#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	mdanderson.org	37	1	1269178	1269178	+	Silent	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr1:1269178C>T	ENST00000339381.5	+	6	1925	c.1893C>T	c.(1891-1893)gcC>gcT	p.A631A		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	631					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		ccagccctgcccgatgcctgg	0.692																																					p.A631A													.	.			0			c.C1893T												16.0	19.0	18.0					1																	1269178		2186	4285	6471	SO:0001819	synonymous_variant	83756	exon6			CCCTGCCCGATGC	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1893C>T	1.37:g.1269178C>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_152228	1	0.00	0	Q5TA49|Q8NGW9	Silent	SNP	ENST00000339381.5	37	CCDS30556.1																																																																																					0.692	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008493.1			
PRDM16	63976	mdanderson.org	37	1	3329295	3329295	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr1:3329295C>T	ENST00000270722.5	+	9	2583	c.2534C>T	c.(2533-2535)gCg>gTg	p.A845V	PRDM16_ENST00000378398.3_Missense_Mutation_p.A846V|PRDM16_ENST00000378391.2_Missense_Mutation_p.A845V|PRDM16_ENST00000442529.2_Missense_Mutation_p.A845V|PRDM16_ENST00000511072.1_Missense_Mutation_p.A846V|PRDM16_ENST00000514189.1_Missense_Mutation_p.A846V|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000441472.2_Missense_Mutation_p.A845V			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	845	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GTGTGCCCGGCGCGGATGCCC	0.697			T	EVI1	"""MDS, AML"""																																p.A845V				Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	PRDM16,colon,carcinoma,0,1	PRDM16	0	1	0			c.C2534T												6.0	8.0	8.0					1																	3329295		1791	3893	5684	SO:0001583	missense	63976	exon9			GCCCGGCGCGGAT	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2534C>T	1.37:g.3329295C>T	ENSP00000270722:p.Ala845Val		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_022114	1	0.00	0	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	37	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	C	7.710	0.694951	0.15039	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.05925	3.38;3.41;3.42;3.42;3.41;3.43;3.42;3.37;3.37	4.05	3.11	0.35812	.	0.132956	0.33127	U	0.005255	T	0.05318	0.0141	L	0.36672	1.1	0.09310	N	1	P;B;P;B	0.41710	0.76;0.108;0.71;0.065	B;B;B;B	0.35859	0.212;0.013;0.08;0.006	T	0.38457	-0.9660	10	0.38643	T	0.18	.	11.3409	0.49533	0.0:0.9093:0.0:0.0906	.	845;845;845;845	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	V	846;846;845;845;845;846;845;661;661;654	ENSP00000426975:A846V;ENSP00000367651:A846V;ENSP00000407968:A845V;ENSP00000405253:A845V;ENSP00000367643:A845V;ENSP00000421400:A846V;ENSP00000270722:A845V;ENSP00000422504:A661V;ENSP00000425796:A654V	ENSP00000270722:A845V	A	+	2	0	PRDM16	3319155	0.011000	0.17503	0.043000	0.18650	0.039000	0.13416	2.326000	0.43849	1.977000	0.57605	0.551000	0.68910	GCG			0.697	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000001382.3		NM_022114	
TP73	7161	mdanderson.org	37	1	3649534	3649534	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr1:3649534G>T	ENST00000378295.4	+	14	1957	c.1802G>T	c.(1801-1803)gGc>gTc	p.G601V	TP73_ENST00000378288.4_Missense_Mutation_p.G552V|TP73_ENST00000357733.3_Missense_Mutation_p.G520V|TP73_ENST00000378285.1_3'UTR|TP73_ENST00000346387.4_Missense_Mutation_p.G505V|TP73_ENST00000378280.1_3'UTR|TP73_ENST00000604074.1_3'UTR|TP73_ENST00000604479.1_Missense_Mutation_p.G505V|TP73_ENST00000603362.1_Missense_Mutation_p.G520V|TP73_ENST00000378290.4_Missense_Mutation_p.G530V|TP73_ENST00000354437.4_3'UTR	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	601					activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		AACCGCGGCGGCCCAGGCGGC	0.697																																					p.G601V													.	.			0			c.G1802T												14.0	18.0	16.0					1																	3649534		2182	4276	6458	SO:0001583	missense	7161	exon14			GCGGCGGCCCAGG	AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.1802G>T	1.37:g.3649534G>T	ENSP00000367545:p.Gly601Val		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_005427	1	0.00	0	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	ENST00000378295.4	37	CCDS49.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.562013	0.27915	.	.	ENSG00000078900	ENST00000378295;ENST00000357733;ENST00000346387;ENST00000378288;ENST00000378290	D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17	4.11	4.11	0.48088	.	0.302249	0.27686	N	0.018262	D	0.83440	0.5255	L	0.27053	0.805	0.43326	D	0.995354	P;P	0.51057	0.939;0.941	P;P	0.50378	0.639;0.536	D	0.84937	0.0863	10	0.87932	D	0	-35.9445	10.3089	0.43697	0.0:0.2207:0.7793:0.0	.	552;601	O15350-8;O15350	.;P73_HUMAN	V	601;520;505;552;530	ENSP00000367545:G601V;ENSP00000350366:G520V;ENSP00000340740:G505V;ENSP00000367537:G552V;ENSP00000367539:G530V	ENSP00000340740:G505V	G	+	2	0	TP73	3639394	1.000000	0.71417	0.059000	0.19551	0.164000	0.22412	2.899000	0.48679	1.829000	0.53265	0.313000	0.20887	GGC			0.697	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001468.4		NM_005427	
CROCCP2	84809	hgsc.bcm.edu	37	1	16953145	16953145	+	lincRNA	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr1:16953145G>A	ENST00000412962.1	-	0	622							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AAAAATCACCGCAGAAAGCCT	0.537																																					.													.	.			0			.																																											84809	.			ATCACCGCAGAAA	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16953145G>A			Somatic	29	0	0		WXS	Illumina HiSeq	.	48	0.25	12	.	0		0	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	ENST00000412962.1	37																																																																																						0.537	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000092784.1		NR_026752.1	
HSP90B3P	343477	bcgsc.ca	37	1	92109629	92109629	+	IGR	SNP	G	G	A	rs12042591		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr1:92109629G>A								CDC7 (118308 upstream) : TGFBR3 (36272 downstream)																							AGCTGAAAACGATAAATTGTA	0.393																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	343477	.			GAAAACGATAAAT																													1.37:g.92109629G>A			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_1	45	0.11	5	.	0		0		RNA	SNP		37																																																																																					0	0.393										
CCDC18	343099	broad.mit.edu	37	1	93744310	93744310	+	IGR	DEL	T	T	-	rs372723050		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr1:93744310delT	ENST00000343253.7	+	0	4867				RP4-717I23.3_ENST00000427669.1_RNA|RP4-717I23.3_ENST00000429859.1_RNA|RP4-717I23.3_ENST00000457025.1_RNA|RP4-717I23.3_ENST00000451302.2_RNA|RP4-717I23.3_ENST00000447577.1_RNA|RP4-717I23.3_ENST00000446528.2_RNA|RP4-717I23.3_ENST00000442860.1_RNA|RP4-717I23.3_ENST00000415150.1_RNA|RP4-717I23.3_ENST00000414430.1_RNA|RP4-717I23.3_ENST00000413606.1_RNA|RP4-717I23.3_ENST00000424517.3_RNA|RP4-717I23.3_ENST00000455474.1_RNA			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18											breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GGAATGCaaattttttttttt	0.279																																					.													.	CCDC18	93		0			.																																									SO:0001628	intergenic_variant	0	.			TGCAAATTTTTTT			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598		1.37:g.93744310delT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	2	0.00	0	Q6ZU17	RNA	DEL	ENST00000343253.7	37																																																																																						0.279	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000382327.1		NM_206886	
RP11-423O2.5	0	broad.mit.edu	37	1	142806243	142806243	+	lincRNA	SNP	G	G	A	rs200190101		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr1:142806243G>A	ENST00000423385.1	-	0	88																											TTGCTCTCAAGCATTTTGCAT	0.343																																					.													.	.			0			.																																											0	.			TCTCAAGCATTTT																													1.37:g.142806243G>A			Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	210	0.06	12	.	0		0		RNA	SNP	ENST00000423385.1	37																																																																																						0.343	RP11-423O2.5-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000193203.1			
Unknown	0	bcgsc.ca	37	10	47727808	47727809	+	IGR	INS	-	-	C	rs375537331|rs372756960	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr10:47727808_47727809insC								ANTXRL (26365 upstream) : FAM25HP (14583 downstream)																							ATGAACAGTTAACTCATTTGCG	0.322													|||unknown(NO_COVERAGE)	541	0.108027	0.1672	0.2046	5008	,	,		12497	0.0089		0.1272	False		,,,				2504	0.0419				.													.	.			0			.																																									SO:0001628	intergenic_variant	653259	.			ACAGTTAACTCAT																													10.37:g.47727808_47727809insC			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_1	26	0.12	3	.	0		0		Splice_Site	INS		37																																																																																					0	0.322										
SYCE1	93426	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	135369120	135369120	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr10:135369120G>T	ENST00000343131.5	-	11	915	c.811C>A	c.(811-813)Cag>Aag	p.Q271K	SYCE1_ENST00000432597.2_Missense_Mutation_p.Q235K|SPRN_ENST00000541506.1_Intron|SYCE1_ENST00000368517.3_Missense_Mutation_p.Q235K	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	271	Gln-rich.				synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ttctgctgctgttgttggcac	0.612																																					p.Q271K													.	SYCE1	81		0			c.C811A												30.0	25.0	26.0					10																	135369120		2202	4300	6502	SO:0001583	missense	93426	exon11			GCTGCTGTTGTTG	AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.811C>A	10.37:g.135369120G>T	ENSP00000341282:p.Gln271Lys		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	45	0.09	4	NM_001143763	3	0.00	0	B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	ENST00000343131.5	37	CCDS44501.1	.	.	.	.	.	.	.	.	.	.	G	4.389	0.071883	0.08436	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.29655	1.56;3.11;3.11;3.11	4.31	1.44	0.22558	.	0.173458	0.27906	N	0.017378	T	0.15262	0.0368	N	0.08118	0	0.09310	N	0.999998	B;B;B	0.15719	0.004;0.004;0.014	B;B;B	0.19391	0.011;0.011;0.025	T	0.20874	-1.0262	10	0.62326	D	0.03	0.5081	8.8604	0.35253	0.275:0.0:0.725:0.0	.	143;271;235	Q8N0S2-3;Q8N0S2;Q8N0S2-2	.;SYCE1_HUMAN;.	K	271;235;235;271	ENSP00000303978:Q271K;ENSP00000411779:Q235K;ENSP00000357503:Q235K;ENSP00000341282:Q271K	ENSP00000303978:Q271K	Q	-	1	0	SYCE1	135219110	0.984000	0.35163	0.973000	0.42090	0.012000	0.07955	0.755000	0.26405	0.082000	0.17018	-1.134000	0.01955	CAG			0.612	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_201564	
ASCL2	430	mdanderson.org	37	11	2291319	2291319	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr11:2291319C>T	ENST00000331289.4	-	1	863	c.244G>A	c.(244-246)Gcc>Acc	p.A82T		NM_005170.2	NP_005161.1	Q99929	ASCL2_HUMAN	achaete-scute family bHLH transcription factor 2	82	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|somatic stem cell maintenance (GO:0035019)|spongiotrophoblast differentiation (GO:0060708)|spongiotrophoblast layer development (GO:0060712)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_epithelial(84;5.75e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.191)|all_lung(207;0.24)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		TTCTTGCTGGCGCCGCCGTGC	0.711																																					p.A82T	Esophageal Squamous(189;1588 2082 17406 36815 44895)												.	.			0			c.G244A												4.0	3.0	4.0					11																	2291319		1766	3556	5322	SO:0001583	missense	430	exon1			TGCTGGCGCCGCC		CCDS7732.1	11p15.5	2013-10-17	2013-10-17		ENSG00000183734	ENSG00000183734		"""Basic helix-loop-helix proteins"""	739	protein-coding gene	gene with protein product		601886	"""achaete-scute complex (Drosophila) homolog-like 2"", ""achaete-scute complex-like 2 (Drosophila)"", ""achaete-scute complex homolog 2 (Drosophila)"""			9175731	Standard	NM_005170		Approved	ASH2, HASH2, bHLHa45	uc001lvu.3	Q99929	OTTHUMG00000009648	ENST00000331289.4:c.244G>A	11.37:g.2291319C>T	ENSP00000332293:p.Ala82Thr		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_005170	0		0	Q6PEY9|Q9UM68	Missense_Mutation	SNP	ENST00000331289.4	37	CCDS7732.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.302658	0.81136	.	.	ENSG00000183734	ENST00000331289	D	0.97831	-4.56	3.89	2.96	0.34315	Helix-loop-helix DNA-binding (5);	0.000000	0.64402	U	0.000003	D	0.97281	0.9111	L	0.49455	1.56	0.52501	D	0.99995	D	0.76494	0.999	D	0.66602	0.945	D	0.95119	0.8245	10	0.14656	T	0.56	-13.0796	12.0796	0.53663	0.1738:0.8262:0.0:0.0	.	82	Q99929	ASCL2_HUMAN	T	82	ENSP00000332293:A82T	ENSP00000332293:A82T	A	-	1	0	ASCL2	2247895	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	3.328000	0.52052	0.752000	0.32923	0.306000	0.20318	GCC			0.711	ASCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026607.1		NM_005170	
OR51A4	401666	ucsc.edu	37	11	4967831	4967831	+	Missense_Mutation	SNP	T	T	C	rs2595987	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr11:4967831T>C	ENST00000380373.2	-	1	525	c.500A>G	c.(499-501)aAc>aGc	p.N167S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATATCTCAAGTTTCTTAAAGT	0.408													.|||	429	0.0856629	0.0681	0.0634	5008	,	,		26152	0.0506		0.1262	False		,,,				2504	0.1196				p.N167S													.	OR51A4	73		0			c.A500G												219.0	204.0	209.0					11																	4967831		2179	4244	6423	SO:0001583	missense	401666	exon1			CTCAAGTTTCTTA	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.500A>G	11.37:g.4967831T>C	ENSP00000369731:p.Asn167Ser		Somatic	293	0.1365187713	40		WXS	Illumina HiSeq		85	0.38	32	NM_001005329	0		0		Missense_Mutation	SNP	ENST00000380373.2	37	CCDS31367.1	215	0.09844322344322344	29	0.05894308943089431	41	0.1132596685082873	31	0.05419580419580419	114	0.1503957783641161	C	9.279	1.047619	0.19827	.	.	ENSG00000205497	ENST00000380373	T	0.72505	-0.66	3.44	-2.14	0.07123	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	N	0.01705	-0.755	0.80722	P	0.0	B	0.02656	0.0	B	0.09377	0.004	T	0.03193	-1.1062	8	0.59425	D	0.04	.	3.0937	0.06302	0.3227:0.2548:0.0:0.4225	rs2595987;rs2898970	167	Q8NGJ6	O51A4_HUMAN	S	167	ENSP00000369731:N167S	ENSP00000369731:N167S	N	-	2	0	OR51A4	4924407	0.000000	0.05858	0.000000	0.03702	0.159000	0.22180	-0.702000	0.05069	-0.651000	0.05415	-0.348000	0.07805	AAC			0.408	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000142821.1		NM_001005329	
GTF2H1	2965	mdanderson.org	37	11	18387386	18387386	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr11:18387386G>A	ENST00000265963.4	+	15	1777	c.1617G>A	c.(1615-1617)tgG>tgA	p.W539*	GTF2H1_ENST00000530496.2_Nonsense_Mutation_p.W227*|GTF2H1_ENST00000526630.2_Nonsense_Mutation_p.W129*|GTF2H1_ENST00000453096.2_Nonsense_Mutation_p.W539*|GTF2H1_ENST00000534641.1_Nonsense_Mutation_p.W423*	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	539					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						TCCACACATGGCAGTCACGGC	0.478								Nucleotide excision repair (NER)																													p.W539X													.	.			0			c.G1617A												154.0	132.0	140.0					11																	18387386		2199	4293	6492	SO:0001587	stop_gained	2965	exon16			CACATGGCAGTCA		CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.1617G>A	11.37:g.18387386G>A	ENSP00000265963:p.Trp539*		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001142307	75	0.00	0	B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Nonsense_Mutation	SNP	ENST00000265963.4	37	CCDS7838.1	.	.	.	.	.	.	.	.	.	.	G	38	6.909768	0.97928	.	.	ENSG00000110768	ENST00000453096;ENST00000534641;ENST00000265963;ENST00000530496;ENST00000526630	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-0.1585	20.3931	0.98965	0.0:0.0:1.0:0.0	.	.	.	.	X	539;423;539;227;129	.	ENSP00000265963:W539X	W	+	3	0	GTF2H1	18343962	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.760000	0.91671	2.824000	0.97209	0.655000	0.94253	TGG			0.478	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395627.2		NM_005316	
MYBPC3	4607	mdanderson.org	37	11	47355259	47355259	+	Silent	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr11:47355259G>T	ENST00000545968.1	-	29	3093	c.3039C>A	c.(3037-3039)ccC>ccA	p.P1013P	MYBPC3_ENST00000256993.4_Silent_p.P1012P|MYBPC3_ENST00000399249.2_Silent_p.P1013P	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	1013	Ig-like C2-type 6.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CGCCTGCCAGGGGCTGCCCCT	0.652																																					p.P1013P													.	.			0			c.C3039A												43.0	51.0	48.0					11																	47355259		2114	4221	6335	SO:0001819	synonymous_variant	4607	exon28			TGCCAGGGGCTGC	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.3039C>A	11.37:g.47355259G>T			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_000256	1	0.00	0	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Silent	SNP	ENST00000545968.1	37	CCDS53621.1																																																																																					0.652	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000392271.3			
TCIRG1	10312	mdanderson.org	37	11	67817527	67817527	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr11:67817527G>T	ENST00000265686.3	+	17	2220	c.2112G>T	c.(2110-2112)gaG>gaT	p.E704D	RP11-802E16.3_ENST00000526897.1_RNA|TCIRG1_ENST00000532635.1_Missense_Mutation_p.E488D|RP11-802E16.3_ENST00000529934.1_RNA|RP11-802E16.3_ENST00000534517.1_RNA	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	704					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						ATGAAGAGGAGGCCGAGGTGG	0.662																																					p.E704D													.	.			0			c.G2112T												43.0	45.0	44.0					11																	67817527		2199	4294	6493	SO:0001583	missense	10312	exon17			AGAGGAGGCCGAG	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2112G>T	11.37:g.67817527G>T	ENSP00000265686:p.Glu704Asp		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_006019	87	0.00	0	O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	CCDS8177.1	.	.	.	.	.	.	.	.	.	.	G	6.909	0.537395	0.13188	.	.	ENSG00000110719	ENST00000265686;ENST00000532635;ENST00000546315;ENST00000530063	D;D;D	0.86694	-2.16;-2.16;-2.16	3.89	-5.55	0.02536	.	1.839880	0.03384	N	0.200801	T	0.73931	0.3650	L	0.28458	0.855	0.09310	N	1	B	0.10296	0.003	B	0.17979	0.02	T	0.57797	-0.7749	10	0.20046	T	0.44	-4.2738	0.1038	0.00050	0.2937:0.2522:0.1904:0.2637	.	704	Q13488	VPP3_HUMAN	D	704;488;62;5	ENSP00000265686:E704D;ENSP00000434407:E488D;ENSP00000432957:E5D	ENSP00000265686:E704D	E	+	3	2	TCIRG1	67574103	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.358000	0.07641	-1.027000	0.03325	0.462000	0.41574	GAG			0.662	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394305.1		NM_006019	
SPCS2	9789	broad.mit.edu	37	11	74680617	74680617	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr11:74680617G>T	ENST00000263672.6	+	4	406	c.367G>T	c.(367-369)Gtg>Ttg	p.V123L	SPCS2_ENST00000526361.1_Intron|SPCS2_ENST00000530257.1_Intron|RNU6-216P_ENST00000363282.1_RNA|SPCS2_ENST00000528265.1_Intron	NM_014752.2	NP_055567.2	Q15005	SPCS2_HUMAN	signal peptidase complex subunit 2 homolog (S. cerevisiae)	123					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			breast(1)	1						AACCTATTTTGTGATGATGGG	0.353																																					p.V123L													.	SPCS2	17		0			c.G367T												103.0	87.0	92.0					11																	74680617		1835	4081	5916	SO:0001583	missense	9789	exon4			TATTTTGTGATGA	D14658	CCDS44681.1	11q13.4	2008-02-05			ENSG00000118363	ENSG00000118363			28962	protein-coding gene	gene with protein product						7788527	Standard	NM_014752		Approved	KIAA0102	uc001ovu.2	Q15005	OTTHUMG00000165517	ENST00000263672.6:c.367G>T	11.37:g.74680617G>T	ENSP00000263672:p.Val123Leu		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	86	0.03	3	NM_014752	18	0.00	0	Q15507|Q3KQT0|Q641R4|Q6FG65|Q6IRX0|Q6P1P4|Q96HU9	Missense_Mutation	SNP	ENST00000263672.6	37	CCDS44681.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160011	0.38119	.	.	ENSG00000118363	ENST00000263672;ENST00000532972;ENST00000526883	.	.	.	5.33	4.4	0.53042	.	0.695522	0.13540	N	0.380317	T	0.28632	0.0709	N	0.05383	-0.06	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.14420	-1.0473	9	0.15952	T	0.53	-6.0E-4	8.1355	0.31052	0.0886:0.163:0.7485:0.0	.	123	Q15005	SPCS2_HUMAN	L	123;154;127	.	ENSP00000263672:V123L	V	+	1	0	SPCS2	74358265	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.234000	0.58658	2.649000	0.89929	0.650000	0.86243	GTG			0.353	SPCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384587.1		NM_014752	
NCAM1	4684	mdanderson.org	37	11	113133588	113133588	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr11:113133588G>A	ENST00000533760.1	+	17	2367	c.1768G>A	c.(1768-1770)Gca>Aca	p.A590T	NCAM1_ENST00000397957.4_Intron|NCAM1_ENST00000316851.7_Intron	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	0	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		AGGCAATTCTGCATCCTACAC	0.433																																					p.A743T													.	.			0			c.G2227A												159.0	154.0	156.0					11																	113133588		1930	4126	6056	SO:0001583	missense	4684	exon20			AATTCTGCATCCT		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1768G>A	11.37:g.113133588G>A	ENSP00000473281:p.Ala590Thr		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	111	0.05	5	NM_001076682	0		0	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37																																																																																						0.433	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000394068.2		NM_000615	
DCP1B	196513	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	2062350	2062350	+	Missense_Mutation	SNP	C	C	G	rs570843986	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr12:2062350C>G	ENST00000280665.6	-	7	835	c.756G>C	c.(754-756)caG>caC	p.Q252H	DCP1B_ENST00000397173.4_Missense_Mutation_p.Q150H|DCP1B_ENST00000540622.1_Missense_Mutation_p.Q126H|DCP1B_ENST00000541700.1_5'UTR	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	252	Poly-Gln.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.Q252H(8)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			gctgctgctgctgGTGGAGAG	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		14619	0.002		0.0	False		,,,				2504	0.0				p.Q252H													DCP1B,bladder,carcinoma,0,13	DCP1B	0	13	8	Substitution - Missense(8)	endometrium(5)|lung(2)|large_intestine(1)	c.G756C												35.0	42.0	40.0					12																	2062350		2203	4300	6503	SO:0001583	missense	196513	exon7			CTGCTGCTGGTGG	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.756G>C	12.37:g.2062350C>G	ENSP00000280665:p.Gln252His		Somatic	23	0	0		WXS	Illumina HiSeq	.	88	0.07	6	NM_152640	84	0.00	0	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	ENST00000280665.6	37	CCDS31727.1	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361713	0.01235	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.19250	2.19;2.17;2.16	4.04	-8.09	0.01090	.	1.568620	0.03045	N	0.153823	T	0.13072	0.0317	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15694	-1.0428	10	0.17369	T	0.5	.	12.662	0.56820	0.0881:0.1213:0.7178:0.0728	.	150;252	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	H	252;150;126	ENSP00000280665:Q252H;ENSP00000380358:Q150H;ENSP00000444374:Q126H	ENSP00000280665:Q252H	Q	-	3	2	DCP1B	1932611	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.268000	0.02836	-2.090000	0.00859	-2.175000	0.00321	CAG			0.552	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398244.1		NM_152640	
SETD1B	23067	broad.mit.edu;mdanderson.org	37	12	122257461	122257461	+	Silent	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr12:122257461G>A	ENST00000604567.1	+	11	3638	c.3570G>A	c.(3568-3570)gaG>gaA	p.E1190E	SETD1B_ENST00000542440.1_Silent_p.E1147E|SETD1B_ENST00000267197.5_Silent_p.E1147E			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1190	Glu-rich.|Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						aggaagaagaggaggaggagg	0.617																																					p.E1147E													.	SETD1B	105		0			c.G3441A												64.0	75.0	72.0					12																	122257461		692	1591	2283	SO:0001819	synonymous_variant	23067	exon11			AGAAGAGGAGGAG	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.3570G>A	12.37:g.122257461G>A			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_015048	17	0.00	0	F6MFW1	Silent	SNP	ENST00000604567.1	37																																																																																						0.617	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000468264.1		XM_037523	
TPTE2P1	646405	broad.mit.edu	37	13	25525716	25525716	+	RNA	DEL	A	A	-	rs200495212	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr13:25525716delA	ENST00000429698.1	-	0	282							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		TGGAAGAAACAAAAAAAAGAA	0.383													AAAAAAA|AAAAAAAA|AAAAAAA|insertion	774	0.154553	0.1256	0.1571	5008	,	,		14949	0.2123		0.162	False		,,,				2504	0.1247				.													.	.			0			.																																											0	.			AGAAACAAAAAAA			13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25525716delA			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	11	0.55	6	.	0		0	B3KST4|B4DMH9	RNA	DEL	ENST00000429698.1	37																																																																																						0.383	TPTE2P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000044206.1			
INTS6	26512	mdanderson.org	37	13	51961633	51961633	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr13:51961633C>T	ENST00000311234.4	-	7	1255	c.783G>A	c.(781-783)tgG>tgA	p.W261*	INTS6_ENST00000463928.1_Nonsense_Mutation_p.W261*|INTS6_ENST00000398119.2_Nonsense_Mutation_p.W248*|INTS6_ENST00000425000.1_5'UTR|INTS6_ENST00000497989.1_Nonsense_Mutation_p.W83*|INTS6_ENST00000490542.1_5'Flank|INTS6_ENST00000420668.2_3'UTR	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	261					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		GACAGCTATGCCAAGGCTGAG	0.403																																					p.W261X													.	.			0			c.G783A												75.0	69.0	71.0					13																	51961633		2203	4300	6503	SO:0001587	stop_gained	26512	exon7			GCTATGCCAAGGC	AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.783G>A	13.37:g.51961633C>T	ENSP00000310260:p.Trp261*		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_012141	5	0.00	0	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Nonsense_Mutation	SNP	ENST00000311234.4	37	CCDS9428.1	.	.	.	.	.	.	.	.	.	.	C	39	7.633482	0.98403	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000497989	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-4.7342	17.2129	0.86935	0.0:1.0:0.0:0.0	.	.	.	.	X	261;248;83	.	ENSP00000310260:W261X	W	-	3	0	INTS6	50859634	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.772000	0.85439	2.356000	0.79943	0.561000	0.74099	TGG			0.403	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045023.1		NM_012141	
CUL4A	8451	mdanderson.org	37	13	113864355	113864355	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr13:113864355G>T	ENST00000375440.4	+	2	301	c.217G>T	c.(217-219)Gtg>Ttg	p.V73L	PCID2_ENST00000375457.2_5'Flank|CUL4A_ENST00000463426.1_3'UTR|PCID2_ENST00000375477.1_5'Flank|PCID2_ENST00000375459.1_5'Flank|CUL4A_ENST00000326335.4_5'UTR|PCID2_ENST00000375479.2_5'Flank|PCID2_ENST00000337344.4_5'Flank|CUL4A_ENST00000375441.3_5'UTR|CUL4A_ENST00000451881.1_5'UTR|PCID2_ENST00000246505.5_5'Flank	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	73					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			GGTGCGGGCCGTGCAGAGCAG	0.711																																					p.V73L													.	.			0			c.G217T												7.0	9.0	9.0					13																	113864355		1902	4006	5908	SO:0001583	missense	8451	exon2			CGGGCCGTGCAGA	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.217G>T	13.37:g.113864355G>T	ENSP00000364589:p.Val73Leu		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001008895	56	0.00	0	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458994	0.43634	.	.	ENSG00000139842	ENST00000375440	T	0.77877	-1.13	5.31	4.15	0.48705	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.056591	0.64402	D	0.000003	T	0.71005	0.3289	L	0.49513	1.565	0.80722	D	1	B	0.02656	0.0	B	0.10450	0.005	T	0.67377	-0.5686	10	0.87932	D	0	-16.2213	9.4635	0.38798	0.9138:0.0:0.0862:0.0	.	73	Q13619	CUL4A_HUMAN	L	73	ENSP00000364589:V73L	ENSP00000364589:V73L	V	+	1	0	CUL4A	112912356	1.000000	0.71417	0.664000	0.29753	0.000000	0.00434	5.503000	0.66962	0.882000	0.36016	-0.389000	0.06534	GTG			0.711	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045888.3		NM_003589	
ANG	283	broad.mit.edu	37	14	21162161	21162161	+	Silent	SNP	T	T	G			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr14:21162161T>G	ENST00000336811.6	+	2	1038	c.438T>G	c.(436-438)cgT>cgG	p.R146R	ANG_ENST00000397990.4_Silent_p.R146R|RNASE4_ENST00000555835.1_Intron|RNASE4_ENST00000397995.2_Intron|ANG_ENST00000554073.1_Intron|RNASE4_ENST00000555597.1_Intron|RNASE4_ENST00000304704.4_Intron|RP11-903H12.3_ENST00000554286.1_RNA|AL163636.6_ENST00000553909.1_Intron	NM_001145.4	NP_001136.1	P03950	ANGI_HUMAN	angiogenin, ribonuclease, RNase A family, 5	146					actin filament polymerization (GO:0030041)|activation of phospholipase A2 activity (GO:0032431)|activation of phospholipase C activity (GO:0007202)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|cell communication (GO:0007154)|cell death (GO:0008219)|cell migration (GO:0016477)|diacylglycerol biosynthetic process (GO:0006651)|homeostatic process (GO:0042592)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|placenta development (GO:0001890)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein secretion (GO:0050714)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|RNA phosphodiester bond hydrolysis (GO:0090501)|rRNA transcription (GO:0009303)	angiogenin-PRI complex (GO:0032311)|basal lamina (GO:0005605)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	actin binding (GO:0003779)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|heparin binding (GO:0008201)|peptide binding (GO:0042277)|receptor binding (GO:0005102)|ribonuclease activity (GO:0004540)|rRNA binding (GO:0019843)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)	5	all_cancers(95;0.00387)	all_cancers(140;0.196)|all_epithelial(140;0.156)	Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	OV - Ovarian serous cystadenocarcinoma(311;3.25e-17)|GBM - Glioblastoma multiforme(265;5.56e-07)		TTTTCCGTCGTCCGTAACCAG	0.552																																					p.R146R													.	ANG	8		0			c.T438G												88.0	85.0	86.0					14																	21162161		2203	4300	6503	SO:0001819	synonymous_variant	283	exon2			CCGTCGTCCGTAA		CCDS9554.1	14q11.1-q11.2	2014-09-17			ENSG00000214274	ENSG00000214274	3.1.27.-	"""Ribonucleases, RNase A"""	483	protein-coding gene	gene with protein product		105850				1978563	Standard	NM_001145		Approved	RNASE5	uc001vxw.4	P03950	OTTHUMG00000029576	ENST00000336811.6:c.438T>G	14.37:g.21162161T>G			Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	175	0.02	4	NM_001097577	14	0.00	0	Q05CV1|Q53X86|Q6P5T2|Q8WXE7	Silent	SNP	ENST00000336811.6	37	CCDS9554.1																																																																																					0.552	ANG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000073731.3		NM_001097577	
ARHGEF40	55701	mdanderson.org	37	14	21542129	21542129	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr14:21542129G>A	ENST00000298694.4	+	3	367	c.240G>A	c.(238-240)tgG>tgA	p.W80*	ARHGEF40_ENST00000298693.3_Nonsense_Mutation_p.W80*			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	80						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						ATGAGGGGTGGCCGCTCTGCC	0.612																																					p.W80X													.	.			0			c.G240A												61.0	63.0	62.0					14																	21542129		2203	4300	6503	SO:0001587	stop_gained	55701	exon3			GGGGTGGCCGCTC		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.240G>A	14.37:g.21542129G>A	ENSP00000298694:p.Trp80*		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_018071	7	0.00	0	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Nonsense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	G	33	5.257456	0.95368	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	.	.	.	4.81	4.81	0.61882	.	0.000000	0.45867	D	0.000324	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.42	0.75003	0.0:0.0:1.0:0.0	.	.	.	.	X	80	.	ENSP00000298693:W80X	W	+	3	0	ARHGEF40	20611969	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.753000	0.85153	2.504000	0.84457	0.561000	0.74099	TGG			0.612	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413122.1			
STON2	85439	mdanderson.org	37	14	81837529	81837529	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr14:81837529G>T	ENST00000267540.2	-	3	574	c.374C>A	c.(373-375)gCc>gAc	p.A125D	STON2_ENST00000555447.1_Splice_Site_p.A125D	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	125					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CAATGGTAGGGCTGGGGAGAG	0.448																																					p.A125D													.	.			0			c.C374A												69.0	69.0	69.0					14																	81837529		2203	4300	6503	SO:0001630	splice_region_variant	85439	exon5			GGTAGGGCTGGGG	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.374-1C>A	14.37:g.81837529G>T			Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001256430	0		0	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.389687	0.42410	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.56275	0.47;0.47	6.04	5.14	0.70334	Stonin-2, N-terminal (1);	0.590192	0.16796	N	0.199170	T	0.42063	0.1186	L	0.54323	1.7	0.27078	N	0.963154	B;B	0.27416	0.096;0.178	B;B	0.27380	0.061;0.079	T	0.33954	-0.9848	10	0.13853	T	0.58	.	5.2113	0.15318	0.0764:0.1625:0.6161:0.145	.	125;125	Q8WXE9;G3V2T7	STON2_HUMAN;.	D	125;137;125	ENSP00000450857:A125D;ENSP00000267540:A125D	ENSP00000267540:A125D	A	-	2	0	STON2	80907282	0.989000	0.36119	0.923000	0.36655	0.972000	0.66771	2.145000	0.42207	1.529000	0.49120	0.561000	0.74099	GCC			0.448	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000413317.1		NM_033104	Missense_Mutation
MPPE1P1	390501	bcgsc.ca	37	14	89577485	89577485	+	IGR	SNP	A	A	G			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr14:89577485A>G								TTC8 (233150 upstream) : FOXN3 (45030 downstream)																							CACAGAGAAGACAATGAATTT	0.388																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GAGAAGACAATGA																													14.37:g.89577485A>G			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_1	40	0.10	4	.	0		0		RNA	SNP		37																																																																																					0	0.388										
CAPN3	825	broad.mit.edu	37	15	42684848	42684848	+	Silent	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr15:42684848G>T	ENST00000397163.3	+	7	1176	c.957G>T	c.(955-957)ccG>ccT	p.P319P	CAPN3_ENST00000356316.3_Silent_p.P232P|CAPN3_ENST00000318023.7_Silent_p.P319P|CAPN3_ENST00000349748.3_Silent_p.P271P|CAPN3_ENST00000357568.3_Silent_p.P319P|RP11-164J13.1_ENST00000495723.1_RNA	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	319	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.		P -> L (in LGMD2A).		apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CAATCATTCCGGTTCAGTATG	0.542																																					p.P319P													.	CAPN3	172		0			c.G957T												80.0	69.0	73.0					15																	42684848		2203	4299	6502	SO:0001819	synonymous_variant	825	exon7			CATTCCGGTTCAG	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.957G>T	15.37:g.42684848G>T			Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	121	0.03	4	NM_000070	3	0.00	0	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Silent	SNP	ENST00000397163.3	37	CCDS45245.1																																																																																					0.542	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000421075.1			
ARIH1	25820	broad.mit.edu	37	15	72767235	72767235	+	Silent	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr15:72767235C>T	ENST00000379887.4	+	1	569	c.255C>T	c.(253-255)ggC>ggT	p.G85G	RP11-1007O24.3_ENST00000565181.1_lincRNA	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	85	Gly-rich.				cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						gcggcggcggcggtggtggtg	0.736																																					p.G85G													.	ARIH1	42		0			c.C255T												4.0	3.0	3.0					15																	72767235		1491	2998	4489	SO:0001819	synonymous_variant	25820	exon1			CGGCGGCGGTGGT	AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.255C>T	15.37:g.72767235C>T			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	42	0.10	4	NM_005744	0		0	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Silent	SNP	ENST00000379887.4	37	CCDS10244.1																																																																																					0.736	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257350.1		NM_005744	
RASGRF1	5923	hgsc.bcm.edu;broad.mit.edu	37	15	79284128	79284128	+	Silent	SNP	G	G	T	rs147869279	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr15:79284128G>T	ENST00000419573.3	-	22	3358	c.3084C>A	c.(3082-3084)ggC>ggA	p.G1028G	RASGRF1_ENST00000394745.3_Silent_p.G244G|RASGRF1_ENST00000558480.2_Silent_p.G1012G|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1028					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G1028G(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CAGCCTTCACGCCTTCAGCCT	0.547																																					p.G1028G													RASGRF1,colon,carcinoma,0,1	RASGRF1	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C3084A												91.0	80.0	84.0					15																	79284128		2196	4293	6489	SO:0001819	synonymous_variant	5923	exon22			CTTCACGCCTTCA	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3084C>A	15.37:g.79284128G>T			Somatic	102	0	0		WXS	Illumina HiSeq	.	94	0.04	4	NM_002891	0		0	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	CCDS10309.1																																																																																					0.547	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000291371.3		NM_002891	
WASH4P	374677	broad.mit.edu	37	16	67326	67326	+	Silent	SNP	G	G	A	rs553244168	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr16:67326G>A	ENST00000326592.9	-	4	1207	c.549C>T	c.(547-549)gtC>gtT	p.V183V	Z84812.4_ENST00000568710.1_RNA			A8MWX3	WASH4_HUMAN	WAS protein family homolog 4 pseudogene	183					Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GCAAGGAGCTGACAGAGCTGA	0.612											OREG0003691	type=REGULATORY REGION|Gene=BC063682|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	G|||	11	0.00219649	0.0	0.0058	5008	,	,		27187	0.0		0.005	False		,,,				2504	0.002				.													.	.			0			.																																									SO:0001819	synonymous_variant	0	.			GGAGCTGACAGAG			16p13.3	2014-08-28	2008-01-16	2008-01-16	ENSG00000234769	ENSG00000234769		"""WAS protein homologs"""	14126	other	unknown			"""family with sequence similarity 39, member C pseudogene"""	FAM39CP		9054936, 11701968, 18159949	Standard	NG_003159		Approved	FLJ31670		A8MWX3	OTTHUMG00000059914	ENST00000326592.9:c.549C>T	16.37:g.67326G>A			Somatic	21	0	0	585	WXS	Illumina HiSeq	Phase_I	37	0.16	6	.	10	0.00	0		Silent	SNP	ENST00000326592.9	37																																																																																						0.612	WASH4P-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000133175.2		NG_003159	
ZNF598	90850	mdanderson.org	37	16	2052283	2052283	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr16:2052283G>T	ENST00000563630.1	-	5	896	c.654C>A	c.(652-654)agC>agA	p.S218R	ZNF598_ENST00000562103.1_Missense_Mutation_p.S218R|ZNF598_ENST00000431526.1_Missense_Mutation_p.S273R			Q86UK7	ZN598_HUMAN	zinc finger protein 598	273							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CCTCGGCGCGGCTGCGACTGT	0.677																																					p.S273R													ZNF598,NS,carcinoma,-1,1	ZNF598	-1	1	0			c.C819A												32.0	43.0	39.0					16																	2052283		2152	4222	6374	SO:0001583	missense	90850	exon7			GGCGCGGCTGCGA	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.654C>A	16.37:g.2052283G>T	ENSP00000455882:p.Ser218Arg		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_178167	92	0.00	0	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000563630.1	37		.	.	.	.	.	.	.	.	.	.	.	19.46	3.831103	0.71258	.	.	ENSG00000167962	ENST00000431526	T	0.14022	2.54	4.68	3.71	0.42584	.	0.046850	0.85682	D	0.000000	T	0.20495	0.0493	N	0.25825	0.765	0.34114	D	0.66328	D	0.69078	0.997	D	0.62955	0.909	T	0.20538	-1.0272	10	0.41790	T	0.15	-25.6447	12.2586	0.54636	0.0849:0.0:0.9151:0.0	.	273	Q86UK7	ZN598_HUMAN	R	273	ENSP00000411409:S273R	ENSP00000411409:S273R	S	-	3	2	ZNF598	1992284	1.000000	0.71417	0.998000	0.56505	0.664000	0.39144	4.444000	0.60001	0.942000	0.37525	0.462000	0.41574	AGC			0.677	ZNF598-001	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000434439.1		NM_178167	
LOC653786	653786	broad.mit.edu	37	16	22579566	22579569	+	RNA	DEL	ATTC	ATTC	-	rs370421878|rs200819155		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	ATTC	ATTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr16:22579566_22579569delATTC	ENST00000550753.1	+	0	1976					NR_003676.2																						AAATGGGTTAattcatccatccat	0.426																																					.													.	.			0			.																																											0	.			GGGTTAATTCATC																													16.37:g.22579566_22579569delATTC			Somatic	81	0.1358024691	11		WXS	Illumina HiSeq	Phase_I	70	0.10	7	.	0		0		RNA	DEL	ENST00000550753.1	37																																																																																						0.426	RP11-368J21.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409041.1			
KIF22	3835	mdanderson.org	37	16	29809712	29809712	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr16:29809712G>T	ENST00000160827.4	+	3	324	c.284G>T	c.(283-285)gGg>gTg	p.G95V	KIF22_ENST00000400751.5_Missense_Mutation_p.G27V|KIF22_ENST00000561482.1_Missense_Mutation_p.G27V|KIF22_ENST00000569382.2_Missense_Mutation_p.G27V|KIF22_ENST00000400750.2_5'UTR	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	95	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						GCCTTCTATGGGGAGAGGAGT	0.532																																					p.G95V													.	.			0			c.G284T												124.0	114.0	117.0					16																	29809712		2197	4300	6497	SO:0001583	missense	3835	exon3			TCTATGGGGAGAG	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.284G>T	16.37:g.29809712G>T	ENSP00000160827:p.Gly95Val		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_007317	178	0.00	0	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	ENST00000160827.4	37	CCDS10653.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.695843	0.68386	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.74315	-0.83;-0.83	5.85	5.85	0.93711	Kinesin, motor domain (4);	.	.	.	.	D	0.88362	0.6416	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.89629	0.3854	9	0.87932	D	0	.	17.6554	0.88176	0.0:0.0:1.0:0.0	.	27;95	B7Z265;Q14807	.;KIF22_HUMAN	V	95;27	ENSP00000160827:G95V;ENSP00000383562:G27V	ENSP00000160827:G95V	G	+	2	0	KIF22	29717213	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.387000	0.59626	2.772000	0.95346	0.655000	0.94253	GGG			0.532	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215012.2			
FBXL19	54620	mdanderson.org	37	16	30941668	30941668	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr16:30941668C>A	ENST00000380310.2	+	7	1282	c.1124C>A	c.(1123-1125)cCt>cAt	p.P375H	FBXL19_ENST00000565690.1_Missense_Mutation_p.P239H|FBXL19_ENST00000338343.4_Missense_Mutation_p.P355H|FBXL19_ENST00000471231.2_Missense_Mutation_p.P63H|FBXL19_ENST00000562319.1_Missense_Mutation_p.P355H	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	375	Pro-rich.				proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						GCTGTGCGCCCTGGCAGTGGG	0.766																																					p.P375H													.	.			0			c.C1124A												5.0	6.0	6.0					16																	30941668		1574	3579	5153	SO:0001583	missense	54620	exon7			TGCGCCCTGGCAG	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.1124C>A	16.37:g.30941668C>A	ENSP00000369666:p.Pro375His		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001099784	24	0.00	0	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	37	CCDS45465.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485615	0.44147	.	.	ENSG00000099364	ENST00000338343;ENST00000380310	T;T	0.22945	1.93;2.25	5.3	5.3	0.74995	.	0.537818	0.16543	N	0.209826	T	0.22003	0.0530	N	0.01352	-0.895	0.38648	D	0.951781	D;D	0.76494	0.999;0.999	P;D	0.65684	0.867;0.937	T	0.49041	-0.8980	10	0.15499	T	0.54	-7.1126	17.7257	0.88364	0.0:1.0:0.0:0.0	.	375;332	Q6PCT2;Q6PCT2-2	FXL19_HUMAN;.	H	355;375	ENSP00000339712:P355H;ENSP00000369666:P375H	ENSP00000339712:P355H	P	+	2	0	FBXL19	30849169	0.987000	0.35691	0.969000	0.41365	0.382000	0.30200	2.869000	0.48444	2.490000	0.84030	0.655000	0.94253	CCT			0.766	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_019085	
FAM65A	79567	mdanderson.org	37	16	67576061	67576061	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr16:67576061G>T	ENST00000379312.3	+	13	1505	c.1384G>T	c.(1384-1386)Gct>Tct	p.A462S	CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000422602.2_Missense_Mutation_p.A478S|FAM65A_ENST00000540839.3_Missense_Mutation_p.A478S|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000428437.2_Missense_Mutation_p.A472S|FAM65A_ENST00000042381.4_Missense_Mutation_p.A458S	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	462						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TAGTGTAGATGCTGCCTTGGC	0.632																																					p.A478S													.	.			0			c.G1432T												70.0	66.0	67.0					16																	67576061		2198	4300	6498	SO:0001583	missense	79567	exon13			GTAGATGCTGCCT	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.1384G>T	16.37:g.67576061G>T	ENSP00000368614:p.Ala462Ser		Somatic	70	0.0142857143	1		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001193523	18	0.00	0	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.84|19.84	3.902818|3.902818	0.72754|0.72754	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|.	0.35048|.	1.33;1.33;1.33|.	4.56|4.56	4.56|4.56	0.56223|0.56223	.|.	0.334384|.	0.31472|.	N|.	0.007584|.	T|T	0.58192|0.58192	0.2105|0.2105	L|L	0.41236|0.41236	1.265|1.265	0.41657|0.41657	D|D	0.989166|0.989166	D;D;D;D|.	0.60575|.	0.988;0.988;0.988;0.988|.	P;P;P;P|.	0.54759|.	0.76;0.76;0.76;0.696|.	T|T	0.56420|0.56420	-0.7982|-0.7982	10|5	0.10636|.	T|.	0.68|.	-11.1896|-11.1896	13.9141|13.9141	0.63885|0.63885	0.0:0.1533:0.8467:0.0|0.0:0.1533:0.8467:0.0	.|.	472;478;462;478|.	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9|.	.;.;FA65A_HUMAN;.|.	S|F	462;458;478;472|452	ENSP00000368614:A462S;ENSP00000042381:A458S;ENSP00000400099:A478S|.	ENSP00000042381:A458S|.	A|C	+|+	1|2	0|0	FAM65A|FAM65A	66133562|66133562	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.914000|0.914000	0.54420|0.54420	7.432000|7.432000	0.80349|0.80349	2.104000|2.104000	0.64026|0.64026	0.549000|0.549000	0.68633|0.68633	GCT|TGC			0.632	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000268866.3		NM_024519	
SMTNL2	342527	mdanderson.org	37	17	4500213	4500213	+	Missense_Mutation	SNP	G	G	A	rs200110141		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:4500213G>A	ENST00000389313.4	+	6	1115	c.1048G>A	c.(1048-1050)Gcc>Acc	p.A350T	SMTNL2_ENST00000338859.4_Missense_Mutation_p.A206T	NM_001114974.1	NP_001108446.1	Q2TAL5	SMTL2_HUMAN	smoothelin-like 2	350										breast(1)|endometrium(9)|kidney(1)|lung(1)|skin(1)	13				READ - Rectum adenocarcinoma(115;0.0325)		CGTGGCCAGCGCCAGCAGCAT	0.721													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15800	0.0		0.0	False		,,,				2504	0.0				p.A350T													.	.			0			c.G1048A												11.0	11.0	11.0					17																	4500213		2049	4046	6095	SO:0001583	missense	342527	exon6			GCCAGCGCCAGCA	AK124452	CCDS11048.1, CCDS45583.1	17p13.2	2006-04-26			ENSG00000188176	ENSG00000188176			24764	protein-coding gene	gene with protein product							Standard	NM_001114974		Approved	FLJ42461	uc002fyf.1	Q2TAL5	OTTHUMG00000132938	ENST00000389313.4:c.1048G>A	17.37:g.4500213G>A	ENSP00000373964:p.Ala350Thr		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001114974	9	0.00	0	Q6ZVK6	Missense_Mutation	SNP	ENST00000389313.4	37	CCDS45583.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	36	5.600166	0.96614	.	.	ENSG00000188176	ENST00000338859;ENST00000389313	T;T	0.59638	0.25;0.25	5.51	5.51	0.81932	Calponin homology domain (1);	.	.	.	.	T	0.63165	0.2488	N	0.17082	0.46	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.65080	-0.6255	9	0.46703	T	0.11	-29.103	17.2848	0.87138	0.0:0.0:1.0:0.0	.	350	Q2TAL5	SMTL2_HUMAN	T	206;350	ENSP00000345143:A206T;ENSP00000373964:A350T	ENSP00000345143:A206T	A	+	1	0	SMTNL2	4446962	1.000000	0.71417	0.996000	0.52242	0.906000	0.53458	3.931000	0.56529	2.768000	0.95171	0.561000	0.74099	GCC	0		0.721	SMTNL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439129.1		NM_198501	
NUP88	4927	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	5324644	5324644	+	5'Flank	SNP	G	G	C	rs562693433		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:5324644G>C	ENST00000573584.1	-	0	0				RPAIN_ENST00000536255.2_Missense_Mutation_p.R37P|RPAIN_ENST00000405578.4_Missense_Mutation_p.R37P|RPAIN_ENST00000327154.6_Missense_Mutation_p.R37P|RPAIN_ENST00000574003.1_Missense_Mutation_p.R37P|RPAIN_ENST00000381209.3_Missense_Mutation_p.R37P|RPAIN_ENST00000381208.5_Missense_Mutation_p.R37P	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						AGAAACAGCCGGGACAGGCTC	0.448													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17651	0.0		0.0	False		,,,				2504	0.0				p.R37P													.	RPAIN	24		0			c.G110C												53.0	56.0	55.0					17																	5324644		2203	4300	6503	SO:0001631	upstream_gene_variant	84268	exon2			ACAGCCGGGACAG	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453		17.37:g.5324644G>C	Exception_encountered		Somatic	98	0.0102040816	1		WXS	Illumina HiSeq	Phase_I	127	0.10	13	NM_001160246	207	0.12	25	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364825	0.82463	.	.	ENSG00000129197	ENST00000381209;ENST00000381208;ENST00000539417;ENST00000536255;ENST00000405578;ENST00000540734;ENST00000327154	T;T;T;T;T;T	0.74842	-0.34;-0.32;-0.87;-0.48;-0.39;-0.88	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.87493	0.6191	M	0.82323	2.585	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;1.0;1.0	D	0.88715	0.3225	10	0.87932	D	0	2.0E-4	17.8325	0.88687	0.0:0.0:1.0:0.0	.	37;37;37;37;37;37	F5GYE1;F5H3Q7;E9PES3;Q86UA6-6;E9PDG9;Q86UA6	.;.;.;.;.;RIP_HUMAN	P	37	ENSP00000370606:R37P;ENSP00000370605:R37P;ENSP00000446453:R37P;ENSP00000439939:R37P;ENSP00000385814:R37P;ENSP00000315069:R37P	ENSP00000315069:R37P	R	+	2	0	RPAIN	5265368	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	6.643000	0.74334	2.797000	0.96272	0.563000	0.77884	CGG			0.448	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216918.3		NM_002532	
CHD3	1107	broad.mit.edu	37	17	7812537	7812537	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:7812537A>C	ENST00000330494.7	+	37	5621	c.5471A>C	c.(5470-5472)cAc>cCc	p.H1824P	CHD3_ENST00000380358.4_Missense_Mutation_p.H1883P|CHD3_ENST00000358181.4_Missense_Mutation_p.H1790P|SCARNA21_ENST00000517026.1_RNA	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1824	Required for interaction with PCNT.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GAGCCGGCGCACCCCGCCATG	0.711																																					p.H1883P													CHD3,NS,carcinoma,0,1	CHD3	169	1	0			c.A5648C												5.0	5.0	5.0					17																	7812537		2046	3980	6026	SO:0001583	missense	1107	exon37			CGGCGCACCCCGC	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.5471A>C	17.37:g.7812537A>C	ENSP00000332628:p.His1824Pro		Somatic	63	0.1428571429	9		WXS	Illumina HiSeq	Phase_I	101	0.20	20	NM_001005271	41	0.05	2	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	a	15.50	2.852503	0.51270	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494;ENST00000439235;ENST00000449744	D;D;D	0.91011	-2.77;-2.75;-2.71	4.28	4.28	0.50868	CHD, C-terminal 2 (1);	0.000000	0.40385	U	0.001111	D	0.94128	0.8117	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.76494	0.999;0.958;0.98;0.999	D;D;D;D	0.85130	0.997;0.953;0.961;0.99	D	0.94697	0.7879	10	0.87932	D	0	-6.4582	13.5518	0.61736	1.0:0.0:0.0:0.0	.	401;1790;1824;1883	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	P	1883;1790;1824;152;116	ENSP00000369716:H1883P;ENSP00000350907:H1790P;ENSP00000332628:H1824P	ENSP00000332628:H1824P	H	+	2	0	CHD3	7753262	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.008000	0.93601	1.786000	0.52430	0.398000	0.26397	CAC			0.711	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000318050.1		NM_001005273	
ARHGAP23	57636	mdanderson.org	37	17	36666995	36666995	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:36666995G>T	ENST00000431231.2	+	24	4331	c.4263G>T	c.(4261-4263)gaG>gaT	p.E1421D	ARHGAP23_ENST00000443378.1_Missense_Mutation_p.E1327D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1421					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						ACTTCAACGAGTGGAAGGAGC	0.726																																					p.E1421D													.	.			0			c.G4263T												2.0	3.0	3.0					17																	36666995		494	1334	1828	SO:0001583	missense	57636	exon24			CAACGAGTGGAAG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.4263G>T	17.37:g.36666995G>T	ENSP00000393539:p.Glu1421Asp		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001199417	2	0.00	0		Missense_Mutation	SNP	ENST00000431231.2	37	CCDS56027.1	.	.	.	.	.	.	.	.	.	.	G	5.642	0.303065	0.10678	.	.	ENSG00000225485	ENST00000431231;ENST00000443378	T;T	0.09255	3.06;3.0	2.64	1.66	0.24008	.	.	.	.	.	T	0.04272	0.0118	N	0.08118	0	0.21627	N	0.999617	B	0.02656	0.0	B	0.04013	0.001	T	0.45731	-0.9241	9	0.15952	T	0.53	.	3.0998	0.06322	0.2818:0.2325:0.4857:0.0	.	1421	Q9P227	RHG23_HUMAN	D	1421;1327	ENSP00000393539:E1421D;ENSP00000407333:E1327D	ENSP00000393539:E1421D	E	+	3	2	ARHGAP23	33920521	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	0.318000	0.19504	0.297000	0.22615	0.471000	0.43371	GAG			0.726	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000441789.1		XM_290799	
TOP2A	7153	broad.mit.edu	37	17	38555154	38555154	+	Missense_Mutation	SNP	G	G	T	rs544012355		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:38555154G>T	ENST00000423485.1	-	26	3482	c.3324C>A	c.(3322-3324)aaC>aaA	p.N1108K		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1108					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TTTCCTTTTCGTTGTCACTCT	0.333																																					p.N1108K													TOP2A,colon,carcinoma,0,1	TOP2A	124	1	0			c.C3324A												136.0	122.0	126.0					17																	38555154		1848	4093	5941	SO:0001583	missense	7153	exon26			CTTTTCGTTGTCA		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.3324C>A	17.37:g.38555154G>T	ENSP00000411532:p.Asn1108Lys		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	165	0.02	4	NM_001067	184	0.00	0	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	37	CCDS45672.1	.	.	.	.	.	.	.	.	.	.	G	3.625	-0.076839	0.07184	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.21932	1.98	5.56	-2.23	0.06930	DNA topoisomerase, type IIA, subunit A/C-terminal (2);DNA topoisomerase, type IIA, subunit A, alpha-helical (1);DNA topoisomerase, type IIA, central (1);	0.774294	0.13125	N	0.411935	T	0.10637	0.0260	L	0.34521	1.04	0.19300	N	0.999976	B	0.02656	0.0	B	0.09377	0.004	T	0.32402	-0.9908	10	0.21014	T	0.42	.	1.6924	0.02855	0.4293:0.2065:0.2537:0.1105	.	1108	P11388	TOP2A_HUMAN	K	1108;1188;1131;1144	ENSP00000411532:N1108K	ENSP00000269577:N1188K	N	-	3	2	TOP2A	35808680	0.000000	0.05858	0.011000	0.14972	0.717000	0.41224	-0.690000	0.05138	-0.821000	0.04312	-1.068000	0.02270	AAC			0.333	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338035.1			
LRRC59	55379	broad.mit.edu	37	17	48460490	48460490	+	Silent	SNP	T	T	C			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:48460490T>C	ENST00000225972.7	-	7	1018	c.783A>G	c.(781-783)ggA>ggG	p.G261G		NM_018509.3	NP_060979.2	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	261						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			CAACCAGCCCTCCCGCCACAC	0.632																																					p.G261G													.	LRRC59	23		0			c.A783G												24.0	21.0	22.0					17																	48460490		2201	4291	6492	SO:0001819	synonymous_variant	55379	exon7			CAGCCCTCCCGCC	AK025328	CCDS11566.1	17q21.33	2014-02-12	2006-01-12		ENSG00000108829	ENSG00000108829			28817	protein-coding gene	gene with protein product		614854				12477932	Standard	NM_018509		Approved	PRO1855, FLJ21675	uc002iqt.3	Q96AG4	OTTHUMG00000162079	ENST00000225972.7:c.783A>G	17.37:g.48460490T>C			Somatic	69	0.2463768116	17		WXS	Illumina HiSeq	Phase_I	101	0.22	22	NM_018509	339	0.09	32	B2RE83|D3DTX8|Q9P189	Silent	SNP	ENST00000225972.7	37	CCDS11566.1																																																																																					0.632	LRRC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367117.2		NM_018509	
RPTOR	57521	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	78858821	78858821	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:78858821C>T	ENST00000306801.3	+	17	2218	c.1856C>T	c.(1855-1857)gCg>gTg	p.A619V	RPTOR_ENST00000544334.2_Intron|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	619					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.A619V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CGCTGCGCAGCGGTCTTCGCC	0.657																																					p.A619V													RPTOR,rectum,carcinoma,0,1	RPTOR	122	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1856T												47.0	35.0	39.0					17																	78858821		2200	4299	6499	SO:0001583	missense	57521	exon17			GCGCAGCGGTCTT		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.1856C>T	17.37:g.78858821C>T	ENSP00000307272:p.Ala619Val		Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	219	0.03	7	NM_020761	19	0.05	1	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559898	0.45590	.	.	ENSG00000141564	ENST00000306801	T	0.49720	0.77	4.78	4.78	0.61160	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58221	0.2107	L	0.52266	1.64	0.80722	D	1	D	0.69078	0.997	P	0.60012	0.867	T	0.52540	-0.8562	10	0.18276	T	0.48	.	17.8063	0.88602	0.0:1.0:0.0:0.0	.	619	Q8N122	RPTOR_HUMAN	V	619	ENSP00000307272:A619V	ENSP00000307272:A619V	A	+	2	0	RPTOR	76473416	1.000000	0.71417	0.094000	0.20943	0.010000	0.07245	7.323000	0.79105	2.209000	0.71365	0.462000	0.41574	GCG			0.657	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438125.1	rescued with RNA-seq	NM_020761	
C17orf70	80233	mdanderson.org	37	17	79507958	79507958	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr17:79507958G>A	ENST00000327787.8	-	9	2579	c.2533C>T	c.(2533-2535)Cag>Tag	p.Q845*	C17orf70_ENST00000537152.1_Nonsense_Mutation_p.Q694*|C17orf70_ENST00000425898.2_Nonsense_Mutation_p.Q494*			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	845					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CGCAGGGTCTGCACCTCCCGC	0.687																																					p.Q845X													.	.			0			c.C2533T												12.0	13.0	13.0					17																	79507958		2161	4239	6400	SO:0001587	stop_gained	80233	exon9			GGGTCTGCACCTC	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.2533C>T	17.37:g.79507958G>A	ENSP00000333283:p.Gln845*		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_025161	91	0.00	0	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Nonsense_Mutation	SNP	ENST00000327787.8	37	CCDS32765.2	.	.	.	.	.	.	.	.	.	.	G	42	9.324809	0.99137	.	.	ENSG00000185504	ENST00000327787;ENST00000425898;ENST00000361039;ENST00000537152	.	.	.	4.16	4.16	0.48862	.	0.171732	0.39615	N	0.001313	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	13.4536	0.61184	0.0:0.0:1.0:0.0	.	.	.	.	X	845;494;218;694	.	ENSP00000333283:Q845X	Q	-	1	0	C17orf70	77118433	1.000000	0.71417	0.995000	0.50966	0.765000	0.43378	6.575000	0.74018	2.144000	0.66660	0.591000	0.81541	CAG			0.687	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396170.1		NM_025161	
CTAGE1	64693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	19997302	19997302	+	5'Flank	SNP	G	G	C			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr18:19997302G>C	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.A158G			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					TTTGGCTTCAGCTACTTGTGA	0.373																																					p.A158G													.	.			0			c.C473G												105.0	115.0	112.0					18																	19997302		2194	4291	6485	SO:0001631	upstream_gene_variant	64693	exon1			GCTTCAGCTACTT	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19997302G>C	Exception_encountered		Somatic	113	0	0		WXS	Illumina HiSeq	.	82	0.32	26	NM_172241	1	0.00	0	B0YIZ3	Missense_Mutation	SNP	ENST00000525417.1	37		.	.	.	.	.	.	.	.	.	.	G	12.30	1.896205	0.33442	.	.	ENSG00000212710	ENST00000391403	T	0.39056	1.1	0.909	-1.82	0.07857	.	.	.	.	.	T	0.54431	0.1858	M	0.83953	2.67	0.09310	N	1	P	0.48230	0.907	P	0.55055	0.767	T	0.49995	-0.8879	8	.	.	.	.	6.4572	0.21936	0.0:0.5822:0.4178:0.0	.	158	Q96RT6	CTGE2_HUMAN	G	158	ENSP00000375220:A158G	.	A	-	2	0	CTAGE1	18251300	0.469000	0.25846	0.021000	0.16686	0.459000	0.32528	0.216000	0.17585	-0.882000	0.03987	-0.507000	0.04495	GCT			0.373	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000386767.1		NM_022663, NM_172241	
PHLPP1	23239	mdanderson.org	37	18	60384158	60384158	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr18:60384158G>T	ENST00000262719.5	+	1	1476	c.1242G>T	c.(1240-1242)caG>caT	p.Q414H	PHLPP1_ENST00000400316.4_5'UTR			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	414					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CCTCGCCTCAGCCGCAGCAGA	0.791																																					p.Q414H													.	.			0			c.G1242T																																									SO:0001583	missense	23239	exon1			GCCTCAGCCGCAG	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.1242G>T	18.37:g.60384158G>T	ENSP00000262719:p.Gln414His		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_194449	2	0.00	0	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	37	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	G	2.363	-0.346126	0.05208	.	.	ENSG00000081913	ENST00000262719	T	0.25414	1.8	2.91	1.65	0.23941	.	.	.	.	.	T	0.12220	0.0297	N	0.08118	0	0.21064	N	0.999791	.	.	.	.	.	.	T	0.24657	-1.0154	7	0.46703	T	0.11	6.7647	4.1103	0.10055	0.3127:0.0:0.6873:0.0	.	.	.	.	H	414	ENSP00000262719:Q414H	ENSP00000262719:Q414H	Q	+	3	2	PHLPP1	58535138	0.002000	0.14202	0.009000	0.14445	0.171000	0.22731	0.876000	0.28092	0.164000	0.19529	0.462000	0.41574	CAG			0.791	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319249.2		NM_194449	
FBL	2091	hgsc.bcm.edu	37	19	40325395	40325395	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr19:40325395T>C	ENST00000221801.3	-	8	967	c.854A>G	c.(853-855)aAg>aGg	p.K285R	DYRK1B_ENST00000323039.5_5'Flank|DYRK1B_ENST00000593685.1_5'Flank|DYRK1B_ENST00000430012.2_5'Flank|DYRK1B_ENST00000597639.1_5'Flank|DYRK1B_ENST00000348817.3_5'Flank|FBL_ENST00000593503.1_5'UTR|DYRK1B_ENST00000601972.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	285	Helical. {ECO:0000255}.				histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		CTGTTGCATCTTTTTCACTTC	0.542																																					p.K285R													FBL,NS,carcinoma,+1,1	FBL	1	1	0			c.A854G												118.0	99.0	106.0					19																	40325395		2203	4300	6503	SO:0001583	missense	2091	exon8			TGCATCTTTTTCA	AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.854A>G	19.37:g.40325395T>C	ENSP00000221801:p.Lys285Arg		Somatic	105	0.0095238095	1		WXS	Illumina HiSeq	.	100	0.04	4	NM_001436	1842	0.00	1	B5BUE8|O75259|Q6IAT5|Q9UPI6	Missense_Mutation	SNP	ENST00000221801.3	37	CCDS12545.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985469	0.74589	.	.	ENSG00000105202	ENST00000221801	D	0.83755	-1.76	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	M	0.71920	2.185	0.80722	D	1	B;B	0.20368	0.003;0.044	B;B	0.26202	0.012;0.067	T	0.80118	-0.1516	10	0.51188	T	0.08	-17.4554	14.3004	0.66346	0.0:0.0:0.0:1.0	.	224;285	Q96BS4;P22087	.;FBRL_HUMAN	R	285	ENSP00000221801:K285R	ENSP00000221801:K285R	K	-	2	0	FBL	45017235	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.349000	0.79376	2.254000	0.74563	0.533000	0.62120	AAG			0.542	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462509.4		NM_001436	
BLVRB	645	mdanderson.org	37	19	40964299	40964299	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr19:40964299C>T	ENST00000263368.4	-	2	384	c.233G>A	c.(232-234)cGc>cAc	p.R78H	BLVRB_ENST00000595483.1_Missense_Mutation_p.R78H	NM_000713.2	NP_000704.1	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase (NADPH))	78					heme catabolic process (GO:0042167)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	biliverdin reductase activity (GO:0004074)|riboflavin reductase (NADPH) activity (GO:0042602)			large_intestine(3)|lung(3)	6			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		Riboflavin(DB00140)	GAGGTCATTGCGGGTGCCCAG	0.726																																					p.R78H													.	.			0			c.G233A												29.0	23.0	25.0					19																	40964299		2191	4287	6478	SO:0001583	missense	645	exon2			TCATTGCGGGTGC	D26308	CCDS33029.1	19q13.1-q13.2	2011-09-14				ENSG00000090013	1.3.1.24, 1.5.1.30	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	1063	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 43U, member 1"""	600941	"""Flavin reductase"""	FLR		7656592, 19027726	Standard	NM_000713		Approved	SDR43U1	uc002onw.2	P30043		ENST00000263368.4:c.233G>A	19.37:g.40964299C>T	ENSP00000263368:p.Arg78His		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_000713	126	0.00	0	A6NKD8|B2R5C6|P32078|P53005|Q32LZ2	Missense_Mutation	SNP	ENST00000263368.4	37	CCDS33029.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049556	0.75846	.	.	ENSG00000090013	ENST00000263368	T	0.31769	1.48	4.72	3.67	0.42095	NAD(P)-binding domain (1);NmrA-like (1);	0.402421	0.30356	N	0.009815	T	0.41789	0.1174	M	0.84433	2.695	0.58432	D	0.999998	P	0.51147	0.942	B	0.43536	0.423	T	0.56372	-0.7990	10	0.59425	D	0.04	-6.0766	14.099	0.65042	0.0:0.8477:0.1523:0.0	.	78	P30043	BLVRB_HUMAN	H	78	ENSP00000263368:R78H	ENSP00000263368:R78H	R	-	2	0	BLVRB	45656139	1.000000	0.71417	0.072000	0.20136	0.935000	0.57460	6.722000	0.74735	1.333000	0.45449	0.557000	0.71058	CGC			0.726	BLVRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462563.1			
SPTBN4	57731	broad.mit.edu	37	19	41073695	41073695	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr19:41073695A>G	ENST00000352632.3	+	31	6549	c.6463A>G	c.(6463-6465)Agg>Ggg	p.R2155G	SPTBN4_ENST00000392025.1_Missense_Mutation_p.R898G|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R2155G			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2155					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGGCTATGAAAGGGGCTTGGA	0.716																																					p.R2155G													.	SPTBN4	213		0			c.A6463G												3.0	3.0	3.0					19																	41073695		1836	3779	5615	SO:0001583	missense	57731	exon31			TATGAAAGGGGCT	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6463A>G	19.37:g.41073695A>G	ENSP00000263373:p.Arg2155Gly		Somatic	91	0.1428571429	13		WXS	Illumina HiSeq	Phase_I	77	0.25	19	NM_020971	0		0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	A	11.49	1.653135	0.29425	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.76060	-0.99;0.35	4.73	-0.525	0.11917	.	.	.	.	.	T	0.47637	0.1456	N	0.08118	0	0.40809	D	0.983401	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19095	-1.0316	9	0.12766	T	0.61	.	8.5689	0.33556	0.3766:0.5424:0.0809:0.0	.	898;2155	C9JY79;Q9H254	.;SPTN4_HUMAN	G	2155;2155;898	ENSP00000263373:R2155G;ENSP00000375879:R898G	ENSP00000263373:R2155G	R	+	1	2	SPTBN4	45765535	0.001000	0.12720	0.141000	0.22245	0.859000	0.49053	-0.010000	0.12743	-0.135000	0.11495	-0.619000	0.04042	AGG			0.716	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462559.2			
RPS19	6223	mdanderson.org	37	19	42364899	42364899	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr19:42364899G>A	ENST00000598742.1	+	2	427	c.55G>A	c.(55-57)Gca>Aca	p.A19T	RPS19_ENST00000593863.1_Missense_Mutation_p.A19T|RPS19_ENST00000221975.2_5'UTR	NM_001022.3	NP_001013.1	P39019	RS19_HUMAN	ribosomal protein S19	19			LA -> E (in DBA1).		cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|maturation of SSU-rRNA (GO:0030490)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|monocyte chemotaxis (GO:0002548)|mRNA metabolic process (GO:0016071)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleolus organization (GO:0007000)|positive regulation of cellular component movement (GO:0051272)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|protein tetramerization (GO:0051262)|response to extracellular stimulus (GO:0009991)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(1)|upper_aerodigestive_tract(1)	3						CAGAGCTCTGGCAGCCTTCCT	0.557									Diamond-Blackfan Anemia																												p.A19T													.	.			0			c.G55A												124.0	125.0	124.0					19																	42364899		2203	4300	6503	SO:0001583	missense	6223	exon2	Familial Cancer Database	DBA, Congenital Hypoplastic Anemia, Blackfan-Diamond Anemia, incl.: Aase syndrome	GCTCTGGCAGCCT	BC000023	CCDS12588.1	19q13.2	2011-04-05				ENSG00000105372		"""S ribosomal proteins"""	10402	protein-coding gene	gene with protein product	"""Diamond-Blackfan anemia"""	603474				9582194	Standard	NM_001022		Approved	DBA, S19	uc002ort.3	P39019		ENST00000598742.1:c.55G>A	19.37:g.42364899G>A	ENSP00000470972:p.Ala19Thr		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001022	9413	0.00	2		Missense_Mutation	SNP	ENST00000598742.1	37	CCDS12588.1	.	.	.	.	.	.	.	.	.	.	G	34	5.405174	0.96051	.	.	ENSG00000105372	ENST00000221975	.	.	.	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	D	0.85035	0.5605	M	0.92555	3.32	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	D	0.88899	0.3351	9	0.87932	D	0	-13.9021	15.585	0.76475	0.0:0.0:1.0:0.0	.	19	P39019	RS19_HUMAN	T	19	.	ENSP00000221975:A19T	A	+	1	0	RPS19	47056739	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.334000	0.59291	2.476000	0.83614	0.655000	0.94253	GCA			0.557	RPS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463049.1		NM_001022	
BLOC1S3	388552	broad.mit.edu	37	19	45682769	45682769	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr19:45682769delA	ENST00000433642.2	+	2	311	c.215delA	c.(214-216)gaafs	p.E72fs	TRAPPC6A_ENST00000585934.1_5'Flank|BLOC1S3_ENST00000587722.1_Frame_Shift_Del_p.E72fs|TRAPPC6A_ENST00000588062.1_5'Flank|TRAPPC6A_ENST00000592647.1_5'Flank|AC005779.2_ENST00000593083.1_5'Flank|TRAPPC6A_ENST00000006275.4_5'Flank	NM_212550.3	NP_997715.1	Q6QNY0	BL1S3_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 3	72					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|eye development (GO:0001654)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of natural killer cell activation (GO:0032816)|post-Golgi vesicle-mediated transport (GO:0006892)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|transport vesicle (GO:0030133)				ovary(1)|skin(1)	2		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		CCGGAGCCGGAACCGACGGCC	0.791									Hermansky-Pudlak syndrome																												p.E72fs													.	BLOC1S3	4		0			c.215delA												1.0	2.0	2.0					19																	45682769		1022	2320	3342	SO:0001589	frameshift_variant	388552	exon2	Familial Cancer Database	HPS, HPS1-8	AGCCGGAACCGAC	AY531266	CCDS12656.1	19q13.32	2012-08-01	2008-08-11			ENSG00000189114		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20914	protein-coding gene	gene with protein product	"""BLOC-1 subunit 3"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 3"", ""Hermansky-Pudlak syndrome 8"""	609762				15102850	Standard	NM_212550		Approved	BLOS3, HPS8	uc002pax.4	Q6QNY0		ENST00000433642.2:c.215delA	19.37:g.45682769delA	ENSP00000393840:p.Glu72fs		Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_212550	0		0	B2RXB8	Frame_Shift_Del	DEL	ENST00000433642.2	37	CCDS12656.1																																																																																					0.791	BLOC1S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457559.1		NM_212550	
NRBP1	29959	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	27664455	27664455	+	Missense_Mutation	SNP	C	C	T	rs374507004		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr2:27664455C>T	ENST00000233557.3	+	18	2301	c.1469C>T	c.(1468-1470)gCg>gTg	p.A490V	KRTCAP3_ENST00000543753.1_5'Flank|KRTCAP3_ENST00000288873.3_5'Flank|KRTCAP3_ENST00000407293.1_5'Flank|NRBP1_ENST00000379852.3_Missense_Mutation_p.A490V|NRBP1_ENST00000379863.3_Missense_Mutation_p.A498V			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	490					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					CCCGAGTTGGCGGCTGAGCTG	0.577																																					p.A490V													.	.			0			c.C1469T							C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	145.0	138.0	141.0		1469	5.7	1.0	2		141	0,8600		0,0,4300	no	missense	NRBP1	NM_013392.2	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	490/536	27664455	1,13005	2203	4300	6503	SO:0001583	missense	29959	exon17			AGTTGGCGGCTGA	AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.1469C>T	2.37:g.27664455C>T	ENSP00000233557:p.Ala490Val		Somatic	76	0	0		WXS	Illumina HiSeq	.	118	0.04	5	NM_013392	715	0.00	0	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	37	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545866	0.65198	2.27E-4	0.0	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863	T;T;T	0.23147	2.24;2.24;1.92	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.23094	0.0558	L	0.43598	1.365	0.80722	D	1	P;P;P	0.44776	0.843;0.596;0.461	B;B;B	0.34873	0.147;0.191;0.094	T	0.02196	-1.1197	10	0.41790	T	0.15	-12.1709	18.3703	0.90405	0.0:1.0:0.0:0.0	.	470;498;490	B4DW31;F8W6G1;Q9UHY1	.;.;NRBP_HUMAN	V	490;470;490;498	ENSP00000233557:A490V;ENSP00000369181:A490V;ENSP00000369192:A498V	ENSP00000233557:A490V	A	+	2	0	NRBP1	27517959	1.000000	0.71417	0.977000	0.42913	0.916000	0.54674	5.755000	0.68750	2.684000	0.91462	0.561000	0.74099	GCG			0.577	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215033.1		NM_013392	
ARL6IP6	151188	broad.mit.edu	37	2	153573929	153573929	+	5'Flank	SNP	G	G	A	rs371312661		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr2:153573929G>A	ENST00000326446.5	+	0	0				PRPF40A_ENST00000486100.1_5'UTR|PRPF40A_ENST00000410080.1_Missense_Mutation_p.R9W	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						AGACTGCTCCGCCGGCGGCCA	0.657																																					p.R9W													.	PRPF40A	149		0			c.C25T												30.0	37.0	35.0					2																	153573929		1939	4145	6084	SO:0001631	upstream_gene_variant	55660	exon1			TGCTCCGCCGGCG	AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		2.37:g.153573929G>A	Exception_encountered		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	176	0.02	4	NM_017892	43	0.00	0	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	ENST00000326446.5	37	CCDS2197.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173072	0.78452	.	.	ENSG00000196504	ENST00000410080;ENST00000359961;ENST00000448428	T	0.35048	1.33	4.87	3.99	0.46301	.	.	.	.	.	T	0.22044	0.0531	N	0.22421	0.69	0.25072	N	0.990986	P	0.35242	0.492	B	0.26969	0.075	T	0.11518	-1.0584	9	0.62326	D	0.03	.	8.8148	0.34989	0.1006:0.0:0.8994:0.0	.	9	E9PFS0	.	W	9;9;15	ENSP00000386458:R9W	ENSP00000353046:R9W	R	-	1	2	PRPF40A	153282175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.295000	0.51794	1.273000	0.44346	0.655000	0.94253	CGG			0.657	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254852.3		NM_152522	
BAGE2	85319	broad.mit.edu	37	21	11058613	11058614	+	RNA	INS	-	-	A	rs60445243|rs377480117	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr21:11058613_11058614insA	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GATTTTTTTTTAAAGCAAATAG	0.248																																					.													.	.			0			.																																											85319	.			TTTTTTTAAAGCA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058616_11058616dupA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0	A8K925|Q08ER0	RNA	INS	ENST00000470054.1	37																																																																																						0.248	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
SLC7A4	6545	mdanderson.org	37	22	21385978	21385978	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr22:21385978G>T	ENST00000382932.2	-	2	191	c.124C>A	c.(124-126)Ctg>Atg	p.L42M	MIR649_ENST00000384843.1_RNA|SLC7A4_ENST00000403586.1_Missense_Mutation_p.L42M|AC002472.11_ENST00000450652.1_RNA	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	42					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	AGAAGAGTCAGGTCCAGCGTG	0.642																																					p.L42M													.	.			0			c.C124A												62.0	54.0	57.0					22																	21385978		2203	4300	6503	SO:0001583	missense	6545	exon2			GAGTCAGGTCCAG	AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.124C>A	22.37:g.21385978G>T	ENSP00000372390:p.Leu42Met		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_004173	0		0	Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Missense_Mutation	SNP	ENST00000382932.2	37	CCDS33608.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489741	0.64074	.	.	ENSG00000099960	ENST00000403586;ENST00000382932;ENST00000426145	D;D;T	0.91124	-2.79;-2.79;0.27	5.37	0.86	0.19042	Amino acid permease domain (1);	0.000000	0.64402	D	0.000001	D	0.95762	0.8621	H	0.96833	3.89	0.47308	D	0.999382	D	0.89917	1.0	D	0.80764	0.994	D	0.92786	0.6244	10	0.87932	D	0	.	5.6522	0.17622	0.2501:0.1429:0.607:0.0	.	42	O43246	CTR4_HUMAN	M	42	ENSP00000384278:L42M;ENSP00000372390:L42M;ENSP00000408727:L42M	ENSP00000372390:L42M	L	-	1	2	SLC7A4	19715978	1.000000	0.71417	0.994000	0.49952	0.623000	0.37688	2.570000	0.45981	0.054000	0.16065	0.491000	0.48974	CTG			0.642	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320467.1		NM_004173	
TPRXL	348825	hgsc.bcm.edu	37	3	14106354	14106354	+	Silent	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr3:14106354C>T	ENST00000424053.1	+	3	1225	c.678C>T	c.(676-678)agC>agT	p.S226S	TPRXL_ENST00000429201.1_Silent_p.S226S|TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_Silent_p.S226S			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						gcagcagcagccccagcagca	0.701																																					.													TPRXL,NS,carcinoma,0,1	TPRXL	0	1	0			.																																									SO:0001819	synonymous_variant	348825	.			CAGCAGCCCCAGC	AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.678C>T	3.37:g.14106354C>T			Somatic	6	0.1666666667	1		WXS	Illumina HiSeq	.	11	0.45	5	.	3	0.67	2	Q8NAM5	RNA	SNP	ENST00000424053.1	37																																																																																						0.701	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000340436.1		NR_002223	
IFT122	55764	mdanderson.org	37	3	129239031	129239031	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr3:129239031G>T	ENST00000348417.2	+	30	3726	c.3649G>T	c.(3649-3651)Gag>Tag	p.E1217*	IFT122_ENST00000440957.2_Nonsense_Mutation_p.E1008*|IFT122_ENST00000347300.2_Nonsense_Mutation_p.E1158*|IFT122_ENST00000296266.3_Nonsense_Mutation_p.E1268*|IFT122_ENST00000431818.2_Nonsense_Mutation_p.E1067*|IFT122_ENST00000349441.2_Nonsense_Mutation_p.E1107*|IFT122_ENST00000504021.1_Nonsense_Mutation_p.E1094*|IFT122_ENST00000507564.1_Nonsense_Mutation_p.E1210*	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	1217					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						GTTCCATTCTGAGGACTATGA	0.607																																					p.E1268X													.	.			0			c.G3802T												100.0	79.0	87.0					3																	129239031		2203	4300	6503	SO:0001587	stop_gained	55764	exon31			CATTCTGAGGACT	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.3649G>T	3.37:g.129239031G>T	ENSP00000324005:p.Glu1217*		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_052985	58	0.00	0	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Nonsense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	.	.	.	.	.	.	.	.	.	.	G	41	9.012694	0.99037	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-32.4995	20.1054	0.97890	0.0:0.0:1.0:0.0	.	.	.	.	X	1158;1268;1210;1067;1094;1107;1217;1059;1008	.	ENSP00000296266:E1268X	E	+	1	0	IFT122	130721721	1.000000	0.71417	0.982000	0.44146	0.951000	0.60555	9.609000	0.98334	2.757000	0.94681	0.655000	0.94253	GAG			0.607	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000355852.1		NM_018262	
PRDM8	56978	mdanderson.org	37	4	81123665	81123665	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr4:81123665G>T	ENST00000504452.1	+	8	1888	c.1049G>T	c.(1048-1050)tGc>tTc	p.C350F	PRDM8_ENST00000339711.4_Missense_Mutation_p.C350F|PRDM8_ENST00000415738.2_Missense_Mutation_p.C350F			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	350	Gly-rich.				corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						GATCTGGTGTGCACACCGCAG	0.731																																					p.C350F													.	.			0			c.G1049T												3.0	4.0	4.0					4																	81123665		1424	3273	4697	SO:0001583	missense	56978	exon4			TGGTGTGCACACC	AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.1049G>T	4.37:g.81123665G>T	ENSP00000423985:p.Cys350Phe		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_001099403	1	0.00	0	A8K7X2|Q6IQ36	Missense_Mutation	SNP	ENST00000504452.1	37	CCDS43243.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.661011	0.29515	.	.	ENSG00000152784	ENST00000504452;ENST00000515013;ENST00000339711;ENST00000415738	T;T;T;T	0.68624	-0.34;0.22;-0.34;-0.34	4.18	4.18	0.49190	.	0.303053	0.30879	N	0.008692	T	0.65770	0.2723	L	0.27053	0.805	0.33739	D	0.619233	D	0.56521	0.976	P	0.53809	0.735	T	0.76822	-0.2817	10	0.56958	D	0.05	.	16.2871	0.82727	0.0:0.0:1.0:0.0	.	350	Q9NQV8	PRDM8_HUMAN	F	350	ENSP00000423985:C350F;ENSP00000425149:C350F;ENSP00000339764:C350F;ENSP00000406998:C350F	ENSP00000339764:C350F	C	+	2	0	PRDM8	81342689	1.000000	0.71417	1.000000	0.80357	0.274000	0.26718	2.726000	0.47302	2.149000	0.67028	0.491000	0.48974	TGC			0.731	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362793.1			
DSPP	1834	bcgsc.ca	37	4	88537036	88537036	+	Silent	SNP	C	C	T	rs111205183		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr4:88537036C>T	ENST00000282478.7	+	4	3255	c.3222C>T	c.(3220-3222)gaC>gaT	p.D1074D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1074D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1074	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgacagcagcgaca	0.537																																					p.D1074D													DSPP,NS,carcinoma,0,1	DSPP	174	1	0			c.C3222T												57.0	64.0	62.0					4																	88537036		1567	2840	4407	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3222C>T	4.37:g.88537036C>T			Somatic	117	0.0085470085	1		WXS	Illumina HiSeq	Phase_1	72	0.17	12	NM_014208	0		0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																					0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
RTN3P1	152905	bcgsc.ca	37	4	146296711	146296711	+	IGR	SNP	C	C	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr4:146296711C>T								RP11-142A22.4 (35138 upstream) : SMAD1 (106232 downstream)																							GAGCCATCGGCGGCCACTCAG	0.652																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	152905	.			CATCGGCGGCCAC																													4.37:g.146296711C>T			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_1	52	0.38	20	.	6	0.00	0		RNA	SNP		37																																																																																					0	0.652										
MYO10	4651	mdanderson.org	37	5	16673975	16673975	+	Missense_Mutation	SNP	C	C	T	rs25901	byFrequency	TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr5:16673975C>T	ENST00000513610.1	-	36	5442	c.4988G>A	c.(4987-4989)aGc>aAc	p.S1663N	MYO10_ENST00000515803.1_Missense_Mutation_p.S1002N|MYO10_ENST00000427430.2_Missense_Mutation_p.S1020N|MYO10_ENST00000274203.9_Missense_Mutation_p.S1020N|MYO10_ENST00000505695.1_Missense_Mutation_p.S1002N	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1663	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.		S -> T (in dbSNP:rs25901). {ECO:0000269|PubMed:10984435, ECO:0000269|PubMed:11278607, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9872452}.		ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TTCCATCTCGCTTCCTGGAAA	0.468																																					p.S1663N													.	.			0			c.G4988A												91.0	92.0	92.0					5																	16673975		1877	4123	6000	SO:0001583	missense	4651	exon36			ATCTCGCTTCCTG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.4988G>A	5.37:g.16673975C>T	ENSP00000421280:p.Ser1663Asn		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	64	0.03	2	NM_012334	65	0.00	0	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	g	36	5.781783	0.96929	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	D;D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95;-2.95	5.41	5.41	0.78517	MyTH4 domain (3);	.	.	.	.	D	0.92642	0.7662	M	0.68952	2.095	0.43480	P	0.0042959999999999665	P;B;B	0.37781	0.608;0.324;0.269	B;B;B	0.42882	0.401;0.129;0.16	D	0.93044	0.6460	8	0.66056	D	0.02	.	16.4107	0.83712	0.0:0.1316:0.8684:0.0	.	542;1303;1663	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	N	1663;1002;1020;1002;1020	ENSP00000421280:S1663N;ENSP00000425051:S1002N;ENSP00000274203:S1020N;ENSP00000421170:S1002N;ENSP00000391106:S1020N	ENSP00000274203:S1020N	S	-	2	0	MYO10	16726975	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.033000	0.88852	1.291000	0.44653	-0.242000	0.12053	AGC			0.468	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366167.1		NM_012334	
APBB3	10307	broad.mit.edu	37	5	139938282	139938282	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr5:139938282A>G	ENST00000357560.4	-	13	1792	c.1349T>C	c.(1348-1350)cTc>cCc	p.L450P	APBB3_ENST00000412920.3_Missense_Mutation_p.L448P|APBB3_ENST00000354402.5_Missense_Mutation_p.L457P|SRA1_ENST00000336283.6_5'Flank|SRA1_ENST00000520427.1_5'Flank|APBB3_ENST00000356738.2_Missense_Mutation_p.L455P|APBB3_ENST00000358580.5_3'UTR|APBB3_ENST00000508496.2_Missense_Mutation_p.L227P	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	450						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCAGGGGGAGGGGCAGGGG	0.667																																					p.L457P													.	APBB3	34		0			c.T1370C												32.0	39.0	36.0					5																	139938282		2202	4293	6495	SO:0001583	missense	10307	exon12			AGGGGGAGGGGCA	AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.1349T>C	5.37:g.139938282A>G	ENSP00000350171:p.Leu450Pro		Somatic	304	0.0065789474	2		WXS	Illumina HiSeq	Phase_I	286	0.02	5	NM_006051	11	0.00	0	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	CCDS4229.1	.	.	.	.	.	.	.	.	.	.	A	8.048	0.765288	0.15914	.	.	ENSG00000113108	ENST00000356738;ENST00000354402;ENST00000357560;ENST00000508496;ENST00000412920	T;T;T;T;T	0.46451	1.87;1.87;1.87;0.87;1.87	4.76	1.07	0.20283	.	0.634983	0.13994	N	0.348616	T	0.17662	0.0424	N	0.08118	0	0.51233	D	0.999918	B;B	0.06786	0.001;0.0	B;B	0.04013	0.0;0.001	T	0.09729	-1.0661	9	.	.	.	0.0113	4.2081	0.10498	0.6125:0.1906:0.1969:0.0	.	448;455	O95704-2;O95704-3	.;.	P	455;457;450;227;448	ENSP00000349177:L455P;ENSP00000346378:L457P;ENSP00000350171:L450P;ENSP00000444013:L227P;ENSP00000402591:L448P	.	L	-	2	0	APBB3	139918466	0.959000	0.32827	0.075000	0.20258	0.973000	0.67179	1.354000	0.34056	-0.046000	0.13446	0.374000	0.22700	CTC			0.667	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251677.2		NM_006051	
EXOC2	55770	mdanderson.org	37	6	598057	598057	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr6:598057G>T	ENST00000230449.4	-	10	1172	c.1037C>A	c.(1036-1038)aCa>aAa	p.T346K	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	346					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		AGTTGATGGTGTCTCAAGCAA	0.308																																					p.T346K													.	.			0			c.C1037A												131.0	132.0	132.0					6																	598057		2202	4298	6500	SO:0001583	missense	55770	exon10			GATGGTGTCTCAA	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.1037C>A	6.37:g.598057G>T	ENSP00000230449:p.Thr346Lys		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	85	0.05	4	NM_018303	22	0.00	0	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	ENST00000230449.4	37	CCDS34327.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.915906	0.73098	.	.	ENSG00000112685	ENST00000230449	T	0.42900	0.96	5.69	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.21186	0.0510	L	0.60455	1.87	0.80722	D	1	P	0.38335	0.627	B	0.35114	0.196	T	0.06770	-1.0808	10	0.11794	T	0.64	-0.3549	14.6294	0.68645	0.0695:0.0:0.9305:0.0	.	346	Q96KP1	EXOC2_HUMAN	K	346	ENSP00000230449:T346K	ENSP00000230449:T346K	T	-	2	0	EXOC2	543057	1.000000	0.71417	0.973000	0.42090	0.853000	0.48598	9.101000	0.94219	1.412000	0.46977	-0.142000	0.14014	ACA			0.308	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039627.1		NM_018303	
ZNF322	79692	broad.mit.edu	37	6	26637624	26637624	+	Silent	SNP	T	T	C			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr6:26637624T>C	ENST00000415922.2	-	4	1803	c.1158A>G	c.(1156-1158)aaA>aaG	p.K386K	RP11-457M11.2_ENST00000456172.1_RNA|ZNF322_ENST00000471278.1_Silent_p.K386K|ZNF322_ENST00000461899.1_5'Flank	NM_024639.4	NP_078915.2	Q6U7Q0	ZN322_HUMAN	zinc finger protein 322	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCTCAAGACCTTTTTCACTCA	0.413																																					p.K386K													.	.			0			c.A1158G												175.0	133.0	147.0					6																	26637624		2201	4298	6499	SO:0001819	synonymous_variant	79692	exon5			AAGACCTTTTTCA	AY376736	CCDS4617.1	6p22.1	2013-01-08	2011-07-29	2011-07-29	ENSG00000181315	ENSG00000181315		"""Zinc fingers, C2H2-type"""	23640	protein-coding gene	gene with protein product		610847	"""zinc finger protein 489"", ""HLA complex group 12"", ""zinc finger protein 322A"""	ZNF489, ZNF388, HCG12, ZNF322A		15555580	Standard	NM_024639		Approved	bA457M11.3, bA457M11.2	uc021yny.1	Q6U7Q0	OTTHUMG00000014460	ENST00000415922.2:c.1158A>G	6.37:g.26637624T>C			Somatic	762	0	0		WXS	Illumina HiSeq	Phase_I	680	0.01	7	NM_001242797	13	0.00	0	A8K1X3|Q0VDH6|Q6B0G2|Q86W72|Q9H5I9	Silent	SNP	ENST00000415922.2	37	CCDS4617.1																																																																																					0.413	ZNF322-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040126.2		NM_024639	
CUTA	51596	broad.mit.edu	37	6	33384432	33384432	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr6:33384432G>T	ENST00000488034.1	-	6	656	c.535C>A	c.(535-537)Cca>Aca	p.P179T	CUTA_ENST00000492510.1_5'Flank|CUTA_ENST00000488478.1_3'UTR|CUTA_ENST00000494751.1_Nonsense_Mutation_p.C126*|CUTA_ENST00000607266.1_Missense_Mutation_p.P156T|CUTA_ENST00000440279.3_Missense_Mutation_p.P156T|CUTA_ENST00000374496.3_Missense_Mutation_p.P156T|CUTA_ENST00000374500.5_Missense_Mutation_p.P198T	NM_001014837.1|NM_001014838.1|NM_001014840.1|NM_015921.2	NP_001014837.1|NP_001014838.1|NP_001014840.1|NP_057005.1	O60888	CUTA_HUMAN	cutA divalent cation tolerance homolog (E. coli)	179					protein localization (GO:0008104)|response to metal ion (GO:0010038)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)		SLC22A1/CUTA(2)	kidney(1)|lung(3)|urinary_tract(1)	5						GCTCATCATGGCAGGACTGTG	0.537																																					p.P198T													.	CUTA	5		0			c.C592A												93.0	83.0	86.0					6																	33384432		2203	4300	6503	SO:0001583	missense	51596	exon6			ATCATGGCAGGAC	AF106943	CCDS4779.1, CCDS34432.1, CCDS34433.1	6p21.32	2008-02-04	2006-02-15	2006-02-15	ENSG00000112514	ENSG00000112514			21101	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 82"", ""acetylcholinesterase-associated protein"""	C6orf82, ACHAP			Standard	XM_006715108		Approved		uc003oen.1	O60888	OTTHUMG00000031254	ENST00000488034.1:c.535C>A	6.37:g.33384432G>T	ENSP00000417544:p.Pro179Thr		Somatic	247	0	0		WXS	Illumina HiSeq	Phase_I	206	0.02	4	NM_001014433	218	0.00	0	A2AB26|A2BEL4|Q3B784|Q5JXM9|Q5SU05|Q9NYQ9	Nonsense_Mutation	SNP	ENST00000488034.1	37	CCDS34433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.076301|4.076301	0.76415|0.76415	.|.	.|.	ENSG00000112514|ENSG00000112514	ENST00000494751|ENST00000374500;ENST00000440279;ENST00000488034;ENST00000374496	.|.	.|.	.|.	4.98|4.98	4.09|4.09	0.47781|0.47781	.|.	.|0.161610	.|0.29822	.|N	.|0.011109	.|T	.|0.19765	.|0.0475	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|P;B	.|0.41131	.|0.739;0.18	.|P;B	.|0.45232	.|0.474;0.07	.|T	.|0.03863	.|-1.0997	.|9	.|0.87932	.|D	.|0	.|.	9.3953|9.3953	0.38399|0.38399	0.0988:0.0:0.9012:0.0|0.0988:0.0:0.9012:0.0	.|.	.|198;179	.|O60888-2;O60888	.|.;CUTA_HUMAN	X|T	126|198;156;179;156	.|.	.|ENSP00000363620:P156T	C|P	-|-	3|1	2|0	CUTA|CUTA	33492410|33492410	0.351000|0.351000	0.24887|0.24887	0.237000|0.237000	0.24090|0.24090	0.234000|0.234000	0.25298|0.25298	2.842000|2.842000	0.48230|0.48230	2.582000|2.582000	0.87167|0.87167	0.655000|0.655000	0.94253|0.94253	TGC|CCA			0.537	CUTA-008	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000076541.3		NM_015921	
GJA1	2697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	121768358	121768358	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr6:121768358A>G	ENST00000282561.3	+	2	522	c.365A>G	c.(364-366)aAt>aGt	p.N122S		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	122					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	GATGGTGTCAATGTGGACATG	0.448																																					p.N122S													.	.			0			c.A365G												125.0	116.0	119.0					6																	121768358		2203	4300	6503	SO:0001583	missense	2697	exon2			GTGTCAATGTGGA	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.365A>G	6.37:g.121768358A>G	ENSP00000282561:p.Asn122Ser		Somatic	131	0	0		WXS	Illumina HiSeq	.	168	0.24	40	NM_000165	218	0.22	49	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	A	1.685	-0.505626	0.04261	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.97016	-4.21	5.23	5.23	0.72850	.	0.698454	0.14238	N	0.332275	D	0.85013	0.5600	N	0.11064	0.09	0.52099	D	0.999947	B	0.09022	0.002	B	0.06405	0.002	T	0.78229	-0.2285	10	0.11794	T	0.64	.	15.1283	0.72500	1.0:0.0:0.0:0.0	.	122	P17302	CXA1_HUMAN	S	106;122	ENSP00000282561:N122S	ENSP00000282561:N122S	N	+	2	0	GJA1	121810057	1.000000	0.71417	0.076000	0.20297	0.018000	0.09664	9.287000	0.95975	1.993000	0.58246	0.377000	0.23210	AAT			0.448	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042023.1		NM_000165	
MTHFD1L	25902	broad.mit.edu	37	6	151413631	151413631	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr6:151413631G>T	ENST00000367321.3	+	27	3150	c.2876G>T	c.(2875-2877)cGg>cTg	p.R959L	RP1-292B18.4_ENST00000415477.1_RNA	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	959	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		CTGCCCACCCGGCCCTGCTTT	0.488																																					p.R960L													.	MTHFD1L	75		0			c.G2879T												92.0	88.0	90.0					6																	151413631		2203	4300	6503	SO:0001583	missense	25902	exon27			CCACCCGGCCCTG	BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2876G>T	6.37:g.151413631G>T	ENSP00000356290:p.Arg959Leu		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	117	0.03	4	NM_001242767	106	0.00	0	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	37	CCDS5228.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943936	0.92593	.	.	ENSG00000120254	ENST00000367321	T	0.22945	1.93	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.54271	0.1848	M	0.91612	3.225	0.80722	D	1	D;D;P	0.60160	0.987;0.972;0.922	P;D;P	0.68765	0.781;0.96;0.655	T	0.63642	-0.6591	10	0.62326	D	0.03	.	18.4037	0.90526	0.0:0.0:1.0:0.0	.	960;714;959	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	L	959	ENSP00000356290:R959L	ENSP00000356290:R959L	R	+	2	0	MTHFD1L	151455324	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	8.060000	0.89464	2.652000	0.90054	0.655000	0.94253	CGG			0.488	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042699.1		NM_015440	
CCT6P3	643180	broad.mit.edu	37	7	64528813	64528814	+	RNA	INS	-	-	T			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr7:64528813_64528814insT	ENST00000426828.1	+	0	621				SNORA15_ENST00000384334.1_RNA|SNORA22_ENST00000384614.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		CTTTCTGTAACTTTTTTTTTTT	0.317																																					.													.	.			0			.																																											0	.			CTGTAACTTTTTT			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64528824_64528824dupT			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	52	0.15	8	.	1	0.00	0		RNA	INS	ENST00000426828.1	37																																																																																						0.317	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
CCT6P3	643180	broad.mit.edu	37	7	64530103	64530103	+	RNA	SNP	G	G	A	rs369683052		TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr7:64530103G>A	ENST00000426828.1	+	0	923				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGACTGCTTGGGACATGCAGG	0.388																																					.													.	.			0			.																																											0	.			TGCTTGGGACATG			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530103G>A			Somatic	44	0.0227272727	1		WXS	Illumina HiSeq	Phase_I	113	0.05	6	.	54	0.00	0		RNA	SNP	ENST00000426828.1	37																																																																																						0.388	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	348	0.02	7	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
BUD31	8896	hgsc.bcm.edu;broad.mit.edu	37	7	99015089	99015089	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr7:99015089delC	ENST00000403633.2	+	5	784	c.255delC	c.(253-255)gacfs	p.D85fs	PTCD1_ENST00000292478.4_3'UTR|BUD31_ENST00000456893.1_Frame_Shift_Del_p.D44fs|BUD31_ENST00000222969.5_Frame_Shift_Del_p.D85fs|BUD31_ENST00000431419.1_Frame_Shift_Del_p.D56fs			P41223	BUD31_HUMAN	BUD31 homolog (S. cerevisiae)	85					regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	4	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GCTATGCAGACAAAAACCTGA	0.443																																					p.D85fs													.	BUD31	12		0			c.254delA												74.0	72.0	73.0					7																	99015089		2203	4300	6503	SO:0001589	frameshift_variant	8896	exon5			TGCAGACAAAAAC	BC022821	CCDS5663.1	7q22.1	2012-06-07	2007-01-12	2006-03-16	ENSG00000106245	ENSG00000106245			29629	protein-coding gene	gene with protein product	"""G10 maternal transcript homolog (Xenopus laevis)"", ""functional spliceosome-associated protein 17"""	603477	"""BUD31 homolog (yeast)"""			7841202	Standard	NM_003910		Approved	YCR063W, EDG-2, EDG2, G10, fSAP17, Cwc14	uc003uqg.4	P41223	OTTHUMG00000154602	ENST00000403633.2:c.255delC	7.37:g.99015089delC	ENSP00000386023:p.Asp85fs		Somatic	53	0	0		WXS	Illumina HiSeq	.	119	0.12	14	NM_003910	359	0.00	0	A4D274|B7Z4S9|D6W5S6|Q6IB53|Q9UDV1	Frame_Shift_Del	DEL	ENST00000403633.2	37	CCDS5663.1																																																																																					0.443	BUD31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336275.1		NM_003910	
PRKDC	5591	broad.mit.edu	37	8	48746799	48746799	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chr8:48746799delT	ENST00000314191.2	-	60	8163	c.8107delA	c.(8107-8109)aggfs	p.R2703fs	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Frame_Shift_Del_p.R2703fs	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2704	KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	AGGCCCAGCCTTTTTTTCCCA	0.498								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)												.	PRKDC	394		0			.												248.0	251.0	250.0					8																	48746799		1981	4176	6157	SO:0001589	frameshift_variant	5591	.			CCAGCCTTTTTTT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.8107delA	8.37:g.48746799delT	ENSP00000313420:p.Arg2703fs		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	186	0.04	8	.	115	0.00	0	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Del	DEL	ENST00000314191.2	37																																																																																						0.498	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001081640	
MT-CO1	4512	hgsc.bcm.edu;broad.mit.edu	37	M	3047	3047	+	5'Flank	SNP	G	G	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chrM:3047G>A	ENST00000361624.2	+	0	0				MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CGTTTGTTCAACGATTAAAGT	0.433																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6053	.			TTCAACGATTAAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3047G>A	Exception_encountered		Somatic	12	0	0		WXS	Illumina HiSeq	.	14	1.00	14	.	0		0	Q34770	RNA	SNP	ENST00000361624.2	37																																																																																						0.433	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024028	
FRMPD3	84443	broad.mit.edu	37	X	106846471	106846471	+	Silent	SNP	A	A	G			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chrX:106846471A>G	ENST00000276185.4	+	16	5301	c.5301A>G	c.(5299-5301)caA>caG	p.Q1767Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1767	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						agcagcagcaacaacaacagc	0.587																																					.													.	.			0			.												3.0	2.0	3.0					X																	106846471		724	1626	2350	SO:0001819	synonymous_variant	84443	.			GCAGCAACAACAA	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5301A>G	X.37:g.106846471A>G			Somatic	114	0.0087719298	1		WXS	Illumina HiSeq	Phase_I	192	0.03	5	.	3	0.00	0	Q96JK8	Silent	SNP	ENST00000276185.4	37																																																																																						0.587	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_042978	
TXLNGY	246126	broad.mit.edu	37	Y	21761906	21761907	+	RNA	INS	-	-	A			TCGA-2G-AAKM-01A-11D-A42Y-10	TCGA-2G-AAKM-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8473a77-81c3-414f-b0a5-86648ae24892	b3877f2d-d476-43dd-8e0c-008ad1e0029a	g.chrY:21761906_21761907insA	ENST00000253320.4	+	0	4725																				haematopoietic_and_lymphoid_tissue(1)	1						acaaaagtgggaaaaaaaaaaa	0.48																																					.													.	TXLNG2P	4		0			.																																											0	.			AAGTGGGAAAAAA																													Y.37:g.21761917_21761917dupA			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	9	0.44	4	.	0		0		RNA	INS	ENST00000253320.4	37																																																																																						0.480	TXLNG2P-012	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000088781.1			
