#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SPEN	23013	bcgsc.ca	37	1	16199321	16199321	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:16199321G>T	ENST00000375759.3	+	2	298	c.94G>T	c.(94-96)Gtg>Ttg	p.V32L		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	32	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATATGGCCGCGTGGAAAGTGT	0.383																																					p.V32L													SPEN,NS,carcinoma,0,1	SPEN	374	1	0			c.G94T												63.0	68.0	66.0					1																	16199321		2203	4300	6503	SO:0001583	missense	23013	exon2			GGCCGCGTGGAAA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.94G>T	1.37:g.16199321G>T	ENSP00000364912:p.Val32Leu		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_1	55	0.00	0	NM_015001	74	0.00	0	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659723	0.47572	.	.	ENSG00000065526	ENST00000375759	T	0.20598	2.06	5.58	5.58	0.84498	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	T	0.43322	0.1242	L	0.46819	1.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.21381	-1.0247	9	0.72032	D	0.01	-1.6403	19.5632	0.95380	0.0:0.0:1.0:0.0	.	32	Q96T58	MINT_HUMAN	L	32	ENSP00000364912:V32L	ENSP00000364912:V32L	V	+	1	0	SPEN	16071908	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.476000	0.97823	2.636000	0.89361	0.557000	0.71058	GTG			0.383	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025993.1		NM_015001	
SPEN	23013	mdanderson.org	37	1	16258924	16258924	+	Silent	SNP	A	A	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:16258924A>G	ENST00000375759.3	+	11	6393	c.6189A>G	c.(6187-6189)gtA>gtG	p.V2063V		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2063					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TTGAAGTTGTAGAGAAAAAAC	0.483																																					p.V2063V													.	.			0			c.A6189G												46.0	56.0	53.0					1																	16258924		2172	4277	6449	SO:0001819	synonymous_variant	23013	exon11			AGTTGTAGAGAAA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.6189A>G	1.37:g.16258924A>G			Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_015001	255	0.00	0	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	37	CCDS164.1																																																																																					0.483	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025993.1		NM_015001	
CROCCP2	84809	broad.mit.edu	37	1	16959834	16959834	+	lincRNA	SNP	G	G	T	rs201123694	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:16959834G>T	ENST00000412962.1	-	0	23							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCCAGCTGCAGCGGGTCCCTT	0.642																																					.													Q6ZWC0_HUMAN,NS,carcinoma,0,1	.		1	0			.																																											0	.			GCTGCAGCGGGTC	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16959834G>T			Somatic	41	0.0243902439	1		WXS	Illumina HiSeq	Phase_I	52	0.19	10	.	16	0.19	3	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	ENST00000412962.1	37																																																																																						0.642	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000092784.1		NR_026752.1	
ECE1	1889	mdanderson.org	37	1	21560084	21560084	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:21560084G>A	ENST00000374893.6	-	14	1711	c.1637C>T	c.(1636-1638)gCc>gTc	p.A546V	ECE1_ENST00000264205.6_Missense_Mutation_p.A543V|ECE1_ENST00000436918.2_Missense_Mutation_p.A546V|ECE1_ENST00000357071.4_Missense_Mutation_p.A534V|ECE1_ENST00000415912.2_Missense_Mutation_p.A530V	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	546					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		GAGCTGATCGGCAGTGACCCT	0.542																																					p.A546V													.	.			0			c.C1637T												59.0	63.0	62.0					1																	21560084		2203	4300	6503	SO:0001583	missense	1889	exon14			TGATCGGCAGTGA	D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.1637C>T	1.37:g.21560084G>A	ENSP00000364028:p.Ala546Val		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	59	0.07	4	NM_001397	119	0.00	0	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	ENST00000374893.6	37	CCDS215.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733330	0.69189	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	5.36	5.36	0.76844	.	0.106321	0.64402	D	0.000006	D	0.84543	0.5495	L	0.57536	1.79	0.80722	D	1	B;D;B;D;D	0.60575	0.004;0.98;0.015;0.988;0.988	B;P;B;P;P	0.53722	0.008;0.546;0.009;0.733;0.733	D	0.84790	0.0778	10	0.46703	T	0.11	-26.039	17.6527	0.88169	0.0:0.0:1.0:0.0	.	546;530;546;534;543	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	V	530;534;546;546;543	ENSP00000405088:A530V;ENSP00000349581:A534V;ENSP00000364028:A546V;ENSP00000388439:A546V;ENSP00000264205:A543V	ENSP00000264205:A543V	A	-	2	0	ECE1	21432671	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.441000	0.97557	2.527000	0.85204	0.655000	0.94253	GCC			0.542	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000007470.2		NM_001397	
ZMYM4	9202	bcgsc.ca	37	1	35836147	35836147	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:35836147C>T	ENST00000314607.6	+	7	1180	c.1100C>T	c.(1099-1101)aCa>aTa	p.T367I	ZMYM4_ENST00000373297.2_Missense_Mutation_p.T367I|ZMYM4_ENST00000482131.1_3'UTR	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	367					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTCTGCTCCACACTGTGCCTC	0.473																																					p.T367I													.	ZMYM4	143		0			c.C1100T												99.0	97.0	97.0					1																	35836147		2203	4300	6503	SO:0001583	missense	9202	exon7			GCTCCACACTGTG	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1100C>T	1.37:g.35836147C>T	ENSP00000322915:p.Thr367Ile		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_1	76	0.00	0	NM_005095	31	0.00	0	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471841	0.84533	.	.	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.46063	0.88;0.88	5.48	5.48	0.80851	TRASH (1);Zinc finger, MYM-type (1);	0.054232	0.64402	D	0.000001	T	0.53722	0.1814	L	0.35854	1.095	0.24985	N	0.991578	P	0.46578	0.88	P	0.60541	0.876	T	0.45659	-0.9246	10	0.28530	T	0.3	-10.9595	19.3456	0.94361	0.0:1.0:0.0:0.0	.	367	Q5VZL5	ZMYM4_HUMAN	I	367	ENSP00000322915:T367I;ENSP00000362394:T367I	ENSP00000322915:T367I	T	+	2	0	ZMYM4	35608734	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	6.745000	0.74860	2.573000	0.86826	0.591000	0.81541	ACA			0.473	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012207.3		NM_005095	
NRAS	4893	bcgsc.ca	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	C	rs11554290	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:115256529T>C	ENST00000369535.4	-	3	435	c.182A>G	c.(181-183)cAa>cGa	p.Q61R		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61R				Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,-1,2068	NRAS	3766	2068	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	c.A182G												180.0	156.0	164.0					1																	115256529		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TCTTCTTGTCCAG	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>G	1.37:g.115256529T>C	ENSP00000358548:p.Gln61Arg		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_1	124	0.00	0	NM_002524	68	0.00	0	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004139	0.74932	.	.	ENSG00000213281	ENST00000369535	D	0.83673	-1.75	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.86489	0.5945	M	0.92604	3.325	0.80722	D	1	B	0.28512	0.214	B	0.39590	0.304	D	0.88255	0.2919	10	0.66056	D	0.02	.	15.0132	0.71565	0.0:0.0:0.0:1.0	rs11554290;rs11554290	61	P01111	RASN_HUMAN	R	61	ENSP00000358548:Q61R	ENSP00000358548:Q61R	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA			0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033395.2		NM_002524	
RP11-782C8.2	0	broad.mit.edu	37	1	143195473	143195473	+	lincRNA	DEL	A	A	-	rs201120234		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:143195473delA	ENST00000412204.2	-	0	2287				RP11-782C8.1_ENST00000438000.1_lincRNA																							ATACAAAAGCAAAAAAAAAAA	0.244																																					.													.	.			0			.																																											0	.			AAAAGCAAAAAAA																													1.37:g.143195473delA			Somatic	6	0.1666666667	1		WXS	Illumina HiSeq	Phase_I	11	0.55	6	.	0		0		RNA	DEL	ENST00000412204.2	37																																																																																						0.244	RP11-782C8.2-004	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000037567.2			
CR1	1378	broad.mit.edu	37	1	207749012	207749012	+	Silent	SNP	G	G	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:207749012G>A	ENST00000367049.4	+	28	4524	c.4524G>A	c.(4522-4524)ccG>ccA	p.P1508P	CR1_ENST00000367053.1_Silent_p.P1058P|CR1_ENST00000367051.1_Silent_p.P1058P|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Silent_p.P1058P|CR1_ENST00000367052.1_Silent_p.P1058P|RP11-78B10.2_ENST00000596003.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1058	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCACGAAGCCGCCAATTTGTC	0.448																																					p.P1508P													.	CR1	354		0			c.G4524A												291.0	281.0	284.0					1																	207749012		1899	4129	6028	SO:0001819	synonymous_variant	1378	exon28			GAAGCCGCCAATT	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4524G>A	1.37:g.207749012G>A			Somatic	287	0	0		WXS	Illumina HiSeq	Phase_I	286	0.01	4	NM_000651	6	0.00	0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	37	CCDS44308.1																																																																																					0.448	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382527.1		NM_000573	
ARMC3	219681	bcgsc.ca	37	10	23290962	23290962	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr10:23290962G>A	ENST00000298032.5	+	12	1624	c.1540G>A	c.(1540-1542)Gcc>Acc	p.A514T	ARMC3_ENST00000376528.4_Missense_Mutation_p.A251T|ARMC3_ENST00000409983.3_Missense_Mutation_p.A514T|ARMC3_ENST00000409049.3_Missense_Mutation_p.A514T	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	514						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CGAGCTGACGGCCAATGAATT	0.542																																					p.A514T													.	ARMC3	102		0			c.G1540A												107.0	90.0	96.0					10																	23290962		2203	4300	6503	SO:0001583	missense	219681	exon12			CTGACGGCCAATG	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1540G>A	10.37:g.23290962G>A	ENSP00000298032:p.Ala514Thr		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_1	109	0.00	0	NM_173081	2	0.00	0	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033024	0.75504	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.64438	-0.1;-0.1;0.95;0.69	5.91	2.9	0.33743	Armadillo-like helical (1);	0.207206	0.49916	D	0.000122	T	0.76550	0.4003	M	0.80746	2.51	0.37084	D	0.899142	D;D	0.67145	0.996;0.978	D;P	0.74348	0.983;0.737	T	0.80752	-0.1242	10	0.87932	D	0	-4.6801	9.8379	0.40980	0.0651:0.0:0.6846:0.2503	.	514;514	Q5W041-4;Q5W041	.;ARMC3_HUMAN	T	514;514;450;514;251	ENSP00000298032:A514T;ENSP00000386943:A514T;ENSP00000387288:A514T;ENSP00000365711:A251T	ENSP00000298032:A514T	A	+	1	0	ARMC3	23330968	1.000000	0.71417	0.005000	0.12908	0.047000	0.14425	4.007000	0.57093	0.799000	0.34018	0.655000	0.94253	GCC			0.542	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047197.2		NM_173081	
UNC5B	219699	mdanderson.org	37	10	73056412	73056412	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr10:73056412G>T	ENST00000335350.6	+	15	2819	c.2403G>T	c.(2401-2403)ttG>ttT	p.L801F	UNC5B_ENST00000373192.4_Missense_Mutation_p.L790F	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	801	UPA domain. {ECO:0000250}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GGCACAGCTTGGCCTCCACAG	0.597																																					p.L801F													.	.			0			c.G2403T												75.0	65.0	69.0					10																	73056412		2203	4300	6503	SO:0001583	missense	219699	exon15			CAGCTTGGCCTCC	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2403G>T	10.37:g.73056412G>T	ENSP00000334329:p.Leu801Phe		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_170744	2	0.00	0	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.610766	0.46527	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.51325	0.76;0.71	5.23	1.06	0.20224	.	0.090906	0.46758	D	0.000276	T	0.51227	0.1662	M	0.66939	2.045	0.52501	D	0.999951	D;D	0.63046	0.988;0.992	P;P	0.52598	0.703;0.625	T	0.49615	-0.8921	10	0.56958	D	0.05	-14.1075	7.5484	0.27781	0.2051:0.1182:0.6767:0.0	.	790;801	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	F	801;790	ENSP00000334329:L801F;ENSP00000362288:L790F	ENSP00000334329:L801F	L	+	3	2	UNC5B	72726418	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.394000	0.52551	0.176000	0.19873	0.561000	0.74099	TTG			0.597	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048541.1		NM_170744	
SMC3	9126	bcgsc.ca	37	10	112361739	112361739	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr10:112361739G>C	ENST00000361804.4	+	25	3034	c.2908G>C	c.(2908-2910)Gag>Cag	p.E970Q		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	970					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TCGAAAACTTGAGCAGTGCAA	0.299																																					p.E970Q													.	SMC3	103		0			c.G2908C												40.0	42.0	41.0					10																	112361739		2200	4297	6497	SO:0001583	missense	9126	exon25			AAACTTGAGCAGT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2908G>C	10.37:g.112361739G>C	ENSP00000354720:p.Glu970Gln		Somatic	140	0	0		WXS	Illumina HiSeq	Phase_1	144	0.00	0	NM_005445	483	0.00	1	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850234	0.71719	.	.	ENSG00000108055	ENST00000361804	T	0.75821	-0.97	5.56	5.56	0.83823	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.80270	0.4592	L	0.58101	1.795	0.80722	D	1	P	0.49862	0.929	P	0.52957	0.714	T	0.76008	-0.3116	10	0.27785	T	0.31	.	19.8984	0.96975	0.0:0.0:1.0:0.0	.	970	Q9UQE7	SMC3_HUMAN	Q	970	ENSP00000354720:E970Q	ENSP00000354720:E970Q	E	+	1	0	SMC3	112351729	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.967000	0.93402	2.780000	0.95670	0.585000	0.79938	GAG			0.299	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050337.1		NM_005445	
MTG1	92170	mdanderson.org	37	10	135207793	135207793	+	Silent	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr10:135207793C>T	ENST00000317502.6	+	1	119	c.69C>T	c.(67-69)tgC>tgT	p.C23C	MTG1_ENST00000477902.2_Intron|RP11-108K14.8_ENST00000468317.2_Intron	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	23					GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		TCCCCCTGTGCGGTCGCGACG	0.741																																					p.C23C													.	.			0			c.C69T												5.0	6.0	6.0					10																	135207793		1809	3459	5268	SO:0001819	synonymous_variant	92170	exon1			CCTGTGCGGTCGC		CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.69C>T	10.37:g.135207793C>T			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_138384	72	0.00	0	Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Silent	SNP	ENST00000317502.6	37	CCDS31320.1																																																																																					0.741	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051166.1		NM_138384	
KRTAP5-5	439915	mdanderson.org	37	11	1651442	1651442	+	Silent	SNP	G	G	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:1651442G>C	ENST00000399676.2	+	1	410	c.372G>C	c.(370-372)ggG>ggC	p.G124G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	124	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G124G(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.692																																					p.G124G													KRTAP5-5,bladder,carcinoma,0,4	KRTAP5-5	0	4	2	Substitution - coding silent(2)	prostate(2)	c.G372C																																									SO:0001819	synonymous_variant	439915	exon1			TGGGGGGTCCAAG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.372G>C	11.37:g.1651442G>C			Somatic	48	0.0833333333	4		WXS	Illumina HiSeq	Phase_I	35	0.11	4	NM_001001480	0		0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																					0.692	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127919.1			
FOLH1	2346	bcgsc.ca	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																					p.Y277Y													.	FOLH1	141		0			c.T831C												61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346	exon7			ATAAGCATATTCT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			Somatic	182	0.010989011	2		WXS	Illumina HiSeq	Phase_1	153	0.05	8	NM_004476	0		0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																					0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390896.1		NM_004476	
COLCA1	399948	mdanderson.org	37	11	111168758	111168758	+	5'UTR	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:111168758C>T	ENST00000532918.1	-	0	851				COLCA1_ENST00000355430.4_5'UTR|COLCA2_ENST00000526216.1_5'Flank|COLCA1_ENST00000526150.1_5'Flank|COLCA2_ENST00000398035.2_5'Flank|COLCA1_ENST00000540738.1_5'Flank			Q6ZS62	COLC1_HUMAN	colorectal cancer associated 1							integral component of membrane (GO:0016021)|membrane (GO:0016020)											ATGCGGGAATCAGTCTGGCCA	0.542																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	399948	.			GGGAATCAGTCTG	AK127703		11q23.1	2013-08-22	2013-08-22	2013-08-22	ENSG00000196167	ENSG00000196167			33789	other	unknown	"""cancer susceptibility candidate 12"""	615693	"""chromosome 11 open reading frame 92"""	C11orf92			Standard	NR_034154		Approved	FLJ45803, CASC12	uc001pld.3	Q6ZS62	OTTHUMG00000166658	ENST00000532918.1:c.-1555G>A	11.37:g.111168758C>T			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	.	0		0		RNA	SNP	ENST00000532918.1	37																																																																																						0.542	COLCA1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000390999.1			
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	113076296	113076296	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:113076296A>G	ENST00000533760.1	+	4	643	c.44A>G	c.(43-45)gAa>gGa	p.E15G	NCAM1_ENST00000401611.2_Missense_Mutation_p.E132G|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Missense_Mutation_p.E123G	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	133					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CGGGAGGGGGAAGATGCCGTG	0.507																																					p.E133G													.	.			0			c.A398G												123.0	124.0	123.0					11																	113076296		2001	4150	6151	SO:0001583	missense	4684	exon5			AGGGGGAAGATGC		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.44A>G	11.37:g.113076296A>G	ENSP00000473281:p.Glu15Gly		Somatic	137	0	0		WXS	Illumina HiSeq	.	115	0.04	5	NM_001242608	3	0.00	0	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	A	19.52	3.843543	0.71488	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.41758	0.99;0.99	5.73	4.6	0.57074	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.147481	0.64402	N	0.000005	T	0.47060	0.1425	.	.	.	0.80722	D	1	P;P;P;P;D	0.53745	0.922;0.869;0.573;0.932;0.962	B;B;B;P;P	0.47402	0.337;0.179;0.198;0.499;0.546	T	0.50329	-0.8841	9	0.87932	D	0	-40.3969	11.7692	0.51949	0.9311:0.0:0.0689:0.0	.	133;133;133;133;133	P13591-5;P13591-1;P13591;P13591-3;P13591-6	.;.;NCAM1_HUMAN;.;.	G	15;132;123	ENSP00000384055:E132G;ENSP00000318472:E123G	ENSP00000318472:E123G	E	+	2	0	NCAM1	112581506	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.240000	0.78192	0.994000	0.38892	-0.290000	0.09829	GAA			0.507	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000394068.2		NM_000615	
PHLDB1	23187	mdanderson.org	37	11	118498701	118498701	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:118498701G>T	ENST00000361417.2	+	7	1573	c.1162G>T	c.(1162-1164)Gtc>Ttc	p.V388F	PHLDB1_ENST00000356063.5_Missense_Mutation_p.V388F	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	388										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TCAGCCTCCAGTCCCTGCTCC	0.617																																					p.V388F													.	.			0			c.G1162T												93.0	90.0	91.0					11																	118498701		2200	4295	6495	SO:0001583	missense	23187	exon6			CCTCCAGTCCCTG		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1162G>T	11.37:g.118498701G>T	ENSP00000354498:p.Val388Phe		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001144758	22	0.00	0	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281122	0.23392	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000356063	T;T	0.31510	1.49;1.5	5.13	4.15	0.48705	.	0.746115	0.12946	N	0.426229	T	0.17619	0.0423	N	0.25647	0.755	0.18873	N	0.999981	P;B;B	0.37636	0.603;0.144;0.435	B;B;B	0.34242	0.178;0.022;0.082	T	0.05954	-1.0854	10	0.10902	T	0.67	-32.9979	8.6444	0.33996	0.1765:0.0:0.8235:0.0	.	388;388;388	Q86UU1-3;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	F	388;147;388	ENSP00000354498:V388F;ENSP00000348359:V388F	ENSP00000348359:V388F	V	+	1	0	PHLDB1	118003911	0.925000	0.31364	0.997000	0.53966	0.949000	0.60115	1.690000	0.37711	2.667000	0.90743	0.563000	0.77884	GTC			0.617	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389279.1		NM_015157	
KDM5A	5927	bcgsc.ca	37	12	459828	459828	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:459828G>A	ENST00000399788.2	-	10	1629	c.1267C>T	c.(1267-1269)Ccg>Tcg	p.P423S	KDM5A_ENST00000382815.4_Missense_Mutation_p.P423S	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	423					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						TCCTTCACCGGAAATCCACTT	0.418			T	NUP98	AML																																p.P423S				Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	KDM5A_ENST00000399788,NS,carcinoma,+1,4	KDM5A	307	4	0			c.C1267T												106.0	99.0	101.0					12																	459828		1855	4098	5953	SO:0001583	missense	5927	exon10			TCACCGGAAATCC		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.1267C>T	12.37:g.459828G>A	ENSP00000382688:p.Pro423Ser		Somatic	183	0	0		WXS	Illumina HiSeq	Phase_1	219	0.00	0	NM_001042603	39	0.00	0	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	33	5.253523	0.95336	.	.	ENSG00000073614	ENST00000399787;ENST00000399788;ENST00000382815	D;D	0.89270	-2.49;-2.29	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.95191	0.8441	M	0.83312	2.635	0.80722	D	1	D;D;D	0.89917	0.999;0.986;1.0	D;D;D	0.97110	0.996;0.966;1.0	D	0.95154	0.8275	10	0.87932	D	0	-15.0622	20.058	0.97661	0.0:0.0:1.0:0.0	.	423;423;423	F5H1F7;P29375;P29375-2	.;KDM5A_HUMAN;.	S	382;423;423	ENSP00000382688:P423S;ENSP00000372265:P423S	ENSP00000372265:P423S	P	-	1	0	KDM5A	330089	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.809000	0.99208	2.752000	0.94435	0.655000	0.94253	CCG			0.418	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397812.1		NM_005056	
ASIC1	41	mdanderson.org	37	12	50452708	50452708	+	Silent	SNP	C	C	A	rs653576	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:50452708C>A	ENST00000447966.2	+	2	388	c.159C>A	c.(157-159)tcC>tcA	p.S53S	ASIC1_ENST00000228468.4_Silent_p.S53S	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	53					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	TCCTGGGCTCCCTGGCTGTGC	0.622																																					p.S53S													.	.			0			c.C159A												139.0	110.0	120.0					12																	50452708		2203	4300	6503	SO:0001819	synonymous_variant	41	exon2			GGGCTCCCTGGCT	U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.159C>A	12.37:g.50452708C>A			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	73	0.03	2	NM_020039	4	0.00	0	A3KN86|E5KBL7|P78349|Q96CV2	Silent	SNP	ENST00000447966.2	37	CCDS44876.1																																																																																					0.622	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406004.2		NM_020039	
PTPRB	5787	bcgsc.ca	37	12	70970172	70970172	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:70970172T>A	ENST00000261266.5	-	9	2207	c.2178A>T	c.(2176-2178)caA>caT	p.Q726H	PTPRB_ENST00000551525.1_Missense_Mutation_p.Q943H|PTPRB_ENST00000451516.2_Missense_Mutation_p.Q636H|PTPRB_ENST00000334414.6_Missense_Mutation_p.Q944H|PTPRB_ENST00000550857.1_Missense_Mutation_p.Q636H|PTPRB_ENST00000538708.1_Missense_Mutation_p.Q726H|PTPRB_ENST00000550358.1_Intron	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	726	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTGTCCGCTCTTGGCTGAAGG	0.512																																					p.Q944H													.	PTPRB	676		0			c.A2832T												57.0	58.0	57.0					12																	70970172		1986	4170	6156	SO:0001583	missense	5787	exon11			CCGCTCTTGGCTG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2178A>T	12.37:g.70970172T>A	ENSP00000261266:p.Gln726His		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_1	110	0.00	0	NM_001109754	8	0.00	0	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	37	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	T	13.81	2.347471	0.41599	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T	0.05025	4.03;4.02;4.11;4.02;4.08;3.51;3.56	5.98	-1.95	0.07548	Fibronectin, type III (2);	0.185240	0.48286	N	0.000190	T	0.11410	0.0278	L	0.47716	1.5	0.30825	N	0.737355	D;D;D;P;D;D	0.69078	0.994;0.994;0.988;0.903;0.997;0.981	D;D;P;P;D;P	0.65987	0.914;0.914;0.823;0.605;0.94;0.823	T	0.07347	-1.0777	10	0.27082	T	0.32	.	7.8677	0.29547	0.1095:0.464:0.0:0.4265	.	636;726;823;943;944;726	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467	.;.;.;.;.;PTPRB_HUMAN	H	944;636;726;636;726;943;823	ENSP00000334928:Q944H;ENSP00000393028:Q636H;ENSP00000438927:Q726H;ENSP00000447302:Q636H;ENSP00000261266:Q726H;ENSP00000448349:Q943H;ENSP00000446982:Q823H	ENSP00000261266:Q726H	Q	-	3	2	PTPRB	69256439	0.992000	0.36948	0.991000	0.47740	0.930000	0.56654	0.286000	0.18902	-0.394000	0.07727	0.528000	0.53228	CAA			0.512	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000404439.1			
CCDC60	160777	mdanderson.org	37	12	119866560	119866560	+	Nonsense_Mutation	SNP	C	C	T	rs373119369		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:119866560C>T	ENST00000327554.2	+	2	628	c.163C>T	c.(163-165)Cga>Tga	p.R55*	RP11-768F21.1_ENST00000509470.2_lincRNA|CCDC60_ENST00000546345.1_3'UTR|CCDC60_ENST00000536742.1_Nonsense_Mutation_p.R55*|CCDC60_ENST00000539847.1_Nonsense_Mutation_p.R55*	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	55										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GGACCTTATACGAAGCCGGTG	0.478																																					p.R55X													CCDC60,NS,malignant_melanoma,-1,3	CCDC60	-1	3	0			c.C163T							C	stop/ARG	0,4406		0,0,2203	67.0	59.0	61.0		163	3.6	0.9	12		61	1,8597		0,1,4298	no	stop-gained	CCDC60	NM_178499.3		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		55/551	119866560	1,13003	2203	4299	6502	SO:0001587	stop_gained	160777	exon2			CTTATACGAAGCC	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.163C>T	12.37:g.119866560C>T	ENSP00000333374:p.Arg55*		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_178499	0		0		Nonsense_Mutation	SNP	ENST00000327554.2	37	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565342	0.86439	0.0	1.16E-4	ENSG00000183273	ENST00000536742;ENST00000327554;ENST00000539847	.	.	.	4.54	3.63	0.41609	.	0.145780	0.31061	N	0.008324	.	.	.	.	.	.	0.29767	N	0.835063	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.5494	9.9771	0.41791	0.2015:0.7985:0.0:0.0	.	.	.	.	X	55	.	.	R	+	1	2	CCDC60	118350943	0.823000	0.29233	0.861000	0.33841	0.920000	0.55202	1.629000	0.37071	1.465000	0.48006	0.655000	0.94253	CGA			0.478	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401680.1		NM_178499	
TMEM132C	92293	mdanderson.org	37	12	129190080	129190080	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:129190080C>T	ENST00000435159.2	+	9	2567	c.2567C>T	c.(2566-2568)gCc>gTc	p.A856V	TMEM132C_ENST00000537538.1_Missense_Mutation_p.A241V|TMEM132C_ENST00000315208.8_Missense_Mutation_p.A472V	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	856						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CTCCGAAGAGCCACTACCACG	0.652																																					p.A856V													.	.			0			c.C2567T												16.0	22.0	20.0					12																	129190080		692	1591	2283	SO:0001583	missense	92293	exon9			GAAGAGCCACTAC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2567C>T	12.37:g.129190080C>T	ENSP00000410852:p.Ala856Val		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001136103	27	0.00	0	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	C	2.751	-0.260126	0.05791	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.09255	3.81;3.45;3.0	4.78	-3.23	0.05109	.	1.705140	0.03792	N	0.262971	T	0.07098	0.0180	N	0.20685	0.6	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.38887	-0.9640	10	0.25106	T	0.35	.	7.8305	0.29340	0.0:0.1145:0.3943:0.4911	.	856	Q8N3T6	T132C_HUMAN	V	856;472;241	ENSP00000410852:A856V;ENSP00000324458:A472V;ENSP00000438477:A241V	ENSP00000324458:A472V	A	+	2	0	TMEM132C	127756033	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	0.476000	0.22180	-0.492000	0.06687	-0.140000	0.14226	GCC			0.652	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_044062	
INTS6-AS1	100507398	broad.mit.edu;ucsc.edu	37	13	52035085	52035085	+	RNA	SNP	C	C	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr13:52035085C>A	ENST00000594959.1	+	0	411				INTS6-AS1_ENST00000602089.1_RNA|INTS6-AS1_ENST00000596050.1_RNA|INTS6-AS1_ENST00000594358.1_RNA|INTS6-AS1_ENST00000593928.1_RNA|INTS6-AS1_ENST00000434512.1_RNA|INTS6-AS1_ENST00000595424.1_RNA|INTS6-AS1_ENST00000598864.1_RNA|INTS6-AS1_ENST00000601318.1_RNA|INTS6-AS1_ENST00000593672.1_RNA|INTS6-AS1_ENST00000601034.1_RNA|RPS4XP16_ENST00000595905.1_RNA|INTS6-AS1_ENST00000593429.1_RNA|INTS6-AS1_ENST00000593709.1_RNA|INTS6-AS1_ENST00000594488.1_RNA|INTS6-AS1_ENST00000601572.1_RNA|INTS6-AS1_ENST00000594604.1_RNA|INTS6-AS1_ENST00000600477.1_RNA|INTS6-AS1_ENST00000596303.1_RNA|INTS6-AS1_ENST00000595997.1_RNA|INTS6-AS1_ENST00000597745.1_RNA|INTS6-AS1_ENST00000595435.1_RNA|INTS6-AS1_ENST00000599315.1_RNA|INTS6-AS1_ENST00000596180.1_RNA					INTS6 antisense RNA 1																		TCTGGTGACTCATGATGGTCG	0.418																																					.													.	.			0			.																																											0	.			GTGACTCATGATG	AA397528		13q14.3	2012-10-12	2012-08-15		ENSG00000236778	ENSG00000236778		"""Long non-coding RNAs"""	42691	non-coding RNA	RNA, long non-coding			"""INTS6 antisense RNA 1 (non-protein coding)"""				Standard	NR_103812		Approved				OTTHUMG00000016944		13.37:g.52035085C>A			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	41	0.10	4	.	8	0.00	0		RNA	SNP	ENST00000594959.1	37																																																																																						0.418	INTS6-AS1-006	KNOWN	basic	antisense	antisense		OTTHUMT00000462289.1			
RP11-597A11.1	0	broad.mit.edu	37	14	20136847	20136848	+	RNA	INS	-	-	GAGGGGAGCGCGGC	rs372682945	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr14:20136847_20136848insGAGGGGAGCGCGGC	ENST00000548261.1	+	0	391																											TGGTCGGGAGGGAGGGGAGCGC	0.743														1350	0.269569	0.2685	0.2824	5008	,	,		30508	0.1597		0.3718	False		,,,				2504	0.2699				.													.	.			0			.																																											0	.			CGGGAGGGAGGGG																													14.37:g.20136847_20136848insGAGGGGAGCGCGGC			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	23	0.22	5	.	0		0		RNA	INS	ENST00000548261.1	37																																																																																						0.743	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
KIAA0391	9692	bcgsc.ca	37	14	35593060	35593060	+	Silent	SNP	C	C	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr14:35593060C>G	ENST00000557565.1	+	2	990	c.609C>G	c.(607-609)gcC>gcG	p.A203A	PPP2R3C_ENST00000555644.1_5'Flank|KIAA0391_ENST00000603544.1_Silent_p.A203A|KIAA0391_ENST00000534898.4_Silent_p.A203A|KIAA0391_ENST00000250377.7_Silent_p.A108A|KIAA0391_ENST00000605870.1_Intron|PPP2R3C_ENST00000261475.5_5'Flank|KIAA0391_ENST00000604948.1_Silent_p.A108A|KIAA0391_ENST00000603588.1_Intron|KIAA0391_ENST00000321130.10_Silent_p.A203A	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	203					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TTATGAAAGCCAGATATAAGA	0.373																																					p.A203A													.	KIAA0391	35		0			c.C609G												61.0	62.0	62.0					14																	35593060		2203	4300	6503	SO:0001819	synonymous_variant	0	exon2			GAAAGCCAGATAT	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.609C>G	14.37:g.35593060C>G			Somatic	114	0	0		WXS	Illumina HiSeq	Phase_1	103	0.00	0	NM_014672	37	0.00	0	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Silent	SNP	ENST00000557565.1	37	CCDS32063.1																																																																																					0.373	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding		OTTHUMT00000411280.1		NM_014672	
KCNH5	27133	mdanderson.org	37	14	63417243	63417243	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr14:63417243A>G	ENST00000322893.7	-	7	1245	c.977T>C	c.(976-978)gTg>gCg	p.V326A	KCNH5_ENST00000394968.1_Missense_Mutation_p.V268A|KCNH5_ENST00000420622.2_Missense_Mutation_p.V326A|KCNH5_ENST00000394964.2_Missense_Mutation_p.V268A	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	326					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TAAGAGACGCACCACTTTTAA	0.433																																					p.V326A													.	.			0			c.T977C												57.0	57.0	57.0					14																	63417243		2203	4300	6503	SO:0001583	missense	27133	exon7			AGACGCACCACTT	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.977T>C	14.37:g.63417243A>G	ENSP00000321427:p.Val326Ala		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_172375	1	0.00	0	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	A	8.504	0.864965	0.17250	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98	5.79	5.79	0.91817	Ion transport (1);	0.116376	0.64402	D	0.000020	D	0.95364	0.8495	N	0.21448	0.665	0.80722	D	1	B;B;B;B	0.27656	0.009;0.009;0.009;0.184	B;B;B;B	0.33799	0.028;0.006;0.006;0.17	D	0.94091	0.7353	10	0.10111	T	0.7	.	16.1169	0.81309	1.0:0.0:0.0:0.0	.	268;268;326;326	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	A	326;326;268;268	ENSP00000321427:V326A;ENSP00000395439:V326A;ENSP00000378419:V268A;ENSP00000378415:V268A	ENSP00000321427:V326A	V	-	2	0	KCNH5	62486996	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.329000	0.96413	2.205000	0.71048	0.482000	0.46254	GTG			0.433	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411747.1		NM_139318	
CYP19A1	1588	bcgsc.ca	37	15	51504564	51504564	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr15:51504564A>G	ENST00000396402.1	-	9	1369	c.1216T>C	c.(1216-1218)Ttt>Ctt	p.F406L	CYP19A1_ENST00000260433.2_Missense_Mutation_p.F406L|CYP19A1_ENST00000559878.1_Missense_Mutation_p.F406L|RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000396404.4_Missense_Mutation_p.F406L	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	406					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	TTGGGGAAAAACTCGAGTCTG	0.403																																					p.F406L	Melanoma(142;1016 1807 39614 48966 51721)												.	CYP19A1	75		0			c.T1216C												134.0	127.0	129.0					15																	51504564		2196	4293	6489	SO:0001583	missense	1588	exon10			GGAAAAACTCGAG	D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.1216T>C	15.37:g.51504564A>G	ENSP00000379683:p.Phe406Leu		Somatic	138	0.0072463768	1		WXS	Illumina HiSeq	Phase_1	136	0.00	0	NM_031226	0		0	Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	ENST00000396402.1	37	CCDS10139.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361623	0.82353	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404	T;T;T	0.66638	-0.22;-0.22;-0.22	6.06	6.06	0.98353	.	0.090176	0.85682	D	0.000000	T	0.63094	0.2482	L	0.48218	1.51	0.50467	D	0.999878	B	0.25169	0.119	B	0.24541	0.054	T	0.61262	-0.7098	10	0.62326	D	0.03	-14.806	16.6093	0.84858	1.0:0.0:0.0:0.0	.	406	P11511	CP19A_HUMAN	L	406	ENSP00000379683:F406L;ENSP00000260433:F406L;ENSP00000379685:F406L	ENSP00000260433:F406L	F	-	1	0	CYP19A1	49291856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.879000	0.92398	2.324000	0.78689	0.533000	0.62120	TTT			0.403	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254669.1			
CCDC154	645811	mdanderson.org	37	16	1486047	1486047	+	Missense_Mutation	SNP	G	G	T	rs563424903		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr16:1486047G>T	ENST00000389176.3	-	14	1721	c.1555C>A	c.(1555-1557)Cta>Ata	p.L519I	CCDC154_ENST00000409671.1_Missense_Mutation_p.L365I	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	519						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						GATGATAGTAGCGTGGCCAGC	0.667																																					p.L510I													.	.			0			c.C1528A												42.0	38.0	40.0					16																	1486047		692	1590	2282	SO:0001583	missense	645811	exon14			ATAGTAGCGTGGC			16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.1555C>A	16.37:g.1486047G>T	ENSP00000373828:p.Leu519Ile		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001143980	6	0.00	0	G9JV18	Missense_Mutation	SNP	ENST00000389176.3	37		.	.	.	.	.	.	.	.	.	.	G	8.525	0.869634	0.17322	.	.	ENSG00000197599	ENST00000409671;ENST00000389176	.	.	.	5.4	1.99	0.26369	.	0.416258	0.17677	N	0.165742	T	0.27419	0.0673	L	0.27053	0.805	0.09310	N	1	P	0.46912	0.886	B	0.42245	0.381	T	0.10291	-1.0636	9	0.36615	T	0.2	-6.9775	14.3139	0.66434	0.0:0.4349:0.5651:0.0	.	519	A6NI56	CC154_HUMAN	I	365;519	.	ENSP00000373828:L519I	L	-	1	2	CCDC154	1426048	0.001000	0.12720	0.465000	0.27155	0.013000	0.08279	0.248000	0.18198	0.637000	0.30526	0.491000	0.48974	CTA			0.667	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_001143980	
ATF7IP2	80063	mdanderson.org	37	16	10531989	10531989	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr16:10531989G>T	ENST00000396560.2	+	5	1219	c.992G>T	c.(991-993)aGc>aTc	p.S331I	ATF7IP2_ENST00000324570.5_Missense_Mutation_p.S331I|ATF7IP2_ENST00000356427.2_Missense_Mutation_p.S331I|ATF7IP2_ENST00000396559.1_Missense_Mutation_p.S331I|ATF7IP2_ENST00000543967.1_Intron	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						GAGATCTATAGCATAAATTAT	0.308																																					p.S331I													.	.			0			c.G992T												86.0	88.0	88.0					16																	10531989		2197	4300	6497	SO:0001583	missense	80063	exon6			TCTATAGCATAAA	AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.992G>T	16.37:g.10531989G>T	ENSP00000379808:p.Ser331Ile		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001256160	8	0.00	0	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Missense_Mutation	SNP	ENST00000396560.2	37	CCDS10540.1	.	.	.	.	.	.	.	.	.	.	G	4.942	0.174988	0.09391	.	.	ENSG00000166669	ENST00000396559;ENST00000396560;ENST00000535850;ENST00000356427;ENST00000324570	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.65	-2.0	0.07433	.	0.319348	0.28754	N	0.014253	T	0.20618	0.0496	L	0.34521	1.04	0.09310	N	1	B;B	0.29988	0.123;0.264	B;B	0.24974	0.057;0.032	T	0.06180	-1.0841	10	0.39692	T	0.17	-2.4493	0.5517	0.00664	0.2565:0.1213:0.2957:0.3265	.	331;331	Q5U623-2;Q5U623	.;MCAF2_HUMAN	I	331	ENSP00000379807:S331I;ENSP00000379808:S331I;ENSP00000440791:S331I;ENSP00000348799:S331I;ENSP00000322811:S331I	ENSP00000322811:S331I	S	+	2	0	ATF7IP2	10439490	0.039000	0.19947	0.000000	0.03702	0.023000	0.10783	0.103000	0.15292	-0.153000	0.11137	-0.142000	0.14014	AGC			0.308	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251961.1		NM_024997	
APOBR	55911	broad.mit.edu	37	16	28511197	28511197	+	IGR	SNP	T	T	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr16:28511197T>C	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Silent_p.E169E			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						cctcctcctcttcctcctcct	0.672																																					p.E169E													.	IL27	27		0			c.A507G												8.0	9.0	9.0					16																	28511197		2149	4215	6364	SO:0001628	intergenic_variant	246778	exon5			CTCCTCTTCCTCC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			16.37:g.28511197T>C			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	41	0.12	5	NM_145659	1	0.00	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	37																																																																																						0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_182804	
PITPNM3	83394	mdanderson.org	37	17	6358778	6358778	+	Silent	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:6358778G>T	ENST00000262483.8	-	20	2892	c.2805C>A	c.(2803-2805)ccC>ccA	p.P935P	PITPNM3_ENST00000576664.1_5'UTR|PITPNM3_ENST00000421306.3_Silent_p.P899P	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	935					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GGTTGGCGGCGGGCGGGTCGG	0.726																																					p.P935P													.	.			0			c.C2805A												14.0	20.0	18.0					17																	6358778		2170	4283	6453	SO:0001819	synonymous_variant	83394	exon20			GGCGGCGGGCGGG	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2805C>A	17.37:g.6358778G>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_031220	0		0	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	CCDS11076.1																																																																																					0.726	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000219824.2		NM_031220	
TBC1D26	353149	broad.mit.edu;mdanderson.org	37	17	15641610	15641610	+	Missense_Mutation	SNP	A	A	G	rs202131240		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:15641610A>G	ENST00000437605.2	+	7	546	c.296A>G	c.(295-297)tAc>tGc	p.Y99C	AC005324.6_ENST00000434017.1_RNA|AC005324.6_ENST00000433873.1_RNA|AC005324.6_ENST00000580194.1_RNA|TBC1D26_ENST00000579428.1_Missense_Mutation_p.Y99C|ZNF286A_ENST00000413242.2_3'UTR	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	99							Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CAAAGAGTATACAAAGTCATT	0.527																																					p.Y99C													.	TBC1D26	16		0			c.A296G												94.0	90.0	91.0					17																	15641610		1953	4139	6092	SO:0001583	missense	353149	exon7			GAGTATACAAAGT		CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.296A>G	17.37:g.15641610A>G	ENSP00000410111:p.Tyr99Cys		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	89	0.06	5	NM_178571	0		0	A8K929|Q4G172	Missense_Mutation	SNP	ENST00000437605.2	37	CCDS42265.1	.	.	.	.	.	.	.	.	.	.	a	6.884	0.532498	0.13127	.	.	ENSG00000214946	ENST00000437605	T	0.40756	1.02	1.44	-0.0271	0.13927	Rab-GAP/TBC domain (2);	0.436109	0.22940	U	0.053784	T	0.48943	0.1528	L	0.58583	1.82	0.19945	N	0.999948	D;D	0.76494	0.999;0.981	D;D	0.67231	0.95;0.914	T	0.36601	-0.9741	10	0.52906	T	0.07	.	3.1782	0.06576	0.6204:0.0:0.0:0.3796	.	99;99	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	C	99	ENSP00000410111:Y99C	ENSP00000410111:Y99C	Y	+	2	0	TBC1D26	15582335	0.952000	0.32445	0.008000	0.14137	0.029000	0.11900	1.676000	0.37565	-0.258000	0.09446	0.338000	0.21704	TAC			0.527	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_178571	
MED9	55090	mdanderson.org	37	17	17380478	17380478	+	Silent	SNP	T	T	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:17380478T>C	ENST00000268711.3	+	1	179	c.123T>C	c.(121-123)ccT>ccC	p.P41P	MED9_ENST00000585041.1_3'UTR|MED9_ENST00000580462.1_Silent_p.P41P	NM_018019.2	NP_060489.1	Q9NWA0	MED9_HUMAN	mediator complex subunit 9	41	Pro-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			cervix(1)|endometrium(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						tccctgcgcctcaaccgcagc	0.652																																					p.P41P													.	.			0			c.T123C												16.0	17.0	17.0					17																	17380478		2200	4294	6494	SO:0001819	synonymous_variant	55090	exon1			TGCGCCTCAACCG	BC000647	CCDS11184.1	17p11.2	2007-07-30	2007-07-30		ENSG00000141026	ENSG00000141026			25487	protein-coding gene	gene with protein product		609878	"""mediator of RNA polymerase II transcription, subunit 9 homolog (S. cerevisiae)"""			11997338	Standard	NM_018019		Approved	FLJ10193, MED25	uc002grh.1	Q9NWA0	OTTHUMG00000059293	ENST00000268711.3:c.123T>C	17.37:g.17380478T>C			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_018019	40	0.00	0		Silent	SNP	ENST00000268711.3	37	CCDS11184.1																																																																																					0.652	MED9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131669.2		NM_018019	
ERAL1	26284	broad.mit.edu	37	17	27182148	27182148	+	Silent	SNP	T	T	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:27182148T>C	ENST00000254928.5	+	1	193	c.96T>C	c.(94-96)ccT>ccC	p.P32P	ERAL1_ENST00000578001.1_3'UTR|FAM222B_ENST00000583953.1_5'Flank	NM_005702.2	NP_005693.1	O75616	ERAL1_HUMAN	Era-like 12S mitochondrial rRNA chaperone 1	32					ribosomal small subunit assembly (GO:0000028)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			GGGTGATCCCTTTTTCCTCAC	0.627																																					p.P32P													ERAL1,NS,carcinoma,+1,1	ERAL1	28	1	0			c.T96C												89.0	77.0	81.0					17																	27182148		2203	4300	6503	SO:0001819	synonymous_variant	26284	exon1			GATCCCTTTTTCC	AF082657	CCDS11244.1	17q11.2	2013-05-22	2013-05-22		ENSG00000132591	ENSG00000132591			3424	protein-coding gene	gene with protein product		607435	"""Era (E. coli G-protein homolog)-like 1"", ""Era G-protein-like 1 (E. coli)"""			10945472, 20604745	Standard	NM_005702		Approved	HERA-B	uc002hcy.1	O75616	OTTHUMG00000132675	ENST00000254928.5:c.96T>C	17.37:g.27182148T>C			Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	145	0.03	4	NM_005702	72	0.00	0	B3KN21|C9JEC6|O75617|Q8WUY4|Q96LE2|Q96TC0	Silent	SNP	ENST00000254928.5	37	CCDS11244.1																																																																																					0.627	ERAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255937.2			
ATAD5	79915	bcgsc.ca	37	17	29162012	29162012	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:29162012A>G	ENST00000321990.4	+	2	1291	c.913A>G	c.(913-915)Ata>Gta	p.I305V	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	305					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAGTGGTTATATAAGTGAATC	0.393																																					p.I305V													ATAD5,NS,carcinoma,-2,1	ATAD5	150	1	0			c.A913G												44.0	48.0	47.0					17																	29162012		2202	4298	6500	SO:0001583	missense	79915	exon2			GGTTATATAAGTG		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.913A>G	17.37:g.29162012A>G	ENSP00000313171:p.Ile305Val		Somatic	226	0	0		WXS	Illumina HiSeq	Phase_1	230	0.00	0	NM_024857	8	0.00	0	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	A	0.278	-0.988430	0.02162	.	.	ENSG00000176208	ENST00000321990	T	0.15256	2.44	5.91	-0.972	0.10300	.	1.523970	0.03334	N	0.193792	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28776	-1.0033	10	0.02654	T	1	.	6.8054	0.23774	0.5513:0.119:0.3297:0.0	.	305;305	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	V	305	ENSP00000313171:I305V	ENSP00000313171:I305V	I	+	1	0	ATAD5	26186138	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	0.081000	0.14823	-0.387000	0.07809	-1.125000	0.01998	ATA			0.393	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256206.2		NM_024857	
HNF1B	6928	mdanderson.org	37	17	36104627	36104627	+	Silent	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:36104627G>T	ENST00000225893.4	-	1	610	c.249C>A	c.(247-249)ggC>ggA	p.G83G	HNF1B_ENST00000560016.1_Silent_p.G83G|RP11-115K3.1_ENST00000558143.1_RNA|HNF1B_ENST00000561193.1_Silent_p.G83G|HNF1B_ENST00000427275.2_Silent_p.G83G	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	83					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CATAGTCGTCGCCGTCCTCGG	0.687																																					p.G83G	Colon(71;102 1179 9001 27917 43397)												.	.			0			c.C249A												48.0	52.0	50.0					17																	36104627		2203	4299	6502	SO:0001819	synonymous_variant	6928	exon1			GTCGTCGCCGTCC	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.249C>A	17.37:g.36104627G>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_001165923	4	0.00	0	B4DKM3|E0YMJ9	Silent	SNP	ENST00000225893.4	37	CCDS11324.1																																																																																					0.687	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256807.3		NM_000458	
FAM104A	84923	bcgsc.ca	37	17	71228444	71228444	+	Start_Codon_SNP	SNP	A	A	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:71228444A>C	ENST00000403627.3	-	1	62	c.2T>G	c.(1-3)aTg>aGg	p.M1R	FAM104A_ENST00000581110.1_Start_Codon_SNP_p.M1R|FAM104A_ENST00000583024.1_Start_Codon_SNP_p.M1R|C17orf80_ENST00000426147.2_5'Flank|C17orf80_ENST00000577615.1_5'Flank|FAM104A_ENST00000405159.3_Start_Codon_SNP_p.M1R|C17orf80_ENST00000255557.4_5'UTR|C17orf80_ENST00000359042.2_5'Flank|C17orf80_ENST00000268942.8_5'Flank|C17orf80_ENST00000535032.2_5'Flank|FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000582793.1_5'Flank	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	1										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			GCGCCCCCCCATGTCGCTGCC	0.716																																					p.M1R													FAM104A,NS,carcinoma,+1,1	FAM104A	15	1	0			c.T2G												14.0	18.0	17.0					17																	71228444		2014	4139	6153	SO:0001582	initiator_codon_variant	84923	exon1			CCCCCCATGTCGC	AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.2T>G	17.37:g.71228444A>C	ENSP00000384648:p.Met1Arg		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_1	37	0.00	0	NM_032837	1	0.00	0	B4E339	Translation_Start_Site	SNP	ENST00000403627.3	37	CCDS11693.2	.	.	.	.	.	.	.	.	.	.	A	17.21	3.331464	0.60853	.	.	ENSG00000133193	ENST00000403627;ENST00000405159	T;T	0.52754	0.74;0.65	4.86	3.75	0.43078	.	.	.	.	.	T	0.52435	0.1734	.	.	.	0.80722	D	1	D;P	0.53745	0.962;0.899	P;P	0.52481	0.7;0.49	T	0.56625	-0.7948	8	0.87932	D	0	.	7.3985	0.26950	0.9001:0.0:0.0999:0.0	.	1;1	Q969W3-2;Q969W3	.;F104A_HUMAN	R	1	ENSP00000384648:M1R;ENSP00000384832:M1R	ENSP00000384648:M1R	M	-	2	0	FAM104A	68740039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.438000	0.35002	2.036000	0.60181	0.533000	0.62120	ATG			0.716	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318935.1		NM_032837	Missense_Mutation
C2CD4C	126567	mdanderson.org	37	19	407125	407125	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:407125G>A	ENST00000332235.6	-	2	1410	c.1237C>T	c.(1237-1239)Ccc>Tcc	p.P413S		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	413										large_intestine(1)|pancreas(1)	2						GAGGTCAGGGGCAGCTCCTTC	0.687																																					p.P413S													.	.			0			c.C1237T												21.0	23.0	22.0					19																	407125		690	1589	2279	SO:0001583	missense	126567	exon2			TCAGGGGCAGCTC	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.1237C>T	19.37:g.407125G>A	ENSP00000328677:p.Pro413Ser		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001136263	27	0.00	0	Q8N3H7	Missense_Mutation	SNP	ENST00000332235.6	37	CCDS45890.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.614853	0.66672	.	.	ENSG00000183186	ENST00000332235	T	0.79554	-1.28	3.37	3.37	0.38596	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.147975	0.46758	U	0.000275	T	0.75354	0.3838	L	0.55743	1.74	0.54753	D	0.999986	P	0.41624	0.757	B	0.40477	0.33	T	0.72928	-0.4143	10	0.19590	T	0.45	.	14.0625	0.64808	0.0:0.0:1.0:0.0	.	413	Q8TF44	C2C4C_HUMAN	S	413	ENSP00000328677:P413S	ENSP00000328677:P413S	P	-	1	0	C2CD4C	358125	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.806000	0.62569	1.589000	0.49982	0.462000	0.41574	CCC			0.687	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451789.2		XM_065166	
HNRNPM	4670	broad.mit.edu	37	19	8555089	8555089	+	IGR	SNP	A	A	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:8555089A>G	ENST00000325495.4	+	0	2494				PRAM1_ENST00000423345.4_Missense_Mutation_p.L666P|PRAM1_ENST00000255612.3_Missense_Mutation_p.L665P	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						TCCCAGGGGGAGTGGTTGGTT	0.677																																					p.L666P													.	PRAM1	53		0			c.T1997C												25.0	31.0	29.0					19																	8555089		2169	4281	6450	SO:0001628	intergenic_variant	84106	exon10			AGGGGGAGTGGTT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383		19.37:g.8555089A>G			Somatic	113	0.0265486726	3		WXS	Illumina HiSeq	Phase_I	118	0.05	6	NM_032152	9	0.00	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	A	7.886	0.731202	0.15507	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.19394	2.15;2.15	3.65	1.24	0.21308	.	1.112880	0.07123	N	0.844156	T	0.12944	0.0314	N	0.14661	0.345	0.09310	N	0.999998	B;B	0.18461	0.011;0.028	B;B	0.19946	0.018;0.027	T	0.34976	-0.9807	10	0.72032	D	0.01	.	5.5204	0.16929	0.7294:0.0:0.2706:0.0	.	666;714	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	P	665;666	ENSP00000255612:L665P;ENSP00000408342:L666P	ENSP00000255612:L665P	L	-	2	0	PRAM1	8461089	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.266000	0.18534	0.183000	0.20059	-0.464000	0.05259	CTC			0.677	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000460894.1			
SLC35E1	79939	mdanderson.org	37	19	16682776	16682776	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:16682776G>A	ENST00000595753.1	-	1	417	c.400C>T	c.(400-402)Ccc>Tcc	p.P134S	CTD-3222D19.2_ENST00000409035.1_Intron|SLC35E1_ENST00000431408.1_5'UTR	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	134					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						TAGGACACGGGCACCTTCCAG	0.711																																					p.P134S													.	.			0			c.C400T												8.0	8.0	8.0					19																	16682776		685	1578	2263	SO:0001583	missense	79939	exon1			ACACGGGCACCTT	AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.400C>T	19.37:g.16682776G>A	ENSP00000470652:p.Pro134Ser		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_024881	18	0.00	0	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	37	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681561	0.68042	.	.	ENSG00000127526	ENST00000409648;ENST00000436553	.	.	.	3.68	3.68	0.42216	Drug/metabolite transporter (1);	.	.	.	.	T	0.64182	0.2575	L	0.58510	1.815	0.80722	D	1	P	0.52316	0.952	P	0.54460	0.753	T	0.63216	-0.6687	8	0.30854	T	0.27	.	13.9824	0.64313	0.0:0.0:1.0:0.0	.	134	Q96K37	S35E1_HUMAN	S	134;114	.	ENSP00000387152:P134S	P	-	1	0	SLC35E1	16543776	1.000000	0.71417	0.998000	0.56505	0.882000	0.50991	4.365000	0.59486	1.597000	0.50072	0.491000	0.48974	CCC			0.711	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000326809.2		NM_024881	
CILP2	148113	ucsc.edu	37	19	19655587	19655587	+	Missense_Mutation	SNP	G	G	A	rs545964442		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:19655587G>A	ENST00000291495.5	+	8	2318	c.2233G>A	c.(2233-2235)Gcc>Acc	p.A745T	CILP2_ENST00000586018.1_Missense_Mutation_p.A751T	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	745						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GCGCGCCTACGCCAACGACAA	0.687													G|||	1	0.000199681	0.0	0.0	5008	,	,		14019	0.001		0.0	False		,,,				2504	0.0				p.A745T													.	CILP2	84		0			c.G2233A												17.0	19.0	18.0					19																	19655587		2193	4284	6477	SO:0001583	missense	148113	exon8			GCCTACGCCAACG	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2233G>A	19.37:g.19655587G>A	ENSP00000291495:p.Ala745Thr		Somatic	12	0	0		WXS	Illumina HiSeq		19	0.21	4	NM_153221	53	0.00	0	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	10.07	1.250322	0.22880	.	.	ENSG00000160161	ENST00000291495	T	0.09445	2.98	4.89	2.5	0.30297	.	0.377447	0.29972	N	0.010737	T	0.02970	0.0088	N	0.08118	0	0.24740	N	0.993049	P;P	0.38195	0.622;0.622	B;B	0.26416	0.048;0.069	T	0.33599	-0.9862	10	0.13853	T	0.58	-10.6212	2.9211	0.05770	0.242:0.2721:0.4859:0.0	.	745;745	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	T	745	ENSP00000291495:A745T	ENSP00000291495:A745T	A	+	1	0	CILP2	19516587	0.333000	0.24731	0.036000	0.18154	0.937000	0.57800	1.881000	0.39638	1.016000	0.39470	0.555000	0.69702	GCC			0.687	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000459738.3		NM_153221	
CTC-260E6.6	0	broad.mit.edu	37	19	20262850	20262850	+	RNA	DEL	T	T	-			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:20262850delT	ENST00000590606.1	-	0	0				CTC-260E6.6_ENST00000593655.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA																							TTCttttttcttttttttttt	0.468																																					.													.	.			0			.																																											0	.			TTTTTCTTTTTTT																													19.37:g.20262850delT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	DEL	ENST00000590606.1	37																																																																																						0.468	CTC-260E6.6-005	KNOWN	basic	antisense	antisense		OTTHUMT00000452859.1			
MEGF8	1954	mdanderson.org	37	19	42847747	42847747	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:42847747G>T	ENST00000251268.6	+	9	1632	c.1632G>T	c.(1630-1632)aaG>aaT	p.K544N	MEGF8_ENST00000334370.4_Missense_Mutation_p.K544N	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	544					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGCGTACAAGGTGCCCCCCT	0.652																																					p.K544N													.	.			0			c.G1632T												42.0	35.0	37.0					19																	42847747		2203	4300	6503	SO:0001583	missense	1954	exon9			GTACAAGGTGCCC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.1632G>T	19.37:g.42847747G>T	ENSP00000251268:p.Lys544Asn		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_001271938	11	0.00	0	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	G	17.72	3.458188	0.63401	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.22945	1.93;1.94	5.12	2.99	0.34606	.	0.000000	0.64402	D	0.000002	T	0.38134	0.1029	L	0.43152	1.355	0.80722	D	1	D;D	0.76494	0.999;0.989	D;D	0.80764	0.994;0.985	T	0.04128	-1.0975	10	0.45353	T	0.12	-21.5037	9.4101	0.38487	0.1766:0.0:0.8234:0.0	.	544;544	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	N	544	ENSP00000334219:K544N;ENSP00000251268:K544N	ENSP00000251268:K544N	K	+	3	2	MEGF8	47539587	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.299000	0.43611	0.563000	0.29222	0.486000	0.48141	AAG			0.652	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
PSG3	5671	hgsc.bcm.edu	37	19	43236936	43236936	+	Splice_Site	SNP	G	G	T	rs545782001		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:43236936G>T	ENST00000327495.5	-	3	893	c.709C>A	c.(709-711)Ccg>Acg	p.P237T	PSG3_ENST00000595140.1_Splice_Site_p.P237T|PSG3_ENST00000490592.1_5'Flank	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	237					defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				AGATACTCACGGAGGAGATTC	0.542																																					p.P237T													PSG3,bladder,carcinoma,0,1	PSG3	0	1	0			c.C709A												200.0	202.0	202.0					19																	43236936		2202	4300	6502	SO:0001630	splice_region_variant	5671	exon3			ACTCACGGAGGAG		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.709+1C>A	19.37:g.43236936G>T			Somatic	39	0	0		WXS	Illumina HiSeq	.	47	0.04	2	NM_021016	0		0	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	-	3.027	-0.200379	0.06219	.	.	ENSG00000221826	ENST00000327495	T	0.24538	1.85	1.59	0.445	0.16597	.	.	.	.	.	T	0.24661	0.0598	M	0.76170	2.325	0.19945	N	0.999943	B;B	0.23249	0.082;0.002	B;B	0.24006	0.05;0.007	T	0.30822	-0.9965	8	.	.	.	.	3.364	0.07197	0.7398:0.0:0.2602:0.0	.	215;237	Q08266;Q16557	.;PSG3_HUMAN	T	237	ENSP00000332215:P237T	.	P	-	1	0	PSG3	47928776	0.014000	0.17966	0.091000	0.20842	0.002000	0.02628	-0.909000	0.04058	-0.070000	0.12908	-0.515000	0.04445	CCG			0.542	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321423.2		NM_021016	Missense_Mutation
SCAF1	58506	bcgsc.ca	37	19	50154180	50154202	+	Frame_Shift_Del	DEL	CACGGGAGACGGGGGCCCTGCCC	CACGGGAGACGGGGGCCCTGCCC	-	rs373270377|rs200665098|rs151252460	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	CACGGGAGACGGGGGCCCTGCCC	CACGGGAGACGGGGGCCCTGCCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:50154180_50154202delCACGGGAGACGGGGGCCCTGCCC	ENST00000360565.3	+	7	658_680	c.534_556delCACGGGAGACGGGGGCCCTGCCC	c.(532-558)ggcacgggagacgggggccctgccccafs	p.TGDGGPAP179fs		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	179					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		TCACCTTGGGCACGGGAGACGGGGGccctgccccaccccctgc	0.682																																					p.178_186del													.	SCAF1	78		0			c.534_556del																																									SO:0001589	frameshift_variant	58506	exon7			CTTGGGCACGGGA	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.534_556delCACGGGAGACGGGGGCCCTGCCC	19.37:g.50154180_50154202delCACGGGAGACGGGGGCCCTGCCC	ENSP00000353769:p.Thr179fs		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_1	92	0.00	0	NM_021228	63	0.00	0	Q7Z5V7|Q8WVA1|Q9NR59	Frame_Shift_Del	DEL	ENST00000360565.3	37	CCDS33074.1																																																																																					0.682	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465764.1		NM_021228	
ZNF816	125893	mdanderson.org	37	19	53456016	53456016	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:53456016G>T	ENST00000357666.4	-	4	478	c.178C>A	c.(178-180)Ctg>Atg	p.L60M	ZNF816_ENST00000535506.1_Missense_Mutation_p.L60M|ZNF816_ENST00000391786.2_Missense_Mutation_p.P54H|ZNF816_ENST00000444460.2_Missense_Mutation_p.L60M|ZNF321P_ENST00000391777.3_Missense_Mutation_p.L60M|ZNF816_ENST00000270457.4_Missense_Mutation_p.L60M|ZNF816_ENST00000434371.2_Missense_Mutation_p.L60M|ZNF816_ENST00000438970.2_Missense_Mutation_p.L60M	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						ACAAACTCCAGGTTCCTGTAG	0.463																																					p.L60M													.	.			0			c.C178A												107.0	114.0	112.0					19																	53456016		2203	4300	6503	SO:0001583	missense	125893	exon3			ACTCCAGGTTCCT	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.178C>A	19.37:g.53456016G>T	ENSP00000350295:p.Leu60Met		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001202456	15	0.00	0	A8K7H5|Q3KR39|Q659B3	Missense_Mutation	SNP	ENST00000357666.4	37	CCDS33096.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.76|11.76	1.734871|1.734871	0.30774|0.30774	.|.	.|.	ENSG00000180257;ENSG00000180257;ENSG00000180257;ENSG00000180257;ENSG00000221874|ENSG00000180257	ENST00000434371;ENST00000357666;ENST00000444460;ENST00000457013;ENST00000391777|ENST00000332302	T;T;T;T;T|.	0.03772|.	3.81;3.81;3.81;3.81;3.81|.	1.84|1.84	1.84|1.84	0.25277|0.25277	Krueppel-associated box (4);|.	.|.	.|.	.|.	.|.	T|T	0.71341|0.71341	0.3328|0.3328	M|M	0.92555|0.92555	3.32|3.32	0.09310|0.09310	N|N	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.62709|0.62709	-0.6797|-0.6797	9|6	0.72032|0.59425	D|D	0.01|0.04	.|.	10.6538|10.6538	0.45663|0.45663	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	60|.	Q0VGE8|.	ZN816_HUMAN|.	M|H	60|95	ENSP00000438519:L60M;ENSP00000350295:L60M;ENSP00000403266:L60M;ENSP00000408965:L60M;ENSP00000375656:L60M|.	ENSP00000375656:L60M|ENSP00000333199:P95H	L|P	-|-	1|2	2|0	ZNF321P;ZNF816|ZNF816	58147828|58147828	0.006000|0.006000	0.16342|0.16342	0.747000|0.747000	0.31113|0.31113	0.400000|0.400000	0.30750|0.30750	0.181000|0.181000	0.16880|0.16880	1.000000|1.000000	0.39049|0.39049	0.305000|0.305000	0.20034|0.20034	CTG|CCT			0.463	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396132.1		NM_001031665	
UBE2M	9040	bcgsc.ca	37	19	59067702	59067702	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:59067702C>T	ENST00000253023.3	-	5	970	c.392G>A	c.(391-393)gGc>gAc	p.G131D	AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600534.1_RNA|CHMP2A_ENST00000601220.1_5'Flank|CHMP2A_ENST00000600118.1_5'Flank|CHMP2A_ENST00000312547.2_5'Flank	NM_003969.3	NP_003960.1	P61081	UBC12_HUMAN	ubiquitin-conjugating enzyme E2M	131					cellular protein modification process (GO:0006464)|positive regulation of neuron apoptotic process (GO:0043525)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)|ribosomal S6-glutamic acid ligase activity (GO:0018169)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	5		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		ATACTGCAGGCCATAAATTAT	0.552																																					p.G131D													.	UBE2M	14		0			c.G392A												93.0	94.0	93.0					19																	59067702		2203	4300	6503	SO:0001583	missense	9040	exon5			TGCAGGCCATAAA	AB012191	CCDS12987.1	19q13.43	2011-05-19	2011-05-19		ENSG00000130725	ENSG00000130725		"""Ubiquitin-conjugating enzymes E2"""	12491	protein-coding gene	gene with protein product		603173	"""ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12)"", ""ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)"""			9694792	Standard	NM_003969		Approved	hUbc12, UBC12	uc002qtl.4	P61081		ENST00000253023.3:c.392G>A	19.37:g.59067702C>T	ENSP00000253023:p.Gly131Asp		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_1	93	0.00	0	NM_003969	254	0.00	0	O76069|Q8VC50	Missense_Mutation	SNP	ENST00000253023.3	37	CCDS12987.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531995	0.64972	.	.	ENSG00000130725	ENST00000253023	T	0.73152	-0.72	4.62	3.55	0.40652	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.64402	D	0.000004	D	0.89770	0.6811	H	0.98754	4.32	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.92742	0.6209	10	0.87932	D	0	-13.5837	12.6159	0.56576	0.0:0.8317:0.1682:0.0	.	131	P61081	UBC12_HUMAN	D	131	ENSP00000253023:G131D	ENSP00000253023:G131D	G	-	2	0	UBE2M	63759514	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.137000	0.50562	1.280000	0.44463	0.655000	0.94253	GGC			0.552	UBE2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467097.1		NM_003969	
AGBL5	60509	mdanderson.org	37	2	27291584	27291584	+	Missense_Mutation	SNP	G	G	T	rs145155050		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:27291584G>T	ENST00000360131.4	+	13	2486	c.2327G>T	c.(2326-2328)cGg>cTg	p.R776L		NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	776					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTGGAGCTCGGATGCCCTGC	0.532																																					p.R776L													.	.			0			c.G2327T												88.0	94.0	92.0					2																	27291584		2203	4300	6503	SO:0001583	missense	60509	exon13			GAGCTCGGATGCC	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2327G>T	2.37:g.27291584G>T	ENSP00000353249:p.Arg776Leu		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	72	0.06	4	NM_021831	30	0.00	0	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	37	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698364	0.68386	.	.	ENSG00000084693	ENST00000360131	T	0.19250	2.16	5.57	3.74	0.42951	.	0.323072	0.28809	N	0.014068	T	0.14056	0.0340	L	0.29908	0.895	0.28764	N	0.90075	P	0.50066	0.931	B	0.41764	0.366	T	0.07578	-1.0765	10	0.48119	T	0.1	-5.1738	6.2946	0.21079	0.0918:0.0:0.7239:0.1843	.	776	Q8NDL9	CBPC5_HUMAN	L	776	ENSP00000353249:R776L	ENSP00000353249:R776L	R	+	2	0	AGBL5	27145088	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.017000	0.29989	1.331000	0.45412	0.555000	0.69702	CGG			0.532	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000309033.1		NM_021831	
LOC1720	1720	bcgsc.ca	37	2	83084363	83084363	+	IGR	SNP	A	A	G	rs376641495		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:83084363A>G								AC010105.1 (318528 upstream) : AC010744.1 (665574 downstream)																							TGTCACAAGGATCATACAGGA	0.348																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			ACAAGGATCATAC																													2.37:g.83084363A>G			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_1	64	0.00	0	.	0		0		RNA	SNP		37																																																																																					0	0.348										
ANKRD20A8P	729171	broad.mit.edu	37	2	95490975	95490977	+	RNA	DEL	TGT	TGT	-	rs200432553|rs201062749		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:95490975_95490977delTGT	ENST00000432432.2	-	0	1194					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		ctgctgctgctgttgttgttgtt	0.443																																					.													.	.			0			.																																											0	.			TGCTGCTGTTGTT			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95490984_95490986delTGT			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A6NC18	RNA	DEL	ENST00000432432.2	37																																																																																						0.443	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	pseudogene		OTTHUMT00000451404.1			
WASH2P	375260	broad.mit.edu	37	2	114355774	114355784	+	RNA	DEL	GAGGTGGCTGG	GAGGTGGCTGG	-	rs7578831		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	GAGGTGGCTGG	GAGGTGGCTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:114355774_114355784delGAGGTGGCTGG	ENST00000538033.2	+	0	2154							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ccctgtccccgaggtggctgggaggTGGCTC	0.611																																					.													.	.			0			.																																											0	.			GTCCCCGAGGTGG			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355774_114355784delGAGGTGGCTGG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	9	0.44	4	.	9	0.00	0		RNA	DEL	ENST00000538033.2	37																																																																																						0.611	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene		OTTHUMT00000467782.1		NM_198943	
LRP2	4036	mdanderson.org	37	2	169997025	169997025	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:169997025G>T	ENST00000263816.3	-	72	13424	c.13139C>A	c.(13138-13140)cCa>cAa	p.P4380Q		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4380	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GCACCTGCATGGGGGGGGCAG	0.532																																					p.P4380Q													.	.			0			c.C13139A												56.0	53.0	54.0					2																	169997025		2203	4300	6503	SO:0001583	missense	4036	exon72			CTGCATGGGGGGG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13139C>A	2.37:g.169997025G>T	ENSP00000263816:p.Pro4380Gln		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_004525	0		0	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.489879	0.44249	.	.	ENSG00000081479	ENST00000263816	D	0.89123	-2.47	5.95	5.95	0.96441	Growth factor, receptor (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.111999	0.64402	D	0.000012	D	0.87042	0.6079	N	0.22421	0.69	0.80722	D	1	D	0.55800	0.973	P	0.53689	0.732	T	0.82924	-0.0216	10	0.11182	T	0.66	.	18.5553	0.91081	0.0:0.0:1.0:0.0	.	4380	P98164	LRP2_HUMAN	Q	4380	ENSP00000263816:P4380Q	ENSP00000263816:P4380Q	P	-	2	0	LRP2	169705271	1.000000	0.71417	0.990000	0.47175	0.164000	0.22412	8.979000	0.93455	2.817000	0.96982	0.563000	0.77884	CCA			0.532	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255231.2		NM_004525	
FRG1B	284802	broad.mit.edu	37	20	29628299	29628300	+	Missense_Mutation	DNP	AG	AG	GA			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr20:29628299_29628300AG>GA	ENST00000278882.3	+	6	681_682	c.301_302AG>GA	c.(301-303)AGt>GAt	p.S101D	FRG1B_ENST00000439954.2_Missense_Mutation_p.S106D|FRG1B_ENST00000358464.4_Missense_Mutation_p.S101D			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	101								p.S101N(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AGAAGCAAAAAGTAAAACAGCA	0.361																																					p.S101D													FRG1B,bladder,carcinoma,0,16	FRG1B	181	16	2	Substitution - Missense(2)	prostate(2)	.																																									SO:0001583	missense	0	.			GCAAAAAGTAAAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	Exception_encountered	20.37:g.29628299_29628300delinsGA	ENSP00000278882:p.Ser101Asp		Somatic	217	0.0046082949	1		WXS	Illumina HiSeq	Phase_I	237	0.02	5	.	272	0.00	0	C4AME5	Missense_Mutation	DNP	ENST00000278882.3	37																																																																																						0.361	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
ANKRD30BP2	149992	broad.mit.edu	37	21	14415122	14415122	+	RNA	SNP	C	C	T	rs373171837		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr21:14415122C>T	ENST00000507941.1	+	0	95									ankyrin repeat domain 30B pseudogene 2																		CAGAGGGAGGCTTGTGCAAAT	0.353																																					.													.	.			0			.																																											0	.			GGGAGGCTTGTGC	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14415122C>T			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	24	0.21	5	.	0		0		RNA	SNP	ENST00000507941.1	37																																																																																						0.353	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000372094.1		NR_026916	
KRTAP10-10	353333	mdanderson.org	37	21	46058034	46058034	+	Missense_Mutation	SNP	G	G	A	rs142158982	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr21:46058034G>A	ENST00000380095.1	+	1	762	c.700G>A	c.(700-702)Gtg>Atg	p.V234M	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	234						keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CTGCCGCCCCGTGTGCTCCCG	0.692																																					p.V234M													.	.			0			c.G700A							G	,MET/VAL	54,4352		0,54,2149	54.0	58.0	57.0		,700	-2.9	0.0	21	dbSNP_134	57	16,8582		0,16,4283	no	intron,missense	TSPEAR,KRTAP10-10	NM_144991.2,NM_181688.1	,21	0,70,6432	AA,AG,GG		0.1861,1.2256,0.5383	,possibly-damaging	,234/252	46058034	70,12934	2203	4299	6502	SO:0001583	missense	353333	exon1			CGCCCCGTGTGCT	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.700G>A	21.37:g.46058034G>A	ENSP00000369438:p.Val234Met		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	51	0.08	4	NM_181688	0		0		Missense_Mutation	SNP	ENST00000380095.1	37	CCDS33585.1	94	0.04304029304029304	28	0.056910569105691054	7	0.019337016574585635	29	0.050699300699300696	30	0.0395778364116095	g	0.883	-0.728095	0.03135	0.012256	0.001861	ENSG00000221859	ENST00000380095	T	0.01215	5.16	3.52	-2.88	0.05682	.	.	.	.	.	T	0.00241	0.0007	M	0.71206	2.165	0.09310	N	1	B	0.20459	0.045	B	0.20955	0.032	T	0.38178	-0.9673	9	0.42905	T	0.14	.	5.1831	0.15171	0.3582:0.0:0.4952:0.1466	.	234	P60014	KR10A_HUMAN	M	234	ENSP00000369438:V234M	ENSP00000369438:V234M	V	+	1	0	KRTAP10-10	44882462	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.581000	0.02119	-0.564000	0.06070	-1.314000	0.01303	GTG			0.692	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128034.1		NM_181688	
DGCR2	9993	mdanderson.org	37	22	19052402	19052402	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr22:19052402C>A	ENST00000263196.7	-	4	754	c.507G>T	c.(505-507)tgG>tgT	p.W169C	DGCR2_ENST00000545799.1_Missense_Mutation_p.W166C|DGCR2_ENST00000473832.1_5'UTR|DGCR2_ENST00000537045.1_Missense_Mutation_p.W128C	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	169	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					CGGGCTGGTCCCATTCCTGGG	0.612																																					p.W169C													.	.			0			c.G507T												56.0	51.0	53.0					22																	19052402		2203	4300	6503	SO:0001583	missense	9993	exon4			CTGGTCCCATTCC	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.507G>T	22.37:g.19052402C>A	ENSP00000263196:p.Trp169Cys		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_005137	65	0.00	0	A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	ENST00000263196.7	37	CCDS33598.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293586	0.80914	.	.	ENSG00000070413	ENST00000537045;ENST00000263196;ENST00000545799;ENST00000447928	T;T;T	0.18960	2.18;2.18;2.18	4.96	4.96	0.65561	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.119039	0.64402	D	0.000013	T	0.46073	0.1374	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74348	0.983;0.931	T	0.34004	-0.9846	10	0.35671	T	0.21	.	17.8327	0.88687	0.0:1.0:0.0:0.0	.	125;169	B7Z3T5;P98153	.;IDD_HUMAN	C	128;169;166;169	ENSP00000440062:W128C;ENSP00000263196:W169C;ENSP00000445069:W166C	ENSP00000263196:W169C	W	-	3	0	DGCR2	17432402	0.998000	0.40836	1.000000	0.80357	0.973000	0.67179	0.878000	0.28126	2.297000	0.77311	0.467000	0.42956	TGG			0.612	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316504.1		NM_005137	
CLDN5	7122	mdanderson.org	37	22	19511708	19511708	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr22:19511708G>T	ENST00000406028.1	-	2	1386	c.326C>A	c.(325-327)gCg>gAg	p.A109E	CLDN5_ENST00000413119.2_Missense_Mutation_p.A109E|CLDN5_ENST00000403084.1_Missense_Mutation_p.A109E			O00501	CLD5_HUMAN	claudin 5	24					calcium-independent cell-cell adhesion (GO:0016338)|myelination (GO:0042552)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			liver(1)|lung(2)|prostate(1)	4	Colorectal(54;0.0993)					CAGCCCGCACGCCAGGATCAG	0.682																																					p.A109E													.	.			0			c.C326A												31.0	32.0	31.0					22																	19511708		2203	4299	6502	SO:0001583	missense	7122	exon1			CCGCACGCCAGGA	AF000959	CCDS13763.2	22q11.21	2008-08-01	2008-08-01		ENSG00000184113	ENSG00000184113		"""Claudins"""	2047	protein-coding gene	gene with protein product		602101	"""transmembrane protein deleted in velocardiofacial syndrome"""	AWAL, TMVCF		9441748, 9192844	Standard	NM_003277		Approved	CPETRL1, BEC1	uc002zpu.2	O00501	OTTHUMG00000150441	ENST00000406028.1:c.326C>A	22.37:g.19511708G>T	ENSP00000385477:p.Ala109Glu		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_001130861	18	0.00	0	B3KS11|Q53XW2|Q8WUW3	Missense_Mutation	SNP	ENST00000406028.1	37	CCDS13763.2	.	.	.	.	.	.	.	.	.	.	G	34	5.324332	0.95708	.	.	ENSG00000184113	ENST00000406028;ENST00000403084;ENST00000413119	D;D;D	0.89050	-2.46;-2.46;-2.46	5.24	5.24	0.73138	.	0.118364	0.56097	D	0.000034	D	0.95265	0.8464	M	0.90369	3.11	0.80722	D	1	D	0.69078	0.997	D	0.71870	0.975	D	0.96070	0.9045	10	0.87932	D	0	.	16.3127	0.82898	0.0:0.0:1.0:0.0	.	109	D3DX19	.	E	109	ENSP00000385477:A109E;ENSP00000384554:A109E;ENSP00000400612:A109E	ENSP00000384554:A109E	A	-	2	0	CLDN5	17891708	0.026000	0.19158	1.000000	0.80357	0.986000	0.74619	1.777000	0.38604	2.466000	0.83321	0.563000	0.77884	GCG			0.682	CLDN5-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318122.3		NM_003277	
TMPRSS6	164656	mdanderson.org	37	22	37480838	37480838	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr22:37480838G>T	ENST00000346753.3	-	9	1158	c.1042C>A	c.(1042-1044)Cag>Aag	p.Q348K	TMPRSS6_ENST00000442782.2_Missense_Mutation_p.Q348K|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.Q339K|TMPRSS6_ENST00000406725.1_Missense_Mutation_p.Q339K|RP5-1170K4.7_ENST00000414203.2_RNA|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.Q339K	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	348	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						AGGACGCCCTGGGAGTCGAGC	0.652																																					p.Q348K													.	.			0			c.C1042A												84.0	69.0	74.0					22																	37480838		2197	4288	6485	SO:0001583	missense	164656	exon9			CGCCCTGGGAGTC	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.1042C>A	22.37:g.37480838G>T	ENSP00000334962:p.Gln348Lys		Somatic	40	0.025	1		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_153609	1	0.00	0	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	g	14.29	2.490328	0.44249	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000429068;ENST00000442782	T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.31;2.1	4.39	4.39	0.52855	CUB (4);	0.000000	0.64402	D	0.000001	T	0.45796	0.1360	M	0.72118	2.19	0.53688	D	0.999973	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.81914	0.995;0.991;0.98	T	0.47947	-0.9077	10	0.54805	T	0.06	.	15.9326	0.79675	0.0:0.0:1.0:0.0	.	348;339;348	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	K	339;348;339;339;10;348	ENSP00000371211:Q339K;ENSP00000334962:Q348K;ENSP00000385453:Q339K;ENSP00000384964:Q339K;ENSP00000392433:Q10K;ENSP00000397691:Q348K	ENSP00000334962:Q348K	Q	-	1	0	TMPRSS6	35810784	1.000000	0.71417	0.741000	0.31004	0.031000	0.12232	8.359000	0.90093	1.985000	0.57927	0.457000	0.33378	CAG			0.652	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000318822.1		NM_153609	
SH3BP1	23616	mdanderson.org	37	22	38044407	38044407	+	Silent	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr22:38044407G>T	ENST00000357436.4	+	14	1594	c.1281G>T	c.(1279-1281)ctG>ctT	p.L427L	SH3BP1_ENST00000442465.2_Silent_p.L427L|SH3BP1_ENST00000599616.1_Silent_p.L363L|SH3BP1_ENST00000336738.5_Silent_p.L427L|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	427	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CCATAGTCCTGGGACCCAACT	0.607																																					p.L427L													.	.			0			c.G1281T												59.0	45.0	50.0					22																	38044407		2192	4294	6486	SO:0001819	synonymous_variant	23616	exon14			AGTCCTGGGACCC		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1281G>T	22.37:g.38044407G>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_018957	282	0.00	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	ENST00000357436.4	37	CCDS13952.2																																																																																					0.607	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075884.4		NM_018957	
SI	6476	bcgsc.ca	37	3	164709207	164709207	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr3:164709207A>T	ENST00000264382.3	-	44	5104	c.5042T>A	c.(5041-5043)aTa>aAa	p.I1681K		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1681	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATGTAGGTTTATTGTGTCATA	0.398										HNSCC(35;0.089)																											p.I1681K													.	SI	500		0			c.T5042A												146.0	132.0	137.0					3																	164709207		2203	4300	6503	SO:0001583	missense	6476	exon44			AGGTTTATTGTGT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5042T>A	3.37:g.164709207A>T	ENSP00000264382:p.Ile1681Lys		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_1	147	0.00	0	NM_001041	0		0	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937457	0.73557	.	.	ENSG00000090402	ENST00000264382	D	0.93366	-3.21	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.97860	0.9297	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99113	1.0847	10	0.87932	D	0	.	14.1377	0.65297	1.0:0.0:0.0:0.0	.	1681	P14410	SUIS_HUMAN	K	1681	ENSP00000264382:I1681K	ENSP00000264382:I1681K	I	-	2	0	SI	166191901	1.000000	0.71417	0.987000	0.45799	0.571000	0.35966	8.074000	0.89500	2.003000	0.58678	0.383000	0.25322	ATA			0.398	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350116.1		NM_001041	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	55593603	55593603	+	Missense_Mutation	SNP	T	T	G	rs121913234|rs121913235		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr4:55593603T>G	ENST00000288135.5	+	11	1766	c.1669T>G	c.(1669-1671)Tgg>Ggg	p.W557G		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	557			Missing (in GIST; somatic mutation). {ECO:0000269|PubMed:15824741, ECO:0000269|PubMed:9438854}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.W557_K558del(120)|p.W557R(28)|p.W557G(23)|p.W557_E561del(17)|p.Y553_K558>(8)|p.E554_K558del(8)|p.M552_W557del(8)|p.K550_K558del(7)|p.W557_V559del(7)|p.Q556_V560del(6)|p.Y553_K558del(4)|p.W557del(4)|p.V555_K558del(3)|p.Y553_T574>S(3)|p.Y553_W557del(3)|p.V555_I571del(3)|p.V555_V560del(3)|p.V555_P573del(3)|p.Q556_V560>H(3)|p.V555_V559del(3)|p.W557_K558>E(2)|p.Q556_L576del(2)|p.K550_V559del(2)|p.W557_Q575del(2)|p.K550fs*6(2)|p.Q556_K558del(2)|p.V555_E562del(2)|p.W557_V560del(2)|p.Q556_V559del(2)|p.V555_G565del(1)|p.M552_W557>R(1)|p.Q556_W557del(1)|p.P551_K558del(1)|p.Q556_V559>H(1)|p.M552_E561>K(1)|p.V555_I563del(1)|p.W557_K558>S(1)|p.Q556_K558>HPCR(1)|p.E554_I571del(1)|p.Q556_V560>F(1)|p.V555_Y570del(1)|p.Q556_N566>SNNLQLY(1)|p.M552_T574>TESA(1)|p.Q556_D572>PS(1)|p.Q556_D572del(1)|p.W557_E562del(1)|p.V555_N566>D(1)|p.V555_V560>V(1)|p.Q556_V560>HNLQLY(1)|p.M552_K558del(1)|p.Q556_E561del(1)|p.Q556_K558>H(1)|p.Q556_E561>HH(1)|p.W557_I571del(1)|p.Q556_K558>R(1)|p.Q556_W557>R(1)|p.E554_N564del(1)|p.Q556_V560>TTF(1)|p.K550_W557del(1)|p.Q556_D572>H(1)|p.W557_V559>I(1)|p.M552_D572del(1)|p.Y553_V559>E(1)|p.Q556_T574del(1)|p.P551_V559del>L(1)|p.Q556_P573del(1)|p.E554_D572del(1)|p.Q556_V559>HT(1)|p.E554_E562del(1)|p.Y553_V559del(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGAAGTACAGTGGAAGGTTGT	0.388		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.W557G			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,germ_cell_tumour,0,64	KIT	0	64	323	Deletion - In frame(233)|Substitution - Missense(51)|Complex - deletion inframe(34)|Complex - insertion inframe(3)|Deletion - Frameshift(2)	soft_tissue(308)|skin(6)|haematopoietic_and_lymphoid_tissue(5)|testis(3)|genital_tract(1)	c.T1669G	GRCh37	CM005329	KIT	M	rs121913235							80.0	82.0	82.0					4																	55593603		2203	4300	6503	SO:0001583	missense	3815	exon11	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GTACAGTGGAAGG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1669T>G	4.37:g.55593603T>G	ENSP00000288135:p.Trp557Gly		Somatic	123	0	0		WXS	Illumina HiSeq	.	115	0.10	11	NM_000222	174	0.30	52	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.231746	0.79688	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.95622	-3.76;-3.76	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000016	D	0.97974	0.9333	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.981	D	0.98792	1.0736	10	0.87932	D	0	.	16.6003	0.84812	0.0:0.0:0.0:1.0	.	64;553;557	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	G	557;553	ENSP00000288135:W557G;ENSP00000390987:W553G	ENSP00000288135:W557G	W	+	1	0	KIT	55288360	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.880000	0.87243	2.319000	0.78375	0.533000	0.62120	TGG			0.388	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
DSPP	1834	broad.mit.edu	37	4	88536079	88536079	+	Silent	SNP	T	T	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr4:88536079T>C	ENST00000282478.7	+	4	2298	c.2265T>C	c.(2263-2265)agT>agC	p.S755S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S755S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	755	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgacagtagcgatagca	0.522																																					p.S755S													.	DSPP	174		0			c.T2265C																																									SO:0001819	synonymous_variant	1834	exon5			TGACAGTAGCGAT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2265T>C	4.37:g.88536079T>C			Somatic	78	0.0128205128	1		WXS	Illumina HiSeq	Phase_I	92	0.11	10	NM_014208	0		0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																					0.522	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
DCHS2	54798	mdanderson.org	37	4	155411422	155411422	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr4:155411422G>T	ENST00000339452.1	-	1	1446	c.1086C>A	c.(1084-1086)agC>agA	p.S362R	DCHS2_ENST00000456341.2_Missense_Mutation_p.S355R|DCHS2_ENST00000443500.1_Missense_Mutation_p.S362R	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1531	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GCACCACGCCGCTCAGCTCCT	0.726																																					p.S362R													.	.			0			c.C1086A												7.0	10.0	9.0					4																	155411422		687	1575	2262	SO:0001583	missense	54798	exon1			CACGCCGCTCAGC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1086C>A	4.37:g.155411422G>T	ENSP00000345062:p.Ser362Arg		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001142552	0		0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	37	CCDS47150.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321586	0.23994	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.53857	0.6;0.6;0.6	4.7	1.94	0.25998	.	.	.	.	.	T	0.66366	0.2782	M	0.70787	2.145	0.36679	D	0.878946	D;D	0.89917	0.999;1.0	D;D	0.83275	0.964;0.996	T	0.67883	-0.5555	9	0.59425	D	0.04	.	7.6783	0.28499	0.2916:0.1162:0.5922:0.0	.	362;362	E9PG03;E9PC11	.;.	R	362;362;355;362	ENSP00000345062:S362R;ENSP00000408543:S355R;ENSP00000395539:S362R	ENSP00000345062:S362R	S	-	3	2	DCHS2	155630872	0.041000	0.20044	1.000000	0.80357	0.163000	0.22366	-0.493000	0.06459	0.163000	0.19507	-1.134000	0.01955	AGC			0.726	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000365282.1		NM_001142552	
MORF4	10934	bcgsc.ca	37	4	174537281	174537281	+	IGR	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr4:174537281C>T								RP11-475B2.1 (21574 upstream) : RP11-161D15.2 (280263 downstream)																							AGATGTGGCACTCCATACACC	0.448																																					.													.	.			0			.												158.0	158.0	158.0					4																	174537281		2203	4300	6503	SO:0001628	intergenic_variant	10934	.			GTGGCACTCCATA																													4.37:g.174537281C>T			Somatic	210	0	0		WXS	Illumina HiSeq	Phase_1	208	0.00	0	.	0		0		RNA	SNP		37																																																																																					0	0.448										
PLEKHG4B	153478	mdanderson.org	37	5	144949	144949	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr5:144949G>T	ENST00000283426.6	+	4	801	c.751G>T	c.(751-753)Gtc>Ttc	p.V251F	Y_RNA_ENST00000362670.1_RNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	251							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CAGGAAAGAGGTCCGGGACCT	0.562																																					p.V251F													.	.			0			c.G751T												52.0	55.0	54.0					5																	144949		2203	4298	6501	SO:0001583	missense	153478	exon4			AAAGAGGTCCGGG	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.751G>T	5.37:g.144949G>T	ENSP00000283426:p.Val251Phe		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	51	0.08	4	NM_052909	29	0.00	0		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.322506	0.23994	.	.	ENSG00000153404	ENST00000283426;ENST00000502646	T;T	0.32988	1.43;1.43	3.17	1.31	0.21738	.	.	.	.	.	T	0.44871	0.1314	M	0.79693	2.465	0.20703	N	0.999865	D	0.64830	0.994	P	0.59221	0.854	T	0.28870	-1.0030	9	0.48119	T	0.1	.	2.3725	0.04334	0.2817:0.0:0.4772:0.2411	.	251	Q96PX9	PKH4B_HUMAN	F	251;165	ENSP00000283426:V251F;ENSP00000422493:V165F	ENSP00000283426:V251F	V	+	1	0	PLEKHG4B	197949	0.010000	0.17322	0.983000	0.44433	0.194000	0.23727	0.779000	0.26746	0.323000	0.23307	0.313000	0.20887	GTC			0.562	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365359.1		NM_052909	
MBOAT1	154141	mdanderson.org	37	6	20151480	20151480	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr6:20151480G>T	ENST00000324607.7	-	3	423	c.259C>A	c.(259-261)Ctt>Att	p.L87I	MBOAT1_ENST00000536798.1_Missense_Mutation_p.L87I|MBOAT1_ENST00000541730.1_5'UTR	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	87					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			AGCACAAAAAGATGCACAGAG	0.378																																					p.L87I													.	.			0			c.C259A												146.0	127.0	133.0					6																	20151480		2203	4300	6503	SO:0001583	missense	154141	exon3			CAAAAAGATGCAC	AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.259C>A	6.37:g.20151480G>T	ENSP00000324944:p.Leu87Ile		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001080480	15	0.00	0	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	ENST00000324607.7	37	CCDS34346.1	.	.	.	.	.	.	.	.	.	.	G	8.863	0.947498	0.18356	.	.	ENSG00000172197	ENST00000324607;ENST00000536798	T;T	0.26373	2.62;1.74	5.69	4.76	0.60689	.	0.174595	0.47852	D	0.000220	T	0.06735	0.0172	N	0.17872	0.535	0.43874	D	0.996485	B	0.13145	0.007	B	0.12837	0.008	T	0.16217	-1.0410	10	0.14252	T	0.57	-16.8067	11.4923	0.50387	0.0:0.0:0.6754:0.3246	.	87	Q6ZNC8	MBOA1_HUMAN	I	87	ENSP00000324944:L87I;ENSP00000439814:L87I	ENSP00000324944:L87I	L	-	1	0	MBOAT1	20259459	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	2.913000	0.48790	2.661000	0.90470	0.650000	0.86243	CTT			0.378	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039980.1			
COL11A2	1302	mdanderson.org	37	6	33133977	33133977	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr6:33133977C>T	ENST00000374708.4	-	59	4399	c.4141G>A	c.(4141-4143)Gct>Act	p.A1381T	COL11A2_ENST00000395197.1_Missense_Mutation_p.A1407T|COL11A2_ENST00000374713.1_Missense_Mutation_p.A1420T|COL11A2_ENST00000374714.1_Missense_Mutation_p.A1441T|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000374712.1_Missense_Mutation_p.A1386T|COL11A2_ENST00000361917.1_Missense_Mutation_p.A1360T|COL11A2_ENST00000341947.2_Missense_Mutation_p.A1467T|COL11A2_ENST00000357486.1_Missense_Mutation_p.A1446T	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1467	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						TTGGGGCCAGCAGGTCCCTGT	0.577																																					p.A1467T	Melanoma(1;90 116 3946 5341 17093)												.	.			0			c.G4399A												22.0	21.0	21.0					6																	33133977		2203	4300	6503	SO:0001583	missense	1302	exon61			GGCCAGCAGGTCC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.4141G>A	6.37:g.33133977C>T	ENSP00000363840:p.Ala1381Thr		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_080680	1	0.00	0	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	37	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960933	0.34565	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	4.05	3.14	0.36123	.	0.566462	0.17043	N	0.189252	T	0.77143	0.4087	L	0.35414	1.06	0.20975	N	0.999814	B;B;B	0.33413	0.358;0.358;0.411	B;B;B	0.33846	0.107;0.107;0.171	T	0.66404	-0.5932	10	0.17832	T	0.49	.	6.4793	0.22053	0.2183:0.5878:0.194:0.0	.	1360;1381;1467	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	T	1381;1467;1446;1441;1420;1407;1386;1360	ENSP00000363840:A1381T;ENSP00000339915:A1467T;ENSP00000350079:A1446T;ENSP00000363846:A1441T;ENSP00000363845:A1420T;ENSP00000378623:A1407T;ENSP00000363844:A1386T;ENSP00000355123:A1360T	ENSP00000339915:A1467T	A	-	1	0	COL11A2	33241955	0.236000	0.23804	1.000000	0.80357	0.998000	0.95712	0.736000	0.26130	0.845000	0.35118	0.551000	0.68910	GCT			0.577	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076032.2			
BAK1	578	mdanderson.org	37	6	33543581	33543581	+	Silent	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr6:33543581C>T	ENST00000374467.3	-	3	443	c.195G>A	c.(193-195)ctG>ctA	p.L65L	BAK1_ENST00000360661.5_Silent_p.L65L|BAK1_ENST00000442998.2_Silent_p.L65L	NM_001188.3	NP_001179.1	Q16611	BAK_HUMAN	BCL2-antagonist/killer 1	65					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell negative selection (GO:0002352)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast apoptotic process (GO:0044346)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|limb morphogenesis (GO:0035108)|mitochondrial fusion (GO:0008053)|myeloid cell homeostasis (GO:0002262)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of gene expression (GO:0010629)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic camera-type eye morphogenesis (GO:0048597)|regulation of cell cycle (GO:0051726)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fungus (GO:0009620)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to mycotoxin (GO:0010046)|response to organic cyclic compound (GO:0014070)|response to UV-C (GO:0010225)|thymocyte apoptotic process (GO:0070242)|vagina development (GO:0060068)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|pore complex (GO:0046930)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4						TGCTAGGTTGCAGAGGTAAGG	0.602																																					p.L65L													.	.			0			c.G195A												84.0	76.0	79.0					6																	33543581		2203	4300	6503	SO:0001819	synonymous_variant	578	exon3			AGGTTGCAGAGGT	U23765	CCDS4781.1	6p21.31	2014-03-07			ENSG00000030110	ENSG00000030110			949	protein-coding gene	gene with protein product		600516		CDN1		7715730, 7715731	Standard	NM_001188		Approved	BCL2L7, BAK	uc003oes.3	Q16611	OTTHUMG00000014530	ENST00000374467.3:c.195G>A	6.37:g.33543581C>T			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001188	55	0.00	0	C0H5Y7|Q6I9T6|Q92533	Silent	SNP	ENST00000374467.3	37	CCDS4781.1	.	.	.	.	.	.	.	.	.	.	C	2.764	-0.257219	0.05791	.	.	ENSG00000030110	ENST00000374460	.	.	.	3.96	-7.92	0.01160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7329	0.46107	0.0:0.6044:0.1302:0.2654	.	.	.	.	.	-1	.	.	.	-	.	.	BAK1	33651559	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.748000	0.00794	-1.715000	0.01389	-1.270000	0.01421	.			0.602	BAK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040202.1		NM_001188	
KLC4	89953	broad.mit.edu	37	6	43039101	43039101	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr6:43039101G>T	ENST00000394056.2	+	10	1739	c.1244G>T	c.(1243-1245)gGg>gTg	p.G415V	KLC4_ENST00000259708.3_Missense_Mutation_p.G433V|KLC4_ENST00000453940.2_Missense_Mutation_p.G338V|KLC4_ENST00000347162.5_Missense_Mutation_p.G415V|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000479388.1_Missense_Mutation_p.G415V|KLC4_ENST00000394058.1_Missense_Mutation_p.G415V			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	415						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			CAGGAGTTTGGGTCTGTGGAT	0.552																																					p.G433V													.	KLC4	89		0			c.G1298T												77.0	78.0	78.0					6																	43039101		2203	4300	6503	SO:0001583	missense	89953	exon9			AGTTTGGGTCTGT	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1244G>T	6.37:g.43039101G>T	ENSP00000377620:p.Gly415Val		Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	155	0.03	4	NM_201523	22	0.00	0	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	37	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336612	0.81801	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T	0.81247	-1.46;1.28;-1.47;-1.46;-1.46;-1.46	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000005	D	0.89139	0.6630	M	0.86178	2.8	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.96;0.912	D	0.89350	0.3660	10	0.56958	D	0.05	-13.5181	15.6839	0.77393	0.0:0.1372:0.8627:0.0	.	338;433;415	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	V	415;338;433;415;415;415	ENSP00000340221:G415V;ENSP00000395806:G338V;ENSP00000259708:G433V;ENSP00000418031:G415V;ENSP00000377620:G415V;ENSP00000377622:G415V	ENSP00000259708:G433V	G	+	2	0	KLC4	43147079	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.610000	0.82949	2.810000	0.96702	0.650000	0.86243	GGG			0.552	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040579.2		NM_138343	
ERMARD	55780	hgsc.bcm.edu;mdanderson.org	37	6	170175417	170175417	+	Nonsense_Mutation	SNP	G	G	T	rs376417698		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr6:170175417G>T	ENST00000366773.3	+	14	1402	c.1369G>T	c.(1369-1371)Gaa>Taa	p.E457*	ERMARD_ENST00000392095.4_Nonsense_Mutation_p.E331*|ERMARD_ENST00000588451.1_Nonsense_Mutation_p.E321*|ERMARD_ENST00000366772.2_Nonsense_Mutation_p.E457*|ERMARD_ENST00000418781.3_Nonsense_Mutation_p.E457*	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	457					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GCCTTTCCCCGAAGAACTCAC	0.498																																					p.E457X													C6orf70,NS,carcinoma,0,1	C6orf70	0	1	0			c.G1369T												77.0	68.0	71.0					6																	170175417		2203	4300	6503	SO:0001587	stop_gained	55780	exon14			TTCCCCGAAGAAC	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.1369G>T	6.37:g.170175417G>T	ENSP00000355735:p.Glu457*		Somatic	58	0	0		WXS	Illumina HiSeq	.	52	0.06	3	NM_018341	106	0.00	0	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Nonsense_Mutation	SNP	ENST00000366773.3	37	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	.	34	5.332142	0.95733	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095;ENST00000366771	.	.	.	5.03	2.13	0.27403	.	0.595751	0.15395	N	0.264585	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	4.0079	0.09610	0.0897:0.1569:0.5915:0.1619	.	.	.	.	X	457;457;457;331;105	.	ENSP00000355733:E105X	E	+	1	0	C6orf70	169917342	0.012000	0.17670	0.000000	0.03702	0.005000	0.04900	0.485000	0.22324	0.091000	0.17302	-0.336000	0.08194	GAA			0.498	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043238.2		NM_018341	
NT5C3A	51251	bcgsc.ca	37	7	33102326	33102326	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:33102326C>G	ENST00000242210.7	-	1	83	c.7G>C	c.(7-9)Gcc>Ccc	p.A3P	NT5C3A_ENST00000610140.1_5'UTR	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	3					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										ATGGACGGGGCCCTCATGCGC	0.687																																					p.A3P													.	.			0			c.G7C												7.0	7.0	7.0					7																	33102326		2110	4041	6151	SO:0001583	missense	51251	exon1			ACGGGGCCCTCAT	AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.7G>C	7.37:g.33102326C>G	ENSP00000242210:p.Ala3Pro		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_1	126	0.01	1	NM_001002010	7	0.00	0	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Missense_Mutation	SNP	ENST00000242210.7	37	CCDS34616.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647470	0.47258	.	.	ENSG00000122643	ENST00000242210	T	0.32272	1.46	4.63	0.709	0.18150	.	1.500820	0.05038	N	0.475778	T	0.15696	0.0378	N	0.08118	0	0.27133	N	0.961846	B	0.02656	0.0	B	0.01281	0.0	T	0.28332	-1.0047	10	0.87932	D	0	.	2.4023	0.04404	0.2921:0.4206:0.1883:0.099	.	3	Q9H0P0	5NT3_HUMAN	P	3	ENSP00000242210:A3P	ENSP00000242210:A3P	A	-	1	0	NT5C3	33068851	0.113000	0.22115	0.008000	0.14137	0.570000	0.35934	2.253000	0.43205	-0.080000	0.12685	0.491000	0.48974	GCC			0.687	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000328880.1		NM_016489	
CAMK2B	816	broad.mit.edu	37	7	44268438	44268439	+	Frame_Shift_Ins	INS	-	-	G	rs537871427		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:44268438_44268439insG	ENST00000395749.2	-	19	1500_1501	c.1424_1425insC	c.(1423-1425)ccgfs	p.P475fs	CAMK2B_ENST00000457475.1_Intron|CAMK2B_ENST00000489429.1_5'UTR|CAMK2B_ENST00000347193.4_Intron|CAMK2B_ENST00000353625.4_Intron|CAMK2B_ENST00000358707.3_Intron|CAMK2B_ENST00000346990.4_Intron|CAMK2B_ENST00000502837.2_Intron|CAMK2B_ENST00000395747.2_Intron|CAMK2B_ENST00000258682.6_Intron|CAMK2B_ENST00000440254.2_Intron|CAMK2B_ENST00000350811.3_Intron	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	475					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						ACAGGCAGGGCGGGGGCCCCGC	0.673																																					p.P475fs													.	CAMK2B	56		0			c.1425_1426insC																																									SO:0001589	frameshift_variant	816	exon19			GCAGGGCGGGGGC	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.1425dupC	7.37:g.44268443_44268443dupG	ENSP00000379098:p.Pro475fs		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	51	0.16	8	NM_001220	0		0	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Frame_Shift_Ins	INS	ENST00000395749.2	37	CCDS5483.1																																																																																					0.673	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251138.2		NM_172084	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72685060	72685061	+	RNA	INS	-	-	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:72685060_72685061insA	ENST00000425256.1	-	0	120									GTF2I repeat domain containing 2 pseudogene 1																		agcaagactcctctcagaaaaa	0.45																																					.													.	.			0			.																																											0	.			AGACTCCTCTCAG	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72685060_72685061insA			Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	1	0.00	0		RNA	INS	ENST00000425256.1	37																																																																																						0.450	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
PHTF2	57157	broad.mit.edu	37	7	77531162	77531162	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:77531162T>C	ENST00000248550.7	+	6	446	c.370T>C	c.(370-372)Ttt>Ctt	p.F124L	PHTF2_ENST00000422959.2_Missense_Mutation_p.F90L|PHTF2_ENST00000424760.1_Missense_Mutation_p.F86L|PHTF2_ENST00000307305.8_Missense_Mutation_p.F86L|PHTF2_ENST00000416283.2_Missense_Mutation_p.F90L|PHTF2_ENST00000415251.2_Missense_Mutation_p.F86L|PHTF2_ENST00000275575.7_Missense_Mutation_p.F86L|PHTF2_ENST00000450574.1_Missense_Mutation_p.F90L			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						ATTTTTCCCCTTTTTCTTCCG	0.373																																					p.F90L													.	PHTF2	104		0			c.T268C												101.0	93.0	96.0					7																	77531162		1819	4082	5901	SO:0001583	missense	57157	exon5			TTCCCCTTTTTCT	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.370T>C	7.37:g.77531162T>C	ENSP00000248550:p.Phe124Leu		Somatic	336	0	0		WXS	Illumina HiSeq	Phase_I	308	0.02	5	NM_001127359	199	0.00	0	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	ENST00000248550.7	37		.	.	.	.	.	.	.	.	.	.	T	13.81	2.347504	0.41599	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000415251;ENST00000275575;ENST00000450574;ENST00000416283;ENST00000248550	.	.	.	5.43	5.43	0.79202	Transcription factor homeodomain, male germ-cell (1);	0.114448	0.64402	D	0.000012	T	0.47210	0.1433	N	0.05012	-0.13	0.58432	D	0.999997	P;B;P;D;D;B;D	0.76494	0.852;0.013;0.904;0.998;0.961;0.181;0.999	B;B;P;D;P;B;D	0.72625	0.437;0.038;0.578;0.94;0.689;0.163;0.978	T	0.43376	-0.9395	9	0.02654	T	1	-21.3953	15.7541	0.78011	0.0:0.0:0.0:1.0	.	86;90;124;90;86;86;86	Q8N3S3-4;Q8N3S3-2;Q8N3S3;G5E9H7;Q8N3S3-3;B3KQZ2;E9PEE3	.;.;PHTF2_HUMAN;.;.;.;.	L	90;90;86;86;86;86;90;90;124	.	ENSP00000248550:F124L	F	+	1	0	PHTF2	77369098	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.655000	0.83696	2.173000	0.68751	0.482000	0.46254	TTT			0.373	PHTF2-006	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000340638.2		NM_020432	
MUC17	140453	hgsc.bcm.edu	37	7	100678918	100678918	+	Silent	SNP	G	G	A	rs200627718|rs71286278	byFrequency	TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:100678918G>A	ENST00000306151.4	+	3	4285	c.4221G>A	c.(4219-4221)ccG>ccA	p.P1407P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1407	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCACCACGCCGGTAGTCAGTT	0.512																																					p.P1407P													MUC17,colon,carcinoma,+1,1	MUC17	1	1	0			c.G4221A												272.0	277.0	276.0					7																	100678918		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CACGCCGGTAGTC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4221G>A	7.37:g.100678918G>A			Somatic	85	0.0117647059	1		WXS	Illumina HiSeq	.	86	0.06	5	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			0.002		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
LAMB1	3912	mdanderson.org	37	7	107570055	107570055	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:107570055G>T	ENST00000222399.6	-	30	4777	c.4547C>A	c.(4546-4548)gCt>gAt	p.A1516D	LAMB1_ENST00000393561.1_Missense_Mutation_p.A1540D|LAMB1_ENST00000474380.1_5'UTR	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1516	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GTCCAAATCAGCACTATCCTC	0.408																																					p.A1516D													.	.			0			c.C4547A												95.0	82.0	87.0					7																	107570055		2203	4300	6503	SO:0001583	missense	3912	exon30			AAATCAGCACTAT	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4547C>A	7.37:g.107570055G>T	ENSP00000222399:p.Ala1516Asp		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_002291	65	0.00	0	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	33	5.263705	0.95399	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.36340	1.26;1.26	5.52	5.52	0.82312	.	.	.	.	.	T	0.64316	0.2587	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	T	0.66348	-0.5946	9	0.87932	D	0	.	19.6435	0.95767	0.0:0.0:1.0:0.0	.	1516;1540	P07942;G3XAI2	LAMB1_HUMAN;.	D	1540;1516	ENSP00000377191:A1540D;ENSP00000222399:A1516D	ENSP00000222399:A1516D	A	-	2	0	LAMB1	107357291	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.259000	0.95561	2.866000	0.98385	0.650000	0.86243	GCT			0.408	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314584.1		NM_002291	
SSPO	23145	mdanderson.org	37	7	149474940	149474940	+	RNA	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:149474940C>T	ENST00000378016.2	+	0	739							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACACTGTCAGCGGGTGAGGGA	0.682																																					p.R247W													.	.			0			c.C739T												14.0	17.0	16.0					7																	149474940		1975	4136	6111			23145	exon5			TGTCAGCGGGTGA	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149474940C>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_198455	0		0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																						0.682	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
KCNH2	3757	hgsc.bcm.edu	37	7	150671831	150671831	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:150671831C>T	ENST00000262186.5	-	2	676	c.275G>A	c.(274-276)cGc>cAc	p.R92H	KCNH2_ENST00000430723.3_Missense_Mutation_p.R92H	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	92	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TTCCACTTTGCGCTCCTCGGC	0.726																																					p.R92H	GBM(137;110 1844 13671 20123 45161)												.	.			0			c.G275A												9.0	10.0	10.0					7																	150671831		2175	4224	6399	SO:0001583	missense	3757	exon2			ACTTTGCGCTCCT	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.275G>A	7.37:g.150671831C>T	ENSP00000262186:p.Arg92His		Somatic	123	0	0		WXS	Illumina HiSeq	.	121	0.04	5	NM_000238	17	0.00	0	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657651	0.88154	.	.	ENSG00000055118	ENST00000262186;ENST00000430723	D;D	0.99563	-6.17;-6.17	4.38	3.49	0.39957	PAS-associated, C-terminal (1);PAS (1);PAS fold (1);	0.091297	0.39615	N	0.001319	D	0.99052	0.9675	L	0.39147	1.195	0.42596	D	0.993268	D;P	0.89917	1.0;0.953	P;P	0.61477	0.889;0.881	D	0.98570	1.0645	10	0.46703	T	0.11	.	11.9938	0.53189	0.0:0.8233:0.1767:0.0	.	92;92	G5E9I0;Q12809	.;KCNH2_HUMAN	H	92	ENSP00000262186:R92H;ENSP00000387657:R92H	ENSP00000262186:R92H	R	-	2	0	KCNH2	150302764	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	3.161000	0.50747	0.811000	0.34303	0.297000	0.19635	CGC			0.726	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350741.2		NM_000238	
ASIC3	9311	broad.mit.edu	37	7	150746098	150746098	+	Silent	SNP	G	G	T	rs555665814		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:150746098G>T	ENST00000349064.5	+	1	324	c.126G>T	c.(124-126)cgG>cgT	p.R42R	ASIC3_ENST00000297512.8_Silent_p.R42R|ASIC3_ENST00000357922.4_Silent_p.R42R	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	42					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										GCCTGCGCCGGGGGATGTGGG	0.692																																					p.R42R													.	.			0			c.G126T												42.0	43.0	43.0					7																	150746098		2203	4299	6502	SO:0001819	synonymous_variant	9311	exon1			GCGCCGGGGGATG	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.126G>T	7.37:g.150746098G>T			Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	68	0.04	3	NM_020322	41	0.00	0	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1																																																																																					0.692	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351725.1		NM_004769	
ERICH1	157697	bcgsc.ca	37	8	623373	623373	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:623373C>T	ENST00000262109.7	-	4	1056	c.979G>A	c.(979-981)Gag>Aag	p.E327K	ERICH1_ENST00000522706.1_Missense_Mutation_p.E233K|ERICH1_ENST00000518277.1_5'Flank	NM_207332.1	NP_997215.1	Q86X53	ERIC1_HUMAN	glutamate-rich 1	327	Glu-rich.									endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)	20		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		TCATCTTCCTCGCTGGCGTCT	0.502																																					p.E327K													ERICH1,NS,carcinoma,+1,1	ERICH1	50	1	0			c.G979A												154.0	159.0	157.0					8																	623373		2203	4300	6503	SO:0001583	missense	157697	exon4			CTTCCTCGCTGGC		CCDS5955.1	8p23.3	2005-09-01			ENSG00000104714	ENSG00000104714			27234	protein-coding gene	gene with protein product							Standard	NM_207332		Approved		uc003wph.3	Q86X53	OTTHUMG00000129163	ENST00000262109.7:c.979G>A	8.37:g.623373C>T	ENSP00000262109:p.Glu327Lys		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_1	115	0.00	0	NM_207332	64	0.00	0	A8K2J9|Q9P063	Missense_Mutation	SNP	ENST00000262109.7	37	CCDS5955.1	.	.	.	.	.	.	.	.	.	.	C	9.333	1.061088	0.19987	.	.	ENSG00000104714	ENST00000543819;ENST00000522706;ENST00000262109	T;T	0.34859	1.34;1.37	4.18	1.34	0.21922	.	0.606585	0.15774	N	0.245313	T	0.18215	0.0437	N	0.12182	0.205	0.20196	N	0.99992	B;B;B	0.21452	0.056;0.056;0.056	B;B;B	0.20384	0.029;0.018;0.02	T	0.21552	-1.0242	10	0.25751	T	0.34	-12.1972	8.0641	0.30651	0.0:0.5362:0.3689:0.0948	.	327;327;233	B4DMI5;Q86X53;E5RHA3	.;ERIC1_HUMAN;.	K	327;233;327	ENSP00000428635:E233K;ENSP00000262109:E327K	ENSP00000262109:E327K	E	-	1	0	ERICH1	613373	0.910000	0.30920	0.145000	0.22337	0.009000	0.06853	2.883000	0.48554	0.283000	0.22279	-0.122000	0.15005	GAG			0.502	ERICH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251228.3		NM_207332	
CHRNA2	1135	mdanderson.org	37	8	27327404	27327404	+	Silent	SNP	G	G	T	rs200729883		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:27327404G>T	ENST00000520933.2	-	2	321	c.168C>A	c.(166-168)acC>acA	p.T56T	CHRNA2_ENST00000407991.1_Silent_p.T56T|CHRNA2_ENST00000240132.2_Silent_p.T56T			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	56					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	CCTCAGTCTCGGTATGCGAGC	0.642																																					p.T56T													.	.			0			c.C168A												60.0	64.0	62.0					8																	27327404		2203	4300	6503	SO:0001819	synonymous_variant	1135	exon3			AGTCTCGGTATGC	U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.168C>A	8.37:g.27327404G>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	73	0.07	5	NM_000742	0		0	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Silent	SNP	ENST00000520933.2	37	CCDS6059.1																																																																																					0.642	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376125.4			
PURG	29942	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	30889696	30889696	+	Silent	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:30889696G>T	ENST00000475541.1	-	1	1535	c.603C>A	c.(601-603)acC>acA	p.T201T	WRN_ENST00000298139.5_5'Flank|PURG_ENST00000339382.2_Silent_p.T201T	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	201						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		CCCGCATCATGGTTTGTCTAA	0.458																																					p.T201T													PURG_ENST00000475541,colon,carcinoma,-2,2	PURG_ENST00000475541	-2	2	0			c.C603A												92.0	87.0	89.0					8																	30889696		2203	4300	6503	SO:0001819	synonymous_variant	29942	exon1			CATCATGGTTTGT	AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.603C>A	8.37:g.30889696G>T			Somatic	117	0	0		WXS	Illumina HiSeq	.	114	0.07	8	NM_013357	0		0	Q8TE64	Silent	SNP	ENST00000475541.1	37	CCDS6081.1																																																																																					0.458	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348565.1		NM_013357	
GDAP1	54332	bcgsc.ca	37	8	75262792	75262792	+	Silent	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:75262792G>T	ENST00000220822.7	+	1	176	c.96G>T	c.(94-96)acG>acT	p.T32T	CTD-2320G14.2_ENST00000521872.1_RNA|GDAP1_ENST00000434412.2_Intron|GDAP1_ENST00000521096.1_Intron	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	32	GST N-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			ACCATTGGACGCATTCGTTCA	0.622																																					p.T32T													.	GDAP1	36		0			c.G96T												59.0	61.0	60.0					8																	75262792		2203	4300	6503	SO:0001819	synonymous_variant	54332	exon1			TTGGACGCATTCG		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.96G>T	8.37:g.75262792G>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_1	41	0.00	0	NM_018972	8	0.00	0	A8K957|E7FJF3|E7FJF4	Silent	SNP	ENST00000220822.7	37	CCDS34911.1																																																																																					0.622	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379061.1		NM_018972	
MT-CYB	4519	hgsc.bcm.edu	37	M	14698	14698	+	5'Flank	SNP	G	G	A			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrM:14698G>A	ENST00000361789.2	+	0	0				MT-ND6_ENST00000361681.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b						cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACTACAACCACGACCAATGAT	0.383																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			AACCACGACCAAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156			M.37:g.14698G>A	Exception_encountered		Somatic	186	0	0		WXS	Illumina HiSeq	.	65	0.09	6	.	0		0	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	RNA	SNP	ENST00000361789.2	37																																																																																						0.383	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024038	
ZFX	7543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	24228773	24228773	+	Silent	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:24228773C>T	ENST00000379177.1	+	11	2125	c.1698C>T	c.(1696-1698)caC>caT	p.H566H	ZFX_ENST00000379188.3_Silent_p.H566H|ZFX_ENST00000338565.3_Silent_p.H516H|ZFX_ENST00000539115.1_Silent_p.H337H|ZFX_ENST00000540034.1_Silent_p.H605H|ZFX_ENST00000304543.5_Silent_p.H566H	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	566					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						TCAAAAAGCACATGAGAATCC	0.453																																					p.H566H	Esophageal Squamous(20;306 562 7346 32868 37983)												.	.			0			c.C1698T												109.0	99.0	103.0					X																	24228773		2203	4300	6503	SO:0001819	synonymous_variant	7543	exon10			AAAGCACATGAGA		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1698C>T	X.37:g.24228773C>T			Somatic	166	0	0		WXS	Illumina HiSeq	.	151	0.13	20	NM_003410	25	0.24	6	B9EG97|O43668|Q8WYJ8	Silent	SNP	ENST00000379177.1	37	CCDS14211.1																																																																																					0.453	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056084.1		NM_003410	
DDX3X	1654	hgsc.bcm.edu;broad.mit.edu	37	X	41204800	41204801	+	Splice_Site	INS	-	-	G			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:41204800_41204801insG	ENST00000399959.2	+	12	2169_2170	c.1314_1315insG	c.(1315-1317)ggc>Gggc	p.G439fs	DDX3X_ENST00000457138.2_Splice_Site_p.G423fs|DDX3X_ENST00000478993.1_3'UTR|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000542215.1_3'UTR|DDX3X_ENST00000441189.2_Intron	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	439	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TAAATGCAACAGGTAACATTAT	0.411										HNSCC(61;0.18)																											p.T438fs													.	DDX3X	138		0			c.1314_1315insG																																									SO:0001630	splice_region_variant	1654	exon12			TGCAACAGGTAAC	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1315+1->G	X.37:g.41204802_41204802dupG			Somatic	226	0	0		WXS	Illumina HiSeq	.	214	0.14	30	NM_001356	196	0.00	0	A8K538|B4E3E8|O15536	Frame_Shift_Ins	INS	ENST00000399959.2	37	CCDS43931.1																																																																																					0.411	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056253.1		NM_024005	Frame_Shift_Ins
TEX13A	56157	mdanderson.org	37	X	104464815	104464815	+	Silent	SNP	C	C	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:104464815C>T	ENST00000413579.1	-	2	378	c.267G>A	c.(265-267)agG>agA	p.R89R	IL1RAPL2_ENST00000372582.1_Intron|IL1RAPL2_ENST00000344799.4_Intron|TEX13A_ENST00000372575.1_Silent_p.R89R|TEX13A_ENST00000372578.3_Silent_p.R89R			Q9BXU3	TX13A_HUMAN	testis expressed 13A	89							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						GCCACCGCACCCTGTGCCTTT	0.627																																					p.R89R													.	.			0			c.G267A												32.0	33.0	32.0					X																	104464815		2203	4292	6495	SO:0001819	synonymous_variant	56157	exon2			CCGCACCCTGTGC	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.267G>A	X.37:g.104464815C>T			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_031274	0		0	B1B1G8|Q32NB6	Silent	SNP	ENST00000413579.1	37																																																																																						0.627	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_031274	
HCFC1	3054	mdanderson.org	37	X	153223524	153223524	+	Silent	SNP	G	G	T	rs370251100		TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:153223524G>T	ENST00000310441.7	-	11	2946	c.1980C>A	c.(1978-1980)acC>acA	p.T660T	HCFC1_ENST00000354233.3_Silent_p.T591T|HCFC1_ENST00000369984.4_Silent_p.T660T|HCFC1_ENST00000461098.1_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	660	Interaction with SIN3A.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCAGGGTGATGGTCTTGGTGA	0.622																																					p.T660T													.	.			0			c.C1980A												52.0	54.0	53.0					X																	153223524		2127	4203	6330	SO:0001819	synonymous_variant	3054	exon11			GGTGATGGTCTTG		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1980C>A	X.37:g.153223524G>T			Somatic	57	0.0175438596	1		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_005334	64	0.00	0	Q6P4G5	Silent	SNP	ENST00000310441.7	37	CCDS44020.1																																																																																					0.622	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061099.4		NM_005334	
DNM1	1759	mdanderson.org	37	9	130996383	130996383	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-01A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f5020af-426f-498a-8b86-56a7cbd58bc9	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr9:130996383G>T	ENST00000372923.3	+	11	1511	c.1419G>T	c.(1417-1419)gaG>gaT	p.E473D	DNM1_ENST00000341179.7_Missense_Mutation_p.E473D|DNM1_ENST00000393594.3_Missense_Mutation_p.E473D|DNM1_ENST00000486160.1_Missense_Mutation_p.E473D|DNM1_ENST00000475805.1_Missense_Mutation_p.E473D	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	473					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						GCACTAAGGAGCAGGTGAGCC	0.682																																					.	GBM(113;146 1575 2722 28670 29921)												.	.			0			.												16.0	15.0	16.0					9																	130996383		2167	4254	6421	SO:0001583	missense	1759	.			TAAGGAGCAGGTG	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1419G>T	9.37:g.130996383G>T	ENSP00000362014:p.Glu473Asp		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	.	24	0.00	0	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	G	5.487	0.274838	0.10403	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77	5.0	0.711	0.18162	Dynamin central domain (1);Pleckstrin homology-type (1);	0.436255	0.23920	N	0.043242	T	0.41789	0.1174	N	0.05510	-0.035	0.40025	D	0.975451	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.36672	-0.9738	10	0.02654	T	1	-5.3746	3.1313	0.06424	0.183:0.4562:0.2404:0.1204	.	473;473;473	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	D	473;473;473;468;473;473;18	ENSP00000419225:E473D;ENSP00000345680:E473D;ENSP00000362014:E473D;ENSP00000377219:E473D;ENSP00000420045:E473D	ENSP00000345680:E473D	E	+	3	2	DNM1	130036204	0.989000	0.36119	1.000000	0.80357	0.955000	0.61496	0.220000	0.17660	0.131000	0.18576	0.455000	0.32223	GAG			0.682	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054367.1		NM_004408	
