#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PERM1	84808	bcgsc.ca	37	1	915325	915325	+	Missense_Mutation	SNP	A	A	G	rs540430710	byFrequency	TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:915325A>G	ENST00000341290.2	-	3	778	c.743T>C	c.(742-744)aTa>aCa	p.I248T	C1orf170_ENST00000433179.2_Missense_Mutation_p.I268T			Q5SV97	PERM1_HUMAN		362					regulation of transcription, DNA-templated (GO:0006355)|response to muscle activity (GO:0014850)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGAGGCAGGTATAGACACAGC	0.572													a|||	4	0.000798722	0.0015	0.0	5008	,	,		18506	0.0		0.0	False		,,,				2504	0.002				.													.	C1orf170	5		0			.																																									SO:0001583	missense	84808	.			GCAGGTATAGACA																												ENST00000341290.2:c.743T>C	1.37:g.915325A>G	ENSP00000343864:p.Ile248Thr		Somatic	82	0.012195122	1		WXS	Illumina HiSeq	Phase_1	63	0.13	8	.	0		0	Q6ZVZ7|Q9BRF2|S5G239	Missense_Mutation	SNP	ENST00000341290.2	37		.	.	.	.	.	.	.	.	.	.	.	0.680	-0.798586	0.02841	.	.	ENSG00000187642	ENST00000433179;ENST00000341290	T;T	0.39787	1.06;1.06	4.04	3.12	0.35913	.	0.305549	0.23103	N	0.051885	T	0.17577	0.0422	.	.	.	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	8.4167	0.32676	0.198:0.0:0.802:0.0	.	268	Q5SV97	CA170_HUMAN	T	268;248	ENSP00000414022:I268T;ENSP00000343864:I248T	ENSP00000343864:I248T	I	-	2	0	C1orf170	905188	0.006000	0.16342	0.165000	0.22776	0.114000	0.19823	-0.031000	0.12287	0.391000	0.25143	-1.214000	0.01621	ATA			0.572	C1orf170-001	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000097943.2			
MST1L	11223	broad.mit.edu;bcgsc.ca	37	1	17084730	17084730	+	RNA	DEL	G	G	-	rs369371609		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:17084730delG	ENST00000455405.2	-	0	286							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R494fs*37(1)									AAGCACTGCCGGGCAGTCAGT	0.582																																					.													.	.			1	Deletion - Frameshift(1)	large_intestine(1)	.																																											0	.			ACTGCCGGGCAGT	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084730delG			Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	144	0.07	10	.	3	0.00	0	B7WPB1|Q13209	RNA	DEL	ENST00000455405.2	37																																																																																						0.582	MST1L-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000400328.1		NM_001271733	
LYPLA2	11313	mdanderson.org	37	1	24120782	24120782	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:24120782C>T	ENST00000374514.3	+	8	745	c.438C>T	c.(436-438)agC>agT	p.S146S	LYPLA2_ENST00000374502.3_Silent_p.S146S|LYPLA2_ENST00000374505.2_Silent_p.L122L|LYPLA2_ENST00000495365.1_3'UTR|LYPLA2_ENST00000374501.1_Silent_p.S79S|LYPLA2_ENST00000400061.1_Silent_p.L122L|LYPLA2_ENST00000374503.3_Silent_p.S146S	NM_007260.2	NP_009191.1	O95372	LYPA2_HUMAN	lysophospholipase II	146					fatty acid metabolic process (GO:0006631)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		TGGCGTTGAGCTGCTGGCTGC	0.687																																					p.S146S													.	.			0			c.C438T												39.0	42.0	41.0					1																	24120782		2203	4298	6501	SO:0001819	synonymous_variant	11313	exon8			GTTGAGCTGCTGG	AF098668	CCDS241.1	1p36.11	2008-08-08			ENSG00000011009	ENSG00000011009	3.1.1.5		6738	protein-coding gene	gene with protein product							Standard	NM_007260		Approved	APT-2	uc001bht.3	O95372	OTTHUMG00000002961	ENST00000374514.3:c.438C>T	1.37:g.24120782C>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_007260	216	0.00	0	Q7Z4Z2	Silent	SNP	ENST00000374514.3	37	CCDS241.1																																																																																					0.687	LYPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008245.1			
TACSTD2	4070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	59042191	59042191	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:59042191G>A	ENST00000371225.2	-	1	975	c.638C>T	c.(637-639)gCc>gTc	p.A213V		NM_002353.2	NP_002344.2	P09758	TACD2_HUMAN	tumor-associated calcium signal transducer 2	213					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell motility (GO:2000146)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of stress fiber assembly (GO:0051497)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of stem cell differentiation (GO:2000738)|regulation of epithelial cell proliferation (GO:0050678)|ureteric bud morphogenesis (GO:0060675)|visual perception (GO:0007601)	basal plasma membrane (GO:0009925)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)					all_cancers(7;6.54e-05)					GTCACCGGCGGCCTTCTGAGA	0.647																																					p.A213V													.	.			0			c.C638T												14.0	16.0	16.0					1																	59042191		2199	4293	6492	SO:0001583	missense	4070	exon1			CCGGCGGCCTTCT	X77753	CCDS609.1	1p32	2008-02-05			ENSG00000184292	ENSG00000184292			11530	protein-coding gene	gene with protein product		137290		M1S1		8382772, 11306819	Standard	NM_002353		Approved	TROP2, GA733-1, EGP-1	uc001cyz.4	P09758	OTTHUMG00000010067	ENST00000371225.2:c.638C>T	1.37:g.59042191G>A	ENSP00000360269:p.Ala213Val		Somatic	78	0	0		WXS	Illumina HiSeq	.	126	0.25	32	NM_002353	10	0.10	1	Q15658|Q6FG48|Q7Z7Q4|Q96QD2	Missense_Mutation	SNP	ENST00000371225.2	37	CCDS609.1	.	.	.	.	.	.	.	.	.	.	G	2.708	-0.269448	0.05716	.	.	ENSG00000184292	ENST00000371225	T	0.77750	-1.12	4.64	-2.56	0.06268	.	0.529435	0.19508	N	0.112568	T	0.51210	0.1661	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25572	-1.0128	10	0.25106	T	0.35	-6.9924	1.8189	0.03106	0.3143:0.1236:0.4352:0.1268	.	213	P09758	TACD2_HUMAN	V	213	ENSP00000360269:A213V	ENSP00000360269:A213V	A	-	2	0	TACSTD2	58814779	0.000000	0.05858	0.115000	0.21578	0.019000	0.09904	-0.021000	0.12504	-0.763000	0.04658	-1.263000	0.01449	GCC			0.647	TACSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000027818.1		NM_002353	
LOC645166	645166	ucsc.edu	37	1	148933289	148933289	+	lincRNA	SNP	A	A	G	rs9729175	byFrequency	TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:148933289A>G	ENST00000539543.1	+	0	176					NR_027355.2																						TGCTGCCCGCAGGATATTGTG	0.562													.|||	630	0.125799	0.112	0.1282	5008	,	,		27649	0.1796		0.0656	False		,,,				2504	0.1493				.													.	.			0			c.236-2A>G																																											645166	exon3			GCCCGCAGGATAT																													1.37:g.148933289A>G			Somatic	61	0.0655737705	4		WXS	Illumina HiSeq		52	0.27	14	NR_027355	0		0		Splice_Site	SNP	ENST00000539543.1	37																																																																																						0.562	RP11-14N7.2-201	KNOWN	basic	lincRNA	lincRNA					
CHRNB2	1141	mdanderson.org	37	1	154544408	154544408	+	Missense_Mutation	SNP	G	G	T	rs200483865		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:154544408G>T	ENST00000368476.3	+	5	1373	c.1109G>T	c.(1108-1110)cGc>cTc	p.R370L		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	370					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CAGCGTGAGCGCGAGGGCGCT	0.706																																					p.R370L													.	.			0			c.G1109T												8.0	6.0	7.0					1																	154544408		2114	4087	6201	SO:0001583	missense	1141	exon5			GTGAGCGCGAGGG	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.1109G>T	1.37:g.154544408G>T	ENSP00000357461:p.Arg370Leu		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	15	0.20	3	NM_000748	0		0	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	G	8.542	0.873577	0.17322	.	.	ENSG00000160716	ENST00000368476	D	0.85088	-1.94	3.97	1.82	0.25136	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.437610	0.03938	N	0.286389	T	0.41143	0.1146	N	0.00788	-1.185	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.38023	-0.9680	10	0.23891	T	0.37	.	9.0395	0.36309	0.1:0.1554:0.7446:0.0	.	370	P17787	ACHB2_HUMAN	L	370	ENSP00000357461:R370L	ENSP00000357461:R370L	R	+	2	0	CHRNB2	152811032	0.000000	0.05858	0.287000	0.24848	0.486000	0.33341	0.042000	0.13949	0.822000	0.34565	0.313000	0.20887	CGC			0.706	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090697.1		NM_000748	
ATP1A2	477	mdanderson.org	37	1	160109764	160109764	+	Silent	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:160109764G>T	ENST00000361216.3	+	22	3113	c.3024G>T	c.(3022-3024)cgG>cgT	p.R1008R	ATP1A2_ENST00000459972.1_3'UTR|ATP1A2_ENST00000392233.3_Silent_p.R997R	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	1008					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TCCTGCGGCGGTATCCTGGTG	0.582																																					p.R1008R													ATP1A2,NS,carcinoma,+2,3	ATP1A2	2	3	0			c.G3024T												113.0	102.0	106.0					1																	160109764		2203	4300	6503	SO:0001819	synonymous_variant	477	exon22			GCGGCGGTATCCT	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.3024G>T	1.37:g.160109764G>T			Somatic	55	0.0363636364	2		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_000702	3	0.00	0	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Silent	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	G	8.404	0.842655	0.16963	.	.	ENSG00000018625	ENST00000447527	.	.	.	4.37	-6.69	0.01772	.	.	.	.	.	T	0.18509	0.0444	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43015	-0.9417	4	.	.	.	.	1.2751	0.02029	0.1861:0.2378:0.3418:0.2343	.	.	.	.	V	702	.	.	G	+	2	0	ATP1A2	158376388	0.000000	0.05858	0.949000	0.38748	0.896000	0.52359	-1.158000	0.03153	-0.972000	0.03559	-0.982000	0.02568	GGT			0.582	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060642.2		NM_000702	
MAEL	84944	mdanderson.org	37	1	166961963	166961963	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:166961963C>T	ENST00000367872.4	+	4	610	c.366C>T	c.(364-366)agC>agT	p.S122S	MAEL_ENST00000367870.2_Silent_p.S91S|MAEL_ENST00000491055.1_3'UTR	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	122					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						ACATTTTTAGCCATGGCGAGC	0.363																																					p.S122S													.	.			0			c.C366T												75.0	76.0	76.0					1																	166961963		2203	4300	6503	SO:0001819	synonymous_variant	84944	exon4			TTTTAGCCATGGC	AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.366C>T	1.37:g.166961963C>T			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_032858	3	0.00	0	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Silent	SNP	ENST00000367872.4	37	CCDS1257.1																																																																																					0.363	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083239.1		NM_032858	
NPL	80896	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	182798766	182798766	+	3'UTR	SNP	C	C	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:182798766C>A	ENST00000367553.1	+	0	1730				NPL_ENST00000367555.1_Missense_Mutation_p.N225K|NPL_ENST00000367552.2_Missense_Mutation_p.N225K|NPL_ENST00000367554.3_3'UTR	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)						carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						TTTCAAAGAACCAAAGGACTC	0.428																																					p.N269K													.	NPL	55		0			c.C807A																																									SO:0001624	3_prime_UTR_variant	80896	exon13			AAAGAACCAAAGG	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.*723C>A	1.37:g.182798766C>A			Somatic	343	0.0029154519	1		WXS	Illumina HiSeq	Phase_I	376	0.03	13	NM_001200056	16	0.00	0	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Missense_Mutation	SNP	ENST00000367553.1	37	CCDS1350.1	.	.	.	.	.	.	.	.	.	.	C	9.112	1.006906	0.19199	.	.	ENSG00000135838	ENST00000367555;ENST00000367552	D;D	0.92595	-3.07;-3.07	2.22	1.3	0.21679	.	.	.	.	.	D	0.84633	0.5515	.	.	.	0.09310	N	0.999999	B;B	0.28400	0.003;0.21	B;B	0.25759	0.003;0.063	T	0.74169	-0.3752	8	0.45353	T	0.12	.	5.0656	0.14580	0.0:0.8246:0.0:0.1754	.	225;269	Q9BXD5-4;Q9BXD5-3	.;.	K	225	ENSP00000356526:N225K;ENSP00000356523:N225K	ENSP00000356523:N225K	N	+	3	2	NPL	181065389	0.000000	0.05858	0.035000	0.18076	0.015000	0.08874	-0.312000	0.08113	0.509000	0.28195	0.563000	0.77884	AAC			0.428	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085463.1		NM_030769	
CRB1	23418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197390687	197390687	+	Missense_Mutation	SNP	G	G	T	rs377023757		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:197390687G>T	ENST00000367400.3	+	6	1864	c.1729G>T	c.(1729-1731)Gct>Tct	p.A577S	CRB1_ENST00000544212.1_Missense_Mutation_p.A58S|CRB1_ENST00000367399.2_Missense_Mutation_p.A465S|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.A508S|CRB1_ENST00000543483.1_Intron|CRB1_ENST00000538660.1_Missense_Mutation_p.A577S	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	577	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATTTGCAGAGGCTGTGACCCT	0.433																																					p.A577S													.	.			0			c.G1729T												121.0	119.0	119.0					1																	197390687		2203	4300	6503	SO:0001583	missense	23418	exon6			GCAGAGGCTGTGA		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1729G>T	1.37:g.197390687G>T	ENSP00000356370:p.Ala577Ser		Somatic	86	0	0		WXS	Illumina HiSeq	.	87	0.15	13	NM_001257966	0		0	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	8.752	0.921536	0.17982	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367401	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.69	0.158	0.14942	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.69061	0.3069	L	0.58302	1.8	0.09310	N	1	B;B;B;B;B	0.31351	0.32;0.313;0.066;0.082;0.243	B;B;B;B;B	0.37601	0.179;0.124;0.049;0.058;0.254	T	0.54009	-0.8357	9	0.07644	T	0.81	.	5.7458	0.18120	0.408:0.1277:0.4643:0.0	.	577;508;465;226;577	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	S	508;577;577;465;58;226	ENSP00000438786:A508S;ENSP00000438091:A577S;ENSP00000356370:A577S;ENSP00000356369:A465S;ENSP00000444556:A58S	ENSP00000356369:A465S	A	+	1	0	CRB1	195657310	0.003000	0.15002	0.002000	0.10522	0.208000	0.24298	0.133000	0.15912	-0.236000	0.09753	-0.262000	0.10625	GCT			0.433	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086565.2		NM_201253	
NEK7	140609	mdanderson.org	37	1	198288648	198288648	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:198288648G>T	ENST00000367385.4	+	10	1247	c.905G>T	c.(904-906)aGc>aTc	p.S302I	NEK7_ENST00000538004.1_Missense_Mutation_p.S302I	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	302					cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						ACTGCAAGCAGCTAAACATGC	0.398																																					p.S302I													.	.			0			c.G905T												81.0	73.0	75.0					1																	198288648		2203	4299	6502	SO:0001583	missense	140609	exon10			CAAGCAGCTAAAC	AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.905G>T	1.37:g.198288648G>T	ENSP00000356355:p.Ser302Ile		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_133494	5	0.00	0	A6NGT8	Missense_Mutation	SNP	ENST00000367385.4	37	CCDS1394.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798649	0.50208	.	.	ENSG00000151414	ENST00000367385;ENST00000538004	T;T	0.70869	-0.52;-0.52	5.54	3.64	0.41730	.	0.188948	0.56097	D	0.000037	T	0.61413	0.2345	L	0.27053	0.805	0.80722	D	1	P	0.49307	0.922	B	0.42625	0.393	T	0.65809	-0.6078	10	0.72032	D	0.01	.	16.2637	0.82563	0.0:0.2498:0.7502:0.0	.	302	Q8TDX7	NEK7_HUMAN	I	302	ENSP00000356355:S302I;ENSP00000444621:S302I	ENSP00000356355:S302I	S	+	2	0	NEK7	196555271	1.000000	0.71417	0.997000	0.53966	0.638000	0.38207	4.616000	0.61197	0.674000	0.31244	0.650000	0.86243	AGC			0.398	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086550.2		NM_133494	
KLHDC8A	55220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	205307669	205307669	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:205307669A>C	ENST00000367156.3	-	8	1629	c.813T>G	c.(811-813)ttT>ttG	p.F271L	KLHDC8A_ENST00000367155.3_Missense_Mutation_p.F271L|KLHDC8A_ENST00000460687.1_Missense_Mutation_p.F137L|KLHDC8A_ENST00000537168.1_Missense_Mutation_p.F158L|KLHDC8A_ENST00000539253.1_Missense_Mutation_p.F271L	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	271										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AGCCAGCCACAAAATCTGCCC	0.502																																					p.F271L													.	.			0			c.T813G												81.0	77.0	79.0					1																	205307669		2203	4300	6503	SO:0001583	missense	55220	exon5			AGCCACAAAATCT		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.813T>G	1.37:g.205307669A>C	ENSP00000356124:p.Phe271Leu		Somatic	82	0	0		WXS	Illumina HiSeq	.	84	0.32	27	NM_018203	4	0.00	0	B3KU70|Q9NVG5	Missense_Mutation	SNP	ENST00000367156.3	37	CCDS30985.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.444408	0.63178	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253;ENST00000537168	T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72	5.45	1.82	0.25136	Kelch-type beta propeller (1);	0.048301	0.85682	D	0.000000	T	0.72447	0.3461	L	0.45422	1.42	0.48975	D	0.999734	D;B	0.56035	0.974;0.025	D;B	0.70487	0.969;0.047	T	0.65195	-0.6227	10	0.14252	T	0.57	-11.9288	9.0193	0.36191	0.6886:0.0:0.3114:0.0	.	158;271	F5H5F1;Q8IYD2	.;KLD8A_HUMAN	L	271;271;271;158	ENSP00000356123:F271L;ENSP00000356124:F271L;ENSP00000442229:F271L;ENSP00000443447:F158L	ENSP00000356123:F271L	F	-	3	2	KLHDC8A	203574292	0.977000	0.34250	1.000000	0.80357	0.614000	0.37383	0.251000	0.18257	0.054000	0.16065	-0.290000	0.09829	TTT			0.502	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090397.1		NM_018203	
WNT9A	7483	mdanderson.org	37	1	228112986	228112986	+	Silent	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:228112986G>A	ENST00000272164.5	-	2	340	c.330C>T	c.(328-330)taC>taT	p.Y110Y		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	110					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				GGCTGGCCCGGTAGCGGCCCT	0.672																																					p.Y110Y													.	.			0			c.C330T												8.0	8.0	8.0					1																	228112986		2154	4230	6384	SO:0001819	synonymous_variant	7483	exon2			GGCCCGGTAGCGG	AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.330C>T	1.37:g.228112986G>A			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_003395	9	0.00	0	A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Silent	SNP	ENST00000272164.5	37	CCDS31045.1																																																																																					0.672	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091646.1		NM_003395	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235904732	235904732	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr1:235904732G>A	ENST00000389794.3	-	31	8522	c.8348C>T	c.(8347-8349)cCa>cTa	p.P2783L	LYST_ENST00000389793.2_Missense_Mutation_p.P2783L			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2783					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTGTAGGGATGGGCTGAGACA	0.368																																					p.P2783L													.	.			0			c.C8348T												186.0	171.0	176.0					1																	235904732		2203	4300	6503	SO:0001583	missense	1130	exon31			AGGGATGGGCTGA	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8348C>T	1.37:g.235904732G>A	ENSP00000374444:p.Pro2783Leu		Somatic	90	0	0		WXS	Illumina HiSeq	.	94	0.32	30	NM_000081	0		0	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357198	0.41801	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.64260	-0.09;-0.09	5.26	3.31	0.37934	.	0.154593	0.64402	D	0.000015	T	0.59376	0.2189	M	0.70595	2.14	0.80722	D	1	B	0.14012	0.009	B	0.15484	0.013	T	0.61893	-0.6969	10	0.72032	D	0.01	.	10.3315	0.43825	0.0718:0.0:0.795:0.1332	.	2783	Q99698	LYST_HUMAN	L	2783	ENSP00000374444:P2783L;ENSP00000374443:P2783L	ENSP00000374443:P2783L	P	-	2	0	LYST	233971355	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	4.659000	0.61504	1.188000	0.43014	0.479000	0.44913	CCA			0.368	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097533.5			
AKR1B10P1	340888	bcgsc.ca	37	10	69510569	69510586	+	IGR	DEL	AAATATAAACCAGTGACT	AAATATAAACCAGTGACT	-	rs559819086		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	AAATATAAACCAGTGACT	AAATATAAACCAGTGACT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr10:69510569_69510586delAAATATAAACCAGTGACT								CTNNA3 (54642 upstream) : DNAJC12 (45840 downstream)																							ACCTGGACTGAAATATAAACCAGTGACTAACCAGGTTG	0.523																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGACTGAAATATA																													10.37:g.69510569_69510586delAAATATAAACCAGTGACT			Somatic	96	0	0		WXS	Illumina HiSeq	Phase_1	97	0.31	30	.	0		0		RNA	DEL		37																																																																																					0	0.523										
ANKRD2	26287	mdanderson.org	37	10	99337614	99337614	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr10:99337614G>T	ENST00000307518.5	+	2	493	c.226G>T	c.(226-228)Gag>Tag	p.E76*	ANKRD2_ENST00000455090.1_Nonsense_Mutation_p.E49*|ANKRD2_ENST00000370655.1_Nonsense_Mutation_p.E49*|ANKRD2_ENST00000298808.5_Nonsense_Mutation_p.E76*			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	76	May mediate interaction with PML, p53/TP53 and YBX1.				muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|euchromatin (GO:0000791)|I band (GO:0031674)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	protein kinase B binding (GO:0043422)|structural constituent of muscle (GO:0008307)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		GCTGGAGGATGAGAAGCACCA	0.612																																					p.E76X													ANKRD2,NS,carcinoma,-1,1	ANKRD2	-1	1	0			c.G226T												52.0	40.0	44.0					10																	99337614		2199	4290	6489	SO:0001587	stop_gained	26287	exon2			GAGGATGAGAAGC	AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887		"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734				10873377, 15136035, 15677738	Standard	NM_001129981		Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000307518.5:c.226G>T	10.37:g.99337614G>T	ENSP00000306163:p.Glu76*		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_020349	1	0.00	0	Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	Nonsense_Mutation	SNP	ENST00000307518.5	37	CCDS7466.1	.	.	.	.	.	.	.	.	.	.	G	38	6.857282	0.97889	.	.	ENSG00000165887	ENST00000307518;ENST00000298808;ENST00000370655;ENST00000455090	.	.	.	4.65	4.65	0.58169	.	0.082483	0.50627	D	0.000101	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-39.2181	15.479	0.75508	0.0:0.0:1.0:0.0	.	.	.	.	X	76;76;49;49	.	ENSP00000298808:E76X	E	+	1	0	ANKRD2	99327604	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.145000	0.64839	2.406000	0.81754	0.561000	0.74099	GAG			0.612	ANKRD2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
MUC2	4583	mdanderson.org	37	11	1092920	1092920	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr11:1092920C>A	ENST00000441003.2	+	30	4766	c.4739C>A	c.(4738-4740)aCc>aAc	p.T1580N	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1581N	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ggcacacagaccccaacatcg	0.632																																					p.T1580N													.	.			0			c.C4739A												74.0	113.0	100.0					11																	1092920		1924	3573	5497	SO:0001583	missense	4583	exon30			CACAGACCCCAAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4739C>A	11.37:g.1092920C>A	ENSP00000415183:p.Thr1580Asn		Somatic	32	0.09375	3		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.897	-0.228278	0.06022	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15952	2.38;2.53	1.75	-3.51	0.04696	.	7739.210000	0.00597	U	0.000365	T	0.08492	0.0211	.	.	.	0.09310	N	1	B	0.28026	0.198	B	0.17098	0.017	T	0.10776	-1.0615	9	0.27082	T	0.32	.	2.0197	0.03506	0.1703:0.3607:0.3305:0.1386	.	1580	E7EUV1	.	N	1580;1581	ENSP00000415183:T1580N;ENSP00000351956:T1581N	ENSP00000351956:T1581N	T	+	2	0	MUC2	1082920	0.001000	0.12720	0.000000	0.03702	0.071000	0.16799	1.304000	0.33482	-1.223000	0.02584	0.121000	0.15741	ACC			0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
MRVI1	10335	mdanderson.org	37	11	10597927	10597927	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr11:10597927G>T	ENST00000436272.1	-	20	2688	c.2610C>A	c.(2608-2610)gaC>gaA	p.D870E	MRVI1_ENST00000541483.1_Missense_Mutation_p.D691E|MRVI1_ENST00000552103.1_Missense_Mutation_p.D806E|MRVI1_ENST00000527509.2_Missense_Mutation_p.D806E|MRVI1_ENST00000558540.1_Missense_Mutation_p.D582E|MRVI1_ENST00000534266.2_Missense_Mutation_p.D582E|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000424001.1_Missense_Mutation_p.D582E|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000421747.1_Missense_Mutation_p.D888E|MRVI1_ENST00000423302.2_Missense_Mutation_p.D897E|MRVI1_ENST00000545852.1_Missense_Mutation_p.D582E|MRVI1_ENST00000531107.1_Missense_Mutation_p.D889E|MRVI1_ENST00000547195.1_Missense_Mutation_p.D806E			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	870					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TCCACCAGGAGTCCCTCTGGG	0.567																																					p.D897E													.	.			0			c.C2691A												68.0	70.0	70.0					11																	10597927		1992	4159	6151	SO:0001583	missense	10335	exon21			CCAGGAGTCCCTC	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.2610C>A	11.37:g.10597927G>T	ENSP00000412229:p.Asp870Glu		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_130385	2	0.00	0	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	37		.	.	.	.	.	.	.	.	.	.	G	20.8	4.044368	0.75732	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46;2.46;2.46;2.46;2.46;2.46	5.82	2.91	0.33838	.	0.190361	0.37053	N	0.002277	T	0.16599	0.0399	L	0.44542	1.39	0.25454	N	0.987972	D;P;D;D	0.57257	0.979;0.906;0.967;0.959	P;P;P;P	0.50405	0.64;0.629;0.629;0.496	T	0.07908	-1.0748	10	0.30854	T	0.27	-13.9624	3.5603	0.07880	0.3255:0.1883:0.4862:0.0	.	691;870;889;888	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	E	888;871;870;806;806;582;582;897;691;889;806	ENSP00000414598:D888E;ENSP00000412229:D870E;ENSP00000448278:D806E;ENSP00000446764:D806E;ENSP00000441971:D582E;ENSP00000401205:D582E;ENSP00000412130:D897E;ENSP00000437784:D691E;ENSP00000432436:D889E;ENSP00000432067:D806E	ENSP00000307885:D871E	D	-	3	2	MRVI1	10554503	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.987000	0.40687	0.785000	0.33685	0.655000	0.94253	GAC			0.567	MRVI1-203	KNOWN	basic	protein_coding	protein_coding				NM_001098579	
SOX6	55553	mdanderson.org	37	11	16068174	16068174	+	Silent	SNP	C	C	T	rs373068695		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr11:16068174C>T	ENST00000352083.6	-	12	1586	c.1509G>A	c.(1507-1509)gcG>gcA	p.A503A	SOX6_ENST00000316399.6_Silent_p.A503A|SOX6_ENST00000396356.3_Silent_p.A503A|SOX6_ENST00000527619.1_Silent_p.A479A|SOX6_ENST00000528429.1_Silent_p.A503A|SOX6_ENST00000528252.1_Silent_p.A476A			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	503					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						GCATCTTCCGCGCCTCCTGAA	0.493																																					p.A516A													SOX6_ENST00000527619,NS,lymphoid_neoplasm,-1,2	SOX6_ENST00000527619	-1	2	0			c.G1548A							C	,,,	0,4400		0,0,2200	116.0	103.0	108.0		1428,1548,1437,1509	-1.9	1.0	11		108	1,8587	1.2+/-3.3	0,1,4293	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SOX6	NM_001145811.1,NM_001145819.1,NM_017508.2,NM_033326.3	,,,	0,1,6493	TT,TC,CC		0.0116,0.0,0.0077	,,,	476/802,516/842,479/805,503/809	16068174	1,12987	2200	4294	6494	SO:0001819	synonymous_variant	55553	exon12			CTTCCGCGCCTCC	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1509G>A	11.37:g.16068174C>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001145819	0		0	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Silent	SNP	ENST00000352083.6	37																																																																																						0.493	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000386811.1		NM_033326	
ZFP91	80829	mdanderson.org	37	11	58377393	58377393	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr11:58377393G>T	ENST00000316059.6	+	3	632	c.461G>T	c.(460-462)aGt>aTt	p.S154I	ZFP91-CNTF_ENST00000389919.4_Missense_Mutation_p.S154I	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	154					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GGCTGGCGTAGTAGTAGGACA	0.483																																					p.S154I													.	.			0			c.G461T												132.0	124.0	126.0					11																	58377393		2201	4295	6496	SO:0001583	missense	80829	exon3			GGCGTAGTAGTAG	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.461G>T	11.37:g.58377393G>T	ENSP00000339030:p.Ser154Ile		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	67	0.06	4	NM_001197051	3	0.00	0	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	ENST00000316059.6	37	CCDS31553.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483122	0.84747	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	T	0.13196	2.61	5.29	5.29	0.74685	.	2.659030	0.01072	N	0.004829	T	0.20861	0.0502	N	0.24115	0.695	0.44117	D	0.996895	D;P	0.54207	0.965;0.94	P;B	0.48089	0.566;0.363	T	0.12811	-1.0533	10	0.62326	D	0.03	-12.1476	15.9669	0.79979	0.0:0.0:1.0:0.0	.	154;154	Q96JP5-2;Q96JP5	.;ZFP91_HUMAN	I	154	ENSP00000339030:S154I	ENSP00000374569:S154I	S	+	2	0	ZFP91	58133969	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.981000	0.70524	2.767000	0.95098	0.655000	0.94253	AGT			0.483	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268674.1		NM_053023	
CEP57	9702	mdanderson.org	37	11	95546250	95546250	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr11:95546250G>T	ENST00000325542.5	+	3	595	c.357G>T	c.(355-357)aaG>aaT	p.K119N	CEP57_ENST00000541150.1_Missense_Mutation_p.K110N|CEP57_ENST00000536587.1_3'UTR|CEP57_ENST00000537677.1_Missense_Mutation_p.K92N|CEP57_ENST00000325486.5_Missense_Mutation_p.K119N|CEP57_ENST00000538658.1_Missense_Mutation_p.K119N	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	119	centrosome localization domain (CLD). {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGAATTCAAAGAATGAGGAAT	0.308									Mosaic Variegated Aneuploidy Syndrome																												p.K119N													.	.			0			c.G357T												45.0	46.0	46.0					11																	95546250		2201	4298	6499	SO:0001583	missense	9702	exon3	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	TTCAAAGAATGAG	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.357G>T	11.37:g.95546250G>T	ENSP00000317902:p.Lys119Asn		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001243777	18	0.00	0	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	37	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276080	0.59649	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000544522;ENST00000541365;ENST00000538658;ENST00000541150	T;T;T;T;D;T;T	0.82803	0.96;0.96;0.96;-1.15;-1.65;0.96;0.96	5.98	2.95	0.34219	.	0.137540	0.51477	D	0.000097	D	0.83755	0.5323	L	0.40543	1.245	0.33372	D	0.573756	D;P;D;D	0.58268	0.977;0.692;0.982;0.977	P;P;P;P	0.59825	0.787;0.549;0.864;0.787	D	0.86926	0.2070	10	0.87932	D	0	-2.3723	10.2469	0.43345	0.288:0.0:0.712:0.0	.	110;119;119;119	F5H5F7;Q86XR8-2;Q86XR8;Q86XR8-3	.;.;CEP57_HUMAN;.	N	92;119;119;110;92;119;110	ENSP00000441392:K92N;ENSP00000317902:K119N;ENSP00000317487:K119N;ENSP00000438065:K110N;ENSP00000445821:K92N;ENSP00000445706:K119N;ENSP00000443436:K110N	ENSP00000317487:K119N	K	+	3	2	CEP57	95185898	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.486000	0.35530	0.756000	0.33013	0.591000	0.81541	AAG			0.308	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395983.1		NM_014679	
HMBS	3145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118958997	118958997	+	Silent	SNP	C	C	T	rs531691068		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr11:118958997C>T	ENST00000278715.3	+	2	217	c.66C>T	c.(64-66)cgC>cgT	p.R22R	HMBS_ENST00000442944.2_Silent_p.R5R|HMBS_ENST00000543090.1_Intron|HMBS_ENST00000537841.1_Silent_p.R5R|HMBS_ENST00000392841.1_Silent_p.R5R|HMBS_ENST00000542729.1_Silent_p.R5R|HMBS_ENST00000544387.1_Silent_p.R22R	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	22			R -> C (in AIP). {ECO:0000269|PubMed:10453740, ECO:0000269|PubMed:9463797}.		heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		GAGTGATTCGCGTGGGTACCC	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19372	0.0		0.0	False		,,,				2504	0.0				p.R22R													HMBS,NS,carcinoma,+2,1	HMBS	2	1	0			c.C66T	GRCh37	CS962736	HMBS	S								98.0	106.0	103.0					11																	118958997		2200	4295	6495	SO:0001819	synonymous_variant	3145	exon2			GATTCGCGTGGGT	X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.66C>T	11.37:g.118958997C>T			Somatic	68	0	0		WXS	Illumina HiSeq	.	63	0.21	13	NM_000190	41	0.44	18	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Silent	SNP	ENST00000278715.3	37	CCDS8409.1																																																																																					0.527	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399188.1		NM_000190	
USP5	8078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6965261	6965261	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr12:6965261C>T	ENST00000229268.8	+	4	437	c.385C>T	c.(385-387)Ctg>Ttg	p.L129L	USP5_ENST00000389231.5_Silent_p.L129L	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	129					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						GCCAGATTACCTGGAGATTGC	0.507																																					p.L129L													.	.			0			c.C385T												162.0	165.0	164.0					12																	6965261		2203	4300	6503	SO:0001819	synonymous_variant	8078	exon4			GATTACCTGGAGA	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.385C>T	12.37:g.6965261C>T			Somatic	100	0	0		WXS	Illumina HiSeq	.	263	0.14	38	NM_003481	115	0.16	18	D3DUS7|D3DUS8|Q96J22	Silent	SNP	ENST00000229268.8	37	CCDS41743.1																																																																																					0.507	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402982.1			
KRT6A	3853	broad.mit.edu	37	12	52883755	52883755	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr12:52883755C>G	ENST00000330722.6	-	6	1243	c.1175G>C	c.(1174-1176)aGa>aCa	p.R392T		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	392	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GATCTCAGATCTCAGCCTCTG	0.532																																					p.R392T													.	KRT6A	89		0			c.G1175C												135.0	108.0	117.0					12																	52883755		2203	4300	6503	SO:0001583	missense	3853	exon6			TCAGATCTCAGCC	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1175G>C	12.37:g.52883755C>G	ENSP00000369317:p.Arg392Thr		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	220	0.03	7	NM_005554	0		0	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	c	20.2	3.943559	0.73672	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.88201	-2.35	5.3	5.3	0.74995	Filament (1);	0.000000	0.64402	D	0.000007	D	0.91523	0.7323	L	0.50919	1.6	0.31008	N	0.719581	D	0.76494	0.999	D	0.76575	0.988	D	0.88326	0.2965	10	0.27785	T	0.31	.	12.6686	0.56855	0.0:0.924:0.0:0.0759	.	392	P02538	K2C6A_HUMAN	T	392;348	ENSP00000369317:R392T	ENSP00000369317:R392T	R	-	2	0	KRT6A	51170022	0.000000	0.05858	0.998000	0.56505	0.982000	0.71751	0.546000	0.23284	2.659000	0.90383	0.561000	0.74099	AGA			0.532	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404978.2		NM_005554	
KRT6A	3853	broad.mit.edu	37	12	52886666	52886666	+	Missense_Mutation	SNP	C	C	T	rs548869463	byFrequency	TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr12:52886666C>T	ENST00000330722.6	-	1	375	c.307G>A	c.(307-309)Ggt>Agt	p.G103S		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	103	Head.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCTCCACCACCGAAACCAAAT	0.652													C|||	2	0.000399361	0.0	0.0	5008	,	,		14422	0.002		0.0	False		,,,				2504	0.0				p.G103S													.	KRT6A	89		0			c.G307A												19.0	23.0	21.0					12																	52886666		2188	4245	6433	SO:0001583	missense	3853	exon1			CACCACCGAAACC	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.307G>A	12.37:g.52886666C>T	ENSP00000369317:p.Gly103Ser		Somatic	250	0	0		WXS	Illumina HiSeq	Phase_I	352	0.12	41	NM_005554	0		0	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.295569	0.23564	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.93247	-3.19	4.3	3.4	0.38934	.	0.127872	0.36409	N	0.002611	D	0.85522	0.5716	L	0.43923	1.385	0.37165	D	0.902769	P	0.45957	0.869	B	0.27380	0.079	D	0.84536	0.0636	10	0.21014	T	0.42	.	11.3144	0.49383	0.0:0.912:0.0:0.088	.	103	P02538	K2C6A_HUMAN	S	103;59	ENSP00000369317:G103S	ENSP00000369317:G103S	G	-	1	0	KRT6A	51172933	0.663000	0.27448	0.023000	0.16930	0.046000	0.14306	3.172000	0.50832	1.116000	0.41820	0.549000	0.68633	GGT			0.652	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404978.2		NM_005554	
NCOR2	9612	broad.mit.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2	475	11	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A												9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			Somatic	41	0.0487804878	2		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_006312	8	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
NCOR2	9612	mdanderson.org	37	12	124887102	124887102	+	Silent	SNP	C	C	T	rs7488825		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr12:124887102C>T	ENST00000405201.1	-	14	1488	c.1488G>A	c.(1486-1488)caG>caA	p.Q496Q	NCOR2_ENST00000397355.1_Silent_p.Q496Q|NCOR2_ENST00000404621.1_Silent_p.Q495Q|NCOR2_ENST00000356219.3_Silent_p.Q496Q|NCOR2_ENST00000404121.2_Silent_p.Q66Q|NCOR2_ENST00000429285.2_Silent_p.Q495Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	496	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgttgttgctgctgctgTC	0.627																																					p.Q496Q													.	.			0			c.G1488A												9.0	10.0	9.0					12																	124887102		2049	4171	6220	SO:0001819	synonymous_variant	9612	exon16			TTGTTGCTGCTGC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1488G>A	12.37:g.124887102C>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_006312	7	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.627	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
LOC101927592	101927592	broad.mit.edu	37	12	127423596	127423597	+	lincRNA	DEL	TG	TG	-	rs376186206|rs533478047		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr12:127423596_127423597delTG	ENST00000512624.2	-	0	685																											tgtatgtgtttgtgtgtgtgtg	0.356																																					.													.	.			0			.																																											0	.			TGTGTTTGTGTGT																													12.37:g.127423606_127423607delTG			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	DEL	ENST00000512624.2	37																																																																																						0.356	RP11-575F12.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000399788.1			
SLITRK1	114798	broad.mit.edu	37	13	84455509	84455509	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr13:84455509T>C	ENST00000377084.2	-	1	1019	c.134A>G	c.(133-135)aAg>aGg	p.K45R		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	45	LRRNT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.K45fs*64(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TGTGAAGCCCTTTTTTTCACA	0.463																																					p.K45R													.	SLITRK1	196		1	Deletion - Frameshift(1)	large_intestine(1)	c.A134G												90.0	89.0	89.0					13																	84455509		2203	4300	6503	SO:0001583	missense	114798	exon1			AAGCCCTTTTTTT	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.134A>G	13.37:g.84455509T>C	ENSP00000366288:p.Lys45Arg		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	105	0.04	4	NM_052910	0		0	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	T	3.734	-0.054985	0.07362	.	.	ENSG00000178235	ENST00000377084	T	0.51817	0.69	4.59	4.59	0.56863	.	0.103397	0.64402	D	0.000003	T	0.26810	0.0656	N	0.10809	0.05	0.41694	D	0.989363	B	0.09022	0.002	B	0.16722	0.016	T	0.09997	-1.0649	10	0.09338	T	0.73	-14.5951	13.2304	0.59941	0.0:0.0:0.0:1.0	.	45	Q96PX8	SLIK1_HUMAN	R	45	ENSP00000366288:K45R	ENSP00000366288:K45R	K	-	2	0	SLITRK1	83353510	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.889000	0.48601	2.050000	0.60909	0.459000	0.35465	AAG			0.463	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045396.1		NM_052910	
SRP54-AS1	100506157	broad.mit.edu	37	14	35409700	35409701	+	RNA	INS	-	-	T	rs528632775|rs712315	byFrequency	TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr14:35409700_35409701insT	ENST00000556355.1	-	0	257				RP11-85K15.2_ENST00000555015.1_RNA																							GATTAAAAAAAATTTTTTTTTC	0.396																																					.													.	.			0			.																																											0	.			AAAAAAAATTTTT																													14.37:g.35409700_35409701insT			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	INS	ENST00000556355.1	37																																																																																						0.396	RP11-85K15.2-004	KNOWN	basic	antisense	processed_transcript		OTTHUMT00000410682.2			
MEGF11	84465	broad.mit.edu	37	15	66262977	66262977	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr15:66262977G>T	ENST00000409699.2	-	8	985	c.813C>A	c.(811-813)tgC>tgA	p.C271*	MEGF11_ENST00000288745.3_Nonsense_Mutation_p.C196*|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000395625.2_Nonsense_Mutation_p.C196*|MEGF11_ENST00000422354.1_Nonsense_Mutation_p.C271*|MEGF11_ENST00000360698.4_Nonsense_Mutation_p.C271*			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	271	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						AATCCTGGCTGCAGTTCTGGC	0.557																																					p.C271X													.	MEGF11	70		0			c.C813A												120.0	84.0	96.0					15																	66262977		2201	4299	6500	SO:0001587	stop_gained	84465	exon8			CTGGCTGCAGTTC	AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.813C>A	15.37:g.66262977G>T	ENSP00000386908:p.Cys271*		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	115	0.03	4	NM_032445	0		0	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Nonsense_Mutation	SNP	ENST00000409699.2	37	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	G	39	7.458728	0.98296	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698	.	.	.	4.73	1.71	0.24356	.	0.000000	0.44285	U	0.000470	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.8261	0.35057	0.2563:0.0:0.7437:0.0	.	.	.	.	X	271;196;271;196;271	.	ENSP00000288745:C196X	C	-	3	2	MEGF11	64050031	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.089000	0.50183	0.575000	0.29434	0.462000	0.41574	TGC			0.557	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000329307.2		NM_032445	
CLK3	1198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74914482	74914482	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr15:74914482C>T	ENST00000395066.3	+	4	1296	c.835C>T	c.(835-837)Cgc>Tgc	p.R279C	CLK3_ENST00000348245.3_Intron|CLK3_ENST00000345005.4_Missense_Mutation_p.R131C|CLK3_ENST00000352989.5_Missense_Mutation_p.R131C	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	279					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						GAGCAGTAAGCGCAGCAGCCG	0.567																																					p.R279C	Ovarian(133;694 1754 28950 29027 31859)												.	.			0			c.C835T												145.0	120.0	128.0					15																	74914482		2197	4296	6493	SO:0001583	missense	1198	exon4			AGTAAGCGCAGCA	L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.835C>T	15.37:g.74914482C>T	ENSP00000378505:p.Arg279Cys		Somatic	95	0	0		WXS	Illumina HiSeq	.	84	0.21	18	NM_001130028	38	0.16	6	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Missense_Mutation	SNP	ENST00000395066.3	37	CCDS45304.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.764297	0.49574	.	.	ENSG00000179335	ENST00000345005;ENST00000395066;ENST00000454830;ENST00000352989	T;T;T	0.60797	0.65;0.16;0.75	5.46	5.46	0.80206	.	0.210963	0.34959	N	0.003542	T	0.72914	0.3520	L	0.58510	1.815	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;P;P	0.65987	0.94;0.447;0.858	T	0.73222	-0.4051	10	0.52906	T	0.07	.	19.3154	0.94211	0.0:1.0:0.0:0.0	.	279;58;131	P49761;B3KUU7;G5E959	CLK3_HUMAN;.;.	C	131;131;279;131	ENSP00000344112:R131C;ENSP00000378505:R131C;ENSP00000323106:R131C	ENSP00000344112:R131C	R	+	1	0	CLK3	72701535	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.489000	0.45285	2.559000	0.86315	0.655000	0.94253	CGC			0.567	CLK3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000390442.3			
PTX4	390667	mdanderson.org	37	16	1537645	1537645	+	Silent	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr16:1537645G>T	ENST00000447419.2	-	2	493	c.468C>A	c.(466-468)cgC>cgA	p.R156R	PTX4_ENST00000293922.1_Silent_p.R151R|PTX4_ENST00000440447.2_Intron			Q96A99	PTX4_HUMAN	pentraxin 4, long	156						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						GGCCCTCCAGGCGTGCCAGTG	0.741																																					p.R151R													.	.			0			c.C453A												18.0	23.0	22.0					16																	1537645		2190	4271	6461	SO:0001819	synonymous_variant	390667	exon2			CTCCAGGCGTGCC		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.468C>A	16.37:g.1537645G>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001013658	0		0		Silent	SNP	ENST00000447419.2	37																																																																																						0.741	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000432526.1		NM_001013658	
COQ7	10229	mdanderson.org	37	16	19089428	19089428	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr16:19089428G>A	ENST00000321998.5	+	6	668	c.602G>A	c.(601-603)aGc>aAc	p.S201N	COQ7_ENST00000568985.1_Missense_Mutation_p.S201N|COQ7_ENST00000569127.1_Missense_Mutation_p.S178N|COQ7_ENST00000544894.2_Missense_Mutation_p.S163N	NM_016138.4	NP_057222.2	Q99807	COQ7_HUMAN	coenzyme Q7 homolog, ubiquinone (yeast)	201	2 X approximate tandem repeats.				age-dependent response to oxidative stress (GO:0001306)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|in utero embryonic development (GO:0001701)|mitochondrial ATP synthesis coupled electron transport (GO:0042775)|mitochondrion morphogenesis (GO:0070584)|neural tube formation (GO:0001841)|neurogenesis (GO:0022008)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(3)|prostate(1)|skin(3)|urinary_tract(1)	10						GTCCTGAAGAGCATTATCCAG	0.403																																					p.S201N													.	.			0			c.G602A												104.0	96.0	99.0					16																	19089428		2197	4300	6497	SO:0001583	missense	10229	exon6			TGAAGAGCATTAT	U81276	CCDS10574.1, CCDS53993.1	16p12.3	2008-05-14	2001-11-28		ENSG00000167186	ENSG00000167186			2244	protein-coding gene	gene with protein product		601683	"""coenzyme Q, 7 (rat, yeast) homolog"""			9020081, 10373325	Standard	NM_016138		Approved	CLK-1, CAT5	uc002dfr.3	Q99807	OTTHUMG00000131455	ENST00000321998.5:c.602G>A	16.37:g.19089428G>A	ENSP00000322316:p.Ser201Asn		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_016138	53	0.00	0	B2RDA9|Q9BTT7|Q9H0T5|Q9UEW5|Q9UNR5	Missense_Mutation	SNP	ENST00000321998.5	37	CCDS10574.1	.	.	.	.	.	.	.	.	.	.	G	8.299	0.819386	0.16607	.	.	ENSG00000167186	ENST00000321998;ENST00000544894	T;T	0.42131	0.98;0.98	5.43	-4.8	0.03190	.	0.774373	0.13294	N	0.398817	T	0.11452	0.0279	N	0.01352	-0.895	0.18873	N	0.999988	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.36065	-0.9763	10	0.11485	T	0.65	-13.1482	8.4213	0.32703	0.5204:0.2872:0.1924:0.0	.	178;201	Q49A71;Q99807	.;COQ7_HUMAN	N	201;163	ENSP00000322316:S201N;ENSP00000442923:S163N	ENSP00000322316:S201N	S	+	2	0	COQ7	18996929	0.003000	0.15002	0.003000	0.11579	0.112000	0.19704	-0.132000	0.10467	-0.941000	0.03700	0.655000	0.94253	AGC			0.403	COQ7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254275.3		NM_016138	
ACSM2A	123876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	20471599	20471599	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr16:20471599G>A	ENST00000573854.1	+	2	277	c.163G>A	c.(163-165)Gct>Act	p.A55T	ACSM2A_ENST00000396104.2_Missense_Mutation_p.A55T|ACSM2A_ENST00000417235.2_Intron|ACSM2A_ENST00000536134.1_De_novo_Start_InFrame|ACSM2A_ENST00000219054.6_Missense_Mutation_p.A55T|ACSM2A_ENST00000424070.1_Missense_Mutation_p.A55T|ACSM2A_ENST00000575558.1_Intron|ACSM2A_ENST00000575690.1_Missense_Mutation_p.A55T	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	55					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GGATCACTGGGCTGACATGGA	0.428																																					p.A55T													.	.			0			c.G163A												69.0	63.0	65.0					16																	20471599		2203	4300	6503	SO:0001583	missense	123876	exon3			CACTGGGCTGACA	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.163G>A	16.37:g.20471599G>A	ENSP00000459451:p.Ala55Thr		Somatic	132	0	0		WXS	Illumina HiSeq	.	96	0.29	28	NM_001010845	0		0	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	37	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644952	0.29246	.	.	ENSG00000183747	ENST00000219054;ENST00000424070;ENST00000396104	T;T;T	0.58358	0.34;0.34;0.34	3.95	0.513	0.17000	.	0.000000	0.43919	D	0.000514	T	0.44030	0.1274	L	0.49350	1.555	0.28216	N	0.926732	P	0.49862	0.929	P	0.47528	0.549	T	0.34054	-0.9844	10	0.39692	T	0.17	-13.5212	3.1973	0.06637	0.2269:0.0:0.4751:0.2979	.	55	Q08AH3	ACS2A_HUMAN	T	55	ENSP00000219054:A55T;ENSP00000394904:A55T;ENSP00000379411:A55T	ENSP00000219054:A55T	A	+	1	0	ACSM2A	20379100	0.996000	0.38824	0.599000	0.28851	0.972000	0.66771	1.411000	0.34702	0.271000	0.22005	0.454000	0.30748	GCT			0.428	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436764.1		NM_001010845	
CLEC18B	497190	broad.mit.edu	37	16	74444923	74444923	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr16:74444923C>T	ENST00000339953.5	-	9	1115	c.994G>A	c.(994-996)Ggg>Agg	p.G332R		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	332	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.G332R(6)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GCCAGCACCCCGCCTTTCCTC	0.612																																					p.G332R													CLEC18B,NS,carcinoma,0,6	CLEC18B	45	6	6	Substitution - Missense(6)	kidney(6)	c.G994A												61.0	70.0	67.0					16																	74444923		2189	4246	6435	SO:0001583	missense	497190	exon9			GCACCCCGCCTTT	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.994G>A	16.37:g.74444923C>T	ENSP00000341051:p.Gly332Arg		Somatic	301	0.0033222591	1		WXS	Illumina HiSeq	Phase_I	247	0.02	4	NM_001011880	3	0.00	0	B4DF90	Missense_Mutation	SNP	ENST00000339953.5	37	CCDS32484.1	.	.	.	.	.	.	.	.	.	.	N	16.90	3.249709	0.59212	.	.	ENSG00000140839	ENST00000429489;ENST00000339953	T	0.25749	1.78	3.14	3.14	0.36123	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.131736	0.49916	D	0.000130	T	0.59770	0.2218	H	0.95884	3.735	0.45354	D	0.998344	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.69716	-0.5070	10	0.87932	D	0	.	9.6467	0.39872	0.0:1.0:0.0:0.0	.	332;332	C9JSV1;Q6UXF7	.;CL18B_HUMAN	R	332	ENSP00000341051:G332R	ENSP00000341051:G332R	G	-	1	0	CLEC18B	73002424	0.998000	0.40836	0.928000	0.36995	0.695000	0.40330	6.316000	0.72857	1.602000	0.50124	0.425000	0.28330	GGG			0.612	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434697.1		NM_001011880	
PIEZO1	9780	mdanderson.org	37	16	88780056	88780056	+	IGR	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr16:88780056G>T	ENST00000301015.9	-	0	8072				CTU2_ENST00000453996.2_Splice_Site_p.G292V|CTU2_ENST00000378384.3_Splice_Site_p.G205V|CTU2_ENST00000567949.1_Splice_Site_p.G363V|MIR4722_ENST00000578292.1_RNA|CTU2_ENST00000312060.5_Splice_Site_p.G292V	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CTCCCGCAGGGCTTCTCGGAT	0.662																																					p.G292V													.	.			0			c.G875T												54.0	55.0	54.0					16																	88780056		2191	4291	6482	SO:0001628	intergenic_variant	348180	exon9			CGCAGGGCTTCTC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776		16.37:g.88780056G>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001012759	83	0.00	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035700	0.75617	.	.	ENSG00000174177	ENST00000378384;ENST00000312060;ENST00000453996	T;T;T	0.42131	0.98;0.98;0.98	4.66	3.66	0.41972	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.60327	0.2260	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.998;1.0	T	0.63310	-0.6666	10	0.62326	D	0.03	.	13.562	0.61795	0.0:0.158:0.8419:0.0	.	205;292;292	Q2VPK5-3;Q2VPK5-5;Q2VPK5	.;.;CTU2_HUMAN	V	205;292;292	ENSP00000367635:G205V;ENSP00000308617:G292V;ENSP00000388320:G292V	ENSP00000308617:G292V	G	+	2	0	CTU2	87307557	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.813000	0.75231	1.027000	0.39758	0.655000	0.94253	GGC			0.662	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000345699.4		NM_014745	
COX10	1352	hgsc.bcm.edu;broad.mit.edu	37	17	13972737	13972737	+	5'Flank	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr17:13972737C>T	ENST00000261643.3	+	0	0				COX10-AS1_ENST00000602539.1_RNA|COX10_ENST00000536205.1_5'Flank|COX10_ENST00000537334.1_5'Flank|COX10-AS1_ENST00000602743.1_RNA|COX10-AS1_ENST00000449363.1_RNA|COX10_ENST00000429152.2_5'Flank	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)						aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TGTCAGCCCGCCACACTCCAG	0.672																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	100874058	.			AGCCCGCCACACT	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814		17.37:g.13972737C>T	Exception_encountered		Somatic	9	0	0		WXS	Illumina HiSeq	.	18	0.22	4	.	1	0.00	0	B2R6U5|B4DJ50|O15334|Q969F7	RNA	SNP	ENST00000261643.3	37	CCDS11166.1																																																																																					0.672	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130003.1		NM_001303	
RP11-271K11.5	0	broad.mit.edu	37	17	29371977	29371978	+	RNA	INS	-	-	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr17:29371977_29371978insA	ENST00000583112.1	-	0	628																		p.?(1)									tcctgtctctgaaaaaaaaaga	0.376																																					.													.	.			1	Unknown(1)	central_nervous_system(1)	.																																											0	.			GTCTCTGAAAAAA																													17.37:g.29371986_29371986dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000583112.1	37																																																																																						0.376	RP11-271K11.5-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000444574.1			
TRIM37	4591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	57126703	57126703	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr17:57126703G>C	ENST00000262294.7	-	15	1625	c.1366C>G	c.(1366-1368)Cca>Gca	p.P456A	TRIM37_ENST00000393066.3_Missense_Mutation_p.P456A|TRIM37_ENST00000393065.2_Missense_Mutation_p.P422A|TRIM37_ENST00000376149.3_Missense_Mutation_p.P334A	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	456					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TGGTTATCTGGTGGTGACAAA	0.448									Mulibrey Nanism																												p.P456A													.	.			0			c.C1366G												123.0	106.0	112.0					17																	57126703		2203	4300	6503	SO:0001583	missense	4591	exon15	Familial Cancer Database	Perheentupa syndrome	TATCTGGTGGTGA	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.1366C>G	17.37:g.57126703G>C	ENSP00000262294:p.Pro456Ala		Somatic	115	0	0		WXS	Illumina HiSeq	.	116	0.20	23	NM_015294	13	0.54	7	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	CCDS32694.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051217	0.55218	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.69435	1.33;1.33;-0.4;0.93	5.37	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.59362	0.2188	L	0.32530	0.975	0.54753	D	0.999986	B;B;B	0.33694	0.421;0.421;0.018	B;B;B	0.37601	0.183;0.254;0.013	T	0.63019	-0.6730	10	0.72032	D	0.01	-21.162	13.7855	0.63108	0.0738:0.0:0.9262:0.0	.	422;334;456	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	A	456;456;334;422	ENSP00000376785:P456A;ENSP00000262294:P456A;ENSP00000365319:P334A;ENSP00000376784:P422A	ENSP00000262294:P456A	P	-	1	0	TRIM37	54481485	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.864000	0.87037	1.265000	0.44215	0.561000	0.74099	CCA			0.448	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445930.1		NM_015294	
ABCA7	10347	mdanderson.org	37	19	1047263	1047263	+	Silent	SNP	C	C	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:1047263C>A	ENST00000263094.6	+	15	2184	c.1953C>A	c.(1951-1953)tcC>tcA	p.S651S	ABCA7_ENST00000533574.1_3'UTR|ABCA7_ENST00000435683.2_Silent_p.S513S|ABCA7_ENST00000433129.1_Silent_p.S651S	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	651					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTCTTCTCCCGCGCCAACC	0.687																																					p.S651S													.	.			0			c.C1953A												32.0	29.0	30.0					19																	1047263		2199	4299	6498	SO:0001819	synonymous_variant	10347	exon15			CTTCTCCCGCGCC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1953C>A	19.37:g.1047263C>A			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_019112	3	0.00	0	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																					0.687	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000394993.1		NM_019112	
C19orf57	79173	mdanderson.org	37	19	13996848	13996848	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:13996848C>T	ENST00000586783.1	-	6	1688	c.1689G>A	c.(1687-1689)aaG>aaA	p.K563K	C19orf57_ENST00000454313.1_Silent_p.K563K|C19orf57_ENST00000591586.1_Silent_p.K138K|C19orf57_ENST00000346736.2_Silent_p.K563K			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	563					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			AAGGGCCCGGCTTGTTCCCCG	0.632																																					p.K563K													.	.			0			c.G1689A												37.0	39.0	38.0					19																	13996848		2203	4300	6503	SO:0001819	synonymous_variant	79173	exon7			GCCCGGCTTGTTC	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.1689G>A	19.37:g.13996848C>T			Somatic	44	0.0227272727	1		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_024323	3	0.00	0	Q13411|Q8N825|Q96D63|Q9BU49	Silent	SNP	ENST00000586783.1	37																																																																																						0.632	C19orf57-003	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000457947.1		NM_024323	
ANKLE1	126549	broad.mit.edu	37	19	17397500	17397501	+	3'UTR	DEL	TT	TT	-	rs71180380|rs563327402|rs534658778|rs1465582	byFrequency	TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:17397500_17397501delTT	ENST00000394458.3	+	0	2263_2264				ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000594072.1_3'UTR|ANKLE1_ENST00000598347.1_Frame_Shift_Del_p.L591fs	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtttgtgtgtgtg	0.53																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTTTGTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TT>-	19.37:g.17397500_17397501delTT			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	12	0.83	10	.	1	0.00	0	A8VU82|Q8N8J8	Frame_Shift_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.530	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
NDUFA13	51079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19638552	19638552	+	Silent	SNP	C	C	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:19638552C>A	ENST00000507754.4	+	4	772	c.288C>A	c.(286-288)atC>atA	p.I96I	YJEFN3_ENST00000436027.5_5'Flank|NDUFA13_ENST00000252576.5_Silent_p.I179I|NDUFA13_ENST00000428459.2_Silent_p.I96I|NDUFA13_ENST00000512771.3_Silent_p.I96I|YJEFN3_ENST00000608404.1_Silent_p.I96I|YJEFN3_ENST00000514277.4_5'Flank|CTC-260F20.3_ENST00000555938.1_Silent_p.I96I|CTC-260F20.3_ENST00000586674.1_3'UTR|NDUFA13_ENST00000503283.1_Silent_p.I96I			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13	96					apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						AGGAGGCCATCATCATGAAGG	0.687																																					p.I96I													.	.			0			c.C288A												34.0	29.0	31.0					19																	19638552		2144	4186	6330	SO:0001819	synonymous_variant	51079	exon4			GGCCATCATCATG	AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.288C>A	19.37:g.19638552C>A			Somatic	53	0	0		WXS	Illumina HiSeq	.	67	0.34	23	NM_015965	1380	0.39	532	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Silent	SNP	ENST00000507754.4	37	CCDS12404.2																																																																																					0.687	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367916.6		NM_015965	
ATP1A3	478	mdanderson.org	37	19	42482471	42482471	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:42482471G>T	ENST00000302102.5	-	13	1788	c.1638C>A	c.(1636-1638)tgC>tgA	p.C546*	ATP1A3_ENST00000602133.1_Nonsense_Mutation_p.C516*|ATP1A3_ENST00000543770.1_Nonsense_Mutation_p.C557*|ATP1A3_ENST00000545399.1_Nonsense_Mutation_p.C559*	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	546					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GGTAATAATGGCAGAAACCTA	0.587																																					p.C559X													.	.			0			c.C1677A												51.0	49.0	50.0					19																	42482471		2203	4299	6502	SO:0001587	stop_gained	478	exon13			ATAATGGCAGAAA		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.1638C>A	19.37:g.42482471G>T	ENSP00000302397:p.Cys546*		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001256214	16	0.00	0	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Nonsense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	38	6.909973	0.97928	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	.	.	.	4.34	3.3	0.37823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2164	0.43170	0.0985:0.0:0.9015:0.0	.	.	.	.	X	546;546;559;516;290;557	.	ENSP00000302397:C546X	C	-	3	2	ATP1A3	47174311	1.000000	0.71417	1.000000	0.80357	0.246000	0.25737	2.746000	0.47467	1.180000	0.42898	0.561000	0.74099	TGC			0.587	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000268107.1		NM_152296	
ZNF526	116115	mdanderson.org	37	19	42729994	42729994	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:42729994G>T	ENST00000301215.3	+	3	1664	c.1439G>T	c.(1438-1440)gGc>gTc	p.G480V		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				TGTGGCAAGGGCTTCAAGAAG	0.627																																					p.G480V													.	.			0			c.G1439T												76.0	79.0	78.0					19																	42729994		2203	4300	6503	SO:0001583	missense	116115	exon3			GCAAGGGCTTCAA	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1439G>T	19.37:g.42729994G>T	ENSP00000301215:p.Gly480Val		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_133444	10	0.00	0	B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	ENST00000301215.3	37	CCDS12598.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914060	0.33815	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.07216	3.21	4.97	0.119	0.14685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.392825	0.24547	N	0.037594	T	0.04634	0.0126	N	0.13327	0.33	0.21499	N	0.999663	B	0.24823	0.112	B	0.19148	0.024	T	0.35226	-0.9797	10	0.62326	D	0.03	-13.6997	9.0722	0.36500	0.0733:0.0:0.2862:0.6405	.	480	Q8TF50	ZN526_HUMAN	V	336;480	ENSP00000301215:G480V	ENSP00000301215:G480V	G	+	2	0	ZNF526	47421834	0.000000	0.05858	0.576000	0.28549	0.998000	0.95712	-0.506000	0.06359	0.065000	0.16485	0.650000	0.86243	GGC			0.627	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463681.2		XM_057401	
BCL3	602	bcgsc.ca	37	19	45262002	45262002	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:45262002A>G	ENST00000164227.5	+	8	1325	c.1081A>G	c.(1081-1083)Aag>Gag	p.K361E		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	361					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				CCTGAGGGGGAAGGCCACCCG	0.642			T	IGH@	CLL																																p.K361E				Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	.	BCL3	28		0			c.A1081G												42.0	38.0	40.0					19																	45262002		2198	4297	6495	SO:0001583	missense	602	exon8			AGGGGGAAGGCCA	M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.1081A>G	19.37:g.45262002A>G	ENSP00000164227:p.Lys361Glu		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_1	26	0.15	4	NM_005178	30	0.00	0		Missense_Mutation	SNP	ENST00000164227.5	37	CCDS12642.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.2|24.2	4.501025|4.501025	0.85176|0.85176	.|.	.|.	ENSG00000069399|ENSG00000069399	ENST00000444487|ENST00000164227	.|T	.|0.38401	.|1.14	4.15|4.15	4.15|4.15	0.48705|0.48705	.|.	.|1.386830	.|0.05316	.|N	.|0.525668	T|T	0.42899|0.42899	0.1223|0.1223	L|L	0.33245|0.33245	0.995|0.995	0.30305|0.30305	N|N	0.789045|0.789045	.|D	.|0.61697	.|0.99	.|P	.|0.51742	.|0.678	T|T	0.36792|0.36792	-0.9733|-0.9733	5|10	.|0.87932	.|D	.|0	-22.2159|-22.2159	11.1034|11.1034	0.48188|0.48188	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|361	.|P20749	.|BCL3_HUMAN	G|E	264|361	.|ENSP00000164227:K361E	.|ENSP00000164227:K361E	E|K	+|+	2|1	0|0	BCL3|BCL3	49953842|49953842	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.981000|0.981000	0.71138|0.71138	5.440000|5.440000	0.66563|0.66563	1.504000|1.504000	0.48704|0.48704	0.402000|0.402000	0.26972|0.26972	GAA|AAG			0.642	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322976.1		NM_005178	
ZC3H4	23211	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	47570041	47570041	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:47570041C>T	ENST00000253048.5	-	15	3521	c.3484G>A	c.(3484-3486)Gag>Aag	p.E1162K	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1162							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GCAGCCGGCTCTGTGGCTTTG	0.687																																					p.E1162K													.	ZC3H4	96		0			c.G3484A												11.0	15.0	14.0					19																	47570041		2027	4172	6199	SO:0001583	missense	23211	exon15			CCGGCTCTGTGGC	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3484G>A	19.37:g.47570041C>T	ENSP00000253048:p.Glu1162Lys		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	22	0.18	4	NM_015168	12	0.50	6	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.367646	0.24771	.	.	ENSG00000130749	ENST00000253048	T	0.19938	2.11	5.43	5.43	0.79202	.	0.277908	0.38548	N	0.001654	T	0.33789	0.0875	L	0.61218	1.895	0.33142	D	0.544494	D	0.58620	0.983	P	0.49301	0.606	T	0.45041	-0.9288	10	0.46703	T	0.11	.	18.0025	0.89201	0.0:1.0:0.0:0.0	.	1162	Q9UPT8	ZC3H4_HUMAN	K	1162	ENSP00000253048:E1162K	ENSP00000253048:E1162K	E	-	1	0	ZC3H4	52261881	0.001000	0.12720	0.512000	0.27736	0.028000	0.11728	0.794000	0.26958	2.541000	0.85698	0.563000	0.77884	GAG			0.687	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466667.1			
LHB	3972	mdanderson.org	37	19	49519472	49519472	+	Silent	SNP	C	C	A	rs377599735		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:49519472C>A	ENST00000221421.2	-	3	278	c.279G>T	c.(277-279)ccG>ccT	p.P93P	CTB-60B18.10_ENST00000600007.1_lincRNA	NM_000894.2	NP_000885.1	P01229	LSHB_HUMAN	luteinizing hormone beta polypeptide	93					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|male gonad development (GO:0008584)|peptide hormone processing (GO:0016486)|progesterone biosynthetic process (GO:0006701)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		CCACACCACGCGGGCAGCCAG	0.682																																					p.P93P													LHB,colon,carcinoma,0,2	LHB	0	2	0			c.G279T												74.0	74.0	74.0					19																	49519472		2203	4300	6503	SO:0001819	synonymous_variant	3972	exon3			ACCACGCGGGCAG		CCDS12748.1	19q13.3	2013-02-26				ENSG00000104826		"""Endogenous ligands"""	6584	protein-coding gene	gene with protein product	"""lutropin, beta chain"", ""interstitial cell stimulating hormone, beta chain"", ""luteinizing hormone beta subunit"""	152780				1191677	Standard	NM_000894		Approved	LSH-B, CGB4, hLHB	uc002plt.3	P01229		ENST00000221421.2:c.279G>T	19.37:g.49519472C>A			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_000894	1	0.00	0	Q9UDI0	Silent	SNP	ENST00000221421.2	37	CCDS12748.1																																																																																					0.682	LHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466246.1		NM_000894	
PPP6R1	22870	mdanderson.org	37	19	55742998	55742998	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:55742998G>T	ENST00000412770.2	-	20	2911	c.2345C>A	c.(2344-2346)gCc>gAc	p.A782D	TMEM86B_ENST00000327042.4_5'Flank|PPP6R1_ENST00000587283.1_Missense_Mutation_p.A782D|AC010327.1_ENST00000581390.1_RNA	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	782	Pro-rich.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						GCCTTCTGTGGCTTCCTGAGG	0.667																																					p.A782D													.	.			0			c.C2345A												25.0	30.0	29.0					19																	55742998		1990	4158	6148	SO:0001583	missense	22870	exon20			TCTGTGGCTTCCT	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.2345C>A	19.37:g.55742998G>T	ENSP00000414202:p.Ala782Asp		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_014931	136	0.00	0	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	37	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688461	0.48097	.	.	ENSG00000105063	ENST00000444538;ENST00000412770	T	0.46819	0.86	4.21	0.93	0.19454	.	0.462856	0.18683	N	0.134114	T	0.38852	0.1056	N	0.19112	0.55	0.20489	N	0.999894	P;D	0.61697	0.948;0.99	P;P	0.55455	0.601;0.776	T	0.16928	-1.0386	10	0.33141	T	0.24	-9.8221	5.9394	0.19184	0.3331:0.0:0.6669:0.0	.	782;144	Q9UPN7;Q96ID3	PP6R1_HUMAN;.	D	297;782	ENSP00000414202:A782D	ENSP00000414202:A782D	A	-	2	0	PPP6R1	60434810	0.000000	0.05858	0.438000	0.26821	0.813000	0.45954	-0.741000	0.04855	0.315000	0.23110	0.561000	0.74099	GCC			0.667	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452663.1		NM_014931	
U2AF2	11338	mdanderson.org	37	19	56173984	56173984	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:56173984G>T	ENST00000308924.4	+	6	643	c.603G>T	c.(601-603)gaG>gaT	p.E201D	U2AF2_ENST00000450554.2_Splice_Site_p.E201D|U2AF2_ENST00000590551.1_Splice_Site_p.E37D|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	201	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CCTTTTTGGAGGTGAGCTGGG	0.577																																					p.E201D													.	.			0			c.G603T												62.0	68.0	66.0					19																	56173984		2203	4300	6503	SO:0001630	splice_region_variant	11338	exon6			TTTGGAGGTGAGC	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.603+1G>T	19.37:g.56173984G>T			Somatic	51	0.0196078431	1		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001012478	271	0.00	0	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	37	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559725	0.86335	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.10192	2.9;2.9	3.97	3.97	0.46021	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.31071	0.0785	M	0.69463	2.115	0.80722	D	1	D;D	0.69078	0.997;0.971	D;P	0.91635	0.999;0.762	T	0.08953	-1.0697	10	0.72032	D	0.01	-36.4381	15.2061	0.73180	0.0:0.0:1.0:0.0	.	201;201	P26368;P26368-2	U2AF2_HUMAN;.	D	201	ENSP00000307863:E201D;ENSP00000388475:E201D	ENSP00000307863:E201D	E	+	3	2	U2AF2	60865796	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.012000	0.93624	1.935000	0.56089	0.460000	0.39030	GAG			0.577	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000453599.1		NM_007279	Missense_Mutation
CHMP2A	27243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	59063125	59063125	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr19:59063125C>A	ENST00000600118.1	-	5	985	c.560G>T	c.(559-561)gGc>gTc	p.G187V	CHMP2A_ENST00000601220.1_Missense_Mutation_p.G187V|CHMP2A_ENST00000312547.2_Missense_Mutation_p.G187V			O43633	CHM2A_HUMAN	charged multivesicular body protein 2A	187	Interaction with VPS4B.				endosomal transport (GO:0016197)|establishment of protein localization (GO:0045184)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	7		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		ACTAAGCGAGCCCCCAGTTGA	0.607																																					p.G187V													.	.			0			c.G560T												51.0	57.0	55.0					19																	59063125		2203	4300	6503	SO:0001583	missense	27243	exon6			AGCGAGCCCCCAG	AF042384	CCDS12986.1	19q13.43	2014-09-04	2011-09-21		ENSG00000130724	ENSG00000130724		"""Charged multivesicular body proteins"""	30216	protein-coding gene	gene with protein product	"""putative breast adenocarcinoma marker (32kD)"", ""VPS2 homolog A (S. cerevisiae)"""	610893	"""chromatin modifying protein 2A"""			15173323, 11559748	Standard	XM_005258746		Approved	BC-2, CHMP2, VPS2, VPS2A	uc002qtk.3	O43633	OTTHUMG00000183547	ENST00000600118.1:c.560G>T	19.37:g.59063125C>A	ENSP00000469240:p.Gly187Val		Somatic	90	0	0		WXS	Illumina HiSeq	.	56	0.30	17	NM_198426	202	0.48	97	B2R4W6|Q3ZTT0	Missense_Mutation	SNP	ENST00000600118.1	37	CCDS12986.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.200869	0.58234	.	.	ENSG00000130724	ENST00000312547	T	0.77489	-1.1	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.64461	0.2600	N	0.14661	0.345	0.80722	D	1	B	0.20368	0.044	B	0.28305	0.088	T	0.58858	-0.7562	10	0.21540	T	0.41	.	15.6104	0.76713	0.0:1.0:0.0:0.0	.	187	O43633	CHM2A_HUMAN	V	187	ENSP00000310440:G187V	ENSP00000310440:G187V	G	-	2	0	CHMP2A	63754937	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	3.787000	0.55439	2.639000	0.89480	0.650000	0.86243	GGC			0.607	CHMP2A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467088.1		NM_014453	
PXDN	7837	hgsc.bcm.edu	37	2	1677521	1677521	+	Silent	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr2:1677521G>T	ENST00000252804.4	-	9	962	c.912C>A	c.(910-912)atC>atA	p.I304I	PXDN_ENST00000483018.1_5'UTR	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	304	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GTGTGTTCTGGATCATCAGGG	0.507																																					p.I304I													.	.			0			c.C912A												160.0	164.0	163.0					2																	1677521		2078	4221	6299	SO:0001819	synonymous_variant	7837	exon9			GTTCTGGATCATC	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.912C>A	2.37:g.1677521G>T			Somatic	128	0	0		WXS	Illumina HiSeq	.	98	0.04	4	NM_012293	13	0.00	0	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	G	9.401	1.078094	0.20227	.	.	ENSG00000130508	ENST00000433670	.	.	.	5.25	0.769	0.18492	.	.	.	.	.	T	0.58308	0.2113	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52555	-0.8560	4	.	.	.	-41.645	10.2604	0.43423	0.3784:0.0:0.6216:0.0	.	.	.	.	Y	300	.	.	S	-	2	0	PXDN	1656528	1.000000	0.71417	0.998000	0.56505	0.809000	0.45718	1.973000	0.40550	0.159000	0.19401	0.561000	0.74099	TCC			0.507	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322505.1		XM_056455	
GGT8P	645367	hgsc.bcm.edu	37	2	91964414	91964414	+	IGR	SNP	C	C	A	rs199937999|rs141248674|rs199560979		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr2:91964414C>A								AC027612.2 (12370 upstream) : SLC9B1P2 (116083 downstream)																							ttctatctatctatatctatc	0.343																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	645367	.			ATCTATCTATATC																													2.37:g.91964414C>A			Somatic	19	0	0		WXS	Illumina HiSeq	.	12	0.33	4	.	0		0		RNA	SNP		37																																																																																					0	0.343										
SH3RF3	344558	mdanderson.org	37	2	109746264	109746264	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr2:109746264C>T	ENST00000309415.6	+	1	268	c.268C>T	c.(268-270)Cac>Tac	p.H90Y	SH3RF3-AS1_ENST00000567491.1_lincRNA	NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	90							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						GTGCTCGCGCCACGAGCTGCG	0.672																																					p.H90Y													.	.			0			c.C268T												7.0	11.0	10.0					2																	109746264		1924	3598	5522	SO:0001583	missense	344558	exon1			TCGCGCCACGAGC	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.268C>T	2.37:g.109746264C>T	ENSP00000309186:p.His90Tyr		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_001099289	1	0.00	0	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37		.	.	.	.	.	.	.	.	.	.	c	11.54	1.669696	0.29693	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	D;D	0.93426	-3.22;-3.22	3.91	3.91	0.45181	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	D	0.93122	0.7810	.	.	.	0.27063	N	0.963508	P	0.48589	0.912	P	0.49887	0.625	D	0.87499	0.2432	8	0.59425	D	0.04	.	10.8507	0.46769	0.1892:0.8108:0.0:0.0	.	90	Q8TEJ3	SH3R3_HUMAN	Y	90	ENSP00000414997:H90Y;ENSP00000309186:H90Y	ENSP00000309186:H90Y	H	+	1	0	SH3RF3	109112696	0.964000	0.33143	0.995000	0.50966	0.087000	0.18053	2.544000	0.45761	1.711000	0.51337	0.457000	0.33378	CAC			0.672	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001099289	
TTN	7273	mdanderson.org	37	2	179442124	179442124	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr2:179442124T>C	ENST00000591111.1	-	274	64239	c.64015A>G	c.(64015-64017)Agt>Ggt	p.S21339G	RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S14107G|TTN_ENST00000342992.6_Missense_Mutation_p.S20412G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S22980G|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S14040G|TTN_ENST00000460472.2_Missense_Mutation_p.S13915G|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21339	Ig-like 113.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGACCAACTTGATTTTGGA	0.403																																					p.S22980G													.	.			0			c.A68938G												108.0	96.0	100.0					2																	179442124		1872	4111	5983	SO:0001583	missense	7273	exon324			ACCAACTTGATTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64015A>G	2.37:g.179442124T>C	ENSP00000465570:p.Ser21339Gly		Somatic	42	0.0238095238	1		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001267550	10	0.00	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	11.83	1.754500	0.31046	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48	5.72	3.37	0.38596	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66208	0.2766	M	0.71206	2.165	0.27310	N	0.957331	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.62258	-0.6892	9	0.87932	D	0	.	5.4501	0.16560	0.0:0.3624:0.0:0.6376	.	13915;14040;14107;21339	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	20412;13915;14107;14040;13913	ENSP00000343764:S20412G;ENSP00000434586:S13915G;ENSP00000340554:S14107G;ENSP00000352154:S14040G	ENSP00000340554:S14107G	S	-	1	0	TTN	179150370	0.978000	0.34361	0.998000	0.56505	0.998000	0.95712	2.972000	0.49256	1.116000	0.41820	0.533000	0.62120	AGT			0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
CLK1	1195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	201721420	201721420	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr2:201721420G>A	ENST00000321356.4	-	9	1177	c.1042C>T	c.(1042-1044)Cct>Tct	p.P348S	CLK1_ENST00000434813.2_Missense_Mutation_p.P390S|CLK1_ENST00000409769.2_Missense_Mutation_p.P171S	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	348	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						ATAACTTCAGGTGCTCTATAA	0.323																																					p.P390S													.	.			0			c.C1168T												131.0	127.0	129.0					2																	201721420		2203	4300	6503	SO:0001583	missense	1195	exon9			CTTCAGGTGCTCT	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.1042C>T	2.37:g.201721420G>A	ENSP00000326830:p.Pro348Ser		Somatic	283	0	0		WXS	Illumina HiSeq	.	254	0.28	72	NM_001162407	70	0.21	15	B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	ENST00000321356.4	37	CCDS2331.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434740	0.83885	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000409769;ENST00000434813	T;T;T	0.70869	-0.52;-0.52;-0.52	4.93	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90954	0.7156	H	0.99211	4.47	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	D	0.94661	0.7848	10	0.87932	D	0	.	16.2642	0.82565	0.0:0.0:1.0:0.0	.	390;318;348;171	B4DFW7;E9PH13;P49759;B8ZZR0	.;.;CLK1_HUMAN;.	S	348;318;171;390	ENSP00000326830:P348S;ENSP00000386358:P171S;ENSP00000394734:P390S	ENSP00000326830:P348S	P	-	1	0	CLK1	201429665	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.734000	0.98822	2.449000	0.82847	0.491000	0.48974	CCT			0.323	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256192.2			
NDUFS1	4719	broad.mit.edu	37	2	207009656	207009656	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr2:207009656G>A	ENST00000233190.6	-	9	1098	c.832C>T	c.(832-834)Cat>Tat	p.H278Y	NDUFS1_ENST00000423725.1_Missense_Mutation_p.H221Y|NDUFS1_ENST00000455934.2_Missense_Mutation_p.H292Y|NDUFS1_ENST00000457011.1_Missense_Mutation_p.H162Y|NDUFS1_ENST00000440274.1_Missense_Mutation_p.H242Y|NDUFS1_ENST00000449699.1_Missense_Mutation_p.H278Y|NDUFS1_ENST00000432169.1_Missense_Mutation_p.H167Y	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	278	4Fe-4S Mo/W bis-MGD-type. {ECO:0000255|PROSITE-ProRule:PRU01004}.				apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATGTCCTCATGCATACGTGGC	0.343																																					p.H292Y													.	NDUFS1	82		0			c.C874T												185.0	152.0	163.0					2																	207009656		2203	4300	6503	SO:0001583	missense	4719	exon9			CCTCATGCATACG		CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.832C>T	2.37:g.207009656G>A	ENSP00000233190:p.His278Tyr		Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	166	0.03	5	NM_001199984	55	0.00	0	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	ENST00000233190.6	37	CCDS2366.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069433	0.76301	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.47	5.47	0.80525	.	0.094982	0.64402	D	0.000001	D	0.90525	0.7031	M	0.75447	2.3	0.52501	D	0.999951	D;P;D;P	0.56746	0.977;0.939;0.966;0.939	P;B;P;P	0.54815	0.761;0.392;0.616;0.616	D	0.91520	0.5234	10	0.87932	D	0	-18.3079	19.3299	0.94281	0.0:0.0:1.0:0.0	.	167;242;292;278	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	Y	278;221;162;242;292;278;167	ENSP00000233190:H278Y;ENSP00000397760:H221Y;ENSP00000400976:H162Y;ENSP00000409766:H242Y;ENSP00000392709:H292Y;ENSP00000399912:H278Y;ENSP00000409689:H167Y	ENSP00000233190:H278Y	H	-	1	0	NDUFS1	206717901	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.269000	0.51592	2.563000	0.86464	0.655000	0.94253	CAT			0.343	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256391.4		NM_005006	
SNED1	25992	broad.mit.edu	37	2	241979571	241979571	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr2:241979571C>T	ENST00000310397.8	+	7	1125	c.1125C>T	c.(1123-1125)tgC>tgT	p.C375C	SNED1_ENST00000342631.6_Silent_p.C375C|SNED1_ENST00000405547.3_Silent_p.C375C|AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000401884.1_Silent_p.C375C	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	375	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		TGTGTGTGTGCCAGGCCGGAT	0.632																																					p.C375C													SNED1,NS,carcinoma,0,1	SNED1	76	1	0			c.C1125T												33.0	40.0	37.0					2																	241979571		2136	4239	6375	SO:0001819	synonymous_variant	25992	exon7			TGTGTGCCAGGCC	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.1125C>T	2.37:g.241979571C>T			Somatic	39	0.0512820513	2		WXS	Illumina HiSeq	Phase_I	57	0.09	5	NM_001080437	1	0.00	0	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Silent	SNP	ENST00000310397.8	37	CCDS46562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.402|1.402	-0.577857|-0.577857	0.03854|0.03854	.|.	.|.	ENSG00000162804|ENSG00000162804	ENST00000431690|ENST00000401644	.|.	.|.	.|.	4.73|4.73	2.88|2.88	0.33553|0.33553	.|.	.|.	.|.	.|.	.|.	T|T	0.55752|0.55752	0.1940|0.1940	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50048|0.50048	-0.8873|-0.8873	4|4	.|.	.|.	.|.	.|.	7.2772|7.2772	0.26292|0.26292	0.0:0.7194:0.0:0.2806|0.0:0.7194:0.0:0.2806	.|.	.|.	.|.	.|.	V|S	33|72	.|.	.|.	A|P	+|+	2|1	0|0	SNED1|SNED1	241628244|241628244	0.895000|0.895000	0.30542|0.30542	0.757000|0.757000	0.31301|0.31301	0.005000|0.005000	0.04900|0.04900	0.488000|0.488000	0.22371|0.22371	0.923000|0.923000	0.37045|0.37045	0.591000|0.591000	0.81541|0.81541	GCC|CCA			0.632	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323935.2		XM_059482	
XRN2	22803	mdanderson.org	37	20	21319686	21319686	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr20:21319686G>T	ENST00000377191.3	+	14	1333	c.1238G>T	c.(1237-1239)aGt>aTt	p.S413I	XRN2_ENST00000539513.1_Missense_Mutation_p.S359I|XRN2_ENST00000430571.2_Missense_Mutation_p.S337I	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	413					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TTTTAGGACAGTTTTAGAAGA	0.299																																					p.S413I													.	.			0			c.G1238T												96.0	107.0	103.0					20																	21319686		2203	4299	6502	SO:0001583	missense	22803	exon14			AGGACAGTTTTAG	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1238G>T	20.37:g.21319686G>T	ENSP00000366396:p.Ser413Ile		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	50	0.08	4	NM_012255	99	0.00	0	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	37	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002165	0.35320	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.31510	1.49;1.49;1.49	4.7	3.74	0.42951	.	0.380565	0.33144	N	0.005221	T	0.22126	0.0533	L	0.48642	1.525	0.37423	D	0.913725	B	0.20261	0.043	B	0.20955	0.032	T	0.11397	-1.0589	10	0.20519	T	0.43	-19.0717	5.6839	0.17792	0.2662:0.0:0.7338:0.0	.	413	Q9H0D6	XRN2_HUMAN	I	413;337;359	ENSP00000366396:S413I;ENSP00000413548:S337I;ENSP00000441113:S359I	ENSP00000366396:S413I	S	+	2	0	XRN2	21267686	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.895000	0.39778	2.335000	0.79485	0.655000	0.94253	AGT			0.299	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078273.2		NM_012255	
FRG1B	284802	hgsc.bcm.edu	37	20	29628458	29628458	+	Intron	SNP	T	T	C			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr20:29628458T>C	ENST00000278882.3	+	6	713				FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TAATGTGGTGTTTCAAATAGA	0.318																																					.													.	.			0			.																																									SO:0001627	intron_variant	284802	.			GTGGTGTTTCAAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.333+127T>C	20.37:g.29628458T>C			Somatic	73	0	0		WXS	Illumina HiSeq	.	69	0.07	5	.	0		0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																						0.318	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
FRG1B	284802	hgsc.bcm.edu	37	20	29628464	29628464	+	Intron	SNP	A	A	G			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr20:29628464A>G	ENST00000278882.3	+	6	713				FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGTGTTTCAAATAGACTCATT	0.323																																					.													.	.			0			.																																									SO:0001627	intron_variant	284802	.			TTTCAAATAGACT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.333+133A>G	20.37:g.29628464A>G			Somatic	70	0	0		WXS	Illumina HiSeq	.	67	0.06	4	.	0		0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																						0.323	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
SOGA1	140710	mdanderson.org	37	20	35422006	35422006	+	Silent	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr20:35422006G>T	ENST00000357779.3	-	14	4091	c.3765C>A	c.(3763-3765)tcC>tcA	p.S1255S	SOGA1_ENST00000279034.6_Intron|SOGA1_ENST00000237536.4_Silent_p.S1493S|SOGA1_ENST00000456801.2_Silent_p.S1096S			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1255					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						TGAAGAGGCTGGAGAGTCCAT	0.617																																					p.S1493S													.	.			0			c.C4479A												23.0	27.0	26.0					20																	35422006		692	1591	2283	SO:0001819	synonymous_variant	140710	exon14			GAGGCTGGAGAGT	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.3765C>A	20.37:g.35422006G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_080627	3	0.00	0	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Silent	SNP	ENST00000357779.3	37																																																																																						0.617	SOGA1-201	KNOWN	basic	protein_coding	protein_coding				NM_199181	
GATA5	140628	mdanderson.org	37	20	61050111	61050111	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr20:61050111G>T	ENST00000252997.2	-	2	528	c.467C>A	c.(466-468)gCc>gAc	p.A156D	RP13-379O24.3_ENST00000606283.1_lincRNA	NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	156					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			GAAGGGCCCGGCAGTCCAGGA	0.736																																					p.A156D													.	.			0			c.C467A												5.0	6.0	6.0					20																	61050111		2003	4029	6032	SO:0001583	missense	140628	exon2			GGCCCGGCAGTCC	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.467C>A	20.37:g.61050111G>T	ENSP00000252997:p.Ala156Asp		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	14	0.21	3	NM_080473	3	0.00	0	D9ZGF7|Q17RE2|Q86VU4	Missense_Mutation	SNP	ENST00000252997.2	37	CCDS13499.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032975	0.54790	.	.	ENSG00000130700	ENST00000370545;ENST00000540404;ENST00000252997	D	0.98585	-5.01	4.37	4.37	0.52481	GATA-type transcription activator, N-terminal (1);	0.637405	0.16734	N	0.201724	D	0.97779	0.9271	L	0.61036	1.89	0.18873	N	0.999987	D	0.53151	0.958	P	0.48982	0.597	D	0.94342	0.7571	10	0.66056	D	0.02	-6.4374	16.9368	0.86205	0.0:0.0:1.0:0.0	.	156	Q9BWX5	GATA5_HUMAN	D	156;176;156	ENSP00000252997:A156D	ENSP00000252997:A156D	A	-	2	0	GATA5	60483506	0.984000	0.35163	0.017000	0.16124	0.611000	0.37282	6.805000	0.75191	2.150000	0.67090	0.556000	0.70494	GCC			0.736	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080038.2		NM_080473	
TPTE	7179	broad.mit.edu	37	21	11014937	11014937	+	Splice_Site	SNP	C	C	T	rs150470		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr21:11014937C>T	ENST00000415664.2	-	6	808		c.e6+1					P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CAGCACAATACCTATCACATT	0.328																																					.													.	.			0			.																																									SO:0001630	splice_region_variant	7179	.			ACAATACCTATCA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000415664.2:c.2528+1G>A	21.37:g.11014937C>T			Somatic	95	0.0105263158	1		WXS	Illumina HiSeq	Phase_I	120	0.06	7	.	0		0	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Splice_Site	SNP	ENST00000415664.2	37																																																																																						0.328	TPTE-006	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000340030.1			Intron
CCT8L2	150160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17072477	17072477	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr22:17072477C>G	ENST00000359963.3	-	1	1223	c.964G>C	c.(964-966)Gag>Cag	p.E322Q		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	322					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TAAATGATCTCCATCCAAGAC	0.562																																					p.E322Q													.	.			0			c.G964C												180.0	160.0	167.0					22																	17072477		2203	4300	6503	SO:0001583	missense	150160	exon1			TGATCTCCATCCA	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.964G>C	22.37:g.17072477C>G	ENSP00000353048:p.Glu322Gln		Somatic	117	0	0		WXS	Illumina HiSeq	.	130	0.24	31	NM_014406	0		0	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	0.555	-0.847737	0.02651	.	.	ENSG00000198445	ENST00000359963	T	0.79845	-1.31	1.98	-0.882	0.10604	.	0.672540	0.12208	N	0.489567	T	0.80696	0.4672	M	0.69358	2.11	0.09310	N	1	P	0.44309	0.832	P	0.49477	0.612	T	0.71490	-0.4577	10	0.87932	D	0	-13.736	7.1363	0.25531	0.0:0.4391:0.5609:0.0	.	322	Q96SF2	TCPQM_HUMAN	Q	322	ENSP00000353048:E322Q	ENSP00000353048:E322Q	E	-	1	0	CCT8L2	15452477	0.003000	0.15002	0.018000	0.16275	0.001000	0.01503	0.482000	0.22276	0.160000	0.19432	-0.822000	0.03109	GAG			0.562	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000280580.1			
TRIM71	131405	mdanderson.org	37	3	32915369	32915369	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr3:32915369C>T	ENST00000383763.5	+	2	975	c.912C>T	c.(910-912)ggC>ggT	p.G304G		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	304					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCACAATGGGCCGGCATGGGG	0.597																																					p.G304G													.	.			0			c.C912T												207.0	216.0	213.0					3																	32915369		2091	4219	6310	SO:0001819	synonymous_variant	131405	exon2			AATGGGCCGGCAT		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.912C>T	3.37:g.32915369C>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001039111	14	0.00	0		Silent	SNP	ENST00000383763.5	37	CCDS43060.1																																																																																					0.597	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341565.3		NM_001039111	
DZIP3	9666	mdanderson.org	37	3	108373068	108373068	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr3:108373068G>T	ENST00000361582.3	+	19	2340	c.2110G>T	c.(2110-2112)Gat>Tat	p.D704Y	DZIP3_ENST00000463306.1_Missense_Mutation_p.D704Y	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	704					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ACTTATAAAAGATGATGCAAG	0.398																																					p.D704Y													DZIP3,colon,carcinoma,0,1	DZIP3	0	1	0			c.G2110T												168.0	149.0	155.0					3																	108373068		2203	4300	6503	SO:0001583	missense	9666	exon19			ATAAAAGATGATG	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.2110G>T	3.37:g.108373068G>T	ENSP00000355028:p.Asp704Tyr		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_014648	13	0.00	0	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	G	9.478	1.097410	0.20552	.	.	ENSG00000198919	ENST00000361582;ENST00000463306	T;T	0.32753	1.44;1.44	4.81	2.82	0.32997	.	0.537871	0.17032	N	0.189643	T	0.19765	0.0475	L	0.36672	1.1	0.28206	N	0.927125	P;P	0.44090	0.826;0.826	B;B	0.38712	0.28;0.28	T	0.07597	-1.0764	10	0.37606	T	0.19	-7.8839	5.4181	0.16386	0.2656:0.0:0.7344:0.0	.	322;704	D3DN61;Q86Y13	.;DZIP3_HUMAN	Y	704	ENSP00000355028:D704Y;ENSP00000419981:D704Y	ENSP00000355028:D704Y	D	+	1	0	DZIP3	109855758	0.992000	0.36948	0.914000	0.36105	0.185000	0.23345	0.742000	0.26216	1.215000	0.43411	0.585000	0.79938	GAT			0.398	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353968.1		NM_014648	
MUC4	4585	bcgsc.ca	37	3	195505870	195505870	+	Missense_Mutation	SNP	G	G	A	rs201928034		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr3:195505870G>A	ENST00000463781.3	-	2	13040	c.12581C>T	c.(12580-12582)cCt>cTt	p.P4194L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4194L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGGGGT	0.602																																					p.P4194L													.	MUC4	1505		0			c.C12581T												21.0	15.0	17.0					3																	195505870		689	1578	2267	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12581C>T	3.37:g.195505870G>A	ENSP00000417498:p.Pro4194Leu		Somatic	77	0.025974026	2		WXS	Illumina HiSeq	Phase_1	83	0.08	7	NM_018406	24	0.08	2	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	1.704	-0.500860	0.04261	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33654	1.46;1.4	.	.	.	.	.	.	.	.	T	0.35913	0.0948	N	0.19112	0.55	0.20196	N	0.999925	D	0.59357	0.985	D	0.64042	0.921	T	0.17319	-1.0373	7	.	.	.	.	6.6097	0.22745	2.0E-4:0.0:0.9998:0.0	.	4066	E7ESK3	.	L	4194	ENSP00000417498:P4194L;ENSP00000420243:P4194L	.	P	-	2	0	MUC4	196990649	0.001000	0.12720	0.080000	0.20451	0.057000	0.15508	0.823000	0.27366	0.452000	0.26830	0.074000	0.15403	CCT			0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
FAM157A	728262	hgsc.bcm.edu	37	3	197880167	197880167	+	lincRNA	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr3:197880167G>A	ENST00000437428.2	+	0	47							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcaACTGG	0.527																																					p.Q82Q													.	.			0			c.G246A												2.0	6.0	5.0					3																	197880167		369	1057	1426			728262	exon2			GCAGCAGCAGCAA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880167G>A			Somatic	405	0	0		WXS	Illumina HiSeq	.	326	0.05	17	NM_001145248	0		0		Silent	SNP	ENST00000437428.2	37																																																																																						0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA		OTTHUMT00000340078.2		NM_001145248	
HSD17B4	3295	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	5	118788317	118788317	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr5:118788317G>T	ENST00000256216.6	+	1	180	c.47G>T	c.(46-48)gGc>gTc	p.G16V	HSD17B4_ENST00000414835.2_5'Flank|HSD17B4_ENST00000510025.1_5'UTR|HSD17B4_ENST00000504811.1_5'UTR|HSD17B4_ENST00000515320.1_Missense_Mutation_p.G16V	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	16	(3R)-hydroxyacyl-CoA dehydrogenase.		G -> S (in DBPD). {ECO:0000269|PubMed:9482850}.		alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		CTGGTCACCGGCGCGGGGGCA	0.677																																					p.G16V	Colon(35;490 801 34689 41394 43344)												.	.			0			c.G47T												73.0	67.0	69.0					5																	118788317		2202	4300	6502	SO:0001583	missense	3295	exon1			TCACCGGCGCGGG		CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.47G>T	5.37:g.118788317G>T	ENSP00000256216:p.Gly16Val		Somatic	68	0	0		WXS	Illumina HiSeq	.	80	0.06	5	NM_000414	40	0.00	0	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	ENST00000256216.6	37	CCDS4126.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.819987	0.71028	.	.	ENSG00000133835	ENST00000256216;ENST00000515320	D;D	0.99730	-6.56;-6.56	4.66	4.66	0.58398	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	H	0.98883	4.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96680	0.9503	10	0.87932	D	0	.	13.2376	0.59979	0.0:0.0:1.0:0.0	.	16;16	E9PB82;P51659	.;DHB4_HUMAN	V	16	ENSP00000256216:G16V;ENSP00000424613:G16V	ENSP00000256216:G16V	G	+	2	0	HSD17B4	118816216	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	4.631000	0.61304	2.571000	0.86741	0.491000	0.48974	GGC			0.677	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250863.3		NM_000414	
PCDHB18	54660	hgsc.bcm.edu;ucsc.edu	37	5	140615614	140615614	+	RNA	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr5:140615614G>T	ENST00000526308.1	+	0	1677					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P443P(1)		endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CCCAGGACCCGCACCTGCCCC	0.647																																					.													PCDHB18,NS,carcinoma,0,2	PCDHB18	0	2	1	Substitution - coding silent(1)	endometrium(1)	.																																											54660	.			GGACCCGCACCTG	AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615614G>T			Somatic	37	0.027027027	1		WXS	Illumina HiSeq	.	49	0.12	6	.	0		0	B3KTF8	RNA	SNP	ENST00000526308.1	37																																																																																						0.647	PCDHB18-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000394776.1			
CDKAL1	54901	mdanderson.org	37	6	20739812	20739812	+	Missense_Mutation	SNP	G	G	T	rs149431105		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr6:20739812G>T	ENST00000378610.1	+	4	444	c.434G>T	c.(433-435)cGc>cTc	p.R145L	CDKAL1_ENST00000274695.4_Missense_Mutation_p.R145L|CDKAL1_ENST00000378624.4_Missense_Mutation_p.R75L			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	145	MTTase N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00780}.				maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)	p.R145H(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			GCCCAGCCTCGCCAGGACTAC	0.428																																					p.R145L													CDKAL1,colon,carcinoma,0,1	CDKAL1	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.G434T							G	LEU/ARG	0,4406		0,0,2203	68.0	66.0	66.0		434	4.8	1.0	6	dbSNP_134	66	2,8598		0,2,4298	no	missense	CDKAL1	NM_017774.3	102	0,2,6501	TT,TG,GG		0.0233,0.0,0.0154	possibly-damaging	145/580	20739812	2,13004	2203	4300	6503	SO:0001583	missense	54901	exon6			AGCCTCGCCAGGA	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.434G>T	6.37:g.20739812G>T	ENSP00000367873:p.Arg145Leu		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_017774	15	0.00	0	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	.	16.44	3.124427	0.56613	0.0	2.33E-4	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.46819	0.86;0.87;0.86	4.77	4.77	0.60923	Methylthiotransferase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.43077	0.1231	L	0.48174	1.505	0.48395	D	0.99964	P;B	0.51653	0.947;0.448	P;B	0.52909	0.713;0.179	T	0.22906	-1.0203	10	0.32370	T	0.25	.	16.602	0.84818	0.0:0.0:1.0:0.0	.	75;145	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	L	145;75;145	ENSP00000274695:R145L;ENSP00000367889:R75L;ENSP00000367873:R145L	ENSP00000274695:R145L	R	+	2	0	CDKAL1	20847791	1.000000	0.71417	0.959000	0.39883	0.809000	0.45718	6.888000	0.75622	2.192000	0.70111	0.557000	0.71058	CGC	0		0.428	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039986.1		NM_017774	
RING1	6015	broad.mit.edu;mdanderson.org	37	6	33179304	33179304	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr6:33179304G>T	ENST00000374656.4	+	5	1033	c.825G>T	c.(823-825)aaG>aaT	p.K275N	RING1_ENST00000478431.1_3'UTR	NM_002931.3	NP_002922.2	Q06587	RING1_HUMAN	ring finger protein 1	275	Necessary for interaction with CBX2. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|histone H2A monoubiquitination (GO:0035518)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(5)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|skin(4)	17						TCGTGGAGAAGGGAGAATACT	0.612																																					p.K275N													.	RING1	40		0			c.G825T												27.0	31.0	30.0					6																	33179304		1282	2591	3873	SO:0001583	missense	6015	exon5			GGAGAAGGGAGAA		CCDS34424.1	6p21.3	2013-01-09			ENSG00000204227	ENSG00000204227		"""RING-type (C3HC4) zinc fingers"""	10018	protein-coding gene	gene with protein product		602045				1906426	Standard	NM_002931		Approved	RNF1	uc003odk.3	Q06587	OTTHUMG00000031278	ENST00000374656.4:c.825G>T	6.37:g.33179304G>T	ENSP00000363787:p.Lys275Asn		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	39	0.10	4	NM_002931	69	0.00	0	A8JZZ0|Q5JP96|Q5SQW2|Q86V19	Missense_Mutation	SNP	ENST00000374656.4	37	CCDS34424.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580936	0.28180	.	.	ENSG00000204227	ENST00000374656	D	0.84442	-1.85	4.03	0.894	0.19242	.	0.160615	0.41500	D	0.000864	T	0.56543	0.1992	L	0.27053	0.805	0.37101	D	0.899886	P	0.47962	0.903	B	0.41646	0.362	T	0.52660	-0.8546	10	0.22109	T	0.4	-11.9157	5.4062	0.16323	0.536:0.0:0.464:0.0	.	275	Q06587	RING1_HUMAN	N	275	ENSP00000363787:K275N	ENSP00000363787:K275N	K	+	3	2	RING1	33287282	0.793000	0.28825	1.000000	0.80357	0.995000	0.86356	-0.188000	0.09642	0.328000	0.23435	0.471000	0.43371	AAG			0.612	RING1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076609.2			
LRRC1	55227	mdanderson.org	37	6	53660065	53660065	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr6:53660065G>T	ENST00000370888.1	+	1	288	c.11G>T	c.(10-12)tGc>tTc	p.C4F	LRRC1_ENST00000370882.1_Missense_Mutation_p.C4F|RP13-476E20.1_ENST00000429053.1_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	4						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		ATGTTCCACTGCATCCCCCTG	0.716																																					p.C4F													.	.			0			c.G11T												29.0	26.0	27.0					6																	53660065		2203	4300	6503	SO:0001583	missense	55227	exon1			TCCACTGCATCCC	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.11G>T	6.37:g.53660065G>T	ENSP00000359925:p.Cys4Phe		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_018214	3	0.00	0	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.912948	0.92178	.	.	ENSG00000137269	ENST00000370888;ENST00000370882	T;T	0.46819	0.86;1.55	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.65544	0.2701	M	0.82323	2.585	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.72527	-0.4266	10	0.72032	D	0.01	.	16.1151	0.81302	0.0:0.0:1.0:0.0	.	4	Q9BTT6	LRRC1_HUMAN	F	4	ENSP00000359925:C4F;ENSP00000359919:C4F	ENSP00000359919:C4F	C	+	2	0	LRRC1	53768024	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.505000	0.90515	2.111000	0.64477	0.563000	0.77884	TGC			0.716	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040970.2		NM_025168	
KHDC3L	154288	mdanderson.org	37	6	74073486	74073486	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr6:74073486C>T	ENST00000370367.3	+	3	610	c.557C>T	c.(556-558)gCc>gTc	p.A186V		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	186							RNA binding (GO:0003723)	p.A186V(1)									CTCCAGGCTGCCAACAAGTCG	0.652																																					p.A186V													C6orf221,NS,carcinoma,0,1	C6orf221	0	1	1	Substitution - Missense(1)	endometrium(1)	c.C557T												33.0	34.0	34.0					6																	74073486		2203	4300	6503	SO:0001583	missense	154288	exon3			AGGCTGCCAACAA	AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.557C>T	6.37:g.74073486C>T	ENSP00000359392:p.Ala186Val		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_001017361	605	0.00	0	B2RNW7	Missense_Mutation	SNP	ENST00000370367.3	37	CCDS34484.1	.	.	.	.	.	.	.	.	.	.	C	6.507	0.461787	0.12342	.	.	ENSG00000203908	ENST00000370367	T	0.28255	1.62	2.14	-4.29	0.03721	.	.	.	.	.	T	0.04272	0.0118	N	0.25647	0.755	0.09310	N	1	B	0.27625	0.183	B	0.26614	0.071	T	0.36625	-0.9740	9	0.11485	T	0.65	.	5.2271	0.15401	0.1641:0.2023:0.0:0.6336	.	186	Q587J8	ECAT1_HUMAN	V	186	ENSP00000359392:A186V	ENSP00000359392:A186V	A	+	2	0	C6orf221	74130207	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.656000	0.01980	-1.748000	0.01332	-0.229000	0.12294	GCC			0.652	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041202.3		NM_001017361	
ARID1B	57492	broad.mit.edu;mdanderson.org	37	6	157100005	157100005	+	Silent	SNP	C	C	A	rs587779748|rs184815562		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr6:157100005C>A	ENST00000350026.5	+	1	943	c.942C>A	c.(940-942)ggC>ggA	p.G314G	ARID1B_ENST00000346085.5_Silent_p.G314G|MIR4466_ENST00000606121.1_RNA|RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000275248.4_Silent_p.G256G|RP11-230C9.3_ENST00000604792.1_RNA|ARID1B_ENST00000367148.1_Silent_p.G314G	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	314	Gly-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		gcggcggcggcggaggaggag	0.756																																					p.G314G													.	ARID1B	320		0			c.C942A												1.0	1.0	1.0					6																	157100005		538	1345	1883	SO:0001819	synonymous_variant	57492	exon1			CGGCGGCGGAGGA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.942C>A	6.37:g.157100005C>A			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	32	0.13	4	NM_017519	0		0	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	ENST00000350026.5	37	CCDS5251.2																																																																																					0.756	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000372723.1		NM_020732	
RAC1	5879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6426908	6426908	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr7:6426908C>G	ENST00000348035.4	+	2	314	c.101C>G	c.(100-102)cCt>cGt	p.P34R	RAC1_ENST00000356142.4_Missense_Mutation_p.P34R|RAC1_ENST00000488373.1_3'UTR	NM_006908.4	NP_008839.2	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	34					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|anatomical structure arrangement (GO:0048532)|anatomical structure morphogenesis (GO:0009653)|apoptotic signaling pathway (GO:0097190)|auditory receptor cell morphogenesis (GO:0002093)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell adhesion (GO:0007155)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|cerebral cortex radially oriented cell migration (GO:0021799)|cochlea morphogenesis (GO:0090103)|dendrite morphogenesis (GO:0048813)|dopaminergic neuron differentiation (GO:0071542)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|engulfment of apoptotic cell (GO:0043652)|epithelial cell morphogenesis (GO:0003382)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor signaling pathway (GO:0007186)|hyperosmotic response (GO:0006972)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|mast cell chemotaxis (GO:0002551)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of receptor-mediated endocytosis (GO:0048261)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA replication (GO:0045740)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein localization to plasma membrane (GO:0072659)|regulation of cell migration (GO:0030334)|regulation of defense response to virus by virus (GO:0050690)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|response to wounding (GO:0009611)|ruffle assembly (GO:0097178)|ruffle organization (GO:0031529)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell costimulation (GO:0031295)|viral process (GO:0016032)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GDP-dissociation inhibitor binding (GO:0051022)|thioesterase binding (GO:0031996)			cervix(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Dextromethorphan(DB00514)	GAATATATCCCTACTGTGTAA	0.363																																					p.P34R													.	.			0			c.C101G												103.0	102.0	103.0					7																	6426908		2203	4298	6501	SO:0001583	missense	5879	exon2			ATATCCCTACTGT	AJ132695	CCDS5348.1, CCDS5349.1	7p22	2014-01-30			ENSG00000136238	ENSG00000136238		"""Endogenous ligands"""	9801	protein-coding gene	gene with protein product		602048				2674130, 10597294	Standard	NM_006908		Approved	TC-25, p21-Rac1, Rac-1	uc003spw.3	P63000	OTTHUMG00000023540	ENST00000348035.4:c.101C>G	7.37:g.6426908C>G	ENSP00000258737:p.Pro34Arg		Somatic	105	0	0		WXS	Illumina HiSeq	.	108	0.16	17	NM_006908	63	0.44	28	O95501|P15154|Q3Y4D3|Q5JAA8|Q9BTB4	Missense_Mutation	SNP	ENST00000348035.4	37	CCDS5348.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.921361	0.92249	.	.	ENSG00000136238	ENST00000348035;ENST00000356142	T;T	0.73789	-0.78;-0.78	6.06	6.06	0.98353	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93207	0.7836	H	0.99379	4.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.95425	0.8511	10	0.87932	D	0	.	20.2312	0.98350	0.0:1.0:0.0:0.0	.	34;34	P63000;A4D2P0	RAC1_HUMAN;.	R	34	ENSP00000258737:P34R;ENSP00000348461:P34R	ENSP00000258737:P34R	P	+	2	0	RAC1	6393433	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.622000	0.83099	2.882000	0.98803	0.655000	0.94253	CCT			0.363	RAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000242868.2		NM_018890	
DYNC1I1	1780	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	95439756	95439756	+	Missense_Mutation	SNP	G	G	A	rs377495263		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr7:95439756G>A	ENST00000324972.6	+	3	354	c.161G>A	c.(160-162)cGc>cAc	p.R54H	DYNC1I1_ENST00000447467.2_Missense_Mutation_p.R54H|DYNC1I1_ENST00000413338.1_Missense_Mutation_p.R54H|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.R54H|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.R54H|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.R54H|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.R54H	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	54	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			GATCTGGATCGCAAACGACGA	0.433																																					p.R54H													.	DYNC1I1	111		0			c.G161A							G	HIS/ARG,HIS/ARG,HIS/ARG	1,4403	2.1+/-5.4	0,1,2201	84.0	84.0	84.0		161,161,161	4.8	1.0	7		84	0,8600		0,0,4300	no	missense,missense,missense	DYNC1I1	NM_001135556.1,NM_001135557.1,NM_004411.4	29,29,29	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	54/629,54/609,54/646	95439756	1,13003	2202	4300	6502	SO:0001583	missense	1780	exon3			TGGATCGCAAACG	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.161G>A	7.37:g.95439756G>A	ENSP00000320130:p.Arg54His		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	94	0.05	5	NM_004411	0		0	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973205	0.92919	2.27E-4	0.0	ENSG00000158560	ENST00000447467;ENST00000524053;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000413338;ENST00000518089;ENST00000457059	T;T;T;T;T;T;T	0.74315	-0.62;2.48;-0.83;-0.62;-0.63;2.48;-0.62	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.78407	0.4278	L	0.52573	1.65	0.45046	D	0.998065	D;D;D;D;D	0.67145	0.99;0.996;0.994;0.994;0.994	P;P;P;P;P	0.52710	0.512;0.707;0.707;0.629;0.707	T	0.79538	-0.1762	10	0.49607	T	0.09	-13.001	18.3447	0.90317	0.0:0.0:1.0:0.0	.	54;54;54;54;54	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	H	54	ENSP00000392337:R54H;ENSP00000320130:R54H;ENSP00000438377:R54H;ENSP00000398118:R54H;ENSP00000352348:R54H;ENSP00000428273:R54H;ENSP00000412444:R54H	ENSP00000320130:R54H	R	+	2	0	DYNC1I1	95277692	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.548000	0.82154	2.629000	0.89072	0.655000	0.94253	CGC			0.433	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000333432.1		NM_004411	
POTEA	340441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	43152474	43152474	+	RNA	SNP	C	C	G			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr8:43152474C>G	ENST00000522175.2	+	0	462							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GTTGCTACAACATGGCACTGA	0.368																																					p.H154D													.	.			0			c.C460G												105.0	103.0	103.0					8																	43152474		2202	4298	6500			340441	exon3			CTACAACATGGCA	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43152474C>G			Somatic	165	0	0		WXS	Illumina HiSeq	.	176	0.23	40	NM_001005365	0		0	A6ND17|A6ND71|Q6S8J6	Missense_Mutation	SNP	ENST00000522175.2	37																																																																																						0.368	POTEA-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000383492.1		NM_001002920	
RIMS2	9699	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	104831755	104831755	+	Missense_Mutation	SNP	G	G	A	rs377178152		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr8:104831755G>A	ENST00000507740.1	+	1	256	c.20G>A	c.(19-21)cGc>cAc	p.R7H	RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000262231.10_Missense_Mutation_p.R7H	NM_014677.4	NP_055492.3	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GAGACATTGCGCCAGGTCTGC	0.353										HNSCC(12;0.0054)																											p.R7H													RIMS2_ENST00000507740,NS,carcinoma,0,2	RIMS2_ENST00000507740	0	2	0			c.G20A							G	,HIS/ARG	1,3637		0,1,1818	119.0	116.0	117.0		,20	5.7	1.0	8		117	0,8168		0,0,4084	no	intron,missense	RIMS2	NM_001100117.2,NM_014677.4	,29	0,1,5902	AA,AG,GG		0.0,0.0275,0.0085	,	,7/1164	104831755	1,11805	1819	4084	5903	SO:0001583	missense	9699	exon1			CATTGCGCCAGGT	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000507740.1:c.20G>A	8.37:g.104831755G>A	ENSP00000423559:p.Arg7His		Somatic	57	0	0		WXS	Illumina HiSeq	.	84	0.08	7	NM_014677	0		0	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000507740.1	37	CCDS43761.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152792	0.78001	2.75E-4	0.0	ENSG00000176406	ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894	T;T;T;T	0.22134	1.97;2.03;2.04;1.98	5.71	5.71	0.89125	.	.	.	.	.	T	0.30230	0.0758	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.989	T	0.41910	-0.9482	9	0.87932	D	0	.	19.8516	0.96743	0.0:0.0:1.0:0.0	.	7;7	Q9UQ26-1;Q9UQ26-3	.;.	H	7	ENSP00000425205:R7H;ENSP00000262231:R7H;ENSP00000423559:R7H;ENSP00000386228:R7H	ENSP00000262231:R7H	R	+	2	0	RIMS2	104900931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.334000	0.96470	2.685000	0.91497	0.585000	0.79938	CGC			0.353	RIMS2-005	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000367215.1		NM_001100117	
NOV	4856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	120435213	120435213	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr8:120435213T>G	ENST00000259526.3	+	5	1142	c.915T>G	c.(913-915)aaT>aaG	p.N305K	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	0	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			CTCCCCACAATACCAAAACCA	0.552																																					p.N305K													.	.			0			c.T915G												113.0	110.0	111.0					8																	120435213		2203	4300	6503	SO:0001583	missense	4856	exon5			CCACAATACCAAA	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.915T>G	8.37:g.120435213T>G	ENSP00000259526:p.Asn305Lys		Somatic	132	0	0		WXS	Illumina HiSeq	.	215	0.16	34	NM_002514	2	0.00	0		Missense_Mutation	SNP	ENST00000259526.3	37	CCDS6328.1	.	.	.	.	.	.	.	.	.	.	T	6.737	0.504750	0.12822	.	.	ENSG00000136999	ENST00000259526	T	0.16597	2.33	5.85	1.46	0.22682	Cystine knot (1);Cystine knot, C-terminal (3);	0.228561	0.51477	D	0.000085	T	0.07999	0.0200	N	0.11673	0.155	0.39742	D	0.971769	B	0.30146	0.27	B	0.34931	0.192	T	0.23190	-1.0195	10	0.02654	T	1	-25.5504	11.462	0.50217	0.0:0.6471:0.0:0.3529	.	305	P48745	NOV_HUMAN	K	305	ENSP00000259526:N305K	ENSP00000259526:N305K	N	+	3	2	NOV	120504394	0.885000	0.30320	1.000000	0.80357	0.870000	0.49936	0.118000	0.15605	0.361000	0.24292	-0.248000	0.11899	AAT			0.552	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381301.1		NM_002514	
AKNA	80709	mdanderson.org	37	9	117124782	117124782	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chr9:117124782G>T	ENST00000307564.4	-	8	1981	c.1820C>A	c.(1819-1821)gCc>gAc	p.A607D	AKNA_ENST00000374088.3_Missense_Mutation_p.A607D|AKNA_ENST00000374075.5_Missense_Mutation_p.A526D|AKNA_ENST00000312033.3_Missense_Mutation_p.A607D|AKNA_ENST00000223791.3_Missense_Mutation_p.A67D	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	607					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CTCCTCTAGGGCCGCGTGGGC	0.637																																					p.A607D													.	.			0			c.C1820A												26.0	29.0	28.0					9																	117124782		2203	4300	6503	SO:0001583	missense	80709	exon8			TCTAGGGCCGCGT	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1820C>A	9.37:g.117124782G>T	ENSP00000303769:p.Ala607Asp		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_030767	12	0.00	0	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	g	18.83	3.706368	0.68615	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000223791;ENST00000374075;ENST00000312033	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	4.94	4.02	0.46733	.	0.126904	0.36167	N	0.002760	T	0.52273	0.1724	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	T	0.53982	-0.8361	10	0.72032	D	0.01	-13.8451	11.0534	0.47903	0.0:0.1872:0.8128:0.0	.	607;526	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	D	607;448;607;67;526;607	ENSP00000303769:A607D;ENSP00000363201:A607D;ENSP00000223791:A67D;ENSP00000363188:A526D;ENSP00000309222:A607D	ENSP00000223791:A67D	A	-	2	0	AKNA	116164603	1.000000	0.71417	0.986000	0.45419	0.726000	0.41606	3.384000	0.52478	1.264000	0.44198	0.550000	0.68814	GCC			0.637	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053767.2		NM_030767	
MT-ND1	4535	hgsc.bcm.edu	37	M	988	988	+	5'Flank	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chrM:988G>A	ENST00000361390.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAACTCACCTGAGTTGTAAAA	0.448																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			ACCTGAGTTGTAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.988G>A	Exception_encountered		Somatic	43	0	0		WXS	Illumina HiSeq	.	36	0.89	32	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.448	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
MAGEB1	4112	broad.mit.edu	37	X	30269096	30269096	+	Silent	SNP	C	C	T	rs200431416		TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chrX:30269096C>T	ENST00000378981.3	+	4	807	c.486C>T	c.(484-486)ggC>ggT	p.G162G	MAGEB1_ENST00000397548.2_Silent_p.G162G|MAGEB1_ENST00000397550.1_Silent_p.G162G	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	162	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						TCGTCTTTGGCCTTGATTTGA	0.473																																					p.G162G													.	MAGEB1	76		0			c.C486T												69.0	52.0	58.0					X																	30269096		2202	4300	6502	SO:0001819	synonymous_variant	4112	exon3			CTTTGGCCTTGAT		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.486C>T	X.37:g.30269096C>T			Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	193	0.03	5	NM_177415	4	0.00	0	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	ENST00000378981.3	37	CCDS14222.1																																																																																					0.473	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056160.1		NM_002363	
TEX13A	56157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	104463847	104463847	+	Silent	SNP	C	C	T			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chrX:104463847C>T	ENST00000413579.1	-	5	1140	c.1029G>A	c.(1027-1029)ctG>ctA	p.L343L	TEX13A_ENST00000372578.3_Missense_Mutation_p.C344Y|IL1RAPL2_ENST00000344799.4_Intron|TEX13A_ENST00000372575.1_Missense_Mutation_p.C344Y|IL1RAPL2_ENST00000372582.1_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	343							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						CATCAGACCACAGGCTAGTAT	0.552																																					p.L343L													.	.			0			c.G1029A												106.0	99.0	101.0					X																	104463847		2101	4214	6315	SO:0001819	synonymous_variant	56157	exon5			AGACCACAGGCTA	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.1029G>A	X.37:g.104463847C>T			Somatic	87	0	0		WXS	Illumina HiSeq	.	116	0.30	35	NM_031274	0		0	B1B1G8|Q32NB6	Silent	SNP	ENST00000413579.1	37		.	.	.	.	.	.	.	.	.	.	C	8.682	0.905316	0.17760	.	.	ENSG00000133149	ENST00000372578;ENST00000372575	.	.	.	2.86	-3.36	0.04913	.	.	.	.	.	T	0.25680	0.0625	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.87932	D	0	.	0.1635	0.00105	0.3521:0.2269:0.1643:0.2566	.	.	.	.	Y	344	.	ENSP00000361656:C344Y	C	-	2	0	TEX13A	104350503	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-2.686000	0.00834	-1.077000	0.03121	0.436000	0.28706	TGT			0.552	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_031274	
AMMECR1	9949	broad.mit.edu;mdanderson.org	37	X	109561071	109561071	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chrX:109561071C>A	ENST00000262844.5	-	1	396	c.229G>T	c.(229-231)Ggc>Tgc	p.G77C	AMMECR1_ENST00000372059.2_Missense_Mutation_p.G77C|AMMECR1_ENST00000496695.1_5'Flank|AMMECR1_ENST00000372057.1_5'UTR	NM_015365.2	NP_056180.1	Q9Y4X0	AMMR1_HUMAN	Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1	77	Gly/Ser-rich.									large_intestine(1)|lung(4)|ovary(1)|stomach(1)	7						CCGCCGCCGCCGCAGCCCTGG	0.726																																					p.G77C													.	AMMECR1	16		0			c.G229T												5.0	5.0	5.0					X																	109561071		1882	3732	5614	SO:0001583	missense	9949	exon1			CGCCGCCGCAGCC	AJ007014	CCDS14551.1, CCDS35368.1, CCDS55476.1	Xq22.3	2014-06-17	2008-09-12		ENSG00000101935	ENSG00000101935			467	protein-coding gene	gene with protein product		300195				10049589, 9480748	Standard	NM_001171689		Approved		uc004eoo.3	Q9Y4X0	OTTHUMG00000022197	ENST00000262844.5:c.229G>T	X.37:g.109561071C>A	ENSP00000262844:p.Gly77Cys		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	62	0.05	3	NM_015365	3	0.00	0	Q5JYV9|Q6P9D8|Q8WX22|Q9UIQ8	Missense_Mutation	SNP	ENST00000262844.5	37	CCDS14551.1	.	.	.	.	.	.	.	.	.	.	c	15.32	2.799024	0.50208	.	.	ENSG00000101935	ENST00000262844;ENST00000372059	.	.	.	4.29	3.42	0.39159	.	0.000000	0.49305	D	0.000153	T	0.48205	0.1487	L	0.29908	0.895	0.80722	D	1	P;P	0.49862	0.929;0.853	P;P	0.51777	0.679;0.599	T	0.32561	-0.9902	8	.	.	.	-0.7539	10.6389	0.45582	0.0:0.898:0.0:0.102	.	77;77	Q9Y4X0-3;Q9Y4X0	.;AMER1_HUMAN	C	77	.	.	G	-	1	0	AMMECR1	109447727	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	2.031000	0.41117	0.744000	0.32741	0.271000	0.19318	GGC			0.726	AMMECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057907.1			
KLHL13	90293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	117043475	117043475	+	Silent	SNP	G	G	A			TCGA-2G-AAL7-01A-11D-A42Y-10	TCGA-2G-AAL7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1ddde10-c7a7-40e6-815d-f237235c2cbb	06a9061b-3846-4626-921d-89f61fe675b5	g.chrX:117043475G>A	ENST00000262820.3	-	5	2064	c.1155C>T	c.(1153-1155)gcC>gcT	p.A385A	KLHL13_ENST00000371882.1_Silent_p.A334A|KLHL13_ENST00000541812.1_Silent_p.A369A|KLHL13_ENST00000469946.1_Silent_p.A334A|KLHL13_ENST00000371878.1_Silent_p.A334A|KLHL13_ENST00000539496.1_Silent_p.A388A|KLHL13_ENST00000540167.1_Silent_p.A369A|KLHL13_ENST00000545703.1_Silent_p.A343A|KLHL13_ENST00000371876.1_Silent_p.A334A	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	385					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)				NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						TTCCAATGACGGCGATGCCAT	0.453																																					p.A388A													.	.			0			c.C1164T												106.0	91.0	96.0					X																	117043475		2203	4300	6503	SO:0001819	synonymous_variant	90293	exon6			AATGACGGCGATG	AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.1155C>T	X.37:g.117043475G>A			Somatic	108	0	0		WXS	Illumina HiSeq	.	153	0.39	60	NM_001168299	0		0	B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Silent	SNP	ENST00000262820.3	37	CCDS14571.1																																																																																					0.453	KLHL13-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_033495	
