002	0.565000	0.28409	0.720000	0.41350	1.198000	0.32223	1.014000	0.39417	-0.663000	0.03849	TGC			0.642	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000092245.1		NM_024319	
OBSCN	84033	hgsc.bcm.edu	37	1	228503691	228503691	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:228503691delG	ENST00000422127.1	+	50	13200	c.13156delG	c.(13156-13158)gccfs	p.A4386fs	OBSCN_ENST00000366709.4_Frame_Shift_Del_p.A1505fs|OBSCN_ENST00000570156.2_Frame_Shift_Del_p.A5343fs|OBSCN_ENST00000366707.4_Frame_Shift_Del_p.A2020fs|OBSCN_ENST00000284548.11_Frame_Shift_Del_p.A4386fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4386	Ig-like 45.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTCGGAGAACGCCGAGGTGGT	0.662																																					p.N5342fs													OBSCN,colon,carcinoma,0,1	OBSCN	2142		0			c.16026delC																																									SO:0001589	frameshift_variant	84033	exon61			GAGAACGCCGAGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13156delG	1.37:g.228503691delG	ENSP00000409493:p.Ala4386fs		Somatic	187	0	0		WXS	Illumina HiSeq	.	151	0.07	10	NM_001271223	0		0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Del	DEL	ENST00000422127.1	37	CCDS58065.1																																																																																					0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
OBSCN	84033	bcgsc.ca	37	1	228503692	228503692	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:228503692C>A	ENST00000422127.1	+	50	13201	c.13157C>A	c.(13156-13158)gCc>gAc	p.A4386D	OBSCN_ENST00000366709.4_Missense_Mutation_p.A1505D|OBSCN_ENST00000570156.2_Missense_Mutation_p.A5343D|OBSCN_ENST00000366707.4_Missense_Mutation_p.A2020D|OBSCN_ENST00000284548.11_Missense_Mutation_p.A4386D	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4386	Ig-like 45.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCGGAGAACGCCGAGGTGGTC	0.662																																					p.A5343D													.	OBSCN	2142		0			c.C16028A												29.0	35.0	33.0					1																	228503692		2107	4191	6298	SO:0001583	missense	84033	exon61			AGAACGCCGAGGT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13157C>A	1.37:g.228503692C>A	ENSP00000409493:p.Ala4386Asp		Somatic	187	0	0		WXS	Illumina HiSeq	Phase_1	154	0.08	12	NM_001271223	0		0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281166	0.59758	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.04809	3.55;3.55;3.55;3.55	5.29	2.63	0.31362	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.401654	0.24443	N	0.038497	T	0.03136	0.0092	N	0.04508	-0.205	0.09310	N	1	P;P	0.48694	0.877;0.914	B;P	0.47346	0.216;0.544	T	0.45116	-0.9283	10	0.36615	T	0.2	.	8.0006	0.30295	0.0:0.6204:0.0:0.3796	.	4386;4386	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	D	4386;4386;2020;1505	ENSP00000284548:A4386D;ENSP00000409493:A4386D;ENSP00000355668:A2020D;ENSP00000355670:A1505D	ENSP00000284548:A4386D	A	+	2	0	OBSCN	226570315	0.002000	0.14202	0.017000	0.16124	0.439000	0.31926	0.984000	0.29565	0.893000	0.36288	0.462000	0.41574	GCC			0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
GNG4	2786	broad.mit.edu	37	1	235747114	235747114	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:235747114T>C	ENST00000366598.4	-	2	240	c.25A>G	c.(25-27)Agc>Ggc	p.S9G	GNG4_ENST00000366597.1_Missense_Mutation_p.S9G|GNG4_ENST00000450593.1_Missense_Mutation_p.S9G|GNG4_ENST00000484517.1_5'UTR|GNG4_ENST00000391854.2_Missense_Mutation_p.S9G			P50150	GBG4_HUMAN	guanine nucleotide binding protein (G protein), gamma 4	9					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell growth (GO:0030308)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)			CTAGTGGTGCTGTTATTAGAC	0.517																																					p.S9G													.	GNG4	18		0			c.A25G												191.0	177.0	182.0					1																	235747114		2203	4300	6503	SO:0001583	missense	2786	exon3			TGGTGCTGTTATT	BC022485	CCDS1607.1	1q42.3	2008-02-05			ENSG00000168243	ENSG00000168243			4407	protein-coding gene	gene with protein product		604388				7665596	Standard	NM_001098721		Approved		uc001hxh.4	P50150	OTTHUMG00000040740	ENST00000366598.4:c.25A>G	1.37:g.235747114T>C	ENSP00000355557:p.Ser9Gly		Somatic	109	0.0091743119	1		WXS	Illumina HiSeq	Phase_I	113	0.03	3	NM_001098721	17	0.00	0		Missense_Mutation	SNP	ENST00000366598.4	37	CCDS1607.1	.	.	.	.	.	.	.	.	.	.	T	12.23	1.875011	0.33162	.	.	ENSG00000168243	ENST00000450593;ENST00000391854;ENST00000366598;ENST00000366597	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.52	5.52	0.82312	G-protein gamma domain (3);	0.054028	0.64402	D	0.000001	T	0.23094	0.0558	.	.	.	0.38375	D	0.944965	B	0.12013	0.005	B	0.14578	0.011	T	0.10177	-1.0641	9	0.23302	T	0.38	-7.3167	13.1495	0.59482	0.0:0.0:0.0:1.0	.	9	P50150	GBG4_HUMAN	G	9	ENSP00000398629:S9G;ENSP00000375727:S9G;ENSP00000355557:S9G;ENSP00000355556:S9G	ENSP00000355556:S9G	S	-	1	0	GNG4	233813737	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.743000	0.74848	2.085000	0.62840	0.533000	0.62120	AGC			0.517	GNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097906.1		NM_004485	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235872530	235872530	+	Missense_Mutation	SNP	C	C	T	rs528102141		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr1:235872530C>T	ENST00000389794.3	-	44	10178	c.10004G>A	c.(10003-10005)cGt>cAt	p.R3335H	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.R3335H			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3335	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GATAAAAAGACGAGGATCATT	0.453													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17566	0.0		0.0	False		,,,				2504	0.0				p.R3335H													.	.			0			c.G10004A												92.0	90.0	91.0					1																	235872530		2203	4300	6503	SO:0001583	missense	1130	exon44			AAAAGACGAGGAT	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10004G>A	1.37:g.235872530C>T	ENSP00000374444:p.Arg3335His		Somatic	268	0	0		WXS	Illumina HiSeq	.	210	0.13	27	NM_000081	13	0.23	3	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	36	5.653267	0.96724	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.80653	-1.4;-1.4	5.39	5.39	0.77823	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.88629	0.6488	L	0.58302	1.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89148	0.3521	10	0.87932	D	0	.	19.5049	0.95111	0.0:1.0:0.0:0.0	.	3335	Q99698	LYST_HUMAN	H	3335	ENSP00000374444:R3335H;ENSP00000374443:R3335H	ENSP00000374443:R3335H	R	-	2	0	LYST	233939153	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.432000	0.80349	2.677000	0.91161	0.655000	0.94253	CGT			0.453	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097533.5			
ANKRD30A	91074	broad.mit.edu;mdanderson.org	37	10	37442507	37442507	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr10:37442507G>A	ENST00000602533.1	+	13	1646	c.1547G>A	c.(1546-1548)tGt>tAt	p.C516Y	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.C516Y|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.C516Y			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	572					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CAGAGTCTCTGTGAGACTGTT	0.274																																					p.C516Y													.	ANKRD30A	448		0			c.G1547A												97.0	99.0	98.0					10																	37442507		1793	4060	5853	SO:0001583	missense	91074	exon13			GTCTCTGTGAGAC	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1547G>A	10.37:g.37442507G>A	ENSP00000473551:p.Cys516Tyr		Somatic	791	0.0012642225	1		WXS	Illumina HiSeq	Phase_I	567	0.03	18	NM_052997	0		0	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	.	0.007	-1.953195	0.00470	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.06068	3.35;3.35	1.47	-0.605	0.11623	.	.	.	.	.	T	0.02649	0.0080	N	0.22421	0.69	0.09310	N	1	P	0.49185	0.92	B	0.40444	0.329	T	0.18053	-1.0349	9	0.02654	T	1	.	0.6861	0.00883	0.2408:0.3509:0.2368:0.1714	.	572	Q9BXX3	AN30A_HUMAN	Y	516	ENSP00000354432:C516Y;ENSP00000363792:C516Y	ENSP00000354432:C516Y	C	+	2	0	ANKRD30A	37482513	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.017000	0.13399	-0.607000	0.05738	-3.948000	0.00015	TGT			0.274	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000047588.2		NM_052997	
NFKB2	4791	broad.mit.edu;mdanderson.org	37	10	104159438	104159438	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr10:104159438C>T	ENST00000369966.3	+	14	1682	c.1432C>T	c.(1432-1434)Cgc>Tgc	p.R478C	NFKB2_ENST00000428099.1_Missense_Mutation_p.R478C|NFKB2_ENST00000189444.6_Missense_Mutation_p.R478C|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	478					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	GGCGGGACAGCGCCACCTGCT	0.726			T	IGH@	B-NHL																																p.R478C				Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2	48		0			c.C1432T												4.0	6.0	5.0					10																	104159438		1624	3316	4940	SO:0001583	missense	4791	exon14			GGACAGCGCCACC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1432C>T	10.37:g.104159438C>T	ENSP00000358983:p.Arg478Cys		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	32	0.13	4	NM_002502	175	0.38	67	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	37	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354942	0.61293	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.42900	0.96;0.96;0.96	4.24	3.32	0.38043	Ankyrin repeat-containing domain (1);	0.182110	0.43579	D	0.000550	T	0.34658	0.0905	M	0.66297	2.02	0.58432	D	0.999996	B;B	0.28850	0.225;0.225	B;B	0.20184	0.028;0.028	T	0.44907	-0.9297	10	0.87932	D	0	.	4.8963	0.13751	0.3332:0.5627:0.0:0.104	.	478;478	Q00653;A8K9D9	NFKB2_HUMAN;.	C	478	ENSP00000410256:R478C;ENSP00000358983:R478C;ENSP00000189444:R478C	ENSP00000189444:R478C	R	+	1	0	NFKB2	104149428	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.644000	0.46613	2.372000	0.80975	0.511000	0.50034	CGC			0.726	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000050080.2			
TAF5	6877	broad.mit.edu	37	10	105145120	105145120	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr10:105145120A>G	ENST00000369839.3	+	8	1725	c.1702A>G	c.(1702-1704)Aga>Gga	p.R568G	TAF5_ENST00000351396.4_Intron	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	568					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		CGGAACTGTTAGATTGTGGAG	0.403																																					p.R568G													.	TAF5	47		0			c.A1702G												103.0	92.0	96.0					10																	105145120		2203	4300	6503	SO:0001583	missense	6877	exon8			ACTGTTAGATTGT	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1702A>G	10.37:g.105145120A>G	ENSP00000358854:p.Arg568Gly		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	70	0.04	3	NM_006951	29	0.00	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.654264	0.67472	.	.	ENSG00000148835	ENST00000369839	T	0.67865	-0.29	5.71	3.27	0.37495	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.043870	0.85682	D	0.000000	T	0.81403	0.4815	M	0.79805	2.47	0.80722	D	1	D	0.62365	0.991	D	0.78314	0.991	T	0.82971	-0.0192	10	0.87932	D	0	-18.4627	13.9027	0.63815	0.493:0.507:0.0:0.0	.	568	Q15542	TAF5_HUMAN	G	568	ENSP00000358854:R568G	ENSP00000358854:R568G	R	+	1	2	TAF5	105135110	0.013000	0.17824	0.997000	0.53966	0.979000	0.70002	0.272000	0.18644	0.465000	0.27167	0.528000	0.53228	AGA			0.403	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050144.1			
SHOC2	8036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112724174	112724174	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr10:112724174T>C	ENST00000369452.4	+	2	403	c.58T>C	c.(58-60)Tca>Cca	p.S20P	SHOC2_ENST00000265277.5_Missense_Mutation_p.S20P|SHOC2_ENST00000489390.1_Intron	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	20					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		CAAAGTACCATCAGCCAAGGA	0.398																																					p.S20P													.	.			0			c.T58C												53.0	57.0	56.0					10																	112724174		2203	4300	6503	SO:0001583	missense	8036	exon2			GTACCATCAGCCA	AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.58T>C	10.37:g.112724174T>C	ENSP00000358464:p.Ser20Pro		Somatic	108	0	0		WXS	Illumina HiSeq	.	73	0.37	27	NM_007373	37	0.51	19	A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	ENST00000369452.4	37	CCDS7568.1	.	.	.	.	.	.	.	.	.	.	T	14.27	2.485346	0.44147	.	.	ENSG00000108061	ENST00000265277;ENST00000369452	D;D	0.91631	-2.88;-2.88	5.99	5.99	0.97316	.	0.059661	0.64402	D	0.000001	D	0.84871	0.5568	N	0.08118	0	0.36464	D	0.866869	B;B	0.29085	0.232;0.079	B;B	0.28849	0.095;0.044	D	0.86048	0.1524	10	0.59425	D	0.04	.	16.4943	0.84223	0.0:0.0:0.0:1.0	.	20;20	Q9UQ13-2;Q9UQ13	.;SHOC2_HUMAN	P	20	ENSP00000265277:S20P;ENSP00000358464:S20P	ENSP00000265277:S20P	S	+	1	0	SHOC2	112714164	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	2.980000	0.49321	2.291000	0.77112	0.533000	0.62120	TCA			0.398	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050355.1		NM_007373	
TACC2	10579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123954584	123954584	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr10:123954584C>A	ENST00000369005.1	+	8	6204	c.5864C>A	c.(5863-5865)aCc>aAc	p.T1955N	TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000358010.1_Missense_Mutation_p.T101N|TACC2_ENST00000493951.1_3'UTR|TACC2_ENST00000360561.3_Missense_Mutation_p.T33N|TACC2_ENST00000369004.3_Missense_Mutation_p.T33N|TACC2_ENST00000515273.1_Missense_Mutation_p.T1959N|TACC2_ENST00000515603.1_Missense_Mutation_p.T1910N|TACC2_ENST00000368999.1_Missense_Mutation_p.T33N|TACC2_ENST00000260733.3_Missense_Mutation_p.T33N|TACC2_ENST00000513429.1_Missense_Mutation_p.T101N|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000453444.2_Missense_Mutation_p.T1959N|TACC2_ENST00000334433.3_Missense_Mutation_p.T1955N	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1955					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GCATTTGAGACCCCGGAGTCA	0.617																																					p.T1955N													.	.			0			c.C5864A												101.0	105.0	104.0					10																	123954584		2203	4300	6503	SO:0001583	missense	10579	exon8			TTGAGACCCCGGA	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5864C>A	10.37:g.123954584C>A	ENSP00000358001:p.Thr1955Asn		Somatic	58	0	0		WXS	Illumina HiSeq	.	63	0.22	14	NM_206862	23	0.57	13	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143468	0.77888	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.53857	0.6;0.6;3.19;2.96;0.6;0.6;3.19;0.6;0.6;0.6;0.6;0.6	4.75	4.75	0.60458	.	0.000000	0.33895	N	0.004459	T	0.68915	0.3053	M	0.62723	1.935	0.43808	D	0.996367	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.997;0.996;0.997;0.997;0.998;0.998;0.999	T	0.70346	-0.4897	10	0.49607	T	0.09	-17.931	14.7498	0.69516	0.0:1.0:0.0:0.0	.	50;1959;33;1910;33;33;101;1955	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;TACC2_HUMAN	N	1955;101;1959;1910;1955;101;1959;1945;33;33;33;33;50	ENSP00000358001:T1955N;ENSP00000425062:T101N;ENSP00000424467:T1959N;ENSP00000427618:T1910N;ENSP00000334280:T1955N;ENSP00000350701:T101N;ENSP00000395048:T1959N;ENSP00000353763:T33N;ENSP00000357995:T33N;ENSP00000422815:T33N;ENSP00000260733:T33N;ENSP00000420967:T50N	ENSP00000260733:T33N	T	+	2	0	TACC2	123944574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.166000	0.64965	2.201000	0.70794	0.556000	0.70494	ACC			0.617	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000090004.1			
HRAS	3265	ucsc.edu	37	11	534295	534295	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:534295C>T	ENST00000451590.1	-	2	215	c.28G>A	c.(28-30)Ggc>Agc	p.G10S	HRAS_ENST00000311189.7_Missense_Mutation_p.G10S|HRAS_ENST00000417302.1_Missense_Mutation_p.G10S|HRAS_ENST00000397594.1_Missense_Mutation_p.G10S|HRAS_ENST00000397596.2_Missense_Mutation_p.G10S|HRAS_ENST00000468682.2_5'UTR	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	10					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)			adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCGCCGGCGCCCACCACCACC	0.647		6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																											p.G10S			yes	Dom	yes	Costello syndrome	11	11p15.5	3265	v-Ha-ras Harvey rat sarcoma viral oncogene homolog		"""E, L, M"""	.	HRAS	1232		0			c.G28A												67.0	64.0	65.0					11																	534295		2202	4300	6502	SO:0001583	missense	3265	exon2	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	CGGCGCCCACCAC	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.28G>A	11.37:g.534295C>T	ENSP00000407586:p.Gly10Ser		Somatic	54	0	0		RNA-Seq	Illumina HiSeq		53	0.06	3	NM_001130442	69	0.10	7	B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	ENST00000451590.1	37	CCDS7698.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644540	0.87859	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	D;D;D;D;D	0.98028	-4.67;-4.67;-4.67;-4.67;-4.67	3.0	3.0	0.34707	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.99324	0.9763	H	0.99609	4.655	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.995;0.997	D	0.97735	1.0205	10	0.87932	D	0	.	14.1517	0.65389	0.0:1.0:0.0:0.0	.	10;10	P01112-2;P01112	.;RASH_HUMAN	S	10	ENSP00000380722:G10S;ENSP00000380723:G10S;ENSP00000407586:G10S;ENSP00000388246:G10S;ENSP00000309845:G10S	ENSP00000309845:G10S	G	-	1	0	HRAS	524295	1.000000	0.71417	0.998000	0.56505	0.510000	0.34073	7.472000	0.80996	1.986000	0.57962	0.561000	0.74099	GGC			0.647	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259403.2		NM_176795	
CRACR2B	283229	mdanderson.org	37	11	830251	830251	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:830251C>T	ENST00000525077.1	+	5	708	c.607C>T	c.(607-609)Cgc>Tgc	p.R203C	CD151_ENST00000322008.4_5'Flank|AP006621.8_ENST00000532946.1_RNA|EFCAB4A_ENST00000450448.1_Splice_Site_p.R203C|CD151_ENST00000397420.3_5'Flank|CD151_ENST00000397421.1_5'Flank|EFCAB4A_ENST00000528542.2_Splice_Site_p.R203C			Q8N4Y2	EFC4A_HUMAN		203					cellular protein localization (GO:0034613)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCCCGAAGGCGCGAGAGCGA	0.716																																					p.R203C													.	.			0			c.C607T												4.0	7.0	6.0					11																	830251		1760	3818	5578	SO:0001630	splice_region_variant	283229	exon6			CGAAGGCGCGAGA																												ENST00000525077.1:c.606-1C>T	11.37:g.830251C>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_173584	4	0.00	0	D5LPR2|Q8NBW8	Missense_Mutation	SNP	ENST00000525077.1	37		.	.	.	.	.	.	.	.	.	.	C	20.2	3.942257	0.73672	.	.	ENSG00000177685	ENST00000528542;ENST00000450448;ENST00000321883;ENST00000525077	T;T;T	0.09911	2.93;2.93;3.16	4.38	2.37	0.29283	.	0.547119	0.16408	N	0.215730	T	0.24470	0.0593	L	0.50333	1.59	0.53688	D	0.999973	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.916;0.992;0.992	T	0.00391	-1.1769	10	0.87932	D	0	-19.0097	10.0941	0.42464	0.5034:0.4965:0.0:0.0	.	203;110;203	Q8N4Y2-3;E7EU41;Q8N4Y2	.;.;EFC4A_HUMAN	C	203	ENSP00000432334:R203C;ENSP00000409256:R203C;ENSP00000435299:R203C	ENSP00000324024:R203C	R	+	1	0	EFCAB4A	820251	0.994000	0.37717	0.996000	0.52242	0.962000	0.63368	0.593000	0.23999	0.251000	0.21505	0.436000	0.28706	CGC			0.716	EFCAB4A-007	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000383097.1			Missense_Mutation
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	RNA	INS	-	-	T	rs11432678	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:14101781_14101782insT	ENST00000310358.7	+	0	1211							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		TAttttttttcttttttttttt	0.441													|||unknown(HR)	1735	0.346446	0.1241	0.2738	5008	,	,		21091	0.4494		0.3917	False		,,,				2504	0.546				.													.	SPON1	65		0			.																																											10418	.			TTTTTTCTTTTTT	AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14101792_14101792dupT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K6W5|O94862|Q8NCD7|Q8WUR5	RNA	INS	ENST00000310358.7	37																																																																																						0.441	SPON1-201	KNOWN	basic	processed_transcript	processed_transcript				NM_145584	
ZDHHC5	25921	broad.mit.edu	37	11	57466827	57466827	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:57466827delA	ENST00000287169.3	+	11	3281	c.1919delA	c.(1918-1920)caafs	p.Q640fs	ZDHHC5_ENST00000527985.1_Frame_Shift_Del_p.Q587fs	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	640					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.Q640P(1)		endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						TACAGCAGCCAAAAAGCCCAA	0.542																																					p.Q640fs													ZDHHC5,NS,carcinoma,0,1	ZDHHC5	49	1	1	Substitution - Missense(1)	endometrium(1)	c.1919delA												62.0	65.0	64.0					11																	57466827		2201	4296	6497	SO:0001589	frameshift_variant	25921	exon11			GCAGCCAAAAAGC	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1919delA	11.37:g.57466827delA	ENSP00000287169:p.Gln640fs		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	115	0.06	7	NM_015457	409	0.00	0	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Frame_Shift_Del	DEL	ENST00000287169.3	37	CCDS7965.1																																																																																					0.542	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393694.1		NM_015457	
CNTF	1270	broad.mit.edu	37	11	58391741	58391741	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:58391741G>A	ENST00000361987.4	+	2	429	c.349G>A	c.(349-351)Gct>Act	p.A117T	ZFP91-CNTF_ENST00000389919.4_3'UTR	NM_000614.3	NP_000605.1	P26441	CNTF_HUMAN	ciliary neurotrophic factor	117					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|growth (GO:0040007)|muscle organ morphogenesis (GO:0048644)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of photoreceptor cell differentiation (GO:0046533)|neuron development (GO:0048666)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of retinal cell programmed cell death (GO:0046668)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			NS(1)|breast(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)	10		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TCTCCAAGTCGCTGCCTTTGC	0.478																																					p.A117T													.	CNTF	22		0			c.G349A												99.0	85.0	90.0					11																	58391741		2201	4295	6496	SO:0001583	missense	1270	exon2			CAAGTCGCTGCCT	BC068030	CCDS31554.1	11q12	2011-07-21			ENSG00000242689	ENSG00000242689			2169	protein-coding gene	gene with protein product		118945				1840538, 1714745	Standard	NM_000614		Approved	HCNTF	uc001nna.4	P26441	OTTHUMG00000137476	ENST00000361987.4:c.349G>A	11.37:g.58391741G>A	ENSP00000355370:p.Ala117Thr		Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	167	0.03	5	NM_000614	0		0	B2RAB2	Missense_Mutation	SNP	ENST00000361987.4	37	CCDS31554.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944787	0.34283	.	.	ENSG00000242689	ENST00000361987	T	0.35236	1.32	5.45	2.3	0.28687	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.	.	.	.	T	0.26666	0.0652	M	0.62723	1.935	0.25691	N	0.985684	B	0.30526	0.283	B	0.25759	0.063	T	0.34129	-0.9841	9	0.02654	T	1	-3.2346	6.9176	0.24369	0.086:0.0:0.3701:0.5438	.	117	P26441	CNTF_HUMAN	T	117	ENSP00000355370:A117T	ENSP00000447778:A117T	A	+	1	0	CNTF	58148317	0.036000	0.19791	0.987000	0.45799	0.750000	0.42670	0.803000	0.27083	0.158000	0.19367	-0.182000	0.12963	GCT			0.478	CNTF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268673.1		NM_000614	
LTBP3	4054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	65310634	65310634	+	Silent	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:65310634G>A	ENST00000301873.5	-	18	2806	c.2538C>T	c.(2536-2538)ggC>ggT	p.G846G	LTBP3_ENST00000536982.1_Silent_p.G472G|LTBP3_ENST00000322147.4_Silent_p.G846G|LTBP3_ENST00000529189.1_5'UTR|LTBP3_ENST00000530785.1_5'UTR|LTBP3_ENST00000532932.1_Silent_p.G276G	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	846	Cys-rich.|EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						ATCTGTAGGAGCCATTGGTAT	0.582																																					p.G846G													.	.			0			c.C2538T												125.0	110.0	115.0					11																	65310634		2201	4297	6498	SO:0001819	synonymous_variant	4054	exon18			GTAGGAGCCATTG	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.2538C>T	11.37:g.65310634G>A			Somatic	106	0	0		WXS	Illumina HiSeq	.	126	0.06	8	NM_001130144	33	0.06	2	O15107|Q96HB9|Q9H7K2|Q9UFN4	Silent	SNP	ENST00000301873.5	37	CCDS44647.1	.	.	.	.	.	.	.	.	.	.	G	9.763	1.170566	0.21621	.	.	ENSG00000168056	ENST00000526927	.	.	.	4.25	-0.0622	0.13781	.	.	.	.	.	T	0.54398	0.1856	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45556	-0.9253	4	.	.	.	.	8.1246	0.30990	0.3929:0.0:0.6071:0.0	.	.	.	.	F	497	.	.	L	-	1	0	LTBP3	65067210	0.998000	0.40836	0.998000	0.56505	0.991000	0.79684	0.300000	0.19156	-0.043000	0.13513	0.455000	0.32223	CTC			0.582	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390538.1		NM_021070	
APOA1	335	hgsc.bcm.edu	37	11	116708059	116708059	+	Splice_Site	SNP	A	A	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:116708059A>C	ENST00000236850.4	-	2	409		c.e2+1		AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000375323.1_Splice_Site|APOA1_ENST00000375320.1_Splice_Site|APOA1_ENST00000359492.2_Splice_Site|APOA1_ENST00000375329.2_Splice_Site	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I						adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		GGGGACACCTACCCGTCAGGA	0.647																																					.													APOA1,NS,carcinoma,-2,1	APOA1	-2	1	0			c.43+2T>G												31.0	30.0	30.0					11																	116708059		2182	4280	6462	SO:0001630	splice_region_variant	335	exon3			ACACCTACCCGTC	X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.43+1T>G	11.37:g.116708059A>C			Somatic	121	0.0082644628	1		WXS	Illumina HiSeq	.	137	0.10	14	NM_000039	0		0	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Splice_Site	SNP	ENST00000236850.4	37	CCDS8378.1	.	.	.	.	.	.	.	.	.	.	A	16.64	3.179343	0.57800	.	.	ENSG00000118137	ENST00000375320;ENST00000359492;ENST00000375329;ENST00000375323;ENST00000236850	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7503	0.57304	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	APOA1	116213269	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	5.135000	0.64777	1.835000	0.53391	0.459000	0.35465	.			0.647	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106281.2		NM_000039	Intron
TIRAP	114609	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	126162546	126162546	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr11:126162546G>A	ENST00000392680.2	+	5	647	c.242G>A	c.(241-243)cGc>cAc	p.R81H	RP11-712L6.5_ENST00000528876.1_5'Flank|TIRAP_ENST00000392679.1_Missense_Mutation_p.R81H|RP11-712L6.7_ENST00000533378.1_RNA|TIRAP_ENST00000392678.3_Missense_Mutation_p.R81H	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	81					3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)			breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		GGCAGTAGTCGCTGGAGCAAA	0.612																																					p.R81H													TIRAP_ENST00000392678,NS,carcinoma,+1,3	TIRAP	37	3	0			c.G242A												82.0	67.0	72.0					11																	126162546		2201	4297	6498	SO:0001583	missense	114609	exon5			GTAGTCGCTGGAG	AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.242G>A	11.37:g.126162546G>A	ENSP00000376447:p.Arg81His		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	66	0.09	6	NM_148910	4	0.25	1	B3KW65|Q56UH9|Q56UI0|Q8N5E5	Missense_Mutation	SNP	ENST00000392680.2	37	CCDS8472.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486171	0.84854	.	.	ENSG00000150455	ENST00000392679;ENST00000279992;ENST00000392678;ENST00000392680	T;T;T	0.02472	4.28;4.28;4.28	5.41	5.41	0.78517	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.059532	0.64402	D	0.000006	T	0.15046	0.0363	M	0.69823	2.125	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.01440	-1.1354	10	0.32370	T	0.25	-0.0428	19.1929	0.93674	0.0:0.0:1.0:0.0	.	81;81	P58753;Q56UH9	TIRAP_HUMAN;.	H	81	ENSP00000376446:R81H;ENSP00000376445:R81H;ENSP00000376447:R81H	ENSP00000279992:R81H	R	+	2	0	TIRAP	125667756	1.000000	0.71417	1.000000	0.80357	0.477000	0.33069	7.706000	0.84615	2.523000	0.85059	0.655000	0.94253	CGC			0.612	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000277092.1		NM_148910	
KLRC4	8302	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	10562068	10562068	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr12:10562068T>G	ENST00000309384.1	-	1	288	c.107A>C	c.(106-108)cAg>cCg	p.Q36P	KLRC4-KLRK1_ENST00000539300.1_Silent_p.T27T	NM_013431.2	NP_038459.1	O43908	NKG2F_HUMAN	killer cell lectin-like receptor subfamily C, member 4	36					cellular defense response (GO:0006968)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						GAATATTTCCTGTTTGGTTCC	0.388																																					p.Q36P													KLRC4,NS,carcinoma,-1,1	KLRC4	23	1	0			c.A107C												221.0	213.0	215.0					12																	10562068		2202	4300	6502	SO:0001583	missense	8302	exon1			ATTTCCTGTTTGG	U96846	CCDS8624.1	12p13.2-p12.3	2008-08-05			ENSG00000183542	ENSG00000183542		"""Killer cell lectin-like receptors"""	6377	protein-coding gene	gene with protein product		602893				9598306	Standard	NM_013431		Approved	NKG2-F	uc001qye.3	O43908	OTTHUMG00000168575	ENST00000309384.1:c.107A>C	12.37:g.10562068T>G	ENSP00000310216:p.Gln36Pro		Somatic	246	0	0		WXS	Illumina HiSeq	Phase_I	538	0.03	17	NM_013431	1	0.00	0	O60851	Missense_Mutation	SNP	ENST00000309384.1	37	CCDS8624.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.325955	0.41197	.	.	ENSG00000183542	ENST00000309384	T	0.10005	2.92	3.78	2.57	0.30868	.	0.425163	0.20355	N	0.093978	T	0.21881	0.0527	M	0.84773	2.715	0.09310	N	1	P	0.51791	0.948	P	0.49999	0.628	T	0.09465	-1.0673	10	0.72032	D	0.01	.	6.8039	0.23766	0.2075:0.0:0.0:0.7925	.	36	O43908	NKG2F_HUMAN	P	36	ENSP00000310216:Q36P	ENSP00000310216:Q36P	Q	-	2	0	KLRC4	10453335	0.001000	0.12720	0.009000	0.14445	0.008000	0.06430	0.428000	0.21395	0.544000	0.28883	0.377000	0.23210	CAG			0.388	KLRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400108.1		NM_013431	
DDX11	1663	ucsc.edu	37	12	31254052	31254052	+	Missense_Mutation	SNP	G	G	C	rs201027785	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr12:31254052G>C	ENST00000407793.2	+	20	2291	c.2040G>C	c.(2038-2040)gaG>gaC	p.E680D	DDX11_ENST00000350437.4_Missense_Mutation_p.E680D|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000542838.1_Missense_Mutation_p.E680D|DDX11_ENST00000228264.6_Missense_Mutation_p.E654D|DDX11_ENST00000545668.1_Missense_Mutation_p.E680D	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	680					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AGAAAAGAGAGCTGCCTCAGA	0.612										Multiple Myeloma(12;0.14)			G|||	11	0.00219649	0.0015	0.0101	5008	,	,		17144	0.0		0.001	False		,,,				2504	0.001				p.E680D													.	DDX11	188		0			c.G2040C												56.0	62.0	60.0					12																	31254052		2203	4300	6503	SO:0001583	missense	1663	exon20			AAGAGAGCTGCCT	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.2040G>C	12.37:g.31254052G>C	ENSP00000384703:p.Glu680Asp		Somatic	88	0	0		RNA-Seq	Illumina HiSeq		121	0.01	1	NM_030653	167	0.13	22	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	149	0.06822344322344322	30	0.06097560975609756	20	0.055248618784530384	39	0.06818181818181818	60	0.079155672823219	G	3.714	-0.058844	0.07317	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.78003	-0.56;-0.55;-0.56;-0.55;-1.14	3.75	0.575	0.17374	.	0.161338	0.53938	D	0.000051	T	0.05044	0.0135	.	.	.	0.80722	D	1	B;B;B;B	0.15141	0.012;0.006;0.002;0.012	B;B;B;B	0.13407	0.009;0.003;0.004;0.009	T	0.02437	-1.1159	9	0.13470	T	0.59	.	2.3945	0.04386	0.112:0.3585:0.3457:0.1839	.	654;680;680;680	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	D	680;680;405;654;680;680	ENSP00000443426:E680D;ENSP00000384703:E680D;ENSP00000228264:E654D;ENSP00000440402:E680D;ENSP00000309965:E680D	ENSP00000228264:E654D	E	+	3	2	DDX11	31145319	0.402000	0.25311	0.969000	0.41365	0.258000	0.26162	0.027000	0.13621	0.748000	0.32831	0.597000	0.82753	GAG			0.612	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000399728.1		NM_030653	
RP11-150C16.1	0	broad.mit.edu	37	12	59414689	59414689	+	RNA	DEL	A	A	-	rs535382021		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr12:59414689delA	ENST00000547590.1	+	0	226																											TTTTTTGAGTAACAAATAAGA	0.338																																					.													.	.			0			.																																											0	.			TTGAGTAACAAAT																													12.37:g.59414689delA			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000547590.1	37																																																																																						0.338	RP11-150C16.1-001	KNOWN	basic	antisense	antisense		OTTHUMT00000406632.1			
CUX2	23316	mdanderson.org	37	12	111779749	111779749	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr12:111779749G>T	ENST00000261726.6	+	21	3705	c.3551G>T	c.(3550-3552)cGg>cTg	p.R1184L	RNA5SP373_ENST00000517271.1_RNA	NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1184					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GAGGCACTGCGGAAGGCCTAT	0.627																																					p.R1184L													.	.			0			c.G3551T												65.0	80.0	75.0					12																	111779749		2180	4297	6477	SO:0001583	missense	23316	exon21			CACTGCGGAAGGC	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3551G>T	12.37:g.111779749G>T	ENSP00000261726:p.Arg1184Leu		Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	124	0.04	5	NM_015267	6	0.00	0	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027192	0.54683	.	.	ENSG00000111249	ENST00000261726	D	0.96168	-3.93	5.1	2.92	0.33932	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.151653	0.53938	D	0.000049	D	0.92701	0.7680	M	0.66297	2.02	0.54753	D	0.999981	B	0.11235	0.004	B	0.23852	0.049	D	0.88726	0.3233	10	0.56958	D	0.05	-17.3874	4.297	0.10906	0.5637:0.0:0.4363:0.0	.	1184	O14529	CUX2_HUMAN	L	1184	ENSP00000261726:R1184L	ENSP00000261726:R1184L	R	+	2	0	CUX2	110264132	1.000000	0.71417	0.754000	0.31244	0.991000	0.79684	3.103000	0.50298	1.084000	0.41184	0.462000	0.41574	CGG			0.627	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404765.1		NM_015267	
SH2B3	10019	hgsc.bcm.edu	37	12	111886037	111886037	+	Silent	SNP	G	G	T	rs369151728		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr12:111886037G>T	ENST00000341259.2	+	8	2016	c.1659G>T	c.(1657-1659)tcG>tcT	p.S553S	SH2B3_ENST00000538307.1_Silent_p.S351S	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	553					blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)	p.S553S(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	CCCGGGACTCGGACTACGAAA	0.602																																					p.S553S													SH2B3,rectum,carcinoma,0,1	SH2B3	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G1659T												86.0	102.0	97.0					12																	111886037		2203	4300	6503	SO:0001819	synonymous_variant	10019	exon8			GGACTCGGACTAC	AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1659G>T	12.37:g.111886037G>T			Somatic	112	0	0		WXS	Illumina HiSeq	.	71	0.04	3	NM_005475	60	0.00	0	B9EGG5|O95184	Silent	SNP	ENST00000341259.2	37	CCDS9153.1																																																																																					0.602	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000404779.1		NM_005475	
TMEM132D	121256	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	130184360	130184360	+	Silent	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr12:130184360C>T	ENST00000422113.2	-	2	1289	c.963G>A	c.(961-963)acG>acA	p.T321T	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	321					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTTACCTCAACGTGAAGCGAT	0.493																																					p.T321T													.	TMEM132D	299		0			c.G963A												104.0	93.0	97.0					12																	130184360		2203	4300	6503	SO:0001819	synonymous_variant	121256	exon2			CCTCAACGTGAAG	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.963G>A	12.37:g.130184360C>T			Somatic	234	0.0042735043	1		WXS	Illumina HiSeq	Phase_I	197	0.09	18	NM_133448	1	1.00	1	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	CCDS9266.1																																																																																					0.493	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399592.1		NM_133448	
GPC6	10082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	94680124	94680124	+	Missense_Mutation	SNP	G	G	C	rs201329039		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr13:94680124G>C	ENST00000377047.4	+	4	1468	c.853G>C	c.(853-855)Gac>Cac	p.D285H	RNA5SP35_ENST00000391257.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	285					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GGCTGACCTCGACACAGAGTG	0.512																																					p.D285H													.	.			0			c.G853C												125.0	115.0	118.0					13																	94680124		2203	4300	6503	SO:0001583	missense	10082	exon4			GACCTCGACACAG	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.853G>C	13.37:g.94680124G>C	ENSP00000366246:p.Asp285His		Somatic	98	0	0		WXS	Illumina HiSeq	.	70	0.11	8	NM_005708	2	0.00	0	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305877	0.81247	.	.	ENSG00000183098	ENST00000377047	T	0.60040	0.22	5.79	5.79	0.91817	.	0.060806	0.64402	D	0.000005	D	0.82426	0.5034	M	0.91818	3.245	0.52099	D	0.999947	D;D	0.89917	1.0;1.0	D;D	0.85130	0.991;0.997	D	0.85372	0.1114	10	0.72032	D	0.01	.	20.0204	0.97499	0.0:0.0:1.0:0.0	.	285;285	B4E2M1;Q9Y625	.;GPC6_HUMAN	H	285	ENSP00000366246:D285H	ENSP00000366246:D285H	D	+	1	0	GPC6	93478125	1.000000	0.71417	0.989000	0.46669	0.870000	0.49936	6.750000	0.74888	2.740000	0.93945	0.561000	0.74099	GAC			0.512	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045460.4		NM_005708	
FARP1	10160	broad.mit.edu	37	13	99083499	99083499	+	Missense_Mutation	SNP	A	A	C	rs201729016		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr13:99083499A>C	ENST00000319562.6	+	18	2373	c.2108A>C	c.(2107-2109)cAc>cCc	p.H703P	FARP1_ENST00000595437.1_Missense_Mutation_p.H703P|FARP1_ENST00000376586.2_Missense_Mutation_p.H703P	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	703	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TGCAAACACCACCCGCCGAGC	0.647																																					p.H703P													.	FARP1	207		0			c.A2108C												14.0	14.0	14.0					13																	99083499		2201	4296	6497	SO:0001583	missense	10160	exon18			AACACCACCCGCC	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2108A>C	13.37:g.99083499A>C	ENSP00000322926:p.His703Pro		Somatic	104	0.2596153846	27		WXS	Illumina HiSeq	Phase_I	93	0.43	40	NM_005766	48	0.21	10	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.87|15.87	2.961184|2.961184	0.53400|0.53400	.|.	.|.	ENSG00000152767|ENSG00000152767	ENST00000376586;ENST00000319562|ENST00000423063	T;T|.	0.62788|.	-0.0;-0.0|.	5.58|5.58	4.4|4.4	0.53042|0.53042	Dbl homology (DH) domain (5);|.	0.126644|.	0.56097|.	D|.	0.000036|.	T|T	0.34629|0.34629	0.0904|0.0904	N|N	0.08118|0.08118	0|0	0.46823|0.46823	D|D	0.999218|0.999218	B;B|.	0.29378|.	0.243;0.0|.	B;B|.	0.28385|.	0.089;0.002|.	T|T	0.11397|0.11397	-1.0589|-1.0589	10|5	0.87932|.	D|.	0|.	.|.	11.2934|11.2934	0.49263|0.49263	0.9285:0.0:0.0715:0.0|0.9285:0.0:0.0715:0.0	.|.	703;703|.	Q9Y4F1;C9JME2|.	FARP1_HUMAN;.|.	P|P	703|6	ENSP00000365771:H703P;ENSP00000322926:H703P|.	ENSP00000322926:H703P|.	H|T	+|+	2|1	0|0	FARP1|FARP1	97881500|97881500	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.791000|0.791000	0.44710|0.44710	5.843000|5.843000	0.69424|0.69424	0.943000|0.943000	0.37553|0.37553	0.454000|0.454000	0.30748|0.30748	CAC|ACC			0.647	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045541.3		NM_005766	
SETD3	84193	hgsc.bcm.edu;broad.mit.edu	37	14	99879294	99879294	+	Frame_Shift_Del	DEL	G	G	-	rs201395609		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr14:99879294delG	ENST00000331768.5	-	8	1002	c.843delC	c.(841-843)aacfs	p.N281fs	SETD3_ENST00000436070.2_Frame_Shift_Del_p.N281fs|SETD3_ENST00000329331.3_Frame_Shift_Del_p.N281fs	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	281	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TTACCAGGCCGTTGGTGTGGT	0.512																																					p.G282fs													.	SETD3	56		0			c.844delG												145.0	128.0	133.0					14																	99879294		2203	4300	6503	SO:0001589	frameshift_variant	84193	exon8			CAGGCCGTTGGTG	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.843delC	14.37:g.99879294delG	ENSP00000327436:p.Asn281fs		Somatic	150	0	0		WXS	Illumina HiSeq	.	154	0.10	15	NM_199123	90	0.01	1	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Frame_Shift_Del	DEL	ENST00000331768.5	37	CCDS9951.1																																																																																					0.512	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000072339.3		NM_032233	
AMN	81693	mdanderson.org	37	14	103389038	103389038	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr14:103389038G>T	ENST00000299155.5	+	1	46	c.13G>T	c.(13-15)Ggc>Tgc	p.G5C		NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	5					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGGCGTCCTGGGCCGGGTCCT	0.721																																					p.G5C													.	.			0			c.G13T												32.0	24.0	27.0					14																	103389038		2187	4278	6465	SO:0001583	missense	81693	exon1			GTCCTGGGCCGGG	AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.13G>T	14.37:g.103389038G>T	ENSP00000299155:p.Gly5Cys		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_030943	1	0.00	0	Q6UX83	Missense_Mutation	SNP	ENST00000299155.5	37	CCDS9977.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628495	0.28978	.	.	ENSG00000166126	ENST00000299155	D	0.89746	-2.56	2.97	0.632	0.17705	.	0.807745	0.11070	U	0.603008	D	0.91415	0.7291	L	0.56769	1.78	0.09310	N	1	D	0.89917	1.0	D	0.76575	0.988	T	0.80970	-0.1144	10	0.41790	T	0.15	-10.9401	8.0668	0.30665	0.0:0.5005:0.4995:0.0	.	5	Q9BXJ7	AMNLS_HUMAN	C	5	ENSP00000299155:G5C	ENSP00000299155:G5C	G	+	1	0	AMN	102458791	0.399000	0.25287	0.440000	0.26846	0.086000	0.17979	1.183000	0.32041	0.488000	0.27723	0.484000	0.47621	GGC			0.721	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415704.1			
IGHV4-34	28395	broad.mit.edu;mdanderson.org	37	14	106829753	106829753	+	RNA	SNP	C	C	T	rs587742910	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr14:106829753C>T	ENST00000390616.2	-	0	240									immunoglobulin heavy variable 4-34																		TCCACTCCAGCCCCTTCCCTG	0.552													G|||	5	0.000998403	0.003	0.0	5008	,	,		14392	0.0		0.001	False		,,,				2504	0.0				.													.	.			0			.												78.0	81.0	80.0					14																	106829753		1880	4107	5987			0	.			CTCCAGCCCCTTC	X92278		14q32.33	2012-02-08			ENSG00000211956	ENSG00000211956		"""Immunoglobulins / IGH locus"""	5650	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152074		14.37:g.106829753C>T			Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	185	0.09	16	.	529	0.02	11		RNA	SNP	ENST00000390616.2	37																																																																																						0.552	IGHV4-34-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000325168.1		NG_001019	
MAPK6	5597	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52353621	52353621	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr15:52353621C>T	ENST00000261845.5	+	5	1798	c.991C>T	c.(991-993)Cct>Tct	p.P331S	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	331					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TTCAAGCCATCCTTTTCATAT	0.363																																					p.P331S													.	MAPK6	70		0			c.C991T												113.0	100.0	104.0					15																	52353621		2195	4293	6488	SO:0001583	missense	5597	exon5			AGCCATCCTTTTC	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.991C>T	15.37:g.52353621C>T	ENSP00000261845:p.Pro331Ser		Somatic	230	0.0043478261	1		WXS	Illumina HiSeq	Phase_I	176	0.27	47	NM_002748	56	0.50	28	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	37	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	C	33	5.243338	0.95272	.	.	ENSG00000069956	ENST00000261845	T	0.72725	-0.68	5.13	5.13	0.70059	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81317	0.4797	L	0.59436	1.845	0.80722	D	1	D	0.69078	0.997	D	0.63488	0.915	D	0.83431	0.0038	10	0.87932	D	0	-11.2854	18.5662	0.91118	0.0:1.0:0.0:0.0	.	331	Q16659	MK06_HUMAN	S	331	ENSP00000261845:P331S	ENSP00000261845:P331S	P	+	1	0	MAPK6	50140913	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.815000	0.86186	2.399000	0.81585	0.585000	0.79938	CCT			0.363	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254841.2		NM_002748	
DENND4A	10260	mdanderson.org	37	15	66021978	66021978	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr15:66021978G>T	ENST00000431932.2	-	10	1413	c.1205C>A	c.(1204-1206)cCt>cAt	p.P402H	DENND4A_ENST00000443035.3_Missense_Mutation_p.P402H	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	402	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						AGCATTTTCAGGGCCTAAATT	0.363																																					p.P402H													.	.			0			c.C1205A												57.0	51.0	53.0					15																	66021978		1865	4098	5963	SO:0001583	missense	10260	exon10			TTTTCAGGGCCTA	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.1205C>A	15.37:g.66021978G>T	ENSP00000396830:p.Pro402His		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_005848	4	0.00	0	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	37	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768284	0.90020	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.12465	2.68;2.68	5.57	5.57	0.84162	DENN (3);	0.104467	0.64402	D	0.000002	T	0.42108	0.1188	M	0.79343	2.45	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.80764	0.967;0.994;0.991	T	0.31641	-0.9936	10	0.87932	D	0	.	19.5378	0.95262	0.0:0.0:1.0:0.0	.	402;402;402	B7Z5Y3;E7EPL3;Q7Z401	.;.;MYCPP_HUMAN	H	402	ENSP00000391167:P402H;ENSP00000396830:P402H	ENSP00000396830:P402H	P	-	2	0	DENND4A	63809032	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.619000	0.88677	0.650000	0.86243	CCT			0.363	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419611.1		NM_005848	
SMAD6	4091	broad.mit.edu;mdanderson.org	37	15	67073787	67073787	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr15:67073787G>T	ENST00000288840.5	+	4	2436	c.1405G>T	c.(1405-1407)Gcc>Tcc	p.A469S	SMAD6_ENST00000338426.4_Missense_Mutation_p.A208S	NM_005585.4	NP_005576.3	O43541	SMAD6_HUMAN	SMAD family member 6	469	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|cell-substrate adhesion (GO:0031589)|fat cell differentiation (GO:0045444)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|response to estrogen (GO:0043627)|response to laminar fluid shear stress (GO:0034616)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I activin receptor binding (GO:0070698)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			lung(1)|skin(1)	2						CATCAGCTTCGCCAAGGGCTG	0.692																																					p.A469S	Esophageal Squamous(179;72 2004 22333 39628 47290)												.	SMAD6	14		0			c.G1405T												11.0	15.0	14.0					15																	67073787		2161	4256	6417	SO:0001583	missense	4091	exon4			AGCTTCGCCAAGG	BC012986	CCDS10221.1	15q22.31	2014-09-11	2006-11-06	2004-05-26	ENSG00000137834	ENSG00000137834		"""SMADs"""	6772	protein-coding gene	gene with protein product		602931	"""MAD, mothers against decapentaplegic homolog 6 (Drosophila)"", ""SMAD, mothers against DPP homolog 6 (Drosophila)"""	MADH7, MADH6		9256479	Standard	NR_027654		Approved	HsT17432	uc002aqf.3	O43541	OTTHUMG00000133218	ENST00000288840.5:c.1405G>T	15.37:g.67073787G>T	ENSP00000288840:p.Ala469Ser		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_005585	30	0.00	0	A9J6M5|O43654|Q15799|Q7Z7L4|Q96E31|Q9UKZ3	Missense_Mutation	SNP	ENST00000288840.5	37	CCDS10221.1	.	.	.	.	.	.	.	.	.	.	G	31	5.081605	0.94050	.	.	ENSG00000137834	ENST00000288840;ENST00000338426	D;D	0.98822	-5.16;-4.42	5.71	5.71	0.89125	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99205	0.9724	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	D	0.99716	1.1008	10	0.72032	D	0.01	.	19.8575	0.96767	0.0:0.0:1.0:0.0	.	208;469	O43541-2;O43541	.;SMAD6_HUMAN	S	469;208	ENSP00000288840:A469S;ENSP00000345054:A208S	ENSP00000288840:A469S	A	+	1	0	SMAD6	64860841	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.741000	0.98843	2.698000	0.92095	0.561000	0.74099	GCC			0.692	SMAD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256953.2		NM_005585	
HCN4	10021	ucsc.edu	37	15	73617654	73617654	+	Silent	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr15:73617654G>A	ENST00000261917.3	-	5	2715	c.1722C>T	c.(1720-1722)agC>agT	p.S574S		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	574					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GCAGGGGCTCGCTTAGCTCGC	0.677																																					p.S574S													.	HCN4	150		0			c.C1722T												41.0	46.0	44.0					15																	73617654		2198	4297	6495	SO:0001819	synonymous_variant	10021	exon5			GGGCTCGCTTAGC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1722C>T	15.37:g.73617654G>A			Somatic	87	0	0		WXS	Illumina HiSeq		58	0.07	4	NM_005477	1	0.00	0	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1																																																																																					0.677	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268900.2		NM_005477	
STRA6	64220	broad.mit.edu	37	15	74476264	74476264	+	Silent	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr15:74476264A>G	ENST00000323940.5	-	14	1478	c.1233T>C	c.(1231-1233)caT>caC	p.H411H	STRA6_ENST00000449139.2_Silent_p.H411H|STRA6_ENST00000423167.2_Silent_p.H402H|STRA6_ENST00000416286.3_Silent_p.H403H|STRA6_ENST00000535552.1_Silent_p.H448H|STRA6_ENST00000563965.1_Silent_p.H450H|STRA6_ENST00000574278.1_Silent_p.H426H|STRA6_ENST00000395105.4_Silent_p.H411H|STRA6_ENST00000574439.1_5'UTR	NM_001142617.1|NM_001142618.1|NM_001142619.1	NP_001136089.1|NP_001136090.1|NP_001136091.1	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid 6	411					adrenal gland development (GO:0030325)|alveolar primary septum development (GO:0061143)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|cognition (GO:0050890)|developmental growth (GO:0048589)|diaphragm development (GO:0060539)|digestive tract morphogenesis (GO:0048546)|ductus arteriosus closure (GO:0097070)|ear development (GO:0043583)|embryonic camera-type eye formation (GO:0060900)|embryonic digestive tract development (GO:0048566)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|feeding behavior (GO:0007631)|female genitalia development (GO:0030540)|head development (GO:0060322)|head morphogenesis (GO:0060323)|heart development (GO:0007507)|kidney development (GO:0001822)|learning (GO:0007612)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung vasculature development (GO:0060426)|neuromuscular process (GO:0050905)|nose morphogenesis (GO:0043585)|paramesonephric duct development (GO:0061205)|phototransduction, visible light (GO:0007603)|positive regulation of behavior (GO:0048520)|positive regulation of JAK-STAT cascade (GO:0046427)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol transport (GO:0034633)|smooth muscle tissue development (GO:0048745)|uterus morphogenesis (GO:0061038)|ventricular septum development (GO:0003281)|vitamin A import (GO:0071939)|vocal learning (GO:0042297)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	receptor activity (GO:0004872)|vitamin transporter activity (GO:0051183)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|stomach(2)	26						GGCGGGAGGGATGGGGACTCC	0.617																																					p.H450H													.	STRA6	66		0			c.T1350C												97.0	84.0	88.0					15																	74476264		2198	4297	6495	SO:0001819	synonymous_variant	64220	exon14			GGAGGGATGGGGA	AF352728	CCDS10261.1, CCDS45301.1, CCDS45302.1, CCDS55973.1, CCDS55974.1, CCDS58387.1	15q24.1	2014-07-14	2012-12-07		ENSG00000137868	ENSG00000137868			30650	protein-coding gene	gene with protein product	"""retinol binding protein 4 receptor"""	610745	"""stimulated by retinoic acid gene 6 homolog (mouse)"", ""stimulated by retinoic acid 6 homolog (mouse)"""			17255476, 17273977	Standard	NM_022369		Approved	FLJ12541	uc002axj.3	Q9BX79	OTTHUMG00000138998	ENST00000323940.5:c.1233T>C	15.37:g.74476264A>G			Somatic	97	0.1340206186	13		WXS	Illumina HiSeq	Phase_I	89	0.16	14	NM_001199042	12	0.00	0	A8K7F1|B7Z5M9|B7Z862|D3DW54|F5GYI8|I3L1G8|Q6PJF8|Q71RB9|Q7L9G1|Q7Z3U9|Q8TB21|Q9BX78|Q9H9U8	Silent	SNP	ENST00000323940.5	37	CCDS10261.1																																																																																					0.617	STRA6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000272891.1			
TARSL2	123283	mdanderson.org	37	15	102264363	102264363	+	Silent	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr15:102264363G>T	ENST00000335968.3	-	1	444	c.228C>A	c.(226-228)gcC>gcA	p.A76A		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	76					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCCGCTCCTCGGCGAGGCACA	0.756																																					p.A76A													.	.			0			c.C228A												2.0	2.0	2.0					15																	102264363		1378	3033	4411	SO:0001819	synonymous_variant	123283	exon1			CTCCTCGGCGAGG	AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.228C>A	15.37:g.102264363G>T			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_152334	4	0.00	0	B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Silent	SNP	ENST00000335968.3	37	CCDS10394.1																																																																																					0.756	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313619.3		NM_152334	
RHBDF1	64285	mdanderson.org	37	16	110496	110496	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:110496G>T	ENST00000262316.6	-	12	1741	c.1599C>A	c.(1597-1599)agC>agA	p.S533R		NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	533					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GCTCTGGGGCGCTGGGATGGA	0.632																																					p.S533R													.	.			0			c.C1599A												68.0	66.0	66.0					16																	110496		2203	4300	6503	SO:0001583	missense	64285	exon12			TGGGGCGCTGGGA	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1599C>A	16.37:g.110496G>T	ENSP00000262316:p.Ser533Arg		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_022450	64	0.00	0	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	37	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	.	16.07	3.019827	0.54576	.	.	ENSG00000007384	ENST00000262316	T	0.43688	0.94	5.38	-8.76	0.00830	.	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	N	0.14661	0.345	0.80722	D	1	P	0.39282	0.666	B	0.38264	0.269	T	0.33523	-0.9865	10	0.66056	D	0.02	-16.7836	19.7037	0.96065	0.2391:0.0:0.7609:0.0	.	533	Q96CC6	RHDF1_HUMAN	R	533	ENSP00000262316:S533R	ENSP00000262316:S533R	S	-	3	2	RHBDF1	50496	0.991000	0.36638	0.581000	0.28614	0.713000	0.41058	0.265000	0.18515	-1.896000	0.01102	-1.105000	0.02106	AGC			0.632	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000134178.2		NM_022450	
TELO2	9894	mdanderson.org	37	16	1559886	1559886	+	Silent	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:1559886G>A	ENST00000262319.6	+	21	2742	c.2463G>A	c.(2461-2463)ctG>ctA	p.L821L		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	821					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				TGAGGGCCCTGCTGCTTCTGC	0.657																																					p.L821L													.	.			0			c.G2463A												56.0	54.0	54.0					16																	1559886		2198	4297	6495	SO:0001819	synonymous_variant	9894	exon21			GGCCCTGCTGCTT	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.2463G>A	16.37:g.1559886G>A			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_016111	156	0.00	0	D3DU73|O75168|Q7LDV4|Q9BR21	Silent	SNP	ENST00000262319.6	37	CCDS32363.1																																																																																					0.657	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103602.2		NM_016111	
CLN3	1201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28488916	28488916	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:28488916C>T	ENST00000569430.1	-	17	2057	c.1238G>A	c.(1237-1239)tGc>tAc	p.C413Y	CLN3_ENST00000395653.4_Missense_Mutation_p.C313Y|CLN3_ENST00000357806.7_Missense_Mutation_p.C314Y|CLN3_ENST00000354630.5_Missense_Mutation_p.C396Y|CLN3_ENST00000355477.5_Missense_Mutation_p.C365Y|CLN3_ENST00000357857.9_Missense_Mutation_p.C359Y|CLN3_ENST00000359984.7_Missense_Mutation_p.C413Y|CLN3_ENST00000567963.1_Missense_Mutation_p.C316Y|CLN3_ENST00000360019.2_Missense_Mutation_p.C413Y|CLN3_ENST00000565316.1_Missense_Mutation_p.C396Y|CLN3_ENST00000568224.1_Missense_Mutation_p.C335Y|CLN3_ENST00000333496.9_Missense_Mutation_p.C389Y|CLN3_ENST00000535392.1_Missense_Mutation_p.C335Y			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	413					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GTCAGAGATGCAGGTGGCCGC	0.622																																					p.C413Y													.	.			0			c.G1238A												71.0	73.0	72.0					16																	28488916		2197	4300	6497	SO:0001583	missense	1201	exon16			GAGATGCAGGTGG	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.1238G>A	16.37:g.28488916C>T	ENSP00000454229:p.Cys413Tyr		Somatic	113	0	0		WXS	Illumina HiSeq	.	79	0.06	5	NM_001042432	260	0.16	42	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	ENST00000569430.1	37	CCDS10632.1	.	.	.	.	.	.	.	.	.	.	c	15.56	2.869189	0.51588	.	.	ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000357857;ENST00000395653;ENST00000357806	D;D;D;D;D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09	5.05	5.05	0.67936	Major facilitator superfamily domain, general substrate transporter (1);	0.221015	0.45606	D	0.000347	D	0.97648	0.9229	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;0.999;0.999	D;D;D;D;D;D;D;D	0.91635	0.987;0.998;0.999;0.999;0.972;0.977;0.982;0.982	D	0.97462	1.0035	10	0.40728	T	0.16	-10.3451	15.8954	0.79329	0.0:1.0:0.0:0.0	.	389;396;311;313;359;365;413;314	B4DXL3;Q13286-3;O95086;B4DMY6;B4DFF3;Q13286-2;Q13286;O95089	.;.;.;.;.;.;CLN3_HUMAN;.	Y	335;413;413;396;365;359;313;314	ENSP00000443221:C335Y;ENSP00000353073:C413Y;ENSP00000353116:C413Y;ENSP00000346650:C396Y;ENSP00000347660:C365Y;ENSP00000350523:C359Y;ENSP00000379014:C313Y;ENSP00000350457:C314Y	ENSP00000346650:C396Y	C	-	2	0	CLN3	28396417	1.000000	0.71417	0.968000	0.41197	0.269000	0.26545	4.560000	0.60802	2.345000	0.79718	0.561000	0.74099	TGC			0.622	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214115.2			
RABEP2	79874	broad.mit.edu	37	16	28935747	28935747	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:28935747G>A	ENST00000358201.4	-	2	839	c.251C>T	c.(250-252)gCc>gTc	p.A84V	RABEP2_ENST00000357573.6_Missense_Mutation_p.A84V|RABEP2_ENST00000544477.1_Intron|RABEP2_ENST00000561803.1_5'UTR	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	84					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CTGCAGCGAGGCCACCTCCTC	0.617																																					p.A84V	Pancreas(66;639 1284 10093 31061 49099)												.	RABEP2	48		0			c.C251T												49.0	52.0	51.0					16																	28935747		2116	4242	6358	SO:0001583	missense	79874	exon2			AGCGAGGCCACCT	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.251C>T	16.37:g.28935747G>A	ENSP00000350934:p.Ala84Val		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	69	0.04	3	NM_024816	22	0.00	0		Missense_Mutation	SNP	ENST00000358201.4	37	CCDS42140.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900400	0.72754	.	.	ENSG00000177548	ENST00000358201;ENST00000357573	T;T	0.53857	0.62;0.6	4.29	4.29	0.51040	Rabaptin coiled-coil domain (1);	0.137298	0.50627	D	0.000111	T	0.68769	0.3037	L	0.58810	1.83	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.83275	0.994;0.99;0.996	T	0.72740	-0.4202	10	0.66056	D	0.02	-10.845	15.91	0.79467	0.0:0.0:1.0:0.0	.	84;84;84	Q9H5N1-2;Q49AT6;Q9H5N1	.;.;RABE2_HUMAN	V	84	ENSP00000350934:A84V;ENSP00000350186:A84V	ENSP00000350186:A84V	A	-	2	0	RABEP2	28843248	1.000000	0.71417	0.975000	0.42487	0.963000	0.63663	5.750000	0.68712	2.106000	0.64143	0.555000	0.69702	GCC			0.617	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000432691.1		NM_024816	
ZNF319	57567	mdanderson.org	37	16	58031252	58031252	+	Silent	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:58031252C>T	ENST00000299237.2	-	2	1540	c.918G>A	c.(916-918)ccG>ccA	p.P306P	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						TTGGCGTGCACGGGTGCTGCA	0.672																																					p.P306P													.	.			0			c.G918A												34.0	34.0	34.0					16																	58031252		2198	4300	6498	SO:0001819	synonymous_variant	57567	exon2			CGTGCACGGGTGC	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.918G>A	16.37:g.58031252C>T			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_020807	4	0.00	0	Q52LH8	Silent	SNP	ENST00000299237.2	37	CCDS32462.1																																																																																					0.672	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430317.1			
RLTPR	146206	mdanderson.org	37	16	67681206	67681206	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:67681206T>A	ENST00000334583.6	+	10	1020	c.692T>A	c.(691-693)cTt>cAt	p.L231H	RLTPR_ENST00000545661.1_Missense_Mutation_p.L231H	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	231					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TCTCAGAGCCTTGAGGTCTCA	0.662																																					p.L231H													.	.			0			c.T692A												18.0	20.0	20.0					16																	67681206		2007	4188	6195	SO:0001583	missense	146206	exon10			AGAGCCTTGAGGT	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.692T>A	16.37:g.67681206T>A	ENSP00000334958:p.Leu231His		Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	86	0.05	4	NM_001013838	5	0.00	0	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.389315	0.61956	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.53640	0.61;0.61	5.15	5.15	0.70609	.	0.362060	0.26210	N	0.025693	T	0.43366	0.1244	N	0.11201	0.11	0.29599	N	0.847846	D;D	0.76494	0.999;0.999	P;P	0.61592	0.846;0.891	T	0.40059	-0.9583	10	0.44086	T	0.13	-6.0904	9.6606	0.39952	0.1655:0.0:0.0:0.8345	.	231;231	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	H	231	ENSP00000334958:L231H;ENSP00000441481:L231H	ENSP00000334958:L231H	L	+	2	0	RLTPR	66238707	0.958000	0.32768	1.000000	0.80357	0.979000	0.70002	1.942000	0.40243	1.938000	0.56188	0.460000	0.39030	CTT			0.662	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000467858.1		NM_001013838	
CIRH1A	84916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	69177275	69177275	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:69177275T>A	ENST00000314423.7	+	6	898	c.721T>A	c.(721-723)Tcc>Acc	p.S241T	CIRH1A_ENST00000563094.1_Missense_Mutation_p.S241T|CIRH1A_ENST00000352319.4_Missense_Mutation_p.S241T|CIRH1A_ENST00000569615.2_3'UTR			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	241					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		TGACGTGCAGTCCATTGCTGT	0.517																																					p.S241T	Melanoma(69;1156 1278 4951 8715 52012)												.	.			0			c.T721A												176.0	130.0	145.0					16																	69177275		2198	4300	6498	SO:0001583	missense	84916	exon6			GTGCAGTCCATTG	AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.721T>A	16.37:g.69177275T>A	ENSP00000327179:p.Ser241Thr		Somatic	135	0	0		WXS	Illumina HiSeq	.	95	0.11	10	NM_032830	164	0.24	39	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	ENST00000314423.7	37	CCDS10872.1	.	.	.	.	.	.	.	.	.	.	T	9.888	1.203331	0.22121	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.39406	1.38;1.08	5.51	4.35	0.52113	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.226657	0.46145	D	0.000315	T	0.47002	0.1422	L	0.58583	1.82	0.39857	D	0.973323	D;B;B	0.57571	0.98;0.038;0.264	P;B;B	0.49922	0.626;0.009;0.055	T	0.50841	-0.8780	10	0.45353	T	0.12	.	11.9312	0.52847	0.0:0.0:0.1453:0.8547	.	241;241;241	Q969X6-2;Q969X6;Q969X6-3	.;CIR1A_HUMAN;.	T	241	ENSP00000327179:S241T;ENSP00000339164:S241T	ENSP00000327179:S241T	S	+	1	0	CIRH1A	67734776	1.000000	0.71417	1.000000	0.80357	0.100000	0.18952	3.609000	0.54117	2.082000	0.62665	0.533000	0.62120	TCC			0.517	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268950.2		NM_032830	
BCAR1	9564	mdanderson.org	37	16	75276786	75276786	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:75276786G>A	ENST00000162330.5	-	2	341	c.215C>T	c.(214-216)gCa>gTa	p.A72V	BCAR1_ENST00000535626.2_Intron|BCAR1_ENST00000393422.2_Missense_Mutation_p.A90V|BCAR1_ENST00000420641.3_Missense_Mutation_p.A90V|BCAR1_ENST00000538440.2_Missense_Mutation_p.A72V|BCAR1_ENST00000393420.6_Missense_Mutation_p.A72V|BCAR1_ENST00000418647.3_Missense_Mutation_p.A118V|BCAR1_ENST00000546196.1_Missense_Mutation_p.A43V|BCAR1_ENST00000542031.2_Missense_Mutation_p.A70V	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	72					actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCCAGGCCCTGCTGGCTTCTT	0.701																																					p.A118V													.	.			0			c.C353T												22.0	24.0	23.0					16																	75276786		2196	4298	6494	SO:0001583	missense	9564	exon3			GGCCCTGCTGGCT	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.215C>T	16.37:g.75276786G>A	ENSP00000162330:p.Ala72Val		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_001170714	27	0.00	0	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	ENST00000162330.5	37	CCDS10915.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810308	0.32053	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	4.97	1.39	0.22231	Src homology-3 domain (1);	1.777890	0.03871	N	0.275664	T	0.50394	0.1613	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B;B;B	0.10296	0.0;0.002;0.003;0.001;0.0;0.003;0.0	B;B;B;B;B;B;B	0.10450	0.001;0.002;0.003;0.004;0.001;0.005;0.001	T	0.22871	-1.0204	10	0.14252	T	0.57	-3.896	7.1464	0.25585	0.1769:0.1787:0.6444:0.0	.	90;118;70;72;90;72;72	B4DIW5;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945	.;.;.;.;.;.;BCAR1_HUMAN	V	72;90;90;72;118;72;70;43	ENSP00000162330:A72V;ENSP00000377074:A90V;ENSP00000392708:A90V;ENSP00000443841:A72V;ENSP00000391669:A118V;ENSP00000377072:A72V;ENSP00000440415:A70V;ENSP00000442161:A43V	ENSP00000162330:A72V	A	-	2	0	BCAR1	73834287	0.943000	0.32029	0.331000	0.25455	0.858000	0.48976	1.563000	0.36364	0.598000	0.29829	0.655000	0.94253	GCA			0.701	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000269017.1		NM_014567	
ZC3H18	124245	mdanderson.org	37	16	88664702	88664702	+	Nonsense_Mutation	SNP	G	G	T	rs372349936		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr16:88664702G>T	ENST00000301011.5	+	4	1005	c.805G>T	c.(805-807)Gga>Tga	p.G269*	ZC3H18_ENST00000452588.2_Nonsense_Mutation_p.G293*	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	269	Pro-rich.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CCCGCCTCTCGGACCTCACCC	0.532																																					p.G269X	Ovarian(121;375 2276 20373 38669)												.	.			0			c.G805T												75.0	78.0	77.0					16																	88664702		2198	4300	6498	SO:0001587	stop_gained	124245	exon4			CCTCTCGGACCTC	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.805G>T	16.37:g.88664702G>T	ENSP00000301011:p.Gly269*		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_144604	70	0.00	0	Q96DG4|Q96MP7	Nonsense_Mutation	SNP	ENST00000301011.5	37	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	G	39	7.357789	0.98235	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588;ENST00000545404	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-20.2009	17.3362	0.87282	0.0:0.0:1.0:0.0	.	.	.	.	X	269;293;293;152	.	ENSP00000289509:G293X	G	+	1	0	ZC3H18	87192203	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	7.010000	0.76353	2.517000	0.84864	0.462000	0.41574	GGA			0.532	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000269168.1		NM_144604	
PIK3R5	23533	mdanderson.org	37	17	8808189	8808189	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr17:8808189G>A	ENST00000447110.1	-	5	441	c.317C>T	c.(316-318)gCc>gTc	p.A106V	PIK3R5_ENST00000581552.1_Missense_Mutation_p.A106V|PIK3R5_ENST00000584803.1_Missense_Mutation_p.A106V	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	106					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GTAGGTGCTGGCTGCCTTCAG	0.542																																					p.A106V	NSCLC(18;589 615 7696 20311 50332)												.	.			0			c.C317T												122.0	107.0	112.0					17																	8808189		2203	4300	6503	SO:0001583	missense	23533	exon5			GTGCTGGCTGCCT	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.317C>T	17.37:g.8808189G>A	ENSP00000392812:p.Ala106Val		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001142633	13	0.00	0	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	37	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089398	0.36855	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T;T	0.77750	-1.12;-1.12	4.75	4.75	0.60458	.	0.573503	0.18393	N	0.142599	T	0.63640	0.2528	N	0.24115	0.695	0.26216	N	0.979239	B	0.13145	0.007	B	0.23018	0.043	T	0.49041	-0.8980	10	0.20046	T	0.44	-11.9387	10.6228	0.45489	0.0916:0.0:0.9084:0.0	.	106	Q8WYR1	PI3R5_HUMAN	V	106	ENSP00000269300:A106V;ENSP00000392812:A106V	ENSP00000269300:A106V	A	-	2	0	PIK3R5	8748914	0.949000	0.32298	1.000000	0.80357	0.991000	0.79684	1.972000	0.40540	2.369000	0.80426	0.644000	0.83932	GCC			0.542	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000227003.2		NM_014308	
FBXW10	10517	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	18681824	18681824	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr17:18681824T>A	ENST00000395665.4	+	14	2593	c.2372T>A	c.(2371-2373)tTg>tAg	p.L791*	TVP23B_ENST00000476139.1_5'Flank|TVP23B_ENST00000574226.1_5'Flank|FBXW10_ENST00000301938.4_Nonsense_Mutation_p.L738*|FBXW10_ENST00000308799.4_Nonsense_Mutation_p.L800*|TVP23B_ENST00000307767.8_5'Flank|FBXW10_ENST00000395667.1_Nonsense_Mutation_p.L790*			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	791										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						CAAGGACAATTGGAAACTCCT	0.393																																					p.L791X													.	FBXW10	82		0			c.T2372A												44.0	40.0	41.0					17																	18681824		2200	4298	6498	SO:0001587	stop_gained	10517	exon14			GACAATTGGAAAC	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.2372T>A	17.37:g.18681824T>A	ENSP00000379025:p.Leu791*		Somatic	426	0	0		WXS	Illumina HiSeq	Phase_I	313	0.09	28	NM_001267585	0		0	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Nonsense_Mutation	SNP	ENST00000395665.4	37	CCDS11199.3	.	.	.	.	.	.	.	.	.	.	T	37	6.073034	0.97256	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	.	.	.	4.04	1.7	0.24286	.	0.858235	0.09076	U	0.852005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6697	0.17715	0.0:0.2413:0.0:0.7587	.	.	.	.	X	790;800;738;791	.	ENSP00000306937:L738X	L	+	2	0	FBXW10	18622549	0.000000	0.05858	0.001000	0.08648	0.172000	0.22775	0.576000	0.23744	0.571000	0.29365	0.338000	0.21704	TTG			0.393	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000313531.2		NM_031456	
SLC5A10	125206	mdanderson.org	37	17	18880197	18880197	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr17:18880197G>T	ENST00000395645.3	+	9	895	c.877G>T	c.(877-879)Gac>Tac	p.D293Y	SLC5A10_ENST00000317977.6_Missense_Mutation_p.D210Y|SLC5A10_ENST00000395647.2_Missense_Mutation_p.D293Y|SLC5A10_ENST00000395642.1_Missense_Mutation_p.D210Y|FAM83G_ENST00000585154.2_Intron|FAM83G_ENST00000388995.6_Intron|FAM83G_ENST00000345041.4_Intron|SLC5A10_ENST00000395643.2_Missense_Mutation_p.D266Y|SLC5A10_ENST00000417251.2_Missense_Mutation_p.D293Y	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	293					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						GTCAGCCCGGGACCTGAACCA	0.612																																					p.D293Y													.	.			0			c.G877T												121.0	87.0	99.0					17																	18880197		2203	4300	6503	SO:0001583	missense	125206	exon9			GCCCGGGACCTGA		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.877G>T	17.37:g.18880197G>T	ENSP00000379007:p.Asp293Tyr		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001270649	2	0.00	0	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	ENST00000395645.3	37	CCDS42275.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246912	0.80024	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.91180	-2.8;-2.29;-2.8;-2.33;-2.23;-2.37	5.97	2.3	0.28687	.	0.202617	0.50627	D	0.000108	D	0.92361	0.7576	M	0.75447	2.3	0.80722	D	1	P;P;P;P;P	0.50617	0.88;0.855;0.88;0.855;0.937	P;P;P;P;P	0.56163	0.793;0.69;0.793;0.69;0.785	D	0.91420	0.5158	10	0.87932	D	0	.	8.9875	0.36003	0.5687:0.0:0.4313:0.0	.	293;266;293;293;210	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	Y	210;293;210;293;293;266	ENSP00000324346:D210Y;ENSP00000379008:D293Y;ENSP00000379004:D210Y;ENSP00000401875:D293Y;ENSP00000379007:D293Y;ENSP00000379005:D266Y	ENSP00000324346:D210Y	D	+	1	0	SLC5A10	18820922	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.452000	0.44961	0.700000	0.31782	0.655000	0.94253	GAC			0.612	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132129.2		NM_152351	
NOS2	4843	bcgsc.ca	37	17	26125770	26125770	+	Silent	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr17:26125770T>C	ENST00000313735.6	-	2	299	c.66A>G	c.(64-66)aaA>aaG	p.K22K		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	22					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TGTTGATGTCTTTTTCCCCAT	0.498																																					p.K22K													.	NOS2	113		0			c.A66G												246.0	226.0	233.0					17																	26125770		2203	4300	6503	SO:0001819	synonymous_variant	4843	exon2			GATGTCTTTTTCC	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.66A>G	17.37:g.26125770T>C			Somatic	188	0	0		WXS	Illumina HiSeq	Phase_1	165	0.04	6	NM_000625	0		0	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	ENST00000313735.6	37	CCDS11223.1																																																																																					0.498	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255597.1		NM_000625	
C17orf96	100170841	mdanderson.org	37	17	36830710	36830710	+	Silent	SNP	C	C	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr17:36830710C>A	ENST00000325814.5	-	1	477	c.39G>T	c.(37-39)ccG>ccT	p.P13P		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	13	Pro-rich.				neuron fate commitment (GO:0048663)												GCGGGGACGCCGGCACTGCCA	0.741																																					p.P13P													.	.			0			c.G39T												1.0	2.0	2.0					17																	36830710		431	1200	1631	SO:0001819	synonymous_variant	100170841	exon1			GGACGCCGGCACT		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.39G>T	17.37:g.36830710C>A			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_001130677	9	0.00	0		Silent	SNP	ENST00000325814.5	37	CCDS45661.1																																																																																					0.741	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255465.2		NM_001130677	
CDC27	996	hgsc.bcm.edu	37	17	45216115	45216115	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr17:45216115T>A	ENST00000066544.3	-	13	1787	c.1694A>T	c.(1693-1695)aAt>aTt	p.N565I	CDC27_ENST00000531206.1_Missense_Mutation_p.N571I|CDC27_ENST00000446365.2_Missense_Mutation_p.N504I|CDC27_ENST00000527547.1_Missense_Mutation_p.N564I	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	565					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.N565I(1)|p.N571I(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CTCTGGCGAATTTTTATCCAT	0.353																																					p.N571I													CDC27_ENST00000531206,NS,carcinoma,0,2	CDC27_ENST00000531206	0	2	2	Substitution - Missense(2)	ovary(2)	c.A1712T												50.0	55.0	54.0					17																	45216115		2201	4299	6500	SO:0001583	missense	996	exon13			GGCGAATTTTTAT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1694A>T	17.37:g.45216115T>A	ENSP00000066544:p.Asn565Ile		Somatic	54	0	0		WXS	Illumina HiSeq	.	74	0.05	4	NM_001114091	84	0.00	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271461	0.80469	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.62	5.62	0.85841	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.041764	0.85682	D	0.000000	T	0.53997	0.1831	L	0.58810	1.83	0.58432	D	0.999999	D;P;D;P	0.57257	0.979;0.952;0.978;0.914	P;P;P;B	0.56788	0.806;0.546;0.645;0.36	T	0.52019	-0.8631	10	0.37606	T	0.19	-4.6177	13.77	0.63019	0.0:0.0:0.0:1.0	.	504;564;571;565	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	I	565;571;504;564	ENSP00000066544:N565I;ENSP00000434614:N571I;ENSP00000392802:N504I;ENSP00000437339:N564I	ENSP00000066544:N565I	N	-	2	0	CDC27	42571114	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.893000	0.56243	2.141000	0.66446	0.528000	0.53228	AAT			0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			
ZNF407	55628	mdanderson.org	37	18	72775889	72775889	+	Missense_Mutation	SNP	G	G	T	rs201021175		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr18:72775889G>T	ENST00000299687.5	+	8	6212	c.6212G>T	c.(6211-6213)cGg>cTg	p.R2071L		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2071					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TCTCAGGAGCGGGCACAGGTG	0.662																																					p.R2071L													.	.			0			c.G6212T												39.0	47.0	44.0					18																	72775889		2111	4225	6336	SO:0001583	missense	55628	exon8			AGGAGCGGGCACA	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6212G>T	18.37:g.72775889G>T	ENSP00000299687:p.Arg2071Leu		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_017757	11	0.00	0	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.328845	0.41197	.	.	ENSG00000215421	ENST00000299687	T	0.14893	2.47	4.42	3.55	0.40652	.	.	.	.	.	T	0.23926	0.0579	M	0.67953	2.075	0.38495	D	0.948089	P	0.47106	0.89	B	0.43155	0.41	T	0.23119	-1.0197	9	0.87932	D	0	.	12.4837	0.55859	0.0823:0.0:0.9177:0.0	.	2071	Q9C0G0	ZN407_HUMAN	L	2071	ENSP00000299687:R2071L	ENSP00000299687:R2071L	R	+	2	0	ZNF407	70904877	0.240000	0.23847	0.094000	0.20943	0.853000	0.48598	0.579000	0.23788	-2.976000	0.00284	0.462000	0.41574	CGG			0.662	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444903.1		NM_017757	
DENND1C	79958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6476886	6476886	+	Silent	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:6476886G>T	ENST00000381480.2	-	10	772	c.660C>A	c.(658-660)acC>acA	p.T220T	DENND1C_ENST00000543576.1_Silent_p.T176T|DENND1C_ENST00000591030.1_5'Flank	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	220	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						GTTTGCTGGCGGTGAGCAGGA	0.697																																					p.T220T													.	.			0			c.C660A												25.0	29.0	28.0					19																	6476886		1944	4130	6074	SO:0001819	synonymous_variant	79958	exon10			GCTGGCGGTGAGC	AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.660C>A	19.37:g.6476886G>T			Somatic	60	0	0		WXS	Illumina HiSeq	.	50	0.12	6	NM_024898	11	0.00	0	B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Silent	SNP	ENST00000381480.2	37	CCDS45938.1																																																																																					0.697	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453332.2		NM_024898	
MCOLN1	57192	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	7593728	7593728	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:7593728C>T	ENST00000264079.6	+	9	1131	c.1006C>T	c.(1006-1008)Cgg>Tgg	p.R336W		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	336					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTTCATGTGGCGGCAGCGGGG	0.632																																					p.R336W													.	.			0			c.C1006T												52.0	49.0	50.0					19																	7593728		2203	4300	6503	SO:0001583	missense	57192	exon9			ATGTGGCGGCAGC	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.1006C>T	19.37:g.7593728C>T	ENSP00000264079:p.Arg336Trp		Somatic	181	0	0		WXS	Illumina HiSeq	.	225	0.04	10	NM_020533	111	0.09	10	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Missense_Mutation	SNP	ENST00000264079.6	37	CCDS12180.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049431	0.36181	.	.	ENSG00000090674	ENST00000264079;ENST00000394321	T	0.77098	-1.07	5.7	4.66	0.58398	.	0.809709	0.11885	N	0.520084	T	0.73257	0.3564	L	0.38175	1.15	0.29424	N	0.860337	D;P	0.62365	0.991;0.867	P;B	0.48334	0.574;0.258	T	0.69026	-0.5254	10	0.66056	D	0.02	.	9.1687	0.37067	0.0:0.8356:0.0:0.1644	.	301;336	Q9GZU1-2;Q9GZU1	.;MCLN1_HUMAN	W	336;301	ENSP00000264079:R336W	ENSP00000264079:R336W	R	+	1	2	MCOLN1	7499728	0.005000	0.15991	1.000000	0.80357	0.426000	0.31534	0.089000	0.15002	2.700000	0.92200	0.563000	0.77884	CGG			0.632	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458974.2		NM_020533	
ZNF559	84527	broad.mit.edu	37	19	9452580	9452580	+	Silent	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:9452580A>G	ENST00000393883.2	+	6	1101	c.453A>G	c.(451-453)caA>caG	p.Q151Q	ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000603380.1_Silent_p.Q151Q|ZNF177_ENST00000602738.1_Intron|ZNF177_ENST00000605471.1_Intron|ZNF559_ENST00000592504.1_3'UTR|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000587557.1_Silent_p.Q215Q|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF559_ENST00000585352.1_3'UTR|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000592896.1_3'UTR|ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000538743.1_Silent_p.Q71Q	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						ACTGTAATCAATGTGAAACAG	0.373																																					p.Q215Q													.	ZNF559	77		0			c.A645G												107.0	108.0	107.0					19																	9452580		2203	4300	6503	SO:0001819	synonymous_variant	84527	exon6			TAATCAATGTGAA	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.453A>G	19.37:g.9452580A>G			Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	98	0.03	3	NM_001202406	67	0.01	1	K7EMG6	Silent	SNP	ENST00000393883.2	37	CCDS12211.1																																																																																					0.373	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000449021.1		NM_032497	
HOOK2	29911	mdanderson.org	37	19	12878672	12878672	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:12878672G>T	ENST00000397668.3	-	13	1334	c.1261C>A	c.(1261-1263)Ctg>Atg	p.L421M	HOOK2_ENST00000589965.1_Intron|HOOK2_ENST00000264827.5_Missense_Mutation_p.L421M	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	421	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						GCGCAGCGCAGCTCCTCATTG	0.652																																					p.L421M													.	.			0			c.C1261A												22.0	27.0	25.0					19																	12878672		1921	4123	6044	SO:0001583	missense	29911	exon13			AGCGCAGCTCCTC	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1261C>A	19.37:g.12878672G>T	ENSP00000380785:p.Leu421Met		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001100176	23	0.00	0	O60562	Missense_Mutation	SNP	ENST00000397668.3	37	CCDS42508.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168284	0.78339	.	.	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.37584	1.19;1.19	5.61	3.47	0.39725	.	0.000000	0.64402	D	0.000001	T	0.62429	0.2427	M	0.86502	2.82	0.41162	D	0.986108	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.69826	-0.5040	10	0.87932	D	0	-18.9845	11.6042	0.51022	0.1501:0.0:0.8499:0.0	.	421;421	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	M	421	ENSP00000380785:L421M;ENSP00000264827:L421M	ENSP00000264827:L421M	L	-	1	2	HOOK2	12739672	1.000000	0.71417	0.999000	0.59377	0.729000	0.41735	5.084000	0.64462	1.389000	0.46526	0.558000	0.71614	CTG			0.652	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000451008.1		NM_013312	
ZNF506	440515	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	19906184	19906184	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:19906184T>G	ENST00000540806.2	-	4	600	c.512A>C	c.(511-513)aAa>aCa	p.K171T	CTC-559E9.6_ENST00000591884.1_RNA|CTC-559E9.4_ENST00000590274.1_lincRNA|ZNF506_ENST00000443905.2_Missense_Mutation_p.K171T|ZNF506_ENST00000450683.2_Missense_Mutation_p.K139T|CTC-559E9.6_ENST00000589657.1_RNA|ZNF506_ENST00000587461.1_Intron			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						TTTAAAAGATTTTTTTCCAGT	0.289																																					p.K171T													.	.			0			c.A512C												40.0	38.0	39.0					19																	19906184		1871	4125	5996	SO:0001583	missense	440515	exon4			AAAGATTTTTTTC	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.512A>C	19.37:g.19906184T>G	ENSP00000440625:p.Lys171Thr		Somatic	174	0	0		WXS	Illumina HiSeq	.	146	0.07	10	NM_001099269	23	0.30	7	B3KTH6	Missense_Mutation	SNP	ENST00000540806.2	37	CCDS42531.1	.	.	.	.	.	.	.	.	.	.	t	10.67	1.416871	0.25552	.	.	ENSG00000081665	ENST00000443905;ENST00000540806;ENST00000450683	T;T;T	0.21191	2.02;2.02;2.02	1.16	-2.32	0.06745	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37839	0.1018	M	0.82056	2.57	0.09310	N	1	D;D	0.69078	0.997;0.993	D;P	0.70935	0.971;0.79	T	0.24799	-1.0150	9	0.87932	D	0	.	2.2165	0.03961	0.2494:0.2165:0.0:0.5341	.	171;139	Q5JVG8;Q5JVG8-2	ZN506_HUMAN;.	T	171;171;139	ENSP00000393835:K171T;ENSP00000440625:K171T;ENSP00000408892:K139T	ENSP00000393835:K171T	K	-	2	0	ZNF506	19767184	0.151000	0.22747	0.001000	0.08648	0.003000	0.03518	0.356000	0.20181	-0.352000	0.08237	0.347000	0.21830	AAA			0.289	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000460794.1		XM_036218	
CAPNS1	826	broad.mit.edu	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	CAPNS1_ENST00000588780.1_Silent_p.G47G|CAPNS1_ENST00000587718.1_Silent_p.G47G|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000590874.1_Silent_p.G47G|CAPNS1_ENST00000588815.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					p.G47G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	CAPNS1	19		0			c.C141T																																									SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGTGGT	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			Somatic	123	0.0081300813	1		WXS	Illumina HiSeq	Phase_I	79	0.09	7	NM_001749	2	0.00	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																					0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
CYP2F2P	171427	bcgsc.ca	37	19	41324703	41324703	+	Intron	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:41324703C>T	ENST00000601627.1	+	1	119																											TCGATGTCCTCGGGCGCACCC	0.652																																					.													.	.			0			.																																									SO:0001627	intron_variant	171427	.			TGTCCTCGGGCGC																												ENST00000601627.1:c.119+17383C>T	19.37:g.41324703C>T			Somatic	139	0	0		WXS	Illumina HiSeq	Phase_1	98	0.12	12	.	7	0.00	0		RNA	SNP	ENST00000601627.1	37																																																																																						0.652	CTC-490E21.12-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding		OTTHUMT00000463921.1			
ERICH4	100170765	mdanderson.org	37	19	41949189	41949189	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:41949189A>T	ENST00000378187.2	+	1	127	c.115A>T	c.(115-117)Act>Tct	p.T39S		NM_001130514.1	NP_001123986.1	A6NGS2	ERIC4_HUMAN		39																	GACCCTCAGGACTGCAGGGGC	0.622																																					p.T39S													.	.			0			c.A115T												38.0	44.0	42.0					19																	41949189		692	1591	2283	SO:0001583	missense	100170765	exon1			CTCAGGACTGCAG																												ENST00000378187.2:c.115A>T	19.37:g.41949189A>T	ENSP00000367429:p.Thr39Ser		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001130514	0		0		Missense_Mutation	SNP	ENST00000378187.2	37	CCDS46085.1	.	.	.	.	.	.	.	.	.	.	A	0.602	-0.828497	0.02734	.	.	ENSG00000204978	ENST00000378187	.	.	.	4.77	1.37	0.22104	.	0.951590	0.08591	N	0.923085	T	0.09379	0.0231	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34030	-0.9845	9	0.02654	T	1	0.0671	3.7178	0.08445	0.1656:0.1873:0.0:0.647	.	39	A6NGS2	CS069_HUMAN	S	39	.	ENSP00000367429:T39S	T	+	1	0	C19orf69	46641029	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.119000	0.10676	-0.038000	0.13624	-0.542000	0.04241	ACT			0.622	C19orf69-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
CCDC8	83987	mdanderson.org	37	19	46915880	46915880	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:46915880G>T	ENST00000307522.3	-	1	961	c.188C>A	c.(187-189)aCc>aAc	p.T63N		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	63					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		CGGGTGCggggtgctcttctc	0.672																																					p.T63N													CCDC8,NS,carcinoma,+1,1	CCDC8	1	1	0			c.C188A												39.0	45.0	43.0					19																	46915880		2203	4300	6503	SO:0001583	missense	83987	exon1			TGCGGGGTGCTCT	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.188C>A	19.37:g.46915880G>T	ENSP00000303158:p.Thr63Asn		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_032040	20	0.00	0	Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420417	0.62622	.	.	ENSG00000169515	ENST00000307522;ENST00000540252	T	0.09255	3.0	4.42	2.3	0.28687	.	0.000000	0.41823	D	0.000820	T	0.19685	0.0473	M	0.64997	1.995	0.27363	N	0.955915	D	0.71674	0.998	D	0.66351	0.943	T	0.07290	-1.0780	10	0.15952	T	0.53	-18.014	5.9451	0.19213	0.2311:0.0:0.7689:0.0	.	63	Q9H0W5	CCDC8_HUMAN	N	63	ENSP00000303158:T63N	ENSP00000303158:T63N	T	-	2	0	CCDC8	51607720	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	2.073000	0.41519	1.155000	0.42497	0.585000	0.79938	ACC			0.672	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368598.1		NM_032040	
ZNF614	80110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52519423	52519423	+	Silent	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:52519423A>G	ENST00000270649.6	-	5	1972	c.1428T>C	c.(1426-1428)tgT>tgC	p.C476C	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TTCCTGTATGACATCTCTCAT	0.408																																					p.C476C													.	.			0			c.T1428C												150.0	137.0	141.0					19																	52519423		2203	4300	6503	SO:0001819	synonymous_variant	80110	exon5			TGTATGACATCTC	BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1428T>C	19.37:g.52519423A>G			Somatic	101	0	0		WXS	Illumina HiSeq	.	76	0.11	8	NM_025040	32	0.31	10	Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	37	CCDS12847.1																																																																																					0.408	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462407.1		NM_025040	
NLRP12	91662	bcgsc.ca	37	19	54313068	54313068	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:54313068G>T	ENST00000324134.6	-	3	2013	c.1845C>A	c.(1843-1845)agC>agA	p.S615R	NLRP12_ENST00000351894.4_Missense_Mutation_p.S615R|NLRP12_ENST00000391775.3_Missense_Mutation_p.S615R|NLRP12_ENST00000391773.1_Missense_Mutation_p.S615R|NLRP12_ENST00000354278.3_Missense_Mutation_p.S615R|NLRP12_ENST00000345770.5_Missense_Mutation_p.S615R|NLRP12_ENST00000535162.1_Missense_Mutation_p.S615R|NLRP12_ENST00000391772.1_Missense_Mutation_p.S615R	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	615					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CGTACAAGCAGCTGAAGAACT	0.567																																					p.Y615X													.	NLRP12	236		0			c.C1845A												88.0	86.0	86.0					19																	54313068		2203	4300	6503	SO:0001583	missense	91662	exon3			CAAGCAGCTGAAG	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1845C>A	19.37:g.54313068G>T	ENSP00000319377:p.Ser615Arg		Somatic	144	0.0069444444	1		WXS	Illumina HiSeq	Phase_1	117	0.05	6	NM_144687	138	0.00	0	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	9.506	1.104552	0.20632	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	4.05	1.68	0.24146	.	0.201691	0.25386	N	0.031052	T	0.76414	0.3984	L	0.60455	1.87	0.80722	D	1	D;P;P;P	0.56521	0.976;0.875;0.933;0.807	B;B;B;B	0.43990	0.438;0.307;0.307;0.328	T	0.71017	-0.4714	10	0.29301	T	0.29	.	6.1594	0.20356	0.1151:0.1911:0.6937:0.0	.	615;615;615;615	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	R	615	ENSP00000319377:S615R;ENSP00000438030:S615R;ENSP00000340473:S615R;ENSP00000346231:S615R;ENSP00000375655:S615R;ENSP00000375653:S615R;ENSP00000375652:S615R	ENSP00000319377:S615R	S	-	3	2	NLRP12	59004880	1.000000	0.71417	0.256000	0.24389	0.971000	0.66376	1.099000	0.31013	0.828000	0.34709	0.485000	0.47835	AGC			0.567	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000134340.1		NM_144687	
KIR3DL1	3811	mdanderson.org	37	19	55285080	55285080	+	Intron	SNP	C	C	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:55285080C>A	ENST00000538269.1	+	2	61				KIR2DL3_ENST00000434419.2_Intron|KIR2DL1_ENST00000336077.6_Silent_p.I122I|KIR2DL4_ENST00000396284.2_Intron|KIR2DL1_ENST00000291633.7_Silent_p.I122I|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		ACATCGTGATCATAGGTGAGA	0.517																																					p.I122I													.	.			0			c.C366A												191.0	173.0	179.0					19																	55285080		2175	4210	6385	SO:0001627	intron_variant	3802	exon3			CGTGATCATAGGT	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-43909C>A	19.37:g.55285080C>A			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_014218	0		0	O43473|Q14946|Q16541	Silent	SNP	ENST00000538269.1	37																																																																																						0.517	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_013289	
KIR3DL1	3811	broad.mit.edu;mdanderson.org	37	19	55329817	55329817	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:55329817C>T	ENST00000391728.4	+	3	151	c.118C>T	c.(118-120)Cct>Tct	p.P40S	KIR3DL1_ENST00000538269.1_Missense_Mutation_p.P40S|KIR3DL1_ENST00000358178.4_Intron|KIR3DL1_ENST00000541392.1_Missense_Mutation_p.P40S|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.P40S|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.P40S	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	40					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CGCTGTGGTGCCTCGAGGAGG	0.542																																					p.P40S													.	KIR3DL1	174		0			c.C118T												95.0	101.0	99.0					19																	55329817		2175	4125	6300	SO:0001583	missense	3811	exon3			GTGGTGCCTCGAG	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.118C>T	19.37:g.55329817C>T	ENSP00000375608:p.Pro40Ser		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_013289	1	0.00	0	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000391728.4	37	CCDS42621.1	.	.	.	.	.	.	.	.	.	.	C	5.460	0.269864	0.10349	.	.	ENSG00000167633	ENST00000402254;ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542	T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71	1.41	-1.68	0.08212	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.12433	0.0302	L	0.46157	1.445	0.09310	N	1	P;B	0.38048	0.616;0.096	B;B	0.41510	0.359;0.016	T	0.25293	-1.0136	9	0.37606	T	0.19	.	5.4331	0.16464	0.5829:0.417:0.0:0.0	.	40;40	F6QF33;P43629	.;KI3L1_HUMAN	S	40;40;40;18;40;40	ENSP00000384528:P40S;ENSP00000443350:P40S;ENSP00000442355:P40S;ENSP00000375608:P40S;ENSP00000326868:P40S	ENSP00000326868:P40S	P	+	1	0	KIR3DL1	60021629	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.803000	0.04540	-0.295000	0.08960	0.184000	0.17185	CCT			0.542	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000141238.1		NM_013289	
TMEM86B	255043	mdanderson.org	37	19	55739752	55739752	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:55739752G>T	ENST00000327042.4	-	2	627	c.105C>A	c.(103-105)taC>taA	p.Y35*	AC010327.2_ENST00000598855.1_3'UTR	NM_173804.4	NP_776165.3	Q8N661	TM86B_HUMAN	transmembrane protein 86B	35					ether lipid metabolic process (GO:0046485)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alkenylglycerophosphocholine hydrolase activity (GO:0047408)|alkenylglycerophosphoethanolamine hydrolase activity (GO:0047409)			skin(2)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0443)		AGAGGCAGAAGTACACGCAGC	0.642																																					p.Y35X													.	.			0			c.C105A												59.0	55.0	56.0					19																	55739752		2202	4300	6502	SO:0001587	stop_gained	255043	exon2			GCAGAAGTACACG	BC023000	CCDS12920.1	19q13.42	2011-07-12					3.3.2.2, 3.3.2.5		28448	protein-coding gene	gene with protein product						21515882	Standard	NM_173804		Approved	MGC30208	uc002qju.3	Q8N661		ENST00000327042.4:c.105C>A	19.37:g.55739752G>T	ENSP00000321038:p.Tyr35*		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_173804	8	0.00	0		Nonsense_Mutation	SNP	ENST00000327042.4	37	CCDS12920.1	.	.	.	.	.	.	.	.	.	.	.	40	8.167541	0.98686	.	.	ENSG00000180089	ENST00000327042	.	.	.	5.4	4.37	0.52481	.	0.071907	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4157	0.44320	0.1593:0.0:0.8407:0.0	.	.	.	.	X	35	.	ENSP00000321038:Y35X	Y	-	3	2	TMEM86B	60431564	1.000000	0.71417	0.999000	0.59377	0.615000	0.37417	2.958000	0.49145	1.440000	0.47531	0.655000	0.94253	TAC			0.642	TMEM86B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452659.1		NM_173804	
NAT14	57106	bcgsc.ca	37	19	55997853	55997853	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr19:55997853G>A	ENST00000205194.4	+	3	454	c.151G>A	c.(151-153)Gcc>Acc	p.A51T	NAT14_ENST00000591590.1_3'UTR|SSC5D_ENST00000587166.1_5'Flank|SSC5D_ENST00000389623.6_5'Flank|NAT14_ENST00000592719.1_Intron|NAT14_ENST00000587400.1_Intron	NM_020378.3	NP_065111.1	Q8WUY8	NAT14_HUMAN	N-acetyltransferase 14 (GCN5-related, putative)	51	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of transcription, DNA-templated (GO:0045893)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|N-acetyltransferase activity (GO:0008080)			central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0527)		CCTGGCGGCGGCCAGCAGCGG	0.731																																					p.A51T													.	NAT14	11		0			c.G151A												8.0	10.0	9.0					19																	55997853		2173	4238	6411	SO:0001583	missense	57106	exon3			GCGGCGGCCAGCA	AB055059	CCDS12926.1	19q13.42	2011-11-25	2008-09-24		ENSG00000090971	ENSG00000090971			28918	protein-coding gene	gene with protein product	"""K562 cells-derived leucine zipper-like protein 1"""		"""N-acetyltransferase 14"""			10873651	Standard	NM_020378		Approved	KLP1	uc002qle.2	Q8WUY8		ENST00000205194.4:c.151G>A	19.37:g.55997853G>A	ENSP00000205194:p.Ala51Thr		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_1	17	0.24	4	NM_020378	37	0.00	0	Q8TDY7|Q9NS72	Missense_Mutation	SNP	ENST00000205194.4	37	CCDS12926.1	.	.	.	.	.	.	.	.	.	.	.	18.40	3.616348	0.66672	.	.	ENSG00000090971	ENST00000205194	.	.	.	3.42	3.42	0.39159	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (1);	0.361525	0.25194	N	0.032435	T	0.38241	0.1033	N	0.22421	0.69	0.36276	D	0.855503	D	0.53885	0.963	P	0.47402	0.546	T	0.43442	-0.9391	9	0.30854	T	0.27	-40.4779	12.7437	0.57268	0.0:0.0:1.0:0.0	.	51	Q8WUY8	NAT14_HUMAN	T	51	.	ENSP00000205194:A51T	A	+	1	0	NAT14	60689665	0.084000	0.21492	0.918000	0.36340	0.862000	0.49288	1.205000	0.32308	1.928000	0.55862	0.491000	0.48974	GCC			0.731	NAT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453339.1		NM_020378	
TAF1B	9014	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	10016027	10016027	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:10016027T>A	ENST00000263663.5	+	7	775	c.587T>A	c.(586-588)gTt>gAt	p.V196D	TAF1B_ENST00000396242.3_Intron	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	196	N-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CTGGATGGAGTTGAATACTCA	0.398																																					p.V196D													.	.			0			c.T587A												201.0	179.0	186.0					2																	10016027		2203	4300	6503	SO:0001583	missense	9014	exon7			ATGGAGTTGAATA	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.587T>A	2.37:g.10016027T>A	ENSP00000263663:p.Val196Asp		Somatic	123	0	0		WXS	Illumina HiSeq	.	117	0.08	9	NM_005680	80	0.16	13	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	ENST00000263663.5	37	CCDS33143.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.114524	0.56505	.	.	ENSG00000115750	ENST00000263663	T	0.03358	3.96	5.72	5.72	0.89469	.	0.380247	0.29660	N	0.011523	T	0.11965	0.0291	M	0.62723	1.935	0.41513	D	0.988353	P;D	0.67145	0.93;0.996	B;D	0.63877	0.383;0.919	T	0.01468	-1.1347	9	.	.	.	-15.7524	8.5514	0.33453	0.0:0.0857:0.0:0.9143	.	196;196	Q53T94;Q53T94-2	TAF1B_HUMAN;.	D	196	ENSP00000263663:V196D	.	V	+	2	0	TAF1B	9933478	0.721000	0.28007	0.407000	0.26434	0.985000	0.73830	2.279000	0.43435	2.184000	0.69523	0.533000	0.62120	GTT			0.398	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323426.2		NM_005680	
GDF7	151449	mdanderson.org	37	2	20870822	20870822	+	Silent	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:20870822G>T	ENST00000272224.3	+	2	1566	c.990G>T	c.(988-990)gcG>gcT	p.A330A		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	330				A -> S (in Ref. 1; AAP97720). {ECO:0000305}.	activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGCGGACAGCGCAGGGCAgcg	0.766																																					p.A330A													.	.			0			c.G990T												2.0	2.0	2.0					2																	20870822		949	2256	3205	SO:0001819	synonymous_variant	151449	exon2			GACAGCGCAGGGC	AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.990G>T	2.37:g.20870822G>T			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	28	0.07	2	NM_182828	0		0		Silent	SNP	ENST00000272224.3	37	CCDS1701.1																																																																																					0.766	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207563.2		NM_182828	
ALK	238	mdanderson.org	37	2	29754982	29754982	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:29754982C>T	ENST00000389048.3	-	4	1859	c.953G>A	c.(952-954)gGc>gAc	p.G318D	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	318	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GAGAAAGGAGCCTGGAAAGAG	0.517			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.G318D			yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.			0			c.G953A												97.0	89.0	91.0					2																	29754982		2203	4300	6503	SO:0001630	splice_region_variant	238	exon4	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	AAGGAGCCTGGAA	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.953-1G>A	2.37:g.29754982C>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_004304	0		0	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038315	0.75617	.	.	ENSG00000171094	ENST00000389048	T	0.31769	1.48	6.08	6.08	0.98989	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	.	.	.	.	T	0.35307	0.0927	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.25117	-1.0141	8	.	.	.	.	16.1635	0.81734	0.0:1.0:0.0:0.0	.	318	Q9UM73	ALK_HUMAN	D	318	ENSP00000373700:G318D	.	G	-	2	0	ALK	29608486	1.000000	0.71417	1.000000	0.80357	0.573000	0.36030	4.385000	0.59613	2.894000	0.99253	0.655000	0.94253	GGC			0.517	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324994.1		NM_004304	Missense_Mutation
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61566736	61566736	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:61566736T>C	ENST00000398571.2	-	17	2657	c.2581A>G	c.(2581-2583)Act>Gct	p.T861A		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	861					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CACAACAAAGTATTTCCTTTC	0.303																																					p.T861A													.	.			0			c.A2581G												88.0	79.0	82.0					2																	61566736		1818	4079	5897	SO:0001583	missense	9736	exon17			ACAAAGTATTTCC	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.2581A>G	2.37:g.61566736T>C	ENSP00000381577:p.Thr861Ala		Somatic	570	0	0		WXS	Illumina HiSeq	.	530	0.13	68	NM_014709	8	0.25	2	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	31	5.083212	0.94050	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.04809	3.55	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.17746	0.0426	L	0.57536	1.79	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.00069	-1.2137	10	0.66056	D	0.02	.	15.9446	0.79784	0.0:0.0:0.0:1.0	.	861	Q70CQ2	UBP34_HUMAN	A	709;709;861	ENSP00000381577:T861A	ENSP00000263989:T709A	T	-	1	0	USP34	61420240	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.040000	0.89188	2.171000	0.68590	0.377000	0.23210	ACT			0.303	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325650.4			
ETAA1	54465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	67630985	67630985	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:67630985C>T	ENST00000272342.5	+	5	1301	c.1171C>T	c.(1171-1173)Cct>Tct	p.P391S	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	391						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						AGGTAGTGAACCTTTTGCTAT	0.353																																					p.P391S													.	.			0			c.C1171T												94.0	98.0	97.0					2																	67630985		2203	4297	6500	SO:0001583	missense	54465	exon5			AGTGAACCTTTTG	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1171C>T	2.37:g.67630985C>T	ENSP00000272342:p.Pro391Ser		Somatic	328	0	0		WXS	Illumina HiSeq	.	212	0.13	28	NM_019002	16	0.19	3	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	C	2.293	-0.361886	0.05103	.	.	ENSG00000143971	ENST00000272342	T	0.17213	2.29	5.77	-1.45	0.08828	.	0.559219	0.19329	N	0.116926	T	0.07052	0.0179	L	0.31664	0.95	0.26351	N	0.977207	B	0.16603	0.018	B	0.16722	0.016	T	0.33189	-0.9878	10	0.07030	T	0.85	-20.1333	0.9169	0.01306	0.1497:0.2041:0.296:0.3502	.	391	Q9NY74	ETAA1_HUMAN	S	391	ENSP00000272342:P391S	ENSP00000272342:P391S	P	+	1	0	ETAA1	67484489	0.788000	0.28762	0.993000	0.49108	0.022000	0.10575	0.736000	0.26130	0.066000	0.16515	-0.844000	0.03045	CCT			0.353	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251735.1		NM_019002	
CNNM4	26504	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	97475063	97475063	+	Missense_Mutation	SNP	C	C	G	rs552453867		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:97475063C>G	ENST00000377075.2	+	7	2235	c.2137C>G	c.(2137-2139)Cgg>Ggg	p.R713G	CNNM4_ENST00000540067.1_Missense_Mutation_p.S229W|RP11-353K11.1_ENST00000608609.1_lincRNA	NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	713					biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						GCAGATCACTCGGCAGCAGTA	0.587																																					p.R713G													.	.			0			c.C2137G												58.0	53.0	55.0					2																	97475063		2203	4300	6503	SO:0001583	missense	26504	exon7			ATCACTCGGCAGC	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.2137C>G	2.37:g.97475063C>G	ENSP00000366275:p.Arg713Gly		Somatic	112	0	0		WXS	Illumina HiSeq	.	112	0.05	6	NM_020184	56	0.05	3	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	37	CCDS2024.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.69|17.69	3.451138|3.451138	0.63290|0.63290	.|.	.|.	ENSG00000158158|ENSG00000158158	ENST00000377075|ENST00000540067	T|.	0.37235|.	1.21|.	5.45|5.45	3.58|3.58	0.41010|0.41010	RmlC-like jelly roll fold (1);|.	0.066851|.	0.64402|.	N|.	0.000014|.	T|T	0.75752|0.75752	0.3892|0.3892	M|M	0.80332|0.80332	2.49|2.49	0.44221|0.44221	D|D	0.997051|0.997051	D|D	0.89917|0.61080	1.0|0.989	D|P	0.79784|0.60541	0.993|0.876	T|T	0.77453|0.77453	-0.2582|-0.2582	10|8	0.87932|0.66056	D|D	0|0.02	-24.2277|-24.2277	11.9741|11.9741	0.53081|0.53081	0.3245:0.6755:0.0:0.0|0.3245:0.6755:0.0:0.0	.|.	713|229	Q6P4Q7|B7Z1U0	CNNM4_HUMAN|.	G|W	713|229	ENSP00000366275:R713G|.	ENSP00000366275:R713G|ENSP00000444806:S229W	R|S	+|+	1|2	2|0	CNNM4|CNNM4	96838790|96838790	0.996000|0.996000	0.38824|0.38824	0.993000|0.993000	0.49108|0.49108	0.895000|0.895000	0.52256|0.52256	3.348000|3.348000	0.52209|0.52209	0.605000|0.605000	0.29947|0.29947	0.563000|0.563000	0.77884|0.77884	CGG|TCG			0.587	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252954.1		NM_020184	
GPR45	11250	broad.mit.edu;mdanderson.org	37	2	105858882	105858882	+	Silent	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:105858882C>T	ENST00000258456.1	+	1	683	c.567C>T	c.(565-567)ctC>ctT	p.L189L		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						ACACGGAGCTCCCCGCTGACC	0.687																																					p.L189L													GPR45,medulla,primitive_neuroectodermal_tumour-medulloblastoma,+2,1	GPR45	73	1	0			c.C567T												32.0	29.0	30.0					2																	105858882		2203	4300	6503	SO:0001819	synonymous_variant	11250	exon1			GGAGCTCCCCGCT	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.567C>T	2.37:g.105858882C>T			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_007227	0		0	Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	37	CCDS2066.1																																																																																					0.687	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253348.1		NM_007227	
ALPPL2	251	mdanderson.org	37	2	233274571	233274571	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:233274571A>T	ENST00000295453.3	+	11	1640	c.1588A>T	c.(1588-1590)Act>Tct	p.T530S		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	530					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	GGGGACGGCCACTGCTCCCTG	0.731																																					p.T530S													.	.			0			c.A1588T												7.0	7.0	7.0					2																	233274571		2164	4247	6411	SO:0001583	missense	251	exon11			ACGGCCACTGCTC	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1588A>T	2.37:g.233274571A>T	ENSP00000295453:p.Thr530Ser		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_031313	381	0.00	1	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	.	.	.	.	.	.	.	.	.	.	a	5.466	0.270956	0.10349	.	.	ENSG00000163286	ENST00000295453	D	0.95342	-3.68	1.79	-3.59	0.04583	.	5.079150	0.00447	N	0.000080	D	0.85885	0.5801	N	0.14661	0.345	0.09310	N	1	B	0.17465	0.022	B	0.06405	0.002	T	0.74830	-0.3531	10	0.30854	T	0.27	.	1.069	0.01617	0.326:0.2864:0.2517:0.1359	.	530	P10696	PPBN_HUMAN	S	530	ENSP00000295453:T530S	ENSP00000295453:T530S	T	+	1	0	ALPPL2	232982815	0.000000	0.05858	0.000000	0.03702	0.281000	0.26958	-3.111000	0.00599	-2.057000	0.00897	0.172000	0.16884	ACT			0.731	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257034.2		NM_031313	
ANO7	50636	mdanderson.org	37	2	242149033	242149033	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr2:242149033G>T	ENST00000274979.8	+	13	1607	c.1504G>T	c.(1504-1506)Gtg>Ttg	p.V502L	ANO7_ENST00000402430.3_Missense_Mutation_p.V501L	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	502					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GGCCGGCTCTGTGGTGATCGT	0.667																																					p.V502L													.	.			0			c.G1504T												53.0	55.0	55.0					2																	242149033		2203	4300	6503	SO:0001583	missense	50636	exon13			GGCTCTGTGGTGA	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1504G>T	2.37:g.242149033G>T	ENSP00000274979:p.Val502Leu		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001001891	0		0	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	G	0.107	-1.144043	0.01728	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.62498	0.02;0.02	3.09	-0.774	0.10991	.	0.652402	0.14269	N	0.330273	T	0.41396	0.1157	L	0.34521	1.04	0.25970	N	0.982513	B	0.09022	0.002	B	0.08055	0.003	T	0.24190	-1.0167	10	0.10902	T	0.67	.	6.4228	0.21754	0.689:0.0:0.311:0.0	.	502	Q6IWH7	ANO7_HUMAN	L	502;501	ENSP00000274979:V502L;ENSP00000385418:V501L	ENSP00000274979:V502L	V	+	1	0	ANO7	241797706	0.947000	0.32204	0.013000	0.15412	0.020000	0.10135	1.916000	0.39986	0.010000	0.14839	0.306000	0.20318	GTG			0.667	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323509.1		NM_001001891	
FTLP3	284764	bcgsc.ca	37	20	4004691	4004691	+	IGR	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004691C>T								RNF24 (8462 upstream) : RP11-352D3.2 (46107 downstream)																							CGCGATGATGCGGCTCTGGAA	0.602																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			ATGATGCGGCTCT																													20.37:g.4004691C>T			Somatic	76	0	0		WXS	Illumina HiSeq	Phase_1	85	0.14	12	.	77	0.79	61		RNA	SNP		37																																																																																					0	0.602										
FTLP3	284764	bcgsc.ca	37	20	4004726	4004726	+	IGR	SNP	T	T	C	rs57328861	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004726T>C								RNF24 (8497 upstream) : RP11-352D3.2 (46072 downstream)																							CTTCCGCGAATTGACCGAGGA	0.577																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			CGCGAATTGACCG																													20.37:g.4004726T>C			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_1	81	0.16	13	.	35	0.57	20		RNA	SNP		37																																																																																					0	0.577										
FTLP3	284764	bcgsc.ca	37	20	4004729	4004729	+	IGR	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004729A>G								RNF24 (8500 upstream) : RP11-352D3.2 (46069 downstream)																							CCGCGAATTGACCGAGGAGAA	0.577																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			GAATTGACCGAGG																													20.37:g.4004729A>G			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_1	81	0.17	14	.	35	0.77	27		RNA	SNP		37																																																																																					0	0.577										
FTLP3	284764	bcgsc.ca	37	20	4004848	4004848	+	IGR	SNP	T	T	C	rs11553193		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004848T>C								RNF24 (8619 upstream) : RP11-352D3.2 (45950 downstream)																							AAACCCCAGATGCCATGAAAG	0.557																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			CCCAGATGCCATG																													20.37:g.4004848T>C			Somatic	97	0	0		WXS	Illumina HiSeq	Phase_1	135	0.13	17	.	30	0.77	23		RNA	SNP		37																																																																																					0	0.557										
FTLP3	284764	bcgsc.ca	37	20	4004916	4004916	+	IGR	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004916A>G								RNF24 (8687 upstream) : RP11-352D3.2 (45882 downstream)																							CATGCCCTGGATTCTGCCCAC	0.527																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			CCCTGGATTCTGC																													20.37:g.4004916A>G			Somatic	102	0	0		WXS	Illumina HiSeq	Phase_1	114	0.10	11	.	27	0.89	24		RNA	SNP		37																																																																																					0	0.527										
FTLP3	284764	bcgsc.ca	37	20	4004925	4004925	+	IGR	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004925A>G								RNF24 (8696 upstream) : RP11-352D3.2 (45873 downstream)																							GATTCTGCCCACATGGACCCC	0.532																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			CTGCCCACATGGA																													20.37:g.4004925A>G			Somatic	103	0	0		WXS	Illumina HiSeq	Phase_1	105	0.10	11	.	15	0.80	12		RNA	SNP		37																																																																																					0	0.532										
FTLP3	284764	bcgsc.ca	37	20	4004928	4004928	+	IGR	SNP	T	T	C	rs11553211		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004928T>C								RNF24 (8699 upstream) : RP11-352D3.2 (45870 downstream)																							TCTGCCCACATGGACCCCCAT	0.537																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			CCCACATGGACCC																													20.37:g.4004928T>C			Somatic	103	0.0097087379	1		WXS	Illumina HiSeq	Phase_1	105	0.11	12	.	18	0.89	16		RNA	SNP		37																																																																																					0	0.537										
FTLP3	284764	bcgsc.ca	37	20	4004986	4004986	+	IGR	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:4004986C>T								RNF24 (8757 upstream) : RP11-352D3.2 (45812 downstream)																							AAGTGAAGCTCATCAAGAAGA	0.562																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284764	.			GAAGCTCATCAAG																													20.37:g.4004986C>T			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_1	67	0.09	6	.	16	0.81	13		RNA	SNP		37																																																																																					0	0.562										
ESF1	51575	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	13753234	13753234	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr20:13753234T>C	ENST00000202816.1	-	5	1284	c.1177A>G	c.(1177-1179)Agg>Ggg	p.R393G		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TCCTTCATCCTCTCCTTTCCA	0.348																																					p.R393G													.	ESF1	77		0			c.A1177G												155.0	147.0	150.0					20																	13753234		2203	4300	6503	SO:0001583	missense	51575	exon5			TCATCCTCTCCTT		CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1177A>G	20.37:g.13753234T>C	ENSP00000202816:p.Arg393Gly		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	95	0.06	6	NM_001276380	79	0.00	0	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	CCDS13117.1	.	.	.	.	.	.	.	.	.	.	T	19.83	3.899602	0.72754	.	.	ENSG00000089048	ENST00000202816	T	0.78246	-1.16	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.81470	0.4829	M	0.91038	3.17	0.80722	D	1	P	0.39665	0.682	B	0.32980	0.156	D	0.85829	0.1390	10	0.87932	D	0	-3.0613	15.9397	0.79745	0.0:0.0:0.0:1.0	.	393	Q9H501	ESF1_HUMAN	G	393	ENSP00000202816:R393G	ENSP00000202816:R393G	R	-	1	2	ESF1	13701234	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.432000	0.59922	2.223000	0.72356	0.528000	0.53228	AGG			0.348	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078049.1		NM_016649	
SLC19A1	6573	broad.mit.edu;ucsc.edu	37	21	46945796	46945796	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr21:46945796C>T	ENST00000311124.4	-	5	1380	c.1228G>A	c.(1228-1230)Gtc>Atc	p.V410I	SLC19A1_ENST00000485649.2_Missense_Mutation_p.V370I|SLC19A1_ENST00000380010.4_Missense_Mutation_p.V410I|SLC19A1_ENST00000567670.1_Missense_Mutation_p.V410I	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	410					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	ATGGTCTTGACGATGGTGGCA	0.582																																					p.V410I													.	SLC19A1	53		0			c.G1228A												141.0	125.0	131.0					21																	46945796		2203	4300	6503	SO:0001583	missense	6573	exon5			TCTTGACGATGGT	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.1228G>A	21.37:g.46945796C>T	ENSP00000308895:p.Val410Ile		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	56	0.09	5	NM_001205206	29	0.24	7	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000311124.4	37	CCDS13725.1	.	.	.	.	.	.	.	.	.	.	C	8.580	0.882172	0.17467	.	.	ENSG00000173638	ENST00000380014;ENST00000311124;ENST00000380010;ENST00000485649	D;D;D	0.84370	-1.84;-1.84;-1.84	4.51	2.62	0.31277	Major facilitator superfamily domain, general substrate transporter (1);	0.528936	0.17732	N	0.163844	T	0.65249	0.2673	N	0.04297	-0.235	0.31936	N	0.61157	P;P;P;P	0.40431	0.568;0.568;0.717;0.568	B;B;B;B	0.37451	0.188;0.188;0.25;0.188	T	0.67233	-0.5722	10	0.27082	T	0.32	-27.2649	8.1814	0.31313	0.0926:0.192:0.7153:0.0	.	370;432;410;410	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	I	157;410;410;370	ENSP00000308895:V410I;ENSP00000369347:V410I;ENSP00000441772:V370I	ENSP00000308895:V410I	V	-	1	0	SLC19A1	45770224	0.995000	0.38212	0.526000	0.27913	0.013000	0.08279	2.250000	0.43178	0.980000	0.38523	-0.211000	0.12701	GTC			0.582	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206796.1			
TPST2	8459	broad.mit.edu	37	22	26937214	26937214	+	Missense_Mutation	SNP	A	A	C	rs200758682		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr22:26937214A>C	ENST00000338754.4	-	3	653	c.383T>G	c.(382-384)gTg>gGg	p.V128G	TPST2_ENST00000398110.2_Missense_Mutation_p.V128G|TPST2_ENST00000403880.1_Missense_Mutation_p.V128G	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	128					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)	p.V128G(1)		central_nervous_system(1)|large_intestine(1)|lung(5)	7						CTCATCCGTCACCCCCGCCTC	0.672																																					p.V128G													TPST2,NS,carcinoma,0,1	TPST2	23	1	1	Substitution - Missense(1)	lung(1)	c.T383G												34.0	28.0	30.0					22																	26937214		2201	4298	6499	SO:0001583	missense	8459	exon3			TCCGTCACCCCCG	AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.383T>G	22.37:g.26937214A>C	ENSP00000339813:p.Val128Gly		Somatic	68	0.1911764706	13		WXS	Illumina HiSeq	Phase_I	55	0.24	13	NM_001008566	344	0.17	58	B3KQA7|Q6FI98|Q9H0V4	Missense_Mutation	SNP	ENST00000338754.4	37	CCDS13839.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.681749	0.47991	.	.	ENSG00000128294	ENST00000338754;ENST00000398110;ENST00000403880;ENST00000528868;ENST00000442495	.	.	.	5.33	5.33	0.75918	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000003	T	0.78685	0.4322	M	0.79475	2.455	0.80722	D	1	D	0.64830	0.994	D	0.74674	0.984	T	0.80939	-0.1158	9	0.56958	D	0.05	-31.6206	14.4823	0.67592	1.0:0.0:0.0:0.0	.	128	O60704	TPST2_HUMAN	G	128;128;128;61;128	.	ENSP00000339813:V128G	V	-	2	0	TPST2	25267214	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	6.838000	0.75359	2.023000	0.59567	0.496000	0.49642	GTG			0.672	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320820.3		NM_003595	
DNAJB7	150353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41257722	41257722	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr22:41257722G>T	ENST00000307221.4	-	1	408	c.277C>A	c.(277-279)Cca>Aca	p.P93T	XPNPEP3_ENST00000544094.1_5'Flank|XPNPEP3_ENST00000357137.4_Intron|XPNPEP3_ENST00000414396.1_Intron|XPNPEP3_ENST00000541156.1_Intron|XPNPEP3_ENST00000482652.1_3'UTR	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	93							chaperone binding (GO:0051087)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						ACATCATCTGGCTTATGGAAT	0.383																																					p.P93T													.	.			0			c.C277A												112.0	111.0	111.0					22																	41257722		2203	4300	6503	SO:0001583	missense	150353	exon1			CATCTGGCTTATG	AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.277C>A	22.37:g.41257722G>T	ENSP00000307197:p.Pro93Thr		Somatic	163	0	0		WXS	Illumina HiSeq	.	159	0.10	16	NM_145174	15	0.07	1	Q2M220|Q5H904|Q8WYJ7	Missense_Mutation	SNP	ENST00000307221.4	37	CCDS14008.1	.	.	.	.	.	.	.	.	.	.	G	8.011	0.757530	0.15846	.	.	ENSG00000172404	ENST00000307221	T	0.79554	-1.28	4.7	1.4	0.22301	.	0.233115	0.28527	N	0.015023	T	0.80944	0.4721	M	0.89840	3.065	0.80722	D	1	P	0.41524	0.753	B	0.41332	0.354	T	0.78334	-0.2244	10	0.87932	D	0	.	4.6556	0.12615	0.0877:0.1563:0.6051:0.1508	.	93	Q7Z6W7	DNJB7_HUMAN	T	93	ENSP00000307197:P93T	ENSP00000307197:P93T	P	-	1	0	DNAJB7	39587668	0.995000	0.38212	0.874000	0.34290	0.014000	0.08584	2.630000	0.46494	0.422000	0.26005	0.591000	0.81541	CCA			0.383	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321765.1		NM_145174	
DENND6B	414918	mdanderson.org	37	22	50756391	50756391	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr22:50756391G>T	ENST00000413817.3	-	4	389	c.318C>A	c.(316-318)agC>agA	p.S106R	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	106					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										CATGCCAGGGGCTCCTCTGCC	0.662																																					p.S106R													.	.			0			c.C318A												47.0	54.0	52.0					22																	50756391		2084	4215	6299	SO:0001583	missense	414918	exon4			CCAGGGGCTCCTC	AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.318C>A	22.37:g.50756391G>T	ENSP00000391524:p.Ser106Arg		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001001794	3	0.00	0	A6X8I5	Missense_Mutation	SNP	ENST00000413817.3	37	CCDS46732.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.47|14.47	2.543643|2.543643	0.45280|0.45280	.|.	.|.	ENSG00000205593|ENSG00000205593	ENST00000433760|ENST00000413817	.|.	.|.	.|.	4.67|4.67	3.65|3.65	0.41850|0.41850	.|.	.|0.317212	.|0.36555	.|N	.|0.002521	T|T	0.42899|0.42899	0.1223|0.1223	L|L	0.55834|0.55834	1.745|1.745	0.50171|0.50171	D|D	0.999859|0.999859	.|B;P	.|0.38642	.|0.337;0.641	.|B;B	.|0.36030	.|0.1;0.216	T|T	0.22765|0.22765	-1.0207|-1.0207	5|9	.|0.14656	.|T	.|0.56	-8.2084|-8.2084	10.736|10.736	0.46126|0.46126	0.0953:0.0:0.9047:0.0|0.0953:0.0:0.9047:0.0	.|.	.|106;106	.|Q8NEG7;C9JIV6	.|F116B_HUMAN;.	D|R	78|106	.|.	.|ENSP00000391524:S106R	A|S	-|-	2|3	0|2	FAM116B|FAM116B	49098963|49098963	0.988000|0.988000	0.35896|0.35896	0.995000|0.995000	0.50966|0.50966	0.810000|0.810000	0.45777|0.45777	1.484000|1.484000	0.35508|0.35508	1.070000|1.070000	0.40811|0.40811	0.313000|0.313000	0.20887|0.20887	GCC|AGC			0.662	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316845.3		NM_001001794	
SETD5	55209	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	9495475	9495475	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr3:9495475C>A	ENST00000406341.1	+	16	2589	c.2399C>A	c.(2398-2400)cCc>cAc	p.P800H	SETD5_ENST00000402198.1_Missense_Mutation_p.P800H|SETD5_ENST00000402466.1_Missense_Mutation_p.P702H|SETD5_ENST00000302463.6_Missense_Mutation_p.P702H|SETD5_ENST00000407969.1_Missense_Mutation_p.P819H|SETD5_ENST00000488236.1_3'UTR			Q9C0A6	SETD5_HUMAN	SET domain containing 5	800										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TCATCTGTACCCCAAGAGACT	0.363																																					p.P800H													SETD5_ENST00000402198,NS,carcinoma,+1,2	SETD5_ENST00000402198	1	2	0			c.C2399A												118.0	116.0	116.0					3																	9495475		1878	4102	5980	SO:0001583	missense	55209	exon17			CTGTACCCCAAGA	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.2399C>A	3.37:g.9495475C>A	ENSP00000383939:p.Pro800His		Somatic	236	0	0		WXS	Illumina HiSeq	.	245	0.04	11	NM_001080517	116	0.09	10	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969826	0.74246	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.93189	-2.84;-3.18;-2.84;-2.81;-3.18	5.52	4.64	0.57946	.	0.178095	0.51477	D	0.000093	D	0.93569	0.7947	L	0.29908	0.895	0.34967	D	0.752745	D;P;P;P	0.63880	0.993;0.915;0.698;0.708	P;P;B;B	0.62649	0.905;0.717;0.286;0.428	D	0.96600	0.9444	10	0.87932	D	0	-3.3143	14.7612	0.69607	0.0:0.9303:0.0:0.0697	.	469;702;800;819	B3KXG4;Q9C0A6-3;Q9C0A6;E7EWN3	.;.;SETD5_HUMAN;.	H	800;702;800;819;702	ENSP00000385852:P800H;ENSP00000384429:P702H;ENSP00000383939:P800H;ENSP00000384114:P819H;ENSP00000302028:P702H	ENSP00000302028:P702H	P	+	2	0	SETD5	9470475	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.897000	0.48664	1.468000	0.48064	0.655000	0.94253	CCC			0.363	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318425.1		XM_371614	
FLNB	2317	broad.mit.edu	37	3	58116558	58116558	+	Missense_Mutation	SNP	G	G	A	rs199590811		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr3:58116558G>A	ENST00000295956.4	+	25	4478	c.4313G>A	c.(4312-4314)cGt>cAt	p.R1438H	FLNB_ENST00000490882.1_Missense_Mutation_p.R1438H|FLNB_ENST00000357272.4_Missense_Mutation_p.R1438H|FLNB_ENST00000348383.5_Missense_Mutation_p.R1438H|FLNB_ENST00000429972.2_Missense_Mutation_p.R1438H|FLNB_ENST00000358537.3_Missense_Mutation_p.R1438H|FLNB_ENST00000493452.1_Missense_Mutation_p.R1269H|FLNB_ENST00000419752.2_Missense_Mutation_p.R1269H	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1438	Interaction with FBLP1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GTCCGAGCCCGTGTCCTGCAG	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17115	0.0		0.0	False		,,,				2504	0.0				p.R1438H													.	FLNB	430		0			c.G4313A												32.0	31.0	32.0					3																	58116558		2203	4300	6503	SO:0001583	missense	2317	exon25			GAGCCCGTGTCCT	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.4313G>A	3.37:g.58116558G>A	ENSP00000295956:p.Arg1438His		Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	241	0.02	4	NM_001457	229	0.00	0	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.37	1.618312	0.28801	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	T;T;D;T;T;T;D;T	0.91792	-0.57;-0.57;-2.91;-0.57;-0.57;-0.57;-2.91;-0.57	5.51	-1.08	0.09936	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.484748	0.24671	N	0.036558	T	0.74168	0.3681	N	0.01417	-0.88	0.21697	N	0.99959	B;B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.001;0.002;0.001;0.001;0.002;0.002	T	0.65335	-0.6193	10	0.27082	T	0.32	.	10.5426	0.45041	0.6373:0.0:0.3627:0.0	.	1438;1438;1269;1269;1438;1438	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	H	1438;1438;1438;1438;1438;1438;1269;1269	ENSP00000295956:R1438H;ENSP00000420213:R1438H;ENSP00000351339:R1438H;ENSP00000415599:R1438H;ENSP00000232447:R1438H;ENSP00000349819:R1438H;ENSP00000418510:R1269H;ENSP00000414532:R1269H	ENSP00000295956:R1438H	R	+	2	0	FLNB	58091598	0.108000	0.22018	0.005000	0.12908	0.650000	0.38633	1.931000	0.40134	-0.142000	0.11354	0.655000	0.94253	CGT			0.642	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000353569.1		NM_001457	
LSAMP	4045	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	115738431	115738431	+	Missense_Mutation	SNP	C	C	T	rs143751711		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr3:115738431C>T	ENST00000490035.2	-	3	944	c.445G>A	c.(445-447)Gtg>Atg	p.V149M	LSAMP_ENST00000539563.1_Missense_Mutation_p.V146M|LSAMP_ENST00000498645.1_5'UTR	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	149	Ig-like C2-type 2.				cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.V149M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		ACCAGAGTCACGTTGCTGCCC	0.473																																					p.V149M													LSAMP,NS,carcinoma,0,1	LSAMP	62	1	1	Substitution - Missense(1)	breast(1)	c.G445A							C	MET/VAL	0,4406		0,0,2203	173.0	132.0	146.0		445	5.9	1.0	3	dbSNP_134	146	1,8599	1.2+/-3.3	0,1,4299	no	missense	LSAMP	NM_002338.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	149/339	115738431	1,13005	2203	4300	6503	SO:0001583	missense	4045	exon3			GAGTCACGTTGCT	U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.445G>A	3.37:g.115738431C>T	ENSP00000419000:p.Val149Met		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	76	0.08	6	NM_002338	8	0.25	2	Q8IV49	Missense_Mutation	SNP	ENST00000490035.2	37	CCDS2982.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.655928	0.88056	0.0	1.16E-4	ENSG00000185565	ENST00000333617;ENST00000490035;ENST00000539563;ENST00000474851	T;T;T;D	0.84800	0.72;0.72;0.72;-1.9	5.92	5.92	0.95590	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93167	0.7824	M	0.81179	2.53	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.91635	0.999;0.883	D	0.93127	0.6530	10	0.87932	D	0	-9.3573	20.3248	0.98698	0.0:1.0:0.0:0.0	.	149;149	B2RCU8;Q13449	.;LSAMP_HUMAN	M	133;149;146;183	ENSP00000328455:V133M;ENSP00000419000:V149M;ENSP00000443429:V146M;ENSP00000418506:V183M	ENSP00000328455:V133M	V	-	1	0	LSAMP	117221121	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.621000	0.61233	2.818000	0.97014	0.655000	0.94253	GTG			0.473	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354495.4		NM_002338	
P2RY13	53829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	151045875	151045875	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr3:151045875T>G	ENST00000325602.5	-	2	988	c.969A>C	c.(967-969)aaA>aaC	p.K323N	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	323					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			TTTCTGTGAATTTTTTACATA	0.363																																					p.K323N													.	.			0			c.A969C												151.0	143.0	146.0					3																	151045875		2203	4300	6503	SO:0001583	missense	53829	exon2			TGTGAATTTTTTA	AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.969A>C	3.37:g.151045875T>G	ENSP00000320376:p.Lys323Asn		Somatic	165	0	0		WXS	Illumina HiSeq	.	99	0.21	21	NM_176894	1	0.00	0	B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Missense_Mutation	SNP	ENST00000325602.5	37	CCDS3158.2	.	.	.	.	.	.	.	.	.	.	T	9.830	1.188161	0.21954	.	.	ENSG00000181631	ENST00000325602	T	0.31510	1.49	5.81	-2.0	0.07433	.	0.493681	0.22695	N	0.056767	T	0.11367	0.0277	N	0.08118	0	0.20703	N	0.999861	B	0.06786	0.001	B	0.09377	0.004	T	0.10474	-1.0628	10	0.40728	T	0.16	-3.5636	3.9096	0.09197	0.1057:0.3827:0.1088:0.4027	.	323	Q9BPV8	P2Y13_HUMAN	N	323	ENSP00000320376:K323N	ENSP00000320376:K323N	K	-	3	2	P2RY13	152528565	0.014000	0.17966	0.574000	0.28523	0.919000	0.55068	-0.718000	0.04980	-0.348000	0.08286	-0.274000	0.10170	AAA			0.363	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341468.1		NM_023914	
NSUN7	79730	mdanderson.org	37	4	40778207	40778207	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr4:40778207G>A	ENST00000381782.2	+	7	1462	c.967G>A	c.(967-969)Gtg>Atg	p.V323M	NSUN7_ENST00000316607.5_Missense_Mutation_p.V323M	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	323							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						AAAAGTATTTGTGTGTGGAGT	0.318																																					p.V323M													.	.			0			c.G967A												87.0	92.0	90.0					4																	40778207		2203	4299	6502	SO:0001583	missense	79730	exon7			GTATTTGTGTGTG	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.967G>A	4.37:g.40778207G>A	ENSP00000371201:p.Val323Met		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	55	0.07	4	NM_024677	8	0.13	1	C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	ENST00000381782.2	37	CCDS3461.2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471438	0.84533	.	.	ENSG00000179299	ENST00000381782;ENST00000316607	T;T	0.09445	2.98;2.98	5.61	5.61	0.85477	.	0.061486	0.64402	D	0.000005	T	0.32315	0.0825	L	0.59436	1.845	0.53688	D	0.999971	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.986	T	0.00567	-1.1667	10	0.56958	D	0.05	-18.7922	19.2661	0.93985	0.0:0.0:1.0:0.0	.	323;323	Q8NE18;Q8NE18-2	NSUN7_HUMAN;.	M	323	ENSP00000371201:V323M;ENSP00000319127:V323M	ENSP00000319127:V323M	V	+	1	0	NSUN7	40472964	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.070000	0.76763	2.643000	0.89663	0.557000	0.71058	GTG			0.318	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250454.2		NM_024677	
PAICS	10606	broad.mit.edu	37	4	57316793	57316793	+	Silent	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr4:57316793G>T	ENST00000512576.1	+	6	857	c.696G>T	c.(694-696)cgG>cgT	p.R232R	PAICS_ENST00000514888.1_Silent_p.R140R|PAICS_ENST00000264221.2_Silent_p.R232R|PAICS_ENST00000399688.3_Silent_p.R239R	NM_001079524.1	NP_001072992.1	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	232	SAICAR synthetase.				'de novo' IMP biosynthetic process (GO:0006189)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|phosphoribosylaminoimidazole carboxylase activity (GO:0004638)|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity (GO:0004639)			endometrium(1)|kidney(2)|large_intestine(1)|urinary_tract(1)	5	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	AGTCTTATCGGGACCTCAAAG	0.373																																					p.R239R	GBM(53;429 1144 8755 40726)												.	PAICS	21		0			c.G717T												60.0	54.0	56.0					4																	57316793		1788	4045	5833	SO:0001819	synonymous_variant	10606	exon7			TTATCGGGACCTC	X53793	CCDS47060.1, CCDS47061.1	4q12	2012-07-13			ENSG00000128050	ENSG00000128050	4.1.1.21, 6.3.2.6		8587	protein-coding gene	gene with protein product		172439		PAIS		2253271, 8106516	Standard	NM_006452		Approved	ADE2H1, AIRC	uc003hbt.1	P22234	OTTHUMG00000160957	ENST00000512576.1:c.696G>T	4.37:g.57316793G>T			Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_001079525	761	0.00	0	E9PDH9|Q68CQ5	Silent	SNP	ENST00000512576.1	37	CCDS47061.1																																																																																					0.373	PAICS-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363136.2		NM_006452	
ALB	213	hgsc.bcm.edu;bcgsc.ca	37	4	74283804	74283804	+	Splice_Site	SNP	G	G	T	rs77256214		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr4:74283804G>T	ENST00000503124.1	+	10	1185		c.e10-1		ALB_ENST00000295897.4_Splice_Site|ALB_ENST00000509063.1_Splice_Site|ALB_ENST00000505649.1_Splice_Site|ALB_ENST00000415165.2_Splice_Site|ALB_ENST00000401494.3_Splice_Site			Q8TES7	FBF1_HUMAN	albumin						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGTTCTTTAGCTATCCGTGG	0.438											OREG0007698	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=ALB|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									.													.	.			0			c.1429-1G>T												60.0	59.0	59.0					4																	74283804		2203	4300	6503	SO:0001630	splice_region_variant	213	exon12			TCTTTAGCTATCC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.979-1G>T	4.37:g.74283804G>T			Somatic	107	0	0	1151	WXS	Illumina HiSeq	.	87	0.20	17	NM_000477	0		0	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Splice_Site	SNP	ENST00000503124.1	37		.	.	.	.	.	.	.	.	.	.	G	10.62	1.401899	0.25291	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202;ENST00000511370	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5909	0.91212	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALB	74502668	1.000000	0.71417	0.940000	0.37924	0.059000	0.15707	5.688000	0.68227	2.744000	0.94065	0.650000	0.86243	.			0.438	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000365419.1		NM_000477	Intron
IRX4	50805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	1879733	1879733	+	Silent	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:1879733C>T	ENST00000505790.1	-	5	1077	c.621G>A	c.(619-621)acG>acA	p.T207T	IRX4_ENST00000505938.1_5'UTR|IRX4_ENST00000513692.1_Silent_p.T207T|IRX4_ENST00000231357.2_Silent_p.T207T	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	207					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGGCGGCCACGTCATCTTGT	0.652																																					p.T207T													IRX4,colon,carcinoma,-1,1	IRX4	-1	1	0			c.G621A												70.0	62.0	64.0					5																	1879733		2203	4300	6503	SO:0001819	synonymous_variant	50805	exon4			CGGCCACGTCATC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.621G>A	5.37:g.1879733C>T			Somatic	117	0	0		WXS	Illumina HiSeq	.	111	0.10	11	NM_016358	61	0.11	7	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																					0.652	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365500.1		NM_016358	
IRX1	79192	broad.mit.edu	37	5	3600085	3600085	+	Silent	SNP	C	C	T	rs369355630		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:3600085C>T	ENST00000302006.3	+	2	1075	c.1023C>T	c.(1021-1023)ccC>ccT	p.P341P	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	341					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						cgggccaccccggcgcgcacg	0.721																																					p.P341P													.	IRX1	106		0			c.C1023T							C		1,3909		0,1,1954	6.0	6.0	6.0		1023	-3.0	0.0	5		6	0,7532		0,0,3766	no	coding-synonymous	IRX1	NM_024337.3		0,1,5720	TT,TC,CC		0.0,0.0256,0.0087		341/481	3600085	1,11441	1955	3766	5721	SO:0001819	synonymous_variant	79192	exon2			CCACCCCGGCGCG	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1023C>T	5.37:g.3600085C>T			Somatic	120	0.0083333333	1		WXS	Illumina HiSeq	Phase_I	89	0.08	7	NM_024337	11	0.00	0	Q7Z2F8|Q8N312	Silent	SNP	ENST00000302006.3	37	CCDS34132.1																																																																																					0.721	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365546.1		NM_024337	
CDH9	1007	broad.mit.edu	37	5	26881347	26881347	+	Silent	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:26881347G>T	ENST00000231021.4	-	12	2440	c.2268C>A	c.(2266-2268)ctC>ctA	p.L756L		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	756					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AATCAGCTGTGAGAGATTCCA	0.468																																					p.L756L	Melanoma(8;187 585 15745 40864 52829)												.	CDH9	305		0			c.C2268A												125.0	118.0	120.0					5																	26881347		2203	4300	6503	SO:0001819	synonymous_variant	1007	exon12			AGCTGTGAGAGAT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2268C>A	5.37:g.26881347G>T			Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	139	0.04	6	NM_016279	0		0	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1																																																																																					0.468	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207352.1		NM_016279	
CTD-2066L21.3	0	broad.mit.edu	37	5	33162312	33162312	+	lincRNA	SNP	C	C	A	rs540794656	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:33162312C>A	ENST00000510327.1	-	0	346																											CAACTGGCACCAGCGCCGCAA	0.547													A|||	2	0.000399361	0.0	0.0	5008	,	,		16124	0.0		0.002	False		,,,				2504	0.0				.													.	.			0			.																																											0	.			TGGCACCAGCGCC																													5.37:g.33162312C>A			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	.	787	0.93	733		RNA	SNP	ENST00000510327.1	37																																																																																						0.547	CTD-2066L21.3-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000366718.1			
CTD-2066L21.3	0	broad.mit.edu	37	5	33162430	33162430	+	lincRNA	SNP	A	A	G	rs548437212	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:33162430A>G	ENST00000510327.1	-	0	346																											GTCCGTGTGCAGGGAAGTAAC	0.542													A|||	2	0.000399361	0.0	0.0	5008	,	,		16548	0.0		0.002	False		,,,				2504	0.0				.													.	.			0			.																																											0	.			GTGTGCAGGGAAG																													5.37:g.33162430A>G			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	55	0.07	4	.	492	0.97	475		RNA	SNP	ENST00000510327.1	37																																																																																						0.542	CTD-2066L21.3-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000366718.1			
CTD-2066L21.3	0	broad.mit.edu	37	5	33162435	33162435	+	lincRNA	SNP	A	A	G	rs573754241	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:33162435A>G	ENST00000510327.1	-	0	346																											TGTGCAGGGAAGTAACAAGAA	0.537																																					.													.	.			0			.																																											0	.			CAGGGAAGTAACA																													5.37:g.33162435A>G			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	56	0.09	5	.	42	0.83	35		RNA	SNP	ENST00000510327.1	37																																																																																						0.537	CTD-2066L21.3-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000366718.1			
NNT	23530	broad.mit.edu	37	5	43613188	43613189	+	Frame_Shift_Ins	INS	-	-	G	rs200396139|rs149285174	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:43613188_43613189insG	ENST00000264663.5	+	3	551_552	c.330_331insG	c.(331-333)gccfs	p.A111fs	NNT_ENST00000344920.4_Frame_Shift_Ins_p.A111fs|NNT_ENST00000512996.2_5'UTR	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	111					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					GAGTGGCAGGTGCCCAAATCCA	0.46																																					p.G110fs													NNT,adrenal_gland,adrenal_cortical_adenoma,0,1	NNT	92	1	0			c.330_331insG																																									SO:0001589	frameshift_variant	23530	exon3			GGCAGGTGCCCAA	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.331dupG	5.37:g.43613189_43613189dupG	ENSP00000264663:p.Ala111fs		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	134	0.11	15	NM_012343	12	0.00	0	Q16796|Q2TB60|Q8N3V4	Frame_Shift_Ins	INS	ENST00000264663.5	37	CCDS3949.1																																																																																					0.460	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214026.1		NM_182977	
PCDHGA4	56111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140735836	140735836	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:140735836C>G	ENST00000571252.1	+	1	1069	c.1069C>G	c.(1069-1071)Cag>Gag	p.Q357E	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	357	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCTCAGTCCAGGAATCTTC	0.478																																					p.Q357E													.	.			0			c.C1069G												31.0	32.0	32.0					5																	140735836		1982	4143	6125	SO:0001583	missense	56111	exon1			TCAGTCCAGGAAT	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1069C>G	5.37:g.140735836C>G	ENSP00000458570:p.Gln357Glu		Somatic	114	0	0		WXS	Illumina HiSeq	.	73	0.16	12	NM_018917	2	0.00	0	Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																					0.478	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437959.1		NM_018917	
GEMIN5	25929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	154280995	154280995	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr5:154280995C>T	ENST00000285873.7	-	21	2993	c.2918G>A	c.(2917-2919)tGt>tAt	p.C973Y		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	973					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATCCTGAAAACACAGCTGTTT	0.418																																					p.C973Y													.	.			0			c.G2918A												112.0	111.0	111.0					5																	154280995		2203	4300	6503	SO:0001583	missense	25929	exon21			TGAAAACACAGCT	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.2918G>A	5.37:g.154280995C>T	ENSP00000285873:p.Cys973Tyr		Somatic	222	0	0		WXS	Illumina HiSeq	.	157	0.12	19	NM_015465	45	0.20	9	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795593	0.90453	.	.	ENSG00000082516	ENST00000285873	T	0.71222	-0.55	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.84683	0.5526	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	D	0.84811	0.0790	10	0.72032	D	0.01	-12.0261	20.3465	0.98790	0.0:1.0:0.0:0.0	.	972;973	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	Y	973	ENSP00000285873:C973Y	ENSP00000285873:C973Y	C	-	2	0	GEMIN5	154261188	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.231000	0.78106	2.798000	0.96311	0.655000	0.94253	TGT			0.418	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252507.1			
GCNT2	2651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	10586756	10586756	+	Intron	SNP	C	C	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:10586756C>G	ENST00000379597.3	+	2	1481				GCNT2_ENST00000316170.3_Intron|GCNT2_ENST00000265012.4_Silent_p.V178V|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000397423.2_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		AAGACCTTGTCGCCTCTGAGG	0.473																																					p.V178V													.	.			0			c.C534G												114.0	112.0	113.0					6																	10586756		2203	4300	6503	SO:0001627	intron_variant	2651	exon1			CCTTGTCGCCTCT	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.926-34828C>G	6.37:g.10586756C>G			Somatic	146	0	0		WXS	Illumina HiSeq	.	149	0.06	9	NM_145655	40	0.13	5		Silent	SNP	ENST00000379597.3	37	CCDS34338.1																																																																																					0.473	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000327912.3		NM_145649	
HIST1H2BF	8343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	26200084	26200084	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:26200084C>T	ENST00000359985.1	+	1	337	c.298C>T	c.(298-300)Cgc>Tgc	p.R100C	HIST1H3D_ENST00000356476.2_5'Flank|HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000377831.5_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	100					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				GACGGCCGTACGCCTGCTGCT	0.597																																					p.R100C													.	.			0			c.C298T												72.0	77.0	75.0					6																	26200084		2203	4300	6503	SO:0001583	missense	8343	exon1			GCCGTACGCCTGC	Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.298C>T	6.37:g.26200084C>T	ENSP00000353074:p.Arg100Cys		Somatic	75	0	0		WXS	Illumina HiSeq	.	86	0.06	5	NM_003522	0		0	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000359985.1	37	CCDS4592.1	.	.	.	.	.	.	.	.	.	.	.	15.31	2.795647	0.50208	.	.	ENSG00000197846	ENST00000359985	T	0.52754	0.65	3.79	3.79	0.43588	.	0.000000	0.51477	D	0.000100	T	0.51193	0.1660	.	.	.	0.41053	D	0.985313	.	.	.	.	.	.	T	0.54781	-0.8242	7	0.46703	T	0.11	.	15.479	0.75508	0.0:1.0:0.0:0.0	.	.	.	.	C	100	ENSP00000353074:R100C	ENSP00000353074:R100C	R	+	1	0	HIST1H2BF	26308063	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	3.118000	0.50414	2.043000	0.60533	0.650000	0.86243	CGC			0.597	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040108.1		NM_003522	
Unknown	0	hgsc.bcm.edu	37	6	29855800	29855800	+	IGR	SNP	T	T	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:29855800T>A								HLA-G (56898 upstream) : HLA-A (53236 downstream)																							CCGCTTCATCTCCGTCGGCTA	0.692																																					.													ENSG00000196306,right_lower_lobe,carcinoma,0,3	ENSG00000196306	0	3	0			.																																									SO:0001628	intergenic_variant	3136	.			TTCATCTCCGTCG																													6.37:g.29855800T>A			Somatic	82	0.0243902439	2		WXS	Illumina HiSeq	.	107	0.09	10	.	176	0.87	153		RNA	SNP		37																																																																																					0	0.692										
ZNRD1-AS1	80862	hgsc.bcm.edu	37	6	29977011	29977011	+	RNA	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:29977011A>G	ENST00000376797.3	-	0	731				HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		TTGGGAGCCCATGGGGGAGCT	0.542																																					.													.	.			0			.																																											3137	.			GAGCCCATGGGGG	AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29977011A>G			Somatic	108	0	0		WXS	Illumina HiSeq	.	87	0.21	18	.	1	0.00	0		RNA	SNP	ENST00000376797.3	37																																																																																						0.542	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	antisense		OTTHUMT00000253083.1		NR_026751	
MUC21	394263	mdanderson.org	37	6	30955233	30955233	+	Silent	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:30955233A>G	ENST00000376296.3	+	2	1522	c.1281A>G	c.(1279-1281)acA>acG	p.T427T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	427	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGTCCAGCACAACCTCCAGTG	0.592																																					p.T427T													.	.			0			c.A1281G												133.0	127.0	129.0					6																	30955233		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CAGCACAACCTCC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1281A>G	6.37:g.30955233A>G			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	98	0.05	5	NM_001010909	13	0.00	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																					0.592	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
FOXP4	116113	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41555161	41555161	+	Silent	SNP	G	G	C	rs375722090		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:41555161G>C	ENST00000307972.4	+	6	795	c.783G>C	c.(781-783)tcG>tcC	p.S261S	FOXP4_ENST00000373057.3_Silent_p.S259S|FOXP4_ENST00000373060.1_Silent_p.S261S|FOXP4_ENST00000373063.3_Silent_p.S260S|FOXP4_ENST00000409208.1_Silent_p.S261S			Q8IVH2	FOXP4_HUMAN	forkhead box P4	261					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					CCGCTACCTCGTTTGCCGCTC	0.682											OREG0004065	type=REGULATORY REGION|Gene=FOXP4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.S261S													.	FOXP4	83		0			c.G783C												70.0	73.0	72.0					6																	41555161		2203	4300	6503	SO:0001819	synonymous_variant	116113	exon7			TACCTCGTTTGCC	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.783G>C	6.37:g.41555161G>C			Somatic	167	0.005988024	1	902	WXS	Illumina HiSeq	Phase_I	286	0.03	10	NM_001012426	110	0.10	11	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Silent	SNP	ENST00000307972.4	37	CCDS34447.1																																																																																					0.682	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000106767.1	rescued with RNA-seq	NM_138457	
CUL9	23113	mdanderson.org	37	6	43194088	43194088	+	IGR	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:43194088A>G	ENST00000252050.4	+	0	7780				DNPH1_ENST00000230431.6_Missense_Mutation_p.L81P|DNPH1_ENST00000393987.2_Missense_Mutation_p.L81P|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9						microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CAGCCACTCCAGGTCCTGCTC	0.622																																					p.L81P													.	.			0			c.T242C												54.0	46.0	48.0					6																	43194088		2203	4300	6503	SO:0001628	intergenic_variant	10591	exon2			CACTCCAGGTCCT	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723		6.37:g.43194088A>G			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_199184	183	0.00	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	A	13.39	2.223573	0.39300	.	.	ENSG00000112667	ENST00000230431;ENST00000509253;ENST00000393987	.	.	.	4.3	3.12	0.35913	.	0.218454	0.30320	N	0.009900	T	0.58850	0.2151	M	0.67953	2.075	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.70016	0.952;0.967	T	0.62358	-0.6871	9	0.66056	D	0.02	-9.1691	6.5644	0.22503	0.89:0.0:0.11:0.0	.	81;81	O43598-2;O43598	.;RCL_HUMAN	P	81;150;81	.	ENSP00000230431:L81P	L	-	2	0	C6orf108	43302066	1.000000	0.71417	0.997000	0.53966	0.059000	0.15707	5.583000	0.67484	0.695000	0.31675	0.260000	0.18958	CTG			0.622	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040582.2		NM_015089	
UBE3D	90025	broad.mit.edu	37	6	83732269	83732269	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:83732269A>T	ENST00000369747.3	-	7	871	c.749T>A	c.(748-750)gTc>gAc	p.V250D		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	250	Interaction with UBE2C.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										CACGCTCTGGACAAACCAAGA	0.403																																					p.V250D													.	.			0			c.T749A												64.0	62.0	62.0					6																	83732269		2203	4300	6503	SO:0001583	missense	90025	exon7			CTCTGGACAAACC	AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.749T>A	6.37:g.83732269A>T	ENSP00000358762:p.Val250Asp		Somatic	295	0	0		WXS	Illumina HiSeq	Phase_I	223	0.04	8	NM_198920	12	0.00	0	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	37	CCDS34491.1	.	.	.	.	.	.	.	.	.	.	A	18.51	3.640516	0.67244	.	.	ENSG00000118420	ENST00000369747	T	0.32023	1.47	5.72	5.72	0.89469	.	0.200950	0.43110	D	0.000603	T	0.38241	0.1033	L	0.57536	1.79	0.80722	D	1	D;D	0.67145	0.996;0.995	D;D	0.66979	0.948;0.929	T	0.11155	-1.0599	10	0.28530	T	0.3	-16.2238	14.2382	0.65941	1.0:0.0:0.0:0.0	.	229;250	C9JRS1;Q7Z6J8	.;UB2CB_HUMAN	D	250	ENSP00000358762:V250D	ENSP00000358762:V250D	V	-	2	0	UBE2CBP	83788988	1.000000	0.71417	0.986000	0.45419	0.616000	0.37450	5.237000	0.65360	2.180000	0.69256	0.460000	0.39030	GTC			0.403	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041347.7		NM_198920	
GPR6	2830	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	110301311	110301311	+	Silent	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:110301311C>T	ENST00000275169.3	+	1	1014	c.996C>T	c.(994-996)cgC>cgT	p.R332R	GPR6_ENST00000414000.2_Silent_p.R347R	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		ATGCCTTCCGCAACCAGGAGA	0.612																																					p.R332R													GPR6,caecum,carcinoma,+1,1	GPR6	46	1	0			c.C996T												107.0	110.0	109.0					6																	110301311		2203	4300	6503	SO:0001819	synonymous_variant	0	exon1			CTTCCGCAACCAG		CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.996C>T	6.37:g.110301311C>T			Somatic	123	0.0081300813	1		WXS	Illumina HiSeq	Phase_I	84	0.10	8	NM_005284	1	0.00	0	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Silent	SNP	ENST00000275169.3	37	CCDS5079.1																																																																																					0.612	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041774.1			
SOGA3	387104	broad.mit.edu;mdanderson.org	37	6	127837119	127837119	+	Missense_Mutation	SNP	G	G	C	rs200377274		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:127837119G>C	ENST00000525778.1	-	2	1386	c.641C>G	c.(640-642)gCc>gGc	p.A214G	SOGA3_ENST00000481848.2_Missense_Mutation_p.A214G|SOGA3_ENST00000368268.2_Missense_Mutation_p.A214G|SOGA3_ENST00000556132.1_Missense_Mutation_p.A214G|SOGA3_ENST00000465909.2_Missense_Mutation_p.A214G			Q5TF21	SOGA3_HUMAN	SOGA family member 3	214	Gly-rich.				regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											AGAAGGGGAGGCCCCCTCCCC	0.741																																					p.A214G													.	.			0			c.C641G												7.0	9.0	8.0					6																	127837119		1663	3887	5550	SO:0001583	missense	387104	exon2			GGGGAGGCCCCCT	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.641C>G	6.37:g.127837119G>C	ENSP00000434570:p.Ala214Gly		Somatic	22	0.1363636364	3		WXS	Illumina HiSeq	Phase_I	32	0.31	10	NM_001012279	0		0		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440974	0.43326	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	3.69	1.84	0.25277	.	0.622559	0.13342	N	0.395072	T	0.07007	0.0178	N	0.08118	0	0.29173	N	0.876984	B	0.06786	0.001	B	0.04013	0.001	T	0.35226	-0.9797	10	0.27082	T	0.32	-3.1076	5.5157	0.16906	0.3774:0.0:0.6226:0.0	.	214	Q5TF21	CF174_HUMAN	G	214	ENSP00000451768:A214G;ENSP00000357251:A214G;ENSP00000434570:A214G;ENSP00000435559:A214G	ENSP00000435559:A214G	A	-	2	0	C6orf174	127878812	0.944000	0.32072	1.000000	0.80357	0.994000	0.84299	1.068000	0.30629	0.326000	0.23384	0.561000	0.74099	GCC			0.741	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388246.1		NM_001012279	
LAMA2	3908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	129204396	129204396	+	Silent	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:129204396G>A	ENST00000421865.2	+	1	55	c.6G>A	c.(4-6)ccG>ccA	p.P2P		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CTACGATGCCGGGAGCCGCCG	0.706																																					p.P2P													.	.			0			c.G6A												6.0	8.0	7.0					6																	129204396		2134	4178	6312	SO:0001819	synonymous_variant	3908	exon1			GATGCCGGGAGCC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.6G>A	6.37:g.129204396G>A			Somatic	40	0	0		WXS	Illumina HiSeq	.	59	0.14	8	NM_000426	0		0	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	CCDS5138.1																																																																																					0.706	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042180.1			
LAMA2	3908	mdanderson.org	37	6	129691055	129691055	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr6:129691055C>T	ENST00000421865.2	+	34	4928	c.4879C>T	c.(4879-4881)Cgg>Tgg	p.R1627W		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1627	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTCACCTCAGCGGGCCCCAGA	0.448																																					p.R1627W													.	.			0			c.C4879T												76.0	81.0	80.0					6																	129691055		2203	4300	6503	SO:0001583	missense	3908	exon34			CCTCAGCGGGCCC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4879C>T	6.37:g.129691055C>T	ENSP00000400365:p.Arg1627Trp		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001079823	9	0.00	0	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026700	0.54683	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.10382	2.88	6.08	3.2	0.36748	Laminin I (1);	0.198113	0.44483	D	0.000451	T	0.10766	0.0263	L	0.32530	0.975	0.42683	D	0.993555	D;D	0.67145	0.996;0.996	P;P	0.59761	0.861;0.863	T	0.01795	-1.1272	10	0.72032	D	0.01	.	15.0559	0.71912	0.3996:0.6004:0.0:0.0	.	1627;1627	A6NF00;P24043	.;LAMA2_HUMAN	W	1627	ENSP00000400365:R1627W	ENSP00000346769:R1627W	R	+	1	2	LAMA2	129732748	1.000000	0.71417	0.911000	0.35937	0.448000	0.32197	1.124000	0.31320	0.360000	0.24265	0.655000	0.94253	CGG			0.448	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042180.1			
HOXA3	3200	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	27150188	27150188	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:27150188G>T	ENST00000396352.4	-	2	271	c.72C>A	c.(70-72)ttC>ttA	p.F24L	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_Missense_Mutation_p.F24L|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	24					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CATTATAAGCGAACCCGTTGG	0.622																																					p.F24L	Esophageal Squamous(136;1368 1743 5685 7935 50360)												.	.			0			c.C72A												50.0	37.0	41.0					7																	27150188		2042	4066	6108	SO:0001583	missense	3200	exon2			ATAAGCGAACCCG		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.72C>A	7.37:g.27150188G>T	ENSP00000379640:p.Phe24Leu		Somatic	190	0	0		WXS	Illumina HiSeq	.	161	0.11	17	NM_030661	1	0.00	0	A4D181	Missense_Mutation	SNP	ENST00000396352.4	37	CCDS5404.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236782	0.79800	.	.	ENSG00000105997	ENST00000396352;ENST00000317201;ENST00000522788;ENST00000522456	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.41	2.64	0.31445	.	0.099208	0.64402	D	0.000001	T	0.38825	0.1055	M	0.64676	1.99	0.47153	D	0.999334	B	0.18610	0.029	B	0.18871	0.023	T	0.19549	-1.0302	10	0.49607	T	0.09	.	10.1736	0.42924	0.2148:0.0:0.7852:0.0	.	24	O43365	HXA3_HUMAN	L	24	ENSP00000379640:F24L;ENSP00000324884:F24L;ENSP00000429426:F24L;ENSP00000430566:F24L	ENSP00000324884:F24L	F	-	3	2	HOXA3	27116713	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.373000	0.59537	0.274000	0.22072	0.462000	0.41574	TTC			0.622	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358708.2			
GLI3	2737	broad.mit.edu;mdanderson.org	37	7	42005961	42005961	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:42005961G>A	ENST00000395925.3	-	15	2794	c.2710C>T	c.(2710-2712)Cgc>Tgc	p.R904C	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	904					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CTGGAGCGGCGCGAGGCGTCG	0.721									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.R904C													.	GLI3	312		0			c.C2710T												21.0	25.0	24.0					7																	42005961		2198	4289	6487	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	AGCGGCGCGAGGC		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2710C>T	7.37:g.42005961G>A	ENSP00000379258:p.Arg904Cys		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_000168	1	0.00	0	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640572	0.67244	.	.	ENSG00000106571	ENST00000395925	D	0.94232	-3.38	4.85	3.01	0.34805	.	0.049095	0.85682	N	0.000000	D	0.96046	0.8712	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94550	0.7753	10	0.87932	D	0	.	7.4362	0.27156	0.0768:0.0:0.5077:0.4156	.	904	P10071	GLI3_HUMAN	C	904	ENSP00000379258:R904C	ENSP00000379258:R904C	R	-	1	0	GLI3	41972486	1.000000	0.71417	0.976000	0.42696	0.889000	0.51656	3.625000	0.54238	0.421000	0.25980	0.462000	0.41574	CGC			0.721	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250806.3		NM_000168	
EGFR	1956	mdanderson.org	37	7	55223545	55223545	+	Silent	SNP	C	C	T	rs182002674	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:55223545C>T	ENST00000275493.2	+	8	1089	c.912C>T	c.(910-912)caC>caT	p.H304H	EGFR_ENST00000420316.2_Silent_p.H304H|EGFR_ENST00000455089.1_Silent_p.H259H|EGFR_ENST00000454757.2_Silent_p.H251H|EGFR_ENST00000442591.1_Silent_p.H304H|EGFR_ENST00000342916.3_Silent_p.H304H|EGFR_ENST00000344576.2_Silent_p.H304H	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	304					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGACAGATCACGGCTCGTGCG	0.597		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			C|||	2	0.000399361	0.0	0.0	5008	,	,		15638	0.0		0.001	False		,,,				2504	0.001				p.H304H			yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	.			0			c.C912T												63.0	59.0	60.0					7																	55223545		2203	4300	6503	SO:0001819	synonymous_variant	1956	exon8	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	AGATCACGGCTCG		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.912C>T	7.37:g.55223545C>T			Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_201283	2	0.00	0	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	37	CCDS5514.1																																																																																			0		0.597	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251456.2		NM_005228	
AUTS2	26053	broad.mit.edu;mdanderson.org	37	7	70249953	70249953	+	Silent	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:70249953T>C	ENST00000342771.4	+	16	2493	c.2172T>C	c.(2170-2172)ccT>ccC	p.P724P	AUTS2_ENST00000406775.2_Silent_p.P700P	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	724										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CTGGGACCCCTTTTGGGCCAC	0.502																																					p.P724P													.	AUTS2	173		0			c.T2172C												110.0	95.0	100.0					7																	70249953		2203	4300	6503	SO:0001819	synonymous_variant	26053	exon16			GACCCCTTTTGGG	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2172T>C	7.37:g.70249953T>C			Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	128	0.04	5	NM_015570	46	0.00	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	CCDS5539.1																																																																																					0.502	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251971.2			
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	82455963	82455963	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:82455963G>A	ENST00000333891.9	-	18	14694	c.14357C>T	c.(14356-14358)aCa>aTa	p.T4786I	PCLO_ENST00000423517.2_Missense_Mutation_p.T4786I|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CACCTCCAGTGTTTTCTTCTT	0.343																																					p.T4786I													.	.			0			c.C14357T												120.0	116.0	117.0					7																	82455963		1826	4086	5912	SO:0001583	missense	27445	exon18			TCCAGTGTTTTCT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14357C>T	7.37:g.82455963G>A	ENSP00000334319:p.Thr4786Ile		Somatic	120	0	0		WXS	Illumina HiSeq	.	83	0.11	9	NM_014510	0		0		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905983	0.52333	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.42900	0.96;0.96	5.48	5.48	0.80851	.	.	.	.	.	T	0.55940	0.1952	L	0.28608	0.87	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.996;1.0	D;D;D;D	0.97110	0.999;0.999;0.994;1.0	T	0.59306	-0.7479	9	0.87932	D	0	.	19.3566	0.94416	0.0:0.0:1.0:0.0	.	4786;4786;207;274	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	I	4786;4786;273	ENSP00000334319:T4786I;ENSP00000388393:T4786I	ENSP00000334319:T4786I	T	-	2	0	PCLO	82293899	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	9.475000	0.97721	2.587000	0.87381	0.555000	0.69702	ACA			0.343	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337368.5		NM_014510	
AKAP9	10142	broad.mit.edu	37	7	91715587	91715587	+	Missense_Mutation	SNP	G	G	T	rs564794970	byFrequency	TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:91715587G>T	ENST00000359028.2	+	37	9307	c.9082G>T	c.(9082-9084)Ggt>Tgt	p.G3028C	AKAP9_ENST00000358100.2_Missense_Mutation_p.G2974C|AKAP9_ENST00000356239.3_Missense_Mutation_p.G3024C			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3028					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGACTGGCGAGGTGAACTACT	0.398			T	BRAF	papillary thyroid																																p.G3024C				Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	AKAP9	788		0			c.G9070T												149.0	142.0	145.0					7																	91715587		2203	4300	6503	SO:0001583	missense	10142	exon37			TGGCGAGGTGAAC	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.9082G>T	7.37:g.91715587G>T	ENSP00000351922:p.Gly3028Cys		Somatic	263	0	0		WXS	Illumina HiSeq	Phase_I	212	0.02	4	NM_005751	19	0.00	0	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.79|15.79	2.936415|2.936415	0.52972|0.52972	.|.	.|.	ENSG00000127914|ENSG00000127914	ENST00000435423|ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	.|T;T;T;T	.|0.04194	.|3.78;3.77;3.8;3.68	4.89|4.89	4.01|4.01	0.46588|0.46588	.|.	.|0.398584	.|0.18615	.|N	.|0.136021	T|T	0.19525|0.19525	0.0469|0.0469	M|M	0.79475|0.79475	2.455|2.455	0.39011|0.39011	D|D	0.959545|0.959545	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;0.998;0.999;0.999	.|D;D;P;D;D	.|0.72338	.|0.961;0.977;0.87;0.939;0.939	T|T	0.01099|0.01099	-1.1452|-1.1452	5|10	.|0.87932	.|D	.|0	.|.	10.6089|10.6089	0.45410|0.45410	0.1552:0.0:0.8448:0.0|0.1552:0.0:0.8448:0.0	.|.	.|3028;3028;3028;3024;3016	.|F5H3X5;Q99996-6;Q99996;Q99996-2;Q99996-3	.|.;.;AKAP9_HUMAN;.;.	D|C	168|3024;3028;2974;3028;870	.|ENSP00000348573:G3024C;ENSP00000351922:G3028C;ENSP00000350813:G2974C;ENSP00000378042:G870C	.|ENSP00000348573:G3024C	E|G	+|+	3|1	2|0	AKAP9|AKAP9	91553523|91553523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.849000|3.849000	0.55910|0.55910	1.407000|1.407000	0.46875|0.46875	0.585000|0.585000	0.79938|0.79938	GAG|GGT			0.398	AKAP9-202	KNOWN	basic	protein_coding	protein_coding				NM_005751	
DUS4L	11062	broad.mit.edu	37	7	107207563	107207563	+	Silent	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:107207563A>G	ENST00000265720.3	+	3	410	c.48A>G	c.(46-48)aaA>aaG	p.K16K	COG5_ENST00000297135.3_5'Flank|COG5_ENST00000393603.2_5'Flank|DUS4L_ENST00000498786.1_3'UTR|DUS4L_ENST00000402620.1_5'UTR	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	16							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						AAAGAAAAAAAGATCCCATAG	0.333																																					p.K16K													.	DUS4L	27		0			c.A48G												84.0	84.0	84.0					7																	107207563		2203	4300	6503	SO:0001819	synonymous_variant	11062	exon3			AAAAAAAGATCCC	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.48A>G	7.37:g.107207563A>G			Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	136	0.03	4	NM_001270419	26	0.00	0	B4DLX0|Q2NKK1	Silent	SNP	ENST00000265720.3	37	CCDS5745.1																																																																																					0.333	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336967.2		NM_181581	
CTTNBP2	83992	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	117368303	117368303	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:117368303A>G	ENST00000160373.3	-	17	3986	c.3895T>C	c.(3895-3897)Tcc>Ccc	p.S1299P		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1299					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TCGCAGGGGGAGGGCGCCTGA	0.512																																					p.S1299P													.	.			0			c.T3895C												79.0	90.0	86.0					7																	117368303		2203	4300	6503	SO:0001583	missense	83992	exon17			AGGGGGAGGGCGC		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3895T>C	7.37:g.117368303A>G	ENSP00000160373:p.Ser1299Pro		Somatic	155	0	0		WXS	Illumina HiSeq	.	140	0.05	7	NM_033427	0		0	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.572|7.572	0.666994|0.666994	0.14710|0.14710	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|D	.|0.90788	.|-2.73	5.22|5.22	1.42|1.42	0.22433|0.22433	.|.	.|0.446324	.|0.26143	.|N	.|0.026099	D|D	0.85526|0.85526	0.5717|0.5717	L|L	0.58669|0.58669	1.825|1.825	0.23515|0.23515	N|N	0.997519|0.997519	.|B	.|0.11235	.|0.004	.|B	.|0.10450	.|0.005	T|T	0.74466|0.74466	-0.3656|-0.3656	5|10	.|0.46703	.|T	.|0.11	22.8976|22.8976	5.3613|5.3613	0.16089|0.16089	0.4928:0.3126:0.1945:0.0|0.4928:0.3126:0.1945:0.0	.|.	.|1299	.|Q8WZ74	.|CTTB2_HUMAN	P|P	786|1299	.|ENSP00000160373:S1299P	.|ENSP00000160373:S1299P	L|S	-|-	2|1	0|0	CTTNBP2|CTTNBP2	117155539|117155539	0.997000|0.997000	0.39634|0.39634	0.176000|0.176000	0.23000|0.23000	0.378000|0.378000	0.30076|0.30076	1.390000|1.390000	0.34464|0.34464	0.053000|0.053000	0.16036|0.16036	-0.280000|-0.280000	0.10049|0.10049	CTC|TCC			0.512	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059201.4		NM_033427	
C7orf49	78996	broad.mit.edu;mdanderson.org	37	7	134851458	134851458	+	Silent	SNP	T	T	G			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:134851458T>G	ENST00000393114.3	-	4	560	c.379A>C	c.(379-381)Agg>Cgg	p.R127R	C7orf49_ENST00000483029.2_Silent_p.R72R|RP11-134L10.1_ENST00000608819.1_RNA|C7orf49_ENST00000430372.1_Silent_p.R126R|C7orf49_ENST00000459937.1_Intron|C7orf49_ENST00000424142.1_Silent_p.R72R			Q9BWK5	MRI_HUMAN	chromosome 7 open reading frame 49	127						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						CCCCCCGGCCTCTGGGAAGGG	0.607																																					p.R127R													.	C7orf49	24		0			c.A379C												57.0	68.0	64.0					7																	134851458		2203	4300	6503	SO:0001819	synonymous_variant	78996	exon4			CCGGCCTCTGGGA	BC000168	CCDS5838.2, CCDS59082.1, CCDS75663.1	7q33	2011-12-09			ENSG00000122783	ENSG00000122783			22432	protein-coding gene	gene with protein product	"""modulator of retrovirus infection"""					17043244	Standard	NM_001243755		Approved	MGC5242, FLJ27285, FLJ22450, MRI	uc003vsh.3	Q9BWK5	OTTHUMG00000155447	ENST00000393114.3:c.379A>C	7.37:g.134851458T>G			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	42	0.10	4	NM_024033	97	0.15	15	Q6NWZ4|Q6ZNR5	Silent	SNP	ENST00000393114.3	37	CCDS5838.2																																																																																					0.607	C7orf49-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340145.1		NM_024033	
SSPO	23145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	149483197	149483197	+	RNA	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr7:149483197G>T	ENST00000378016.2	+	0	3265							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GACGGTGAATGGGGTGAGCGT	0.642																																					p.G1089W													.	.			0			c.G3265T												41.0	48.0	46.0					7																	149483197		2095	4218	6313			23145	exon23			GTGAATGGGGTGA	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149483197G>T			Somatic	103	0	0		WXS	Illumina HiSeq	.	99	0.14	14	NM_198455	0		0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																						0.642	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	3889549	3889549	+	Missense_Mutation	SNP	A	A	G	rs539022079		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr8:3889549A>G	ENST00000520002.1	-	4	1043	c.488T>C	c.(487-489)aTa>aCa	p.I163T	CSMD1_ENST00000537824.1_Missense_Mutation_p.I163T|CSMD1_ENST00000539096.1_Missense_Mutation_p.I163T|CSMD1_ENST00000602723.1_Missense_Mutation_p.I163T|CSMD1_ENST00000542608.1_Missense_Mutation_p.I163T|CSMD1_ENST00000602557.1_Missense_Mutation_p.I163T|CSMD1_ENST00000400186.3_Missense_Mutation_p.I163T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	163	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTTGTCTCCTATGTTGAATCT	0.483													A|||	1	0.000199681	0.0	0.0	5008	,	,		17045	0.0		0.0	False		,,,				2504	0.001				p.I163T													.	.			0			c.T488C												110.0	121.0	117.0					8																	3889549		2093	4232	6325	SO:0001583	missense	64478	exon4			TCTCCTATGTTGA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.488T>C	8.37:g.3889549A>G	ENSP00000430733:p.Ile163Thr		Somatic	171	0	0		WXS	Illumina HiSeq	.	104	0.06	6	NM_033225	0		0	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	A	22.3	4.275220	0.80580	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.52	5.52	0.82312	.	0.131508	0.29185	U	0.012885	T	0.73297	0.3569	L	0.50919	1.6	0.47862	D	0.999537	D	0.89917	1.0	D	0.87578	0.998	T	0.70547	-0.4842	10	0.30078	T	0.28	.	14.8134	0.70013	1.0:0.0:0.0:0.0	.	163	E5RIG2	.	T	163;163;25;163;163;163	ENSP00000383047:I163T;ENSP00000430733:I163T;ENSP00000441462:I163T;ENSP00000446243:I163T;ENSP00000441675:I163T	ENSP00000320445:I25T	I	-	2	0	CSMD1	3876957	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.022000	0.93678	2.111000	0.64477	0.533000	0.62120	ATA			0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000374500.2		NM_033225	
GPR124	25960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	37689047	37689047	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr8:37689047G>A	ENST00000412232.2	+	8	1052	c.1039G>A	c.(1039-1041)Gag>Aag	p.E347K	GPR124_ENST00000315215.7_Missense_Mutation_p.E347K	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	347					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CGTGGTGCTGGAGACCTCTGC	0.652																																					p.E347K													.	.			0			c.G1039A												146.0	104.0	118.0					8																	37689047		2203	4300	6503	SO:0001583	missense	25960	exon8			GTGCTGGAGACCT	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1039G>A	8.37:g.37689047G>A	ENSP00000406367:p.Glu347Lys		Somatic	91	0	0		WXS	Illumina HiSeq	.	53	0.19	10	NM_032777	21	0.10	2	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	36	5.609572	0.96637	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.55234	0.53;0.53	5.22	5.22	0.72569	GPCR, family 2, extracellular hormone receptor domain (1);Immunoglobulin-like fold (1);	0.125343	0.52532	D	0.000071	T	0.73345	0.3575	M	0.77103	2.36	0.80722	D	1	D;P	0.67145	0.996;0.825	D;P	0.67900	0.954;0.473	T	0.76329	-0.2999	10	0.59425	D	0.04	-15.77	18.8299	0.92133	0.0:0.0:1.0:0.0	.	347;347	Q96PE1-2;Q96PE1	.;GP124_HUMAN	K	340;347;347	ENSP00000323508:E347K;ENSP00000406367:E347K	ENSP00000323508:E347K	E	+	1	0	GPR124	37808205	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.795000	0.99099	2.458000	0.83093	0.449000	0.29647	GAG			0.652	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343331.2			
CYP7A1	1581	mdanderson.org	37	8	59409620	59409620	+	Missense_Mutation	SNP	G	G	T	rs201114135		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr8:59409620G>T	ENST00000301645.3	-	3	588	c.451C>A	c.(451-453)Cgt>Agt	p.R151S		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	151					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CTCATGATACGTTGGAGGTTT	0.473									Neonatal Giant Cell Hepatitis																												p.R151S													CYP7A1,colon,carcinoma,0,1	CYP7A1	0	1	0			c.C451A												135.0	135.0	135.0					8																	59409620		2203	4300	6503	SO:0001583	missense	1581	exon3	Familial Cancer Database	Neonatal Hemochromatosis	TGATACGTTGGAG	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.451C>A	8.37:g.59409620G>T	ENSP00000301645:p.Arg151Ser		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_000780	0		0	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	G	1.078	-0.667841	0.03428	.	.	ENSG00000167910	ENST00000301645	T	0.68331	-0.32	5.5	2.59	0.31030	.	0.644139	0.16809	N	0.198636	T	0.33147	0.0853	N	0.02315	-0.6	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.21518	-1.0243	10	0.10377	T	0.69	-3.1479	6.176	0.20444	0.2508:0.1556:0.5936:0.0	.	151	P22680	CP7A1_HUMAN	S	151	ENSP00000301645:R151S	ENSP00000301645:R151S	R	-	1	0	CYP7A1	59572174	0.000000	0.05858	0.005000	0.12908	0.057000	0.15508	0.513000	0.22770	0.748000	0.32831	0.462000	0.41574	CGT			0.473	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378190.1		NM_000780	
MLLT3	4300	hgsc.bcm.edu;broad.mit.edu	37	9	20414311	20414319	+	In_Frame_Del	DEL	CTGCTGCTG	CTGCTGCTG	-	rs62640391		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	CTGCTGCTG	CTGCTGCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr9:20414311_20414319delCTGCTGCTG	ENST00000380338.4	-	5	811_819	c.525_533delCAGCAGCAG	c.(523-534)agcagcagcagt>agt	p.175_178SSSS>S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_In_Frame_Del_p.172_175SSSS>S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	175	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		gctgctgctactgctgctgctgctgctgc	0.522			T	MLL	ALL																																p.176_178del				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,caecum,carcinoma,0,1	MLLT3	125		0			c.526_534del																																									SO:0001651	inframe_deletion	4300	exon5			CTGCTACTGCTGC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.525_533delCAGCAGCAG	9.37:g.20414320_20414328delCTGCTGCTG	ENSP00000369695:p.Ser187_Ser189del		Somatic	85	0	0		WXS	Illumina HiSeq	.	63	0.21	13	NM_004529	0		0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	In_Frame_Del	DEL	ENST00000380338.4	37	CCDS6494.1																																																																																					0.522	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051872.1		NM_004529	
KIF24	347240	broad.mit.edu	37	9	34310903	34310903	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr9:34310903G>T	ENST00000402558.2	-	1	466	c.442C>A	c.(442-444)Cat>Aat	p.H148N	KIF24_ENST00000379174.3_Missense_Mutation_p.H148N|KIF24_ENST00000345050.2_Missense_Mutation_p.H148N|KIF24_ENST00000379166.2_Missense_Mutation_p.H148N			Q5T7B8	KIF24_HUMAN	kinesin family member 24	148					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			GTTTTTGTATGGTACTGGGAA	0.393																																					p.H148N													.	KIF24	64		0			c.C442A												205.0	198.0	200.0					9																	34310903		1902	4131	6033	SO:0001583	missense	347240	exon2			TTGTATGGTACTG	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.442C>A	9.37:g.34310903G>T	ENSP00000384433:p.His148Asn		Somatic	279	0	0		WXS	Illumina HiSeq	Phase_I	223	0.02	4	NM_194313	5	0.00	0	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346351	0.24426	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.70045	-0.24;-0.45;-0.24;-0.45	5.48	-0.359	0.12571	.	1.107710	0.06941	N	0.812735	T	0.53530	0.1802	L	0.44542	1.39	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.04013	0.001;0.001	T	0.34900	-0.9810	10	0.30854	T	0.27	.	4.6377	0.12531	0.309:0.0:0.4034:0.2876	.	148;148	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	N	148	ENSP00000384433:H148N;ENSP00000368472:H148N;ENSP00000368464:H148N;ENSP00000340179:H148N	ENSP00000340179:H148N	H	-	1	0	KIF24	34300903	0.000000	0.05858	0.003000	0.11579	0.810000	0.45777	0.461000	0.21940	0.031000	0.15407	0.650000	0.86243	CAT			0.393	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052150.5			
ANKS6	203286	mdanderson.org	37	9	101498829	101498829	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr9:101498829C>A	ENST00000353234.4	-	15	2635	c.2588G>T	c.(2587-2589)aGg>aTg	p.R863M	ANKS6_ENST00000375019.2_Missense_Mutation_p.R562M|ANKS6_ENST00000375018.1_Missense_Mutation_p.R864M|ANKS6_ENST00000540940.1_Missense_Mutation_p.R668M			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	863						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				GCCAGGGGCCCTGGTGTTGCT	0.572																																					p.R863M													.	.			0			c.G2588T												62.0	68.0	66.0					9																	101498829		1977	4149	6126	SO:0001583	missense	203286	exon15			GGGGCCCTGGTGT	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.2588G>T	9.37:g.101498829C>A	ENSP00000297837:p.Arg863Met		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_173551	20	0.00	0	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	37	CCDS43856.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.0|25.0	4.592169|4.592169	0.86953|0.86953	.|.	.|.	ENSG00000165138|ENSG00000165138	ENST00000444472|ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940	.|T;T;T;T	.|0.73789	.|1.16;-0.77;-0.78;1.65	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	.|0.049951	.|0.85682	.|D	.|0.000000	T|T	0.78123|0.78123	0.4234|0.4234	N|N	0.24115|0.24115	0.695|0.695	0.36933|0.36933	D|D	0.891991|0.891991	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.85130	.|0.997;0.993	T|T	0.83082|0.83082	-0.0137|-0.0137	5|10	.|0.87932	.|D	.|0	-33.1188|-33.1188	14.8357|14.8357	0.70180|0.70180	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|864;863	.|Q68DC2-4;Q68DC2	.|.;ANKS6_HUMAN	H|M	332|562;864;863;668	.|ENSP00000364159:R562M;ENSP00000364158:R864M;ENSP00000297837:R863M;ENSP00000442189:R668M	.|ENSP00000297837:R863M	Q|R	-|-	3|2	2|0	ANKS6|ANKS6	100538650|100538650	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.333000|6.333000	0.72939|0.72939	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	CAG|AGG			0.572	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000277053.1		NM_173551	
TPT1P9	389787	bcgsc.ca	37	9	120845344	120845344	+	IGR	SNP	A	A	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr9:120845344A>T								RP11-281A20.1 (185810 upstream) : RP11-349E4.1 (604685 downstream)																							TTCTGGTCTCAGTTCTTCAAG	0.373																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTCTCAGTTCTT																													9.37:g.120845344A>T			Somatic	75	0	0		WXS	Illumina HiSeq	Phase_1	65	0.14	9	.	48	0.92	44		RNA	SNP		37																																																																																					0	0.373										
TPT1P9	389787	bcgsc.ca	37	9	120845358	120845358	+	IGR	SNP	G	G	C	rs560971842		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr9:120845358G>C								RP11-281A20.1 (185824 upstream) : RP11-349E4.1 (604671 downstream)																							CTTCAAGTTTGCCTTTGATTG	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		19502	0.0		0.0	False		,,,				2504	0.001				.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AAGTTTGCCTTTG																													9.37:g.120845358G>C			Somatic	83	0	0		WXS	Illumina HiSeq	Phase_1	60	0.13	8	.	70	0.87	61		RNA	SNP		37																																																																																					0	0.388										
ZBTB43	23099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	129596183	129596183	+	Silent	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr9:129596183G>A	ENST00000373464.4	+	3	1659	c.1395G>A	c.(1393-1395)gaG>gaA	p.E465E	ZBTB43_ENST00000449886.1_Silent_p.E465E|ZBTB43_ENST00000373457.1_Silent_p.E465E	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						ATACAACTGAGGCTAACTAAA	0.438																																					p.E465E													.	.			0			c.G1395A												73.0	78.0	76.0					9																	129596183		2196	4268	6464	SO:0001819	synonymous_variant	23099	exon2			AACTGAGGCTAAC	AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.1395G>A	9.37:g.129596183G>A			Somatic	155	0	0		WXS	Illumina HiSeq	.	143	0.41	58	NM_001135776	13	0.54	7	Q5JU96	Silent	SNP	ENST00000373464.4	37	CCDS6867.1																																																																																					0.438	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054124.1		NM_001135776	
ARSF	416	broad.mit.edu	37	X	3019220	3019220	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:3019220C>T	ENST00000381127.1	+	8	1281	c.1060C>T	c.(1060-1062)Cga>Tga	p.R354*	ARSF_ENST00000359361.2_Nonsense_Mutation_p.R354*|ARSF_ENST00000537104.1_Nonsense_Mutation_p.R354*	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	354					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGAAGCTAGGCGAGGGCATGC	0.438																																					p.R354X													.	ARSF	97		0			c.C1060T												144.0	122.0	129.0					X																	3019220		2203	4299	6502	SO:0001587	stop_gained	416	exon8			GCTAGGCGAGGGC	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1060C>T	X.37:g.3019220C>T	ENSP00000370519:p.Arg354*		Somatic	297	0	0		WXS	Illumina HiSeq	Phase_I	488	0.01	5	NM_004042	0		0	Q8TCC5	Nonsense_Mutation	SNP	ENST00000381127.1	37	CCDS14123.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.590006	0.66105	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	.	.	.	2.81	-5.62	0.02481	.	2.429870	0.03186	U	0.172680	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	3.3005	0.06982	0.1728:0.3367:0.3857:0.1048	.	.	.	.	X	354	.	ENSP00000352319:R354X	R	+	1	2	ARSF	3029220	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.695000	0.01913	-2.027000	0.00932	-0.312000	0.09012	CGA			0.438	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055652.1			
SCML2	10389	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	18276363	18276374	+	Splice_Site	DEL	ACAGACTTGAGA	ACAGACTTGAGA	-			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	ACAGACTTGAGA	ACAGACTTGAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:18276363_18276374delACAGACTTGAGA	ENST00000251900.4	-	10	1229_1233	c.1070_1074delTCTCAAGTCTGT	c.(1069-1074)gtctca>g	p.VS357del	SCML2_ENST00000398048.3_Splice_Site_p.VS93del	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	357					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					TTACATAGACACAGACTTGAGAAAAAATGCGT	0.425																																					p.357_359del	Esophageal Squamous(100;1252 1965 19021 35517)												.	SCML2	81		0			c.1070_1075del																																									SO:0001630	splice_region_variant	10389	exon10			ATAGACACAGACT	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1070-1TCTCAAGTCTGT>-	X.37:g.18276363_18276374delACAGACTTGAGA			Somatic	169	0	0		WXS	Illumina HiSeq	.	243	0.09	22	NM_006089	36	0.00	0	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	In_Frame_Del	DEL	ENST00000251900.4	37	CCDS14185.1																																																																																					0.425	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055941.1		NM_006089	In_Frame_Del
MAGEB4	4115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	30261215	30261215	+	Silent	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:30261215T>C	ENST00000378982.2	+	1	1159	c.963T>C	c.(961-963)gtT>gtC	p.V321V	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	321										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GGCCCAGAGTTGCAGCCAGGC	0.517																																					p.V321V													.	.			0			c.T963C												47.0	44.0	45.0					X																	30261215		2202	4300	6502	SO:0001819	synonymous_variant	4115	exon1			CAGAGTTGCAGCC		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.963T>C	X.37:g.30261215T>C			Somatic	84	0	0		WXS	Illumina HiSeq	.	107	0.13	14	NM_002367	0		0	B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	ENST00000378982.2	37	CCDS14221.1																																																																																					0.517	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056159.1		NM_002367	
NR0B1	190	broad.mit.edu;mdanderson.org	37	X	30326687	30326687	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:30326687G>C	ENST00000378970.4	-	1	1028	c.794C>G	c.(793-795)aCg>aGg	p.T265R	NR0B1_ENST00000453287.1_Missense_Mutation_p.T265R|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	265	Ligand-binding. {ECO:0000250}.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GAAGCGCAGCGTCTTCAACAG	0.667											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T265R													.	NR0B1	61		0			c.C794G	GRCh37	CI064714|CM071906	NR0B1	I|M								17.0	12.0	14.0					X																	30326687		2176	4245	6421	SO:0001583	missense	190	exon1			CGCAGCGTCTTCA	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.794C>G	X.37:g.30326687G>C	ENSP00000368253:p.Thr265Arg		Somatic	24	0	0	816	WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_000475	4	0.00	0	Q96F69	Missense_Mutation	SNP	ENST00000378970.4	37	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454497	0.84209	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.97352	-4.35;-4.35	5.47	5.47	0.80525	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98639	0.9544	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99731	1.1012	10	0.72032	D	0.01	-18.6329	18.3739	0.90428	0.0:0.0:1.0:0.0	.	265	P51843	NR0B1_HUMAN	R	265	ENSP00000368253:T265R;ENSP00000396403:T265R	ENSP00000368253:T265R	T	-	2	0	NR0B1	30236608	1.000000	0.71417	0.928000	0.36995	0.995000	0.86356	9.270000	0.95690	2.277000	0.76020	0.513000	0.50165	ACG			0.667	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056161.1		NM_000475	
HUWE1	10075	hgsc.bcm.edu;broad.mit.edu	37	X	53574783	53574785	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	GTG	GTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:53574783_53574785delGTG	ENST00000342160.3	-	67	10942_10944	c.10485_10487delCAC	c.(10483-10488)accact>act	p.3495_3496TT>T	HUWE1_ENST00000474288.1_5'UTR|HUWE1_ENST00000262854.6_In_Frame_Del_p.3495_3496TT>T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3495	Thr-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ggaggcggcagtggtggtggtgg	0.591																																					p.3496_3496del													.	HUWE1	724		0			c.10486_10488del																																									SO:0001651	inframe_deletion	10075	exon68			GCGGCAGTGGTGG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.10485_10487delCAC	X.37:g.53574792_53574794delGTG	ENSP00000340648:p.Thr3496del		Somatic	95	0	0		WXS	Illumina HiSeq	.	162	0.07	11	NM_031407	502	0.00	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	In_Frame_Del	DEL	ENST00000342160.3	37	CCDS35301.1																																																																																					0.591	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056766.1		XM_497119	
PHKA1	5255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	71829496	71829496	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:71829496G>T	ENST00000373542.4	-	23	2743	c.2584C>A	c.(2584-2586)Cct>Act	p.P862T	PHKA1_ENST00000339490.3_Missense_Mutation_p.P862T|PHKA1_ENST00000373539.3_Missense_Mutation_p.P862T|PHKA1_ENST00000373545.3_Missense_Mutation_p.P803T|PHKA1_ENST00000541944.1_Missense_Mutation_p.P803T	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	862					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TTTTCTCGAGGTTCTGGAGGA	0.463																																					p.P862T													.	.			0			c.C2584A												215.0	183.0	194.0					X																	71829496		2203	4300	6503	SO:0001583	missense	5255	exon23			CTCGAGGTTCTGG		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2584C>A	X.37:g.71829496G>T	ENSP00000362643:p.Pro862Thr		Somatic	121	0	0		WXS	Illumina HiSeq	.	159	0.26	42	NM_002637	111	0.46	51	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475166	0.84640	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91124	-2.76;-2.79;-2.78;-2.77;-2.75	5.65	5.65	0.86999	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.95319	0.8481	M	0.86178	2.8	0.80722	D	1	D;P;D	0.89917	1.0;0.833;0.994	D;P;D	0.97110	1.0;0.772;0.962	D	0.94145	0.7400	10	0.24483	T	0.36	-13.33	15.893	0.79315	0.0:0.0:1.0:0.0	.	803;862;862	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	T	803;862;803;862;862	ENSP00000362646:P803T;ENSP00000362643:P862T;ENSP00000441251:P803T;ENSP00000342469:P862T;ENSP00000362640:P862T	ENSP00000342469:P862T	P	-	1	0	PHKA1	71746221	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.321000	0.96353	2.353000	0.79882	0.544000	0.68410	CCT			0.463	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000058896.1			
ATRX	546	broad.mit.edu	37	X	76855029	76855029	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:76855029T>C	ENST00000373344.5	-	25	6021	c.5807A>G	c.(5806-5808)aAg>aGg	p.K1936R	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.K1898R	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1936	Poly-Lys.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.K1936T(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTTTTTCCCCTTTTTCCCTTT	0.348			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.K1936R				Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833		3	Substitution - Missense(2)|Unknown(1)	lung(2)|bone(1)	c.A5807G												329.0	308.0	315.0					X																	76855029		2203	4295	6498	SO:0001583	missense	546	exon25			TTCCCCTTTTTCC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5807A>G	X.37:g.76855029T>C	ENSP00000362441:p.Lys1936Arg		Somatic	302	0	0		WXS	Illumina HiSeq	Phase_I	385	0.01	5	NM_000489	22	0.00	0	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.468878	0.26335	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92647	-3.07;-3.08	5.64	0.648	0.17801	.	0.202398	0.40469	N	0.001084	T	0.82217	0.4989	N	0.16903	0.455	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.002	T	0.67492	-0.5657	10	0.38643	T	0.18	-2.2976	8.217	0.31519	0.0:0.3103:0.0:0.6897	.	1898;1936	P46100-4;P46100	.;ATRX_HUMAN	R	1936;1898	ENSP00000362441:K1936R;ENSP00000378967:K1898R	ENSP00000362441:K1936R	K	-	2	0	ATRX	76741685	0.758000	0.28405	0.831000	0.32960	0.973000	0.67179	1.172000	0.31908	-0.241000	0.09681	-0.330000	0.08379	AAG			0.348	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058860.2		NM_000489	
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	109695094	109695094	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:109695094G>A	ENST00000465301.2	+	3	1495	c.1249G>A	c.(1249-1251)Gga>Aga	p.G417R	RGAG1_ENST00000540313.1_Missense_Mutation_p.G417R	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	417										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ACCGCTAATGGGAGCCCCAGC	0.512																																					p.G417R													.	.			0			c.G1249A												174.0	179.0	178.0					X																	109695094		2203	4300	6503	SO:0001583	missense	57529	exon3			CTAATGGGAGCCC	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1249G>A	X.37:g.109695094G>A	ENSP00000419786:p.Gly417Arg		Somatic	44	0	0		WXS	Illumina HiSeq	.	76	0.12	9	NM_020769	0		0	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	7.827	0.719076	0.15372	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.37411	1.2;1.2	3.98	0.229	0.15368	.	0.390976	0.18935	N	0.127112	T	0.16854	0.0405	N	0.20530	0.585	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.15009	-1.0452	9	.	.	.	-3.2294	3.2027	0.06655	0.5961:0.0:0.2242:0.1797	.	417	Q8NET4	RGAG1_HUMAN	R	417	ENSP00000419786:G417R;ENSP00000441452:G417R	.	G	+	1	0	RGAG1	109581750	0.558000	0.26554	0.002000	0.10522	0.563000	0.35712	1.615000	0.36922	-0.067000	0.12976	-0.340000	0.08031	GGA			0.512	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057906.2		NM_020769	
XIAP	331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	123040895	123040895	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:123040895G>T	ENST00000371199.3	+	7	1657	c.1358G>T	c.(1357-1359)tGt>tTt	p.C453F	XIAP_ENST00000355640.3_Missense_Mutation_p.C453F|XIAP_ENST00000434753.3_Missense_Mutation_p.C453F|XIAP_ENST00000468691.1_3'UTR	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	453					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						TGCAAAATCTGTATGGATAGA	0.388									X-linked Lymphoproliferative syndrome																												p.C453F													.	.			0			c.G1358T												89.0	82.0	84.0					X																	123040895		2203	4300	6503	SO:0001583	missense	331	exon7	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	AAATCTGTATGGA	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.1358G>T	X.37:g.123040895G>T	ENSP00000360242:p.Cys453Phe		Somatic	155	0	0		WXS	Illumina HiSeq	.	202	0.17	35	NM_001204401	25	0.24	6	D3DTF2|Q9NQ14	Missense_Mutation	SNP	ENST00000371199.3	37	CCDS14606.1	.	.	.	.	.	.	.	.	.	.	g	18.93	3.727497	0.69074	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	D;D;D	0.96522	-4.04;-4.04;-4.04	5.36	5.36	0.76844	Baculoviral inhibition of apoptosis protein repeat (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	D	0.99083	0.9685	H	0.99325	4.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99044	1.0825	9	.	.	.	-8.9486	17.7815	0.88524	0.0:0.0:1.0:0.0	.	453	P98170	XIAP_HUMAN	F	453	ENSP00000395230:C453F;ENSP00000360242:C453F;ENSP00000347858:C453F	.	C	+	2	0	XIAP	122868576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.254000	0.95512	2.232000	0.73038	0.538000	0.68166	TGT			0.388	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058165.5		NM_001167	
RP11-1007I13.4	0	broad.mit.edu	37	X	151296336	151296337	+	RNA	INS	-	-	A	rs5904333		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chrX:151296336_151296337insA	ENST00000509345.2	-	0	172																											GGGAATTCCAGAAAAAAAAAAA	0.446																																					.													.	.			0			.																																											0	.			ATTCCAGAAAAAA																													X.37:g.151296347_151296347dupA			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	13	0.46	6	.	0		0		RNA	INS	ENST00000509345.2	37																																																																																						0.446	RP11-1007I13.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000445981.1			
TXNRD1	7296	hgsc.bcm.edu;broad.mit.edu	37	12	104709560	104709560	+	Missense_Mutation	SNP	G	G	A	rs370602169		TCGA-2G-AAKH-01A-11D-A42Y-10	TCGA-2G-AAKH-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4181974f-50f6-46f2-80af-81cef983c7df	539c8e99-0cf7-4e55-a88a-d21072e30885	g.chr12:104709560G>A	ENST00000529546.1	+	4	277	c.52G>A	c.(52-54)Gga>Aga	p.G18R	TXNRD1_ENST00000542918.1_Missense_Mutation_p.G106R|TXNRD1_ENST00000540716.1_Missense_Mutation_p.G18R|TXNRD1_ENST00000429002.2_Missense_Mutation_p.G206R|TXNRD1_ENST00000526691.1_Missense_Mutation_p.G108R|TXNRD1_ENST00000397736.2_Missense_Mutation_p.G100R|TXNRD1_ENST00000526390.1_Missense_Mutation_p.G100R|TXNRD1_ENST00000354940.6_Missense_Mutation_p.G56R|TXNRD1_ENST00000525566.1_Missense_Mutation_p.G206R|TXNRD1_ENST00000526950.1_Missense_Mutation_p.G125R|TXNRD1_ENST00000524698.1_Missense_Mutation_p.G56R|TXNRD1_ENST00000378070.4_Missense_Mutation_p.G155R|TXNRD1_ENST00000388854.3_Missense_Mutation_p.G108R|TXNRD1_ENST00000503506.2_Missense_Mutation_p.G56R|TXNRD1_ENST00000427956.1_Missense_Mutation_p.G171R			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	206					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	TGTAGGTCTCGGAGGAACATG	0.378																																					.	Ovarian(139;555 1836 9186 9946 10884)												.	.			0			.							G	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	0,3774		0,0,1887	107.0	101.0	103.0		616,322,166,166,166	5.8	1.0	12		103	1,8251		0,1,4125	no	missense,missense,missense,missense,missense	TXNRD1	NM_001093771.1,NM_003330.2,NM_182729.1,NM_182742.1,NM_182743.1	125,125,125,125,125	0,1,6012	AA,AG,GG		0.0121,0.0,0.0083	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	206/650,108/552,56/500,56/500,56/500	104709560	1,12025	1887	4126	6013	SO:0001583	missense	7296	.			GGTCTCGGAGGAA		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.52G>A	12.37:g.104709560G>A	ENSP00000434919:p.Gly18Arg		Somatic	140	0	0		WXS	Illumina HiSeq	.	95	0.04	4	.	242	0.07	18	B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	ENST00000529546.1	37	CCDS58274.1	.	.	.	.	.	.	.	.	.	.	G	34	5.378021	0.95945	0.0	1.21E-4	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000526266;ENST00000503506;ENST00000526691;ENST00000531691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000531689;ENST00000529546;ENST00000540716;ENST00000526580;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000527335;ENST00000397736;ENST00000427956;ENST00000526950	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56444	0.68;0.68;0.46;0.68;0.68;0.46;0.68;0.68;0.68;0.46;0.68;0.68;0.46;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.81	5.81	0.92471	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87285	0.6139	H	0.99894	4.905	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.93060	0.6473	10	0.87932	D	0	-24.204	20.1336	0.98010	0.0:0.0:1.0:0.0	.	106;100;206;108;56;206;171	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	R	206;206;56;56;108;100;108;56;100;56;18;18;56;56;106;155;56;100;171;125	ENSP00000434516:G206R;ENSP00000412045:G206R;ENSP00000431294:G56R;ENSP00000421934:G56R;ENSP00000435929:G108R;ENSP00000431925:G100R;ENSP00000373506:G108R;ENSP00000347020:G56R;ENSP00000435123:G100R;ENSP00000433507:G56R;ENSP00000434919:G18R;ENSP00000442709:G18R;ENSP00000433887:G56R;ENSP00000433425:G56R;ENSP00000440978:G106R;ENSP00000367310:G155R;ENSP00000433599:G56R;ENSP00000380844:G100R;ENSP00000393328:G171R;ENSP00000432812:G125R	ENSP00000347020:G56R	G	+	1	0	TXNRD1	103233690	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	9.707000	0.98725	2.754000	0.94517	0.650000	0.86243	GGA			0.378	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000389969.1		NM_003330	
