#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921136	12921136	+	Silent	SNP	C	C	T	rs368491327	byFrequency	TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr1:12921136C>T	ENST00000240189.2	+	4	1014	c.927C>T	c.(925-927)gaC>gaT	p.D309D		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	309					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.D309D(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGAAGAGGACTTGAAGTGTC	0.498													.|||	12	0.00239617	0.0038	0.0058	5008	,	,		21997	0.001		0.001	False		,,,				2504	0.001				p.D309D													PRAMEF2,pharynx,carcinoma,0,1	PRAMEF2	0	1	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C927T												131.0	134.0	133.0					1																	12921136		2202	4297	6499	SO:0001819	synonymous_variant	65122	exon4			AGAGGACTTGAAG		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.927C>T	1.37:g.12921136C>T			Somatic	66	0	0		WXS	Illumina HiSeq	.	104	0.06	6	NM_023014	0		0		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																					0.498	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005517.1		NM_023014	
PDPN	10630	broad.mit.edu	37	1	13910397	13910397	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr1:13910397G>A	ENST00000294489.6	+	1	438	c.97G>A	c.(97-99)Gct>Act	p.A33T	PDPN_ENST00000475043.1_5'Flank|PDPN_ENST00000376057.4_Missense_Mutation_p.A33T|PDPN_ENST00000513143.1_5'Flank|PDPN_ENST00000509009.1_5'Flank|PDPN_ENST00000376061.4_5'Flank|PDPN_ENST00000487038.1_5'Flank					podoplanin											endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		CGGGGCTCCTGCTCCCACCCC	0.632																																					p.A33T													.	PDPN	44		0			c.G97A												20.0	24.0	22.0					1																	13910397		2202	4299	6501	SO:0001583	missense	10630	exon1			GCTCCTGCTCCCA	AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000294489.6:c.97G>A	1.37:g.13910397G>A	ENSP00000294489:p.Ala33Thr		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	146	0.04	6	NM_006474	63	0.00	0		Missense_Mutation	SNP	ENST00000294489.6	37	CCDS30602.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.784144	0.31593	.	.	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906	T;T;T	0.50813	0.73;0.73;0.73	3.59	0.56	0.17279	.	27.256800	0.00357	N	0.000035	T	0.26448	0.0646	N	0.08118	0	0.21105	N	0.99978	P;P	0.42203	0.773;0.773	B;B	0.36244	0.22;0.22	T	0.24190	-1.0167	10	0.87932	D	0	.	3.3114	0.07017	0.2557:0.2245:0.5198:0.0	.	33;33	Q86YL7-3;Q86YL7-4	.;.	T	33;33;24	ENSP00000294489:A33T;ENSP00000365225:A33T;ENSP00000426302:A24T	ENSP00000294489:A33T	A	+	1	0	PDPN	13782984	0.091000	0.21658	0.032000	0.17829	0.001000	0.01503	1.429000	0.34903	0.304000	0.22809	-0.499000	0.04595	GCT			0.632	PDPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000021783.2		NM_006474	
CSF3R	1441	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	36937224	36937224	+	Silent	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr1:36937224G>A	ENST00000373106.1	-	10	1642	c.1095C>T	c.(1093-1095)agC>agT	p.S365S	CSF3R_ENST00000361632.4_Silent_p.S365S|CSF3R_ENST00000331941.5_Silent_p.S365S|CSF3R_ENST00000440588.2_Silent_p.S365S|CSF3R_ENST00000338937.5_Silent_p.S365S|CSF3R_ENST00000373103.1_Silent_p.S365S|CSF3R_ENST00000373104.1_Silent_p.S365S|CSF3R_ENST00000418048.2_Silent_p.S365S|CSF3R_ENST00000487540.2_5'UTR	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	365	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGATCCGTCCGCTGTCTTCCT	0.597																																					p.S365S													.	.			0			c.C1095T												74.0	76.0	75.0					1																	36937224		2203	4300	6503	SO:0001819	synonymous_variant	1441	exon10			CCGTCCGCTGTCT	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.1095C>T	1.37:g.36937224G>A			Somatic	114	0	0		WXS	Illumina HiSeq	.	110	0.05	6	NM_156039	7	0.00	0		Silent	SNP	ENST00000373106.1	37	CCDS413.1																																																																																					0.597	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021997.2		NM_156039	
SEC22B	9554	broad.mit.edu	37	1	145109975	145109976	+	RNA	INS	-	-	C	rs376446977|rs11458983		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr1:145109975_145109976insC	ENST00000453618.1	+	0	673							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CAGGAACTTTGCTAAAGATCTA	0.386																																					.													.	.			0			.																																											9554	.			AACTTTGCTAAAG	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109976_145109976dupC			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	1	0.00	0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.386	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
KPRP	448834	broad.mit.edu	37	1	152733728	152733728	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr1:152733728G>A	ENST00000606109.1	+	1	1692	c.1664G>A	c.(1663-1665)aGg>aAg	p.R555K	KPRP_ENST00000368773.1_Missense_Mutation_p.R555K			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	555						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGAGCGGAGGGGTCAGGAT	0.542																																					p.R555K													.	KPRP	152		0			c.G1664A												77.0	71.0	73.0					1																	152733728		2203	4300	6503	SO:0001583	missense	448834	exon2			AGCGGAGGGGTCA	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1664G>A	1.37:g.152733728G>A	ENSP00000475216:p.Arg555Lys		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	139	0.04	5	NM_001025231	0		0		Missense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	G	6.785	0.513786	0.12944	.	.	ENSG00000203786	ENST00000368773	T	0.13307	2.6	3.93	-3.85	0.04243	.	1.838530	0.03164	N	0.169791	T	0.03053	0.0090	L	0.34521	1.04	0.09310	N	1	B	0.28291	0.206	B	0.25140	0.058	T	0.34502	-0.9826	10	0.27785	T	0.31	0.7769	9.1184	0.36773	0.6469:0.0:0.3531:0.0	.	555	Q5T749	KPRP_HUMAN	K	555	ENSP00000357762:R555K	ENSP00000357762:R555K	R	+	2	0	KPRP	151000352	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-1.057000	0.03486	-0.900000	0.03896	0.313000	0.20887	AGG			0.542	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034522.2		NM_001025231	
CD1E	913	hgsc.bcm.edu;mdanderson.org	37	1	158325337	158325337	+	Silent	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr1:158325337G>T	ENST00000368167.3	+	3	842	c.603G>T	c.(601-603)ggG>ggT	p.G201G	CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368163.3_Silent_p.G201G|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368161.3_Silent_p.G201G|CD1E_ENST00000368160.3_Silent_p.G201G|CD1E_ENST00000444681.2_Silent_p.G102G|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368165.3_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000434258.1_Silent_p.G199G|CD1E_ENST00000368156.1_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	201	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					TGGAAGCAGGGGAGTCAGAAC	0.453																																					p.G201G													.	.			0			c.G603T												44.0	44.0	44.0					1																	158325337		1926	4134	6060	SO:0001819	synonymous_variant	913	exon3			AGCAGGGGAGTCA	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.603G>T	1.37:g.158325337G>T			Somatic	56	0	0		WXS	Illumina HiSeq	.	86	0.05	4	NM_001042584	2	0.00	0	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Silent	SNP	ENST00000368167.3	37	CCDS41417.1																																																																																					0.453	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000046353.3		NM_030893	
RP11-400N13.1	0	broad.mit.edu	37	1	222435118	222435119	+	lincRNA	INS	-	-	T	rs374887150		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr1:222435118_222435119insT	ENST00000416510.1	-	0	167																											GCAATAATTTCTTTTTTTTTTA	0.302																																					.													.	.			0			.																																											0	.			TAATTTCTTTTTT																													1.37:g.222435128_222435128dupT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000416510.1	37																																																																																						0.302	RP11-400N13.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000090767.1			
PI4K2A	55361	hgsc.bcm.edu	37	10	99410611	99410729	+	Splice_Site	DEL	ATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA	ATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA	-	rs139961604|rs547144502|rs192834192|rs202070275|rs367725219	byFrequency	TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	ATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA	ATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr10:99410611_99410729delATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA	ENST00000370631.3	+	2	492_524	c.435_467delATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA	c.(433-468)ggatttctttccagattcctgctgacttggtctgtg>ggg	p.FLSRFLLTWSV146fs	PI4K2A_ENST00000555577.1_Splice_Site_p.FLSRFLLTWSV116fs|PI4K2A_ENST00000370649.3_Splice_Site_p.FLSRFLLTWSV116fs	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	146	PI3K/PI4K.				basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		ATGCCCTGTCATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGAAGAGCCCTAT	0.489																																					p.146_156del													.	.			0			c.436_466del																																									SO:0001630	splice_region_variant	55361	exon2			CCTGTCATTTCTT	AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.436-1ATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA>-	10.37:g.99410611_99410729delATTTCTTTCCAGATTCCTGCTGACTTGGTCTGTGGGCTATTTTGGTCAACTCGGATTTAACATCCTCTTTTTCTTTGGTCTCTGTAGAGGATCATTGCTGTCTTCAAACCCAAGAATGA			Somatic	39	0	0		WXS	Illumina HiSeq	.	21	0.00	0	NM_018425	0		0	D3DR59|Q9NSG8	Frame_Shift_Del	DEL	ENST00000370631.3	37	CCDS7469.1																																																																																					0.489	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049735.1		NM_018425	Frame_Shift_Del
SH3PXD2A	9644	mdanderson.org	37	10	105361836	105361836	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr10:105361836G>A	ENST00000369774.4	-	15	3415	c.3139C>T	c.(3139-3141)Ccc>Tcc	p.P1047S	SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.P882S|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.P914S|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.P1019S			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	1047					superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CGCTGGGCGGGCAGTAGGGGT	0.617																																					p.P1019S													.	.			0			c.C3055T												85.0	94.0	91.0					10																	105361836		2203	4300	6503	SO:0001583	missense	9644	exon14			GGGCGGGCAGTAG	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.3139C>T	10.37:g.105361836G>A	ENSP00000358789:p.Pro1047Ser		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_014631	20	0.00	0	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.112|7.112	0.576264|0.576264	0.13686|0.13686	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000420222|ENST00000369774;ENST00000355946;ENST00000315994;ENST00000540321;ENST00000538130	.|T;T;T;T	.|0.58060	.|0.43;0.43;0.58;0.36	5.27|5.27	1.13|1.13	0.20643|0.20643	.|Src homology-3 domain (1);	.|0.369438	.|0.31601	.|N	.|0.007371	T|T	0.33990|0.33990	0.0882|0.0882	L|L	0.34521|0.34521	1.04|1.04	0.32305|0.32305	N|N	0.564522|0.564522	.|B;B;B;B	.|0.09022	.|0.0;0.0;0.002;0.0	.|B;B;B;B	.|0.08055	.|0.001;0.001;0.003;0.002	T|T	0.28038|0.28038	-1.0056|-1.0056	5|10	.|0.18710	.|T	.|0.47	-11.8698|-11.8698	7.1634|7.1634	0.25677|0.25677	0.2075:0.1224:0.6701:0.0|0.2075:0.1224:0.6701:0.0	.|.	.|1047;896;892;1019	.|Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3	.|SPD2A_HUMAN;.;.;.	V|S	973|1047;1019;854;914;882	.|ENSP00000358789:P1047S;ENSP00000348215:P1019S;ENSP00000443663:P914S;ENSP00000441514:P882S	.|ENSP00000318135:P854S	A|P	-|-	2|1	0|0	SH3PXD2A|SH3PXD2A	105351826|105351826	0.024000|0.024000	0.19004|0.19004	0.942000|0.942000	0.38095|0.38095	0.741000|0.741000	0.42261|0.42261	0.137000|0.137000	0.15995|0.15995	0.243000|0.243000	0.21327|0.21327	-0.219000|-0.219000	0.12488|0.12488	GCC|CCC			0.617	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000050178.1		NM_014631	
EMX2	2018	mdanderson.org	37	10	119307662	119307662	+	Silent	SNP	A	A	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr10:119307662A>G	ENST00000553456.3	+	3	1502	c.678A>G	c.(676-678)aaA>aaG	p.K226K	EMX2_ENST00000442245.4_Missense_Mutation_p.R165G|EMX2_ENST00000546446.1_3'UTR	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	226					anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		AAAAGAAAAAAGGGACGCACC	0.468																																					p.R165G													.	.			0			c.A493G												63.0	60.0	61.0					10																	119307662		2203	4300	6503	SO:0001819	synonymous_variant	2018	exon2			GAAAAAAGGGACG	AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.678A>G	10.37:g.119307662A>G			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001165924	19	0.00	0	G3V305|Q96NN8|Q9BQF4	Missense_Mutation	SNP	ENST00000553456.3	37	CCDS7601.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.499110	0.64298	.	.	ENSG00000258614	ENST00000553456	.	.	.	5.24	4.11	0.48088	.	.	.	.	.	T	0.33411	0.0862	.	.	.	0.31368	N	0.680498	B	0.02656	0.0	B	0.08055	0.003	T	0.29792	-1.0000	6	.	.	.	-9.4468	11.1193	0.48279	0.9271:0.0:0.0729:0.0	.	165	G3V305	.	G	165	.	.	R	+	1	2	AC005871.1	119297652	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.961000	0.56759	0.940000	0.37473	-0.263000	0.10527	AGG			0.468	EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050569.4		NM_004098	
MUC2	4583	mdanderson.org	37	11	1093298	1093298	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:1093298C>T	ENST00000441003.2	+	30	5144	c.5117C>T	c.(5116-5118)aCg>aTg	p.T1706M	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1673M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccactacggtgacccca	0.637																																					p.T1706M													.	.			0			c.C5117T												116.0	163.0	146.0					11																	1093298		1884	3471	5355	SO:0001583	missense	4583	exon30			CCACTACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5117C>T	11.37:g.1093298C>T	ENSP00000415183:p.Thr1706Met		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_002457	1	0.00	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.981	-0.006376	0.07773	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.10763	2.84;3.0	1.45	1.45	0.22620	.	28.057100	0.02299	U	0.070964	T	0.07908	0.0198	.	.	.	0.09310	N	1	D	0.62365	0.991	B	0.37451	0.25	T	0.31779	-0.9931	9	0.42905	T	0.14	.	6.2785	0.20993	0.0:1.0:0.0:0.0	.	1706	E7EUV1	.	M	1706;1673	ENSP00000415183:T1706M;ENSP00000351956:T1673M	ENSP00000351956:T1673M	T	+	2	0	MUC2	1083298	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	0.616000	0.24344	0.794000	0.33899	0.184000	0.17185	ACG			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
KRTAP5-5	439915	hgsc.bcm.edu;broad.mit.edu	37	11	1651442	1651442	+	Silent	SNP	G	G	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:1651442G>C	ENST00000399676.2	+	1	410	c.372G>C	c.(370-372)ggG>ggC	p.G124G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	124	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G124G(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.692																																					p.G124G													KRTAP5-5,bladder,carcinoma,0,4	KRTAP5-5	0	4	2	Substitution - coding silent(2)	prostate(2)	c.G372C																																									SO:0001819	synonymous_variant	439915	exon1			TGGGGGGTCCAAG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.372G>C	11.37:g.1651442G>C			Somatic	37	0.027027027	1		WXS	Illumina HiSeq	.	28	0.11	3	NM_001001480	0		0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																					0.692	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127919.1			
LRRC4C	57689	broad.mit.edu	37	11	40137725	40137725	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:40137725C>T	ENST00000278198.2	-	2	2081	c.118G>A	c.(118-120)Ggt>Agt	p.G40S	LRRC4C_ENST00000528697.1_Missense_Mutation_p.G40S|LRRC4C_ENST00000527150.1_Missense_Mutation_p.G40S|LRRC4C_ENST00000530763.1_Missense_Mutation_p.G40S			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	40					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				CGCACCAGACCAGCCACCACA	0.537																																					p.G40S													.	LRRC4C	190		0			c.G118A												63.0	58.0	60.0					11																	40137725		2203	4300	6503	SO:0001583	missense	57689	exon5			CCAGACCAGCCAC	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.118G>A	11.37:g.40137725C>T	ENSP00000278198:p.Gly40Ser		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	110	0.04	4	NM_020929	0		0	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713395	0.89112	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763;ENST00000533474	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.76	5.76	0.90799	.	0.049745	0.85682	D	0.000000	T	0.67011	0.2848	L	0.50333	1.59	0.58432	D	0.99999	D	0.76494	0.999	D	0.75484	0.986	T	0.58370	-0.7648	10	0.19147	T	0.46	.	18.9442	0.92615	0.0:1.0:0.0:0.0	.	40	Q9HCJ2	LRC4C_HUMAN	S	40	ENSP00000278198:G40S;ENSP00000436976:G40S;ENSP00000437132:G40S;ENSP00000434761:G40S	ENSP00000278198:G40S	G	-	1	0	LRRC4C	40094301	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.920000	0.70017	2.719000	0.93026	0.650000	0.86243	GGT			0.537	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389499.1		NM_020929	
PSMC3	5702	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47445698	47445698	+	Silent	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:47445698G>A	ENST00000298852.3	-	6	647	c.490C>T	c.(490-492)Ctg>Ttg	p.L164L	PSMC3_ENST00000602866.1_Silent_p.L148L|PSMC3_ENST00000530912.1_Silent_p.L122L	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	164					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCTGTGGGCAGCGTCTCCAGG	0.562																																					p.L164L													.	.			0			c.C490T												160.0	137.0	145.0					11																	47445698		2201	4298	6499	SO:0001819	synonymous_variant	5702	exon6			TGGGCAGCGTCTC	M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.490C>T	11.37:g.47445698G>A			Somatic	97	0	0		WXS	Illumina HiSeq	.	80	0.15	12	NM_002804	355	0.21	75	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Silent	SNP	ENST00000298852.3	37	CCDS7935.1																																																																																					0.562	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395660.2		NM_002804	
BBS1	582	mdanderson.org	37	11	66290988	66290988	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:66290988G>T	ENST00000318312.7	+	10	943	c.892G>T	c.(892-894)Gta>Tta	p.V298L	ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000455748.2_Missense_Mutation_p.V201L|CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.V335L|BBS1_ENST00000393994.2_Intron|BBS1_ENST00000529766.1_3'UTR	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	298					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						ACTTATCCGGGTACACAAGGT	0.587									Bardet-Biedl syndrome																												p.V298L	GBM(152;173 2612 9770 10137)												.	.			0			c.G892T												76.0	72.0	73.0					11																	66290988		2200	4295	6495	SO:0001583	missense	582	exon10	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	ATCCGGGTACACA	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.892G>T	11.37:g.66290988G>T	ENSP00000317469:p.Val298Leu		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_024649	15	0.00	0	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498030	0.26861	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748	T;T;T	0.56611	0.45;0.45;0.45	5.32	0.843	0.18935	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	.	.	.	.	T	0.27454	0.0674	N	0.16478	0.41	0.80722	D	1	P;B;B;B	0.34462	0.454;0.433;0.055;0.208	B;B;B;B	0.29598	0.08;0.104;0.066;0.104	T	0.03784	-1.1004	9	0.20046	T	0.44	.	6.0509	0.19785	0.5086:0.0:0.4914:0.0	.	201;186;298;335	E7EQH1;Q4G0L2;Q8NFJ9;Q8NFJ9-2	.;.;BBS1_HUMAN;.	L	335;298;201	ENSP00000398526:V335L;ENSP00000317469:V298L;ENSP00000405764:V201L	ENSP00000317469:V298L	V	+	1	0	BBS1;CTD-3074O7.11	66047564	1.000000	0.71417	0.727000	0.30756	0.785000	0.44390	1.979000	0.40608	0.260000	0.21731	-0.140000	0.14226	GTA			0.587	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393235.2			
SUV420H1	51111	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	67925696	67925697	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:67925696_67925697delTG	ENST00000304363.4	-	11	2469_2470	c.2116_2117delCA	c.(2116-2118)cagfs	p.Q706fs		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	706					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TAGGATTAACTGTGCATCATAC	0.396																																					p.706_706del													.	.			0			c.2117_2118del																																									SO:0001589	frameshift_variant	51111	exon11			ATTAACTGTGCAT	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.2116_2117delCA	11.37:g.67925698_67925699delTG	ENSP00000305899:p.Gln706fs		Somatic	107	0	0		WXS	Illumina HiSeq	.	123	0.40	49	NM_017635	7	0.00	0	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Frame_Shift_Del	DEL	ENST00000304363.4	37	CCDS31623.1																																																																																					0.396	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318319.1		NM_017635	
PPP6R3	55291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68359128	68359128	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:68359128G>C	ENST00000393800.2	+	18	2124	c.1870G>C	c.(1870-1872)Gag>Cag	p.E624Q	PPP6R3_ENST00000529710.1_Missense_Mutation_p.E544Q|PPP6R3_ENST00000527403.2_Missense_Mutation_p.E589Q|PPP6R3_ENST00000534534.1_Missense_Mutation_p.E392Q|PPP6R3_ENST00000265637.4_Missense_Mutation_p.E578Q|PPP6R3_ENST00000393799.2_Missense_Mutation_p.E624Q|PPP6R3_ENST00000524904.1_Missense_Mutation_p.E618Q|PPP6R3_ENST00000524845.1_Missense_Mutation_p.E595Q|PPP6R3_ENST00000393801.3_Missense_Mutation_p.E624Q|PPP6R3_ENST00000265636.5_Missense_Mutation_p.E544Q	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	624					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGATATATGGGAGGAAAAGCA	0.368																																					p.E624Q													.	.			0			c.G1870C												130.0	110.0	117.0					11																	68359128		2200	4294	6494	SO:0001583	missense	55291	exon18			ATATGGGAGGAAA	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.1870G>C	11.37:g.68359128G>C	ENSP00000377389:p.Glu624Gln		Somatic	53	0	0		WXS	Illumina HiSeq	.	51	0.20	10	NM_001164160	25	0.12	3	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	ENST00000393800.2	37	CCDS53672.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022224	0.54683	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190	T;T;T;T;T;T;T;T;T;T;T	0.33438	1.45;1.41;1.43;1.45;1.66;1.42;1.46;1.42;1.48;1.5;1.5	5.43	5.43	0.79202	.	0.046577	0.85682	D	0.000000	T	0.40570	0.1122	L	0.31371	0.925	0.80722	D	1	D;P;P;P;P;P;D;B	0.62365	0.985;0.941;0.739;0.835;0.638;0.506;0.991;0.3	P;P;B;P;B;B;P;B	0.60173	0.836;0.616;0.396;0.624;0.359;0.196;0.87;0.253	T	0.03898	-1.0994	10	0.19147	T	0.46	.	19.6027	0.95569	0.0:0.0:1.0:0.0	.	307;392;544;595;618;624;624;544	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;.;.;PP6R3_HUMAN;.;.	Q	624;624;392;595;578;618;624;544;544;589;331	ENSP00000377388:E624Q;ENSP00000377389:E624Q;ENSP00000434429:E392Q;ENSP00000431415:E595Q;ENSP00000265637:E578Q;ENSP00000433058:E618Q;ENSP00000377390:E624Q;ENSP00000265636:E544Q;ENSP00000437329:E544Q;ENSP00000433565:E589Q;ENSP00000436209:E331Q	ENSP00000265636:E544Q	E	+	1	0	PPP6R3	68115704	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.839000	0.86812	2.703000	0.92315	0.650000	0.86243	GAG			0.368	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395275.1		NM_018312	
LRRC32	2615	mdanderson.org	37	11	76370909	76370909	+	Silent	SNP	G	G	A	rs202216778		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:76370909G>A	ENST00000407242.2	-	3	1970	c.1728C>T	c.(1726-1728)tgC>tgT	p.C576C	LRRC32_ENST00000404995.1_Silent_p.C576C|LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Silent_p.C576C|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	576	LRRCT.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						AGCCATTGCCGCAGCAGCTGA	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		16788	0.0		0.001	False		,,,				2504	0.0				p.C576C													.	.			0			c.C1728T												28.0	29.0	29.0					11																	76370909		2199	4290	6489	SO:0001819	synonymous_variant	2615	exon3			ATTGCCGCAGCAG	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1728C>T	11.37:g.76370909G>A			Somatic	51	0.0196078431	1		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001128922	11	0.00	0	Q86V06	Silent	SNP	ENST00000407242.2	37	CCDS8245.1																																																																																			0		0.667	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257926.2		NM_005512	
VSIG2	23584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124619734	124619734	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr11:124619734C>G	ENST00000326621.5	-	4	556	c.456G>C	c.(454-456)caG>caC	p.Q152H	VSIG2_ENST00000403470.1_Missense_Mutation_p.Q152H	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	152	Ig-like C2-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		TTTGTCCACTCTGACTGCATA	0.478																																					p.Q152H													.	.			0			c.G456C												54.0	53.0	54.0					11																	124619734		2201	4299	6500	SO:0001583	missense	23584	exon4			TCCACTCTGACTG	AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.456G>C	11.37:g.124619734C>G	ENSP00000318684:p.Gln152His		Somatic	39	0	0		WXS	Illumina HiSeq	.	42	0.33	14	NM_014312	7	0.29	2	O95791|Q9NX42	Missense_Mutation	SNP	ENST00000326621.5	37	CCDS8452.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657088	0.29425	.	.	ENSG00000019102	ENST00000326621;ENST00000403470	T;T	0.68181	-0.31;-0.31	5.18	3.11	0.35812	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.760031	0.11887	N	0.519994	T	0.62527	0.2435	N	0.22421	0.69	0.09310	N	0.999996	P	0.43885	0.82	P	0.52267	0.694	T	0.53422	-0.8441	10	0.87932	D	0	.	8.3465	0.32277	0.0:0.7822:0.0:0.2178	.	152	Q96IQ7	VSIG2_HUMAN	H	152	ENSP00000318684:Q152H;ENSP00000385013:Q152H	ENSP00000318684:Q152H	Q	-	3	2	VSIG2	124124944	0.001000	0.12720	0.923000	0.36655	0.868000	0.49771	-0.176000	0.09811	1.337000	0.45525	0.655000	0.94253	CAG			0.478	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317785.1		NM_014312	
CHD4	1108	broad.mit.edu	37	12	6709741	6709741	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr12:6709741C>T	ENST00000357008.2	-	8	1185	c.1022G>A	c.(1021-1023)cGc>cAc	p.R341H	CHD4_ENST00000544040.1_Missense_Mutation_p.R334H|CHD4_ENST00000544484.1_Missense_Mutation_p.R338H|CHD4_ENST00000309577.6_Missense_Mutation_p.R341H	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	341					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CTTGCGGCTGCGGCTACTACG	0.448																																					p.R341H	Colon(32;586 792 4568 16848 45314)												.	CHD4	539		0			c.G1022A												64.0	68.0	67.0					12																	6709741		2202	4300	6502	SO:0001583	missense	1108	exon8			CGGCTGCGGCTAC	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.1022G>A	12.37:g.6709741C>T	ENSP00000349508:p.Arg341His		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	208	0.02	5	NM_001273	84	0.00	0	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.369430	0.61624	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90788	-2.72;-2.73;-2.72;-2.73;0.69	4.48	3.5	0.40072	Zinc finger, FYVE/PHD-type (1);	0.236600	0.36134	N	0.002767	D	0.92844	0.7724	M	0.69823	2.125	0.50467	D	0.99987	D;D;D	0.89917	0.999;1.0;0.986	P;P;P	0.61592	0.866;0.891;0.674	D	0.92361	0.5897	10	0.59425	D	0.04	-0.0621	9.9209	0.41464	0.1536:0.6973:0.149:0.0	.	341;341;334	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	H	338;334;341;341;315;341	ENSP00000440392:R338H;ENSP00000440542:R334H;ENSP00000312419:R341H;ENSP00000349508:R341H;ENSP00000437506:R341H	ENSP00000312419:R341H	R	-	2	0	CHD4	6580002	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.477000	0.66799	2.423000	0.82170	0.561000	0.74099	CGC			0.448	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001273	
MLF2	8079	broad.mit.edu	37	12	6858045	6858045	+	Silent	SNP	T	T	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr12:6858045T>C	ENST00000203630.5	-	8	1307	c.663A>G	c.(661-663)ggA>ggG	p.G221G	MLF2_ENST00000539187.1_Silent_p.G221G|MLF2_ENST00000564181.1_5'Flank|MLF2_ENST00000435120.1_Silent_p.G221G|MLF2_ENST00000542154.1_Silent_p.G221G			Q15773	MLF2_HUMAN	myeloid leukemia factor 2	221					defense response (GO:0006952)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(2)|large_intestine(3)|lung(4)	9						CCGCCCTTCGTCCCCCAGCCC	0.706																																					p.G221G													.	MLF2	26		0			c.A663G												21.0	24.0	23.0					12																	6858045		2198	4282	6480	SO:0001819	synonymous_variant	8079	exon8			CCTTCGTCCCCCA	U57342	CCDS8559.1	12p13.31	2014-09-11			ENSG00000089693	ENSG00000089693			7126	protein-coding gene	gene with protein product		601401				8661158	Standard	NM_005439		Approved	NTN4	uc010sfi.2	Q15773	OTTHUMG00000168717	ENST00000203630.5:c.663A>G	12.37:g.6858045T>C			Somatic	102	0.068627451	7		WXS	Illumina HiSeq	Phase_I	181	0.14	25	NM_005439	862	0.05	41		Silent	SNP	ENST00000203630.5	37	CCDS8559.1																																																																																					0.706	MLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400733.2			
DIP2B	57609	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	12	51034560	51034560	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr12:51034560G>T	ENST00000301180.5	+	3	260	c.226G>T	c.(226-228)Gca>Tca	p.A76S		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	76	DMAP-interaction.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TGCTCCATCTGCAGCTCAAAC	0.453																																					p.A76S													.	.			0			c.G226T												84.0	81.0	82.0					12																	51034560		2203	4300	6503	SO:0001583	missense	57609	exon3			CCATCTGCAGCTC	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.226G>T	12.37:g.51034560G>T	ENSP00000301180:p.Ala76Ser		Somatic	84	0	0		WXS	Illumina HiSeq	.	107	0.05	5	NM_173602	3	0.00	0	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	G	0.843	-0.741113	0.03088	.	.	ENSG00000066084	ENST00000455310;ENST00000301180	T	0.39406	1.08	5.69	0.31	0.15825	DMAP1-binding (1);	0.536784	0.21443	N	0.074456	T	0.09468	0.0233	N	0.00321	-1.65	0.31427	N	0.673601	B;B	0.12013	0.001;0.005	B;B	0.10450	0.002;0.005	T	0.36261	-0.9755	10	0.07482	T	0.82	-4.0064	8.3952	0.32553	0.1249:0.0:0.5667:0.3085	.	76;76	Q9P265;E9PHD6	DIP2B_HUMAN;.	S	76	ENSP00000301180:A76S	ENSP00000301180:A76S	A	+	1	0	DIP2B	49320827	1.000000	0.71417	0.846000	0.33378	0.710000	0.40934	1.436000	0.34980	-0.157000	0.11059	-2.619000	0.00157	GCA			0.453	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404243.1		NM_173602	
RP1-288H2.2	0	broad.mit.edu	37	12	52493869	52493869	+	RNA	DEL	C	C	-	rs34419454	byFrequency	TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr12:52493869delC	ENST00000547538.1	-	0	139				OR7E47P_ENST00000546390.1_RNA																							atgatcctctccccccccgga	0.433													|||unknown(ALL_OTHER_Ns)	1771	0.353634	0.1762	0.487	5008	,	,		17194	0.5327		0.3032	False		,,,				2504	0.3661				.													.	.			0			.																																											0	.			TCCTCTCCCCCCC																													12.37:g.52493869delC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0		RNA	DEL	ENST00000547538.1	37																																																																																						0.433	RP1-288H2.2-001	PUTATIVE	basic	processed_transcript	processed_transcript		OTTHUMT00000405073.1			
ZFC3H1	196441	mdanderson.org	37	12	72041536	72041536	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr12:72041536G>T	ENST00000378743.3	-	3	1431	c.1073C>A	c.(1072-1074)tCt>tAt	p.S358Y		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	358					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TACCTTTTCAGACAGAATATC	0.284																																					p.S358Y													.	.			0			c.C1073A												82.0	79.0	80.0					12																	72041536		1814	4068	5882	SO:0001583	missense	196441	exon3			TTTTCAGACAGAA	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.1073C>A	12.37:g.72041536G>T	ENSP00000368017:p.Ser358Tyr		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_144982	0		0	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203042	0.79127	.	.	ENSG00000133858	ENST00000378743	T	0.35236	1.32	5.25	5.25	0.73442	.	0.265401	0.31210	N	0.008057	T	0.47040	0.1424	L	0.27053	0.805	0.80722	D	1	D	0.61697	0.99	D	0.69142	0.962	T	0.46898	-0.9158	10	0.66056	D	0.02	.	15.9455	0.79789	0.0:0.0:1.0:0.0	.	358	O60293	ZC3H1_HUMAN	Y	358	ENSP00000368017:S358Y	ENSP00000368017:S358Y	S	-	2	0	ZFC3H1	70327803	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.154000	0.58125	2.620000	0.88729	0.563000	0.77884	TCT			0.284	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404751.1		NM_144982	
TRAFD1	10906	broad.mit.edu	37	12	112579948	112579948	+	Silent	SNP	T	T	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr12:112579948T>G	ENST00000257604.5	+	6	1316	c.699T>G	c.(697-699)ggT>ggG	p.G233G	TRAFD1_ENST00000412615.2_Silent_p.G233G	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	233					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						CCAAAGAGGGTGGTGAAGAGA	0.473																																					p.G233G													.	TRAFD1	42		0			c.T699G												93.0	98.0	96.0					12																	112579948		2203	4300	6503	SO:0001819	synonymous_variant	10906	exon6			AGAGGGTGGTGAA	AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.699T>G	12.37:g.112579948T>G			Somatic	58	0.1206896552	7		WXS	Illumina HiSeq	Phase_I	76	0.13	10	NM_001143906	41	0.00	0	A8K5L6|B4DI89	Silent	SNP	ENST00000257604.5	37	CCDS9160.1																																																																																					0.473	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405214.1		NM_006700	
TPTE2	93492	bcgsc.ca	37	13	20056686	20056686	+	Splice_Site	SNP	T	T	C	rs201542496		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr13:20056686T>C	ENST00000400230.2	-	4	165	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000457266.2_Splice_Site_p.M41V|TPTE2_ENST00000382978.1_Splice_Site_p.M41V|TPTE2_ENST00000382977.4_Splice_Site_p.M41V|TPTE2_ENST00000382975.4_Splice_Site_p.M41V|TPTE2_ENST00000400103.2_Splice_Site_p.M41V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	41					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTTCTAACATACTTTAGCCA	0.313																																					p.M41V													.	TPTE2	225		0			c.A121G												47.0	46.0	47.0					13																	20056686		2202	4298	6500	SO:0001630	splice_region_variant	93492	exon5			CTAACATACTTTA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.120-1A>G	13.37:g.20056686T>C			Somatic	436	0.004587156	2		WXS	Illumina HiSeq	Phase_1	421	0.03	12	NM_199254	0		0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.805163	0.00075	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94376	-3.41;-3.33;-3.28;-3.28;-3.41;-3.33	2.06	0.838	0.18902	.	0.589765	0.15086	U	0.281346	D	0.83399	0.5246	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68424	-0.5412	9	.	.	.	0.2742	3.9369	0.09310	0.0:0.1886:0.0:0.8114	.	41;41	A8MX64;Q6XPS3	.;TPTE2_HUMAN	V	41	ENSP00000372438:M41V;ENSP00000382974:M41V;ENSP00000383089:M41V;ENSP00000372437:M41V;ENSP00000372435:M41V;ENSP00000442218:M41V	.	M	-	1	0	TPTE2	18954686	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	0.235000	0.21160	0.383000	0.25322	ATG			0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_199254	Missense_Mutation
TPTE2P1	646405	broad.mit.edu	37	13	25527490	25527491	+	RNA	INS	-	-	AAAAAG	rs375560921|rs201773491	byFrequency	TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr13:25527490_25527491insAAAAAG	ENST00000429698.1	-	0	282							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		AGGAAGGTTCTAAAAAAAATTT	0.252														9	0.00179712	0.0008	0.0014	5008	,	,		20326	0.004		0.003	False		,,,				2504	0.0				.													.	.			0			.																																											0	.			AGGTTCTAAAAAA			13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25527490_25527491insAAAAAG			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	37	0.30	11	.	0		0	B3KST4|B4DMH9	RNA	INS	ENST00000429698.1	37																																																																																						0.252	TPTE2P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000044206.1			
RXFP2	122042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	32367149	32367149	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr13:32367149T>A	ENST00000298386.2	+	16	1781	c.1710T>A	c.(1708-1710)aaT>aaA	p.N570K	RXFP2_ENST00000380314.1_Missense_Mutation_p.N546K	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	570					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		ATGGGAAAAATGGAGTATGTT	0.333																																					p.N570K													.	.			0			c.T1710A												44.0	48.0	47.0					13																	32367149		2203	4300	6503	SO:0001583	missense	122042	exon16			GAAAAATGGAGTA	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.1710T>A	13.37:g.32367149T>A	ENSP00000298386:p.Asn570Lys		Somatic	125	0	0		WXS	Illumina HiSeq	.	73	0.21	15	NM_130806	0		0	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	T	19.21	3.783531	0.70222	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.36878	1.23;1.23	5.73	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.62913	0.2467	M	0.88979	2.995	0.51767	D	0.999932	D;D	0.89917	0.999;1.0	D;D	0.91635	0.98;0.999	T	0.65598	-0.6129	10	0.48119	T	0.1	.	10.1966	0.43058	0.0:0.0794:0.0:0.9206	.	546;570	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	K	546;570	ENSP00000369670:N546K;ENSP00000298386:N570K	ENSP00000298386:N570K	N	+	3	2	RXFP2	31265149	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.760000	0.38430	0.968000	0.38212	0.533000	0.62120	AAT			0.333	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000044399.1		NM_130806	
THSD1	55901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	52952281	52952281	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr13:52952281A>T	ENST00000258613.4	-	5	2002	c.1824T>A	c.(1822-1824)gaT>gaA	p.D608E	THSD1_ENST00000349258.4_Missense_Mutation_p.D555E|THSD1_ENST00000544466.1_Missense_Mutation_p.D229E	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	608					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		TCACATTTAGATCCAGCCTGG	0.602																																					p.D608E													.	.			0			c.T1824A												54.0	55.0	55.0					13																	52952281		2203	4300	6503	SO:0001583	missense	55901	exon5			ATTTAGATCCAGC	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1824T>A	13.37:g.52952281A>T	ENSP00000258613:p.Asp608Glu		Somatic	119	0	0		WXS	Illumina HiSeq	.	66	0.11	7	NM_018676	4	0.00	0	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	ENST00000258613.4	37	CCDS9432.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.712501	0.30322	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.33654	2.12;1.4;2.31	5.38	-0.0509	0.13828	.	0.246106	0.36854	N	0.002364	T	0.46964	0.1420	L	0.55103	1.725	0.09310	N	0.999993	D;D	0.71674	0.996;0.998	D;D	0.77557	0.99;0.938	T	0.32929	-0.9888	10	0.87932	D	0	-22.1051	6.4776	0.22045	0.6964:0.1251:0.1785:0.0	.	555;608	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	E	555;229;608	ENSP00000340650:D555E;ENSP00000438512:D229E;ENSP00000258613:D608E	ENSP00000258613:D608E	D	-	3	2	THSD1	51850282	0.002000	0.14202	0.025000	0.17156	0.034000	0.12701	0.073000	0.14640	-0.223000	0.09943	0.455000	0.32223	GAT			0.602	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045058.3			
SALL2	6297	hgsc.bcm.edu	37	14	21991589	21991589	+	Missense_Mutation	SNP	G	G	T	rs372214185	byFrequency	TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr14:21991589G>T	ENST00000327430.3	-	2	2567	c.2273C>A	c.(2272-2274)cCg>cAg	p.P758Q	SALL2_ENST00000450879.2_Missense_Mutation_p.P621Q|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000538754.1_Intron|AE000658.22_ENST00000535893.1_RNA	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	758					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P758L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CTCCTCTTCCGGTGATGGCTG	0.577																																					p.P758Q													SALL2,colon,carcinoma,0,1	SALL2	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2273A												52.0	49.0	50.0					14																	21991589		2203	4300	6503	SO:0001583	missense	6297	exon2			TCTTCCGGTGATG	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2273C>A	14.37:g.21991589G>T	ENSP00000333537:p.Pro758Gln		Somatic	64	0	0		WXS	Illumina HiSeq	.	62	0.08	5	NM_005407	93	0.00	0	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025067	0.35701	.	.	ENSG00000165821	ENST00000327430;ENST00000450879	T;T	0.04119	3.77;3.7	4.76	2.95	0.34219	.	0.260152	0.20493	N	0.091250	T	0.02970	0.0088	L	0.27053	0.805	0.09310	N	1	P;P;P;P	0.43094	0.799;0.799;0.609;0.609	B;B;B;B	0.40256	0.324;0.324;0.174;0.123	T	0.32613	-0.9900	10	0.10111	T	0.7	-4.7548	4.35	0.11151	0.1875:0.0:0.6343:0.1781	.	621;621;519;758	B4DK65;E7EW59;B4DFD9;Q9Y467	.;.;.;SALL2_HUMAN	Q	758;621	ENSP00000333537:P758Q;ENSP00000396773:P621Q	ENSP00000333537:P758Q	P	-	2	0	SALL2	21061429	0.001000	0.12720	0.244000	0.24202	0.792000	0.44763	0.615000	0.24329	0.624000	0.30286	-0.244000	0.11960	CCG			0.577	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401242.1		NM_005407	
NYNRIN	57523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24880356	24880356	+	Missense_Mutation	SNP	G	G	A	rs540767530		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr14:24880356G>A	ENST00000382554.3	+	5	2807	c.2489G>A	c.(2488-2490)cGa>cAa	p.R830Q		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	830					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CGGGGACACCGAGAGGTCACT	0.592											OREG0022626	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		19481	0.0		0.0	False		,,,				2504	0.001				p.R830Q													.	.			0			c.G2489A												102.0	112.0	109.0					14																	24880356		2064	4214	6278	SO:0001583	missense	57523	exon5			GACACCGAGAGGT	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2489G>A	14.37:g.24880356G>A	ENSP00000371994:p.Arg830Gln		Somatic	106	0	0	774	WXS	Illumina HiSeq	.	86	0.20	17	NM_025081	66	0.27	18	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	G	34	5.322741	0.95708	.	.	ENSG00000205978	ENST00000382554	T	0.46451	0.87	5.02	5.02	0.67125	Ribonuclease Zc3h12a-like (1);	.	.	.	.	T	0.50837	0.1639	L	0.33189	0.99	0.42380	D	0.992481	D	0.64830	0.994	P	0.61070	0.883	T	0.54180	-0.8332	9	0.87932	D	0	.	15.882	0.79211	0.0:0.0:1.0:0.0	.	830	Q9P2P1	NYNRI_HUMAN	Q	830	ENSP00000371994:R830Q	ENSP00000371994:R830Q	R	+	2	0	NYNRIN	23950196	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.470000	0.90399	2.603000	0.88011	0.467000	0.42956	CGA			0.592	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412939.1			
OTUD7A	161725	mdanderson.org	37	15	31779760	31779760	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr15:31779760G>T	ENST00000307050.4	-	9	1252	c.1160C>A	c.(1159-1161)cCc>cAc	p.P387H	OTUD7A_ENST00000382902.1_Missense_Mutation_p.P394H	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	387	Catalytic. {ECO:0000250}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		ATCCGTCAGGGGGATCACGGC	0.602																																					p.P387H													.	.			0			c.C1160A												62.0	55.0	57.0					15																	31779760		2202	4300	6502	SO:0001583	missense	161725	exon9			GTCAGGGGGATCA	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.1160C>A	15.37:g.31779760G>T	ENSP00000305926:p.Pro387His		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	90	0.06	5	NM_130901	0		0	Q8IWK5	Missense_Mutation	SNP	ENST00000307050.4	37	CCDS10026.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396364	0.83011	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	D;D	0.87491	-2.26;-2.21	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.93579	0.7950	M	0.80422	2.495	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.94699	0.7881	10	0.87932	D	0	-20.7568	17.4453	0.87577	0.0:0.0:1.0:0.0	.	394;387	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	H	387;394	ENSP00000305926:P387H;ENSP00000372358:P394H	ENSP00000305926:P387H	P	-	2	0	OTUD7A	29567052	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	9.020000	0.93667	2.147000	0.66899	0.555000	0.69702	CCC			0.602	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251393.2		NM_130901	
KLHL25	64410	mdanderson.org	37	15	86311959	86311959	+	Silent	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr15:86311959G>A	ENST00000337975.5	-	2	1357	c.1083C>T	c.(1081-1083)taC>taT	p.Y361Y	MIR1276_ENST00000408707.1_RNA|KLHL25_ENST00000559131.1_Intron|KLHL25_ENST00000536947.1_Silent_p.Y361Y	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	361					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)				breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						GTACGGTGTCGTACACCCAGA	0.632																																					p.Y361Y													.	.			0			c.C1083T												41.0	39.0	40.0					15																	86311959		2202	4299	6501	SO:0001819	synonymous_variant	64410	exon2			GGTGTCGTACACC		CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.1083C>T	15.37:g.86311959G>A			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_022480	9	0.00	0	B2RDH2|B3KRT7	Silent	SNP	ENST00000337975.5	37	CCDS10339.1																																																																																					0.632	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309023.1		NM_022480	
IGFALS	3483	mdanderson.org	37	16	1840925	1840925	+	Silent	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr16:1840925G>T	ENST00000215539.3	-	2	1604	c.1494C>A	c.(1492-1494)ccC>ccA	p.P498P	IGFALS_ENST00000415638.3_Silent_p.P536P			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	498			P -> S (in dbSNP:rs9282730).		cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						AGAGGCTGTTGGGCAATGCCT	0.706																																					p.P536P													.	.			0			c.C1608A												10.0	11.0	11.0					16																	1840925		2167	4283	6450	SO:0001819	synonymous_variant	3483	exon2			GCTGTTGGGCAAT	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.1494C>A	16.37:g.1840925G>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_001146006	8	0.00	0	B4DZY8|E9PGU3	Silent	SNP	ENST00000215539.3	37	CCDS10446.1																																																																																					0.706	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250509.2			
AMDHD2	51005	mdanderson.org	37	16	2579075	2579075	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr16:2579075C>A	ENST00000293971.6	+	10	1214	c.1120C>A	c.(1120-1122)Ctg>Atg	p.L374M	AMDHD2_ENST00000302956.4_Missense_Mutation_p.L404M|CEMP1_ENST00000382350.1_Intron|AMDHD2_ENST00000565570.1_Intron|AMDHD2_ENST00000413459.3_Missense_Mutation_p.L404M|MIR3178_ENST00000581887.1_RNA	NM_015944.3	NP_057028.2	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	374					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylneuraminate catabolic process (GO:0019262)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-phosphate deacetylase activity (GO:0008448)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)|skin(2)|urinary_tract(2)	19						TAAGGGGACCCTGGACTTTGG	0.667																																					p.L404M													.	.			0			c.C1210A												37.0	33.0	34.0					16																	2579075		2193	4297	6490	SO:0001583	missense	51005	exon9			GGGACCCTGGACT	AF132948	CCDS10471.1, CCDS53984.1	16p13.3	2008-02-05			ENSG00000162066	ENSG00000162066			24262	protein-coding gene	gene with protein product						10810093	Standard	NM_001145815		Approved	CGI-14	uc010uwc.2	Q9Y303	OTTHUMG00000128866	ENST00000293971.6:c.1120C>A	16.37:g.2579075C>A	ENSP00000293971:p.Leu374Met		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_001145815	58	0.00	0	B4DL77|Q8WV54	Missense_Mutation	SNP	ENST00000293971.6	37		.	.	.	.	.	.	.	.	.	.	C	17.52	3.411256	0.62399	.	.	ENSG00000162066	ENST00000413459;ENST00000302956;ENST00000293971	D;D;T	0.92446	-3.04;-3.04;0.38	5.28	4.23	0.50019	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.64402	D	0.000001	D	0.97377	0.9142	H	0.98314	4.2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.997	D	0.97429	1.0014	10	0.87932	D	0	.	10.8148	0.46569	0.0:0.8714:0.0:0.1286	.	404;374;404	Q9Y303-3;Q9Y303;Q9Y303-2	.;NAGA_HUMAN;.	M	404;404;374	ENSP00000391596:L404M;ENSP00000307481:L404M;ENSP00000293971:L374M	ENSP00000293971:L374M	L	+	1	2	AMDHD2	2519076	0.997000	0.39634	1.000000	0.80357	0.618000	0.37518	2.155000	0.42301	2.457000	0.83068	0.655000	0.94253	CTG			0.667	AMDHD2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000435652.1		NM_015944	
OR2C1	4993	mdanderson.org	37	16	3406294	3406294	+	Missense_Mutation	SNP	G	G	T	rs144910600		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr16:3406294G>T	ENST00000304936.2	+	1	406	c.354G>T	c.(352-354)atG>atT	p.M118I		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	118					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						TGGTGGTGATGGCATTTGACC	0.612																																					p.M118I													.	.			0			c.G354T												48.0	39.0	42.0					16																	3406294		2197	4300	6497	SO:0001583	missense	4993	exon1			GGTGATGGCATTT	AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.354G>T	16.37:g.3406294G>T	ENSP00000307726:p.Met118Ile		Somatic	59	0.0169491525	1		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_012368	0		0	A0AVA4|Q6IF34|Q6IF55	Missense_Mutation	SNP	ENST00000304936.2	37	CCDS10502.1	.	.	.	.	.	.	.	.	.	.	g	15.65	2.897701	0.52121	.	.	ENSG00000168158	ENST00000304936	T	0.01126	5.3	4.63	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000155	T	0.11965	0.0291	H	0.98155	4.16	0.39318	D	0.965198	D	0.89917	1.0	D	0.87578	0.998	T	0.02617	-1.1133	10	0.87932	D	0	.	10.7694	0.46314	0.0932:0.0:0.9068:0.0	.	118	O95371	OR2C1_HUMAN	I	118	ENSP00000307726:M118I	ENSP00000307726:M118I	M	+	3	0	OR2C1	3346295	1.000000	0.71417	0.998000	0.56505	0.371000	0.29859	7.462000	0.80851	1.175000	0.42826	0.509000	0.49947	ATG			0.612	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206993.3			
TFAP4	7023	bcgsc.ca;mdanderson.org	37	16	4312419	4312419	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr16:4312419G>A	ENST00000204517.6	-	3	588	c.260C>T	c.(259-261)gCc>gTc	p.A87V		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	87	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CTGGAGAATGGCTGCCTGAGG	0.602																																					p.A87V													.	TFAP4	31		0			c.C260T												95.0	89.0	91.0					16																	4312419		2197	4300	6497	SO:0001583	missense	7023	exon3			AGAATGGCTGCCT	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.260C>T	16.37:g.4312419G>A	ENSP00000204517:p.Ala87Val		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_1	89	0.06	5	NM_003223	61	0.00	0	O60409	Missense_Mutation	SNP	ENST00000204517.6	37	CCDS10510.1	.	.	.	.	.	.	.	.	.	.	G	35	5.537451	0.96460	.	.	ENSG00000090447	ENST00000204517	D	0.97976	-4.64	5.53	5.53	0.82687	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98115	0.9378	L	0.46157	1.445	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.98948	1.0793	10	0.54805	T	0.06	.	19.0702	0.93130	0.0:0.0:1.0:0.0	.	87	Q01664	TFAP4_HUMAN	V	87	ENSP00000204517:A87V	ENSP00000204517:A87V	A	-	2	0	TFAP4	4252420	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.368000	0.97152	2.596000	0.87737	0.561000	0.74099	GCC			0.602	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251595.2		NM_003223	
GSPT1	2935	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	11990539	11990539	+	Silent	SNP	C	C	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr16:11990539C>A	ENST00000563468.1	-	2	152	c.126G>T	c.(124-126)ccG>ccT	p.P42P	GSPT1_ENST00000420576.2_Silent_p.P42P|RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000439887.2_Silent_p.P179P|GSPT1_ENST00000434724.2_Silent_p.P180P			P15170	ERF3A_HUMAN	G1 to S phase transition 1	42					G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						TTTCCTCTGGCGGCCTTCCAT	0.488																																					p.P180P													.	GSPT1	71		0			c.G540T												87.0	81.0	83.0					16																	11990539		1914	4133	6047	SO:0001819	synonymous_variant	2935	exon4			CTCTGGCGGCCTT	BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.126G>T	16.37:g.11990539C>A			Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	196	0.33	65	NM_002094	58	0.33	19	J3KQG6|Q96GF2	Silent	SNP	ENST00000563468.1	37	CCDS45414.1																																																																																					0.488	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000421513.1		NM_002094	
PLA2G15	23659	mdanderson.org	37	16	68279456	68279456	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr16:68279456G>T	ENST00000219345.5	+	1	210	c.127G>T	c.(127-129)Gtc>Ttc	p.V43F	PLA2G15_ENST00000566188.1_Splice_Site_p.V43F|PLA2G15_ENST00000444212.2_Splice_Site_p.G43*|PLA2G15_ENST00000413021.2_Splice_Site_p.G43C	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	43					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)			kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						AGTGGTGCTGGGTGAGGCACG	0.697																																					p.V43F													.	.			0			c.G127T												21.0	17.0	18.0					16																	68279456		2185	4281	6466	SO:0001630	splice_region_variant	23659	exon1			GTGCTGGGTGAGG	AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.127+1G>T	16.37:g.68279456G>T			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_012320	22	0.00	0	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Missense_Mutation	SNP	ENST00000219345.5	37	CCDS10864.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	34|34|34	5.352395|5.352395|5.352395	0.95830|0.95830|0.95830	.|.|.	.|.|.	ENSG00000103066|ENSG00000103066|ENSG00000103066	ENST00000413021|ENST00000444212|ENST00000219345	D|.|D	0.97303|.|0.96587	-4.33|.|-4.06	4.24|4.24|4.24	4.24|4.24|4.24	0.50183|0.50183|0.50183	.|.|.	.|.|0.187798	.|.|0.47455	.|.|D	.|.|0.000238	D|.|D	0.95570|.|0.95570	0.8560|.|0.8560	M|M|M	0.86864|0.86864|0.86864	2.845|2.845|2.845	0.80722|0.80722|0.80722	D|D|D	1|1|1	D|.|B;B	0.65815|.|0.29612	0.995|.|0.251;0.028	P|.|B;B	0.53649|.|0.22152	0.731|.|0.038;0.014	D|.|D	0.94909|.|0.94909	0.8063|.|0.8063	9|.|10	0.87932|0.72032|0.62326	D|D|D	0|0.01|0.03	0.2979|0.2979|0.2979	12.4253|12.4253|12.4253	0.55542|0.55542|0.55542	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	43|.|43;43	B4DUD1|.|B4DJW4;Q8NCC3	.|.|.;PAG15_HUMAN	C|X|F	43|43|43	ENSP00000394197:G43C|.|ENSP00000219345:V43F	ENSP00000394197:G43C|ENSP00000393610:G43X|ENSP00000219345:V43F	G|G|V	+|+|+	1|1|1	0|0|0	PLA2G15|PLA2G15|PLA2G15	66836957|66836957|66836957	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.766000|0.766000|0.766000	0.43426|0.43426|0.43426	2.595000|2.595000|2.595000	0.46197|0.46197|0.46197	2.653000|2.653000|2.653000	0.90120|0.90120|0.90120	0.511000|0.511000|0.511000	0.50034|0.50034|0.50034	GGC|GGA|GTC			0.697	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268888.2		NM_012320	Missense_Mutation
ANKRD11	29123	broad.mit.edu	37	16	89346906	89346906	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr16:89346906T>G	ENST00000301030.4	-	9	6504	c.6044A>C	c.(6043-6045)tAc>tCc	p.Y2015S	ANKRD11_ENST00000378330.2_Missense_Mutation_p.Y2015S	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2015	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGGGGCGGGGTACGGCGCCTC	0.721																																					p.Y2015S													.	ANKRD11	195		0			c.A6044C																																									SO:0001583	missense	29123	exon9			GCGGGGTACGGCG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.6044A>C	16.37:g.89346906T>G	ENSP00000301030:p.Tyr2015Ser		Somatic	53	0.6981132075	37		WXS	Illumina HiSeq	Phase_I	58	0.52	30	NM_001256183	63	0.21	13	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	t	13.45	2.242091	0.39598	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.41065	1.01;1.01	5.29	4.16	0.48862	.	0.171432	0.38778	N	0.001561	T	0.30386	0.0763	L	0.34521	1.04	0.80722	D	1	B	0.22800	0.075	B	0.17098	0.017	T	0.04991	-1.0913	10	0.25751	T	0.34	.	11.0477	0.47867	0.1395:0.0:0.0:0.8605	.	2015	Q6UB99	ANR11_HUMAN	S	2015	ENSP00000301030:Y2015S;ENSP00000367581:Y2015S	ENSP00000301030:Y2015S	Y	-	2	0	ANKRD11	87874407	1.000000	0.71417	0.977000	0.42913	0.023000	0.10783	4.288000	0.59007	0.795000	0.33922	0.370000	0.22315	TAC			0.721	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430462.3		NM_013275	
MSL1	339287	mdanderson.org	37	17	38288344	38288344	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr17:38288344T>C	ENST00000398532.4	+	5	1796	c.1481T>C	c.(1480-1482)cTt>cCt	p.L494P	MSL1_ENST00000579565.1_Missense_Mutation_p.L231P|MSL1_ENST00000578648.1_Missense_Mutation_p.L478P	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)	494					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						CCTTCAGACCTTTTGGAGGTA	0.413																																					p.L231P													.	.			0			c.T692C												45.0	43.0	44.0					17																	38288344		1830	4084	5914	SO:0001583	missense	339287	exon6			CAGACCTTTTGGA		CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.1481T>C	17.37:g.38288344T>C	ENSP00000381543:p.Leu494Pro		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001012241	46	0.00	0	Q0VF46|Q69Z03	Missense_Mutation	SNP	ENST00000398532.4	37		.	.	.	.	.	.	.	.	.	.	T	11.54	1.668736	0.29604	.	.	ENSG00000188895	ENST00000339569;ENST00000398532	T	0.40756	1.02	5.99	5.99	0.97316	.	0.499471	0.23680	N	0.045637	T	0.31606	0.0802	N	0.04880	-0.145	0.80722	D	1	.	.	.	.	.	.	T	0.32322	-0.9911	8	0.46703	T	0.11	-23.2976	14.0175	0.64533	0.0:0.0:0.0:1.0	.	.	.	.	P	231;494	ENSP00000381543:L494P	ENSP00000341409:L231P	L	+	2	0	MSL1	35541870	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.581000	0.60949	2.291000	0.77112	0.533000	0.62120	CTT			0.413	MSL1-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000447409.2		NM_001012241	
ACE	1636	mdanderson.org	37	17	61561704	61561704	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr17:61561704G>A	ENST00000290866.4	+	12	1747	c.1723G>A	c.(1723-1725)Gct>Act	p.A575T	ACE_ENST00000428043.1_Missense_Mutation_p.A575T|ACE_ENST00000290863.6_5'Flank|ACE_ENST00000577647.1_5'Flank|ACE_ENST00000421982.2_5'Flank|ACE_ENST00000490216.2_5'Flank|ACE_ENST00000413513.3_5'Flank	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	575	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GGTGCTGCAGGCTGGCTCCTC	0.652																																					p.A575T													.	.			0			c.G1723A												28.0	22.0	24.0					17																	61561704		2200	4293	6493	SO:0001583	missense	1636	exon12			CTGCAGGCTGGCT	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1723G>A	17.37:g.61561704G>A	ENSP00000290866:p.Ala575Thr		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_000789	6	0.00	0	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478768	0.26511	.	.	ENSG00000159640	ENST00000290866;ENST00000428043	T;T	0.34667	1.35;1.35	4.97	2.9	0.33743	.	0.331628	0.35262	N	0.003336	T	0.53126	0.1777	M	0.76170	2.325	0.80722	D	1	P;B	0.35894	0.526;0.266	B;P	0.54590	0.367;0.756	T	0.50136	-0.8863	10	0.45353	T	0.12	-3.8439	9.0106	0.36139	0.0:0.2666:0.4591:0.2743	.	575;575	P12821-2;P12821	.;ACE_HUMAN	T	575	ENSP00000290866:A575T;ENSP00000397593:A575T	ENSP00000290866:A575T	A	+	1	0	ACE	58915436	1.000000	0.71417	0.313000	0.25210	0.026000	0.11368	3.080000	0.50112	0.634000	0.30469	0.462000	0.41574	GCT			0.652	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337675.2			
SETBP1	26040	mdanderson.org	37	18	42531720	42531720	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr18:42531720G>T	ENST00000282030.5	+	4	2711	c.2415G>T	c.(2413-2415)atG>atT	p.M805I		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	805						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGAAAACTATGCCAAATCTCC	0.507									Schinzel-Giedion syndrome																												p.M805I													.	.			0			c.G2415T												64.0	65.0	65.0					18																	42531720		2203	4300	6503	SO:0001583	missense	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AACTATGCCAAAT	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2415G>T	18.37:g.42531720G>T	ENSP00000282030:p.Met805Ile		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_015559	4	0.00	0	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	19.90	3.911970	0.72983	.	.	ENSG00000152217	ENST00000282030	D	0.88975	-2.45	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.90219	0.6942	N	0.19112	0.55	0.54753	D	0.999986	D	0.67145	0.996	P	0.61874	0.895	D	0.90457	0.4443	10	0.56958	D	0.05	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	805	Q9Y6X0	SETBP_HUMAN	I	805	ENSP00000282030:M805I	ENSP00000282030:M805I	M	+	3	0	SETBP1	40785718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	ATG			0.507	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255854.4		NM_001130110	
MYO5B	4645	ucsc.edu	37	18	47429149	47429149	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr18:47429149C>T	ENST00000285039.7	-	21	2925	c.2626G>A	c.(2626-2628)Gca>Aca	p.A876T	MYO5B_ENST00000324581.6_Missense_Mutation_p.A17T	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	876	Arg-rich.|IQ 5. {ECO:0000255|PROSITE- ProRule:PRU00116}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TGCCTGCGTGCCATCCAGCCC	0.607																																					p.A876T													.	MYO5B	178		0			c.G2626A												26.0	30.0	29.0					18																	47429149		2040	4191	6231	SO:0001583	missense	4645	exon21			TGCGTGCCATCCA	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2626G>A	18.37:g.47429149C>T	ENSP00000285039:p.Ala876Thr		Somatic	15	0	0		WXS	Illumina HiSeq		21	0.19	4	NM_001080467	5	0.00	0	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	33	5.194027	0.94960	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.38401	1.14;1.14	5.63	5.63	0.86233	.	0.217059	0.38548	N	0.001644	T	0.53367	0.1792	L	0.59912	1.85	0.58432	D	0.999999	P;D	0.59767	0.784;0.986	P;P	0.56648	0.573;0.803	T	0.50759	-0.8790	10	0.56958	D	0.05	.	19.6675	0.95898	0.0:1.0:0.0:0.0	.	876;17	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	T	876;17	ENSP00000285039:A876T;ENSP00000315531:A17T	ENSP00000285039:A876T	A	-	1	0	MYO5B	45683147	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.934000	0.48956	2.826000	0.97356	0.655000	0.94253	GCA			0.607	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448515.2			
GRP	2922	mdanderson.org	37	18	56887564	56887564	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr18:56887564G>T	ENST00000256857.2	+	1	165	c.67G>T	c.(67-69)Gcg>Tcg	p.A23S	GRP_ENST00000420468.2_Missense_Mutation_p.A23S|GRP_ENST00000529320.2_Missense_Mutation_p.A23S	NM_001012512.1|NM_002091.3	NP_001012530.1|NP_002082.2	P07492	GRP_HUMAN	gastrin-releasing peptide	23					neuropeptide signaling pathway (GO:0007218)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			large_intestine(1)|lung(3)	4		Colorectal(73;0.0946)				CCGGGGGCGAGCGGTCCCGCT	0.761																																					p.A23S													.	.			0			c.G67T												3.0	5.0	4.0					18																	56887564		1988	3837	5825	SO:0001583	missense	2922	exon1			GGGCGAGCGGTCC		CCDS11971.1, CCDS45877.1, CCDS45878.1	18q21.1-q21.32	2013-02-26			ENSG00000134443	ENSG00000134443		"""Endogenous ligands"""	4605	protein-coding gene	gene with protein product	"""bombesin"", ""neuromedin C"", ""prepro-GRP"""	137260					Standard	NM_002091		Approved		uc002lhv.3	P07492	OTTHUMG00000132760	ENST00000256857.2:c.67G>T	18.37:g.56887564G>T	ENSP00000256857:p.Ala23Ser		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	15	0.20	3	NM_001012512	7	0.00	0	P07491|P81553|Q14454|Q53YA0|Q9BSY7	Missense_Mutation	SNP	ENST00000256857.2	37	CCDS11971.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623379	0.46840	.	.	ENSG00000134443	ENST00000256857;ENST00000529320;ENST00000420468	T;T;T	0.47177	0.85;0.93;0.87	4.02	2.21	0.28008	.	0.090124	0.42172	D	0.000754	T	0.41903	0.1179	L	0.34521	1.04	0.23180	N	0.99816	P;P;D	0.55172	0.869;0.916;0.97	P;B;P	0.51193	0.475;0.409;0.662	T	0.21999	-1.0229	10	0.48119	T	0.1	-6.5056	7.6949	0.28590	0.2047:0.0:0.7953:0.0	.	23;23;23	P07492-3;P07492;P07492-2	.;GRP_HUMAN;.	S	23	ENSP00000256857:A23S;ENSP00000434101:A23S;ENSP00000389696:A23S	ENSP00000256857:A23S	A	+	1	0	GRP	55038544	0.971000	0.33674	0.292000	0.24919	0.651000	0.38670	1.921000	0.40035	0.361000	0.24292	0.549000	0.68633	GCG			0.761	GRP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256131.2		NM_002091	
APC2	10297	mdanderson.org	37	19	1467050	1467050	+	Silent	SNP	C	C	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr19:1467050C>T	ENST00000535453.1	+	14	5463	c.3750C>T	c.(3748-3750)tgC>tgT	p.C1250C	APC2_ENST00000238483.4_Silent_p.C976C|APC2_ENST00000233607.2_Silent_p.C1250C|C19orf25_ENST00000588427.1_Intron			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAGCGCTGCCGGCTGCCAT	0.687																																					p.C1250C													.	.			0			c.C3750T												16.0	17.0	17.0					19																	1467050		2157	4228	6385	SO:0001819	synonymous_variant	10297	exon15			GCGCTGCCGGCTG		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.3750C>T	19.37:g.1467050C>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_005883	4	0.00	0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	ENST00000535453.1	37	CCDS12068.1																																																																																					0.687	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449539.2		NM_005883	
MEX3D	399664	mdanderson.org	37	19	1556639	1556639	+	Silent	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr19:1556639G>T	ENST00000402693.4	-	2	878	c.879C>A	c.(877-879)ggC>ggA	p.G293G	AC027307.2_ENST00000581992.1_RNA|MEX3D_ENST00000388824.6_Silent_p.G293G|AC027307.1_ENST00000410788.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D	293	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGATGGTGGCGCCCTTGGGCC	0.716																																					p.G293G													.	.			0			c.C879A												22.0	24.0	23.0					19																	1556639		2195	4295	6490	SO:0001819	synonymous_variant	399664	exon2			GGTGGCGCCCTTG	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.879C>A	19.37:g.1556639G>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_001174118	42	0.00	0	A0PJL8|A1L023|E9PAL6|Q71M49	Silent	SNP	ENST00000402693.4	37	CCDS32865.2																																																																																					0.716	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000317870.2		NM_203304	
CPAMD8	27151	mdanderson.org	37	19	17038840	17038840	+	Silent	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr19:17038840G>T	ENST00000443236.1	-	25	3521	c.3490C>A	c.(3490-3492)Cga>Aga	p.R1164R		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1117						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GCGGTGGCTCGCTCAGACCCA	0.617																																					p.R1164R													.	.			0			c.C3490A												42.0	51.0	48.0					19																	17038840		2036	4175	6211	SO:0001819	synonymous_variant	27151	exon25			TGGCTCGCTCAGA	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3490C>A	19.37:g.17038840G>T			Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	72	0.06	4	NM_015692	18	0.00	0	Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	G	1.142	-0.649320	0.03506	.	.	ENSG00000160111	ENST00000443236	.	.	.	3.02	1.9	0.25705	.	.	.	.	.	T	0.55609	0.1931	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51568	-0.8689	4	.	.	.	.	7.8107	0.29230	0.0:0.0:0.3646:0.6354	.	.	.	.	R	1174	.	.	S	-	3	2	CPAMD8	16899840	1.000000	0.71417	0.658000	0.29665	0.098000	0.18820	5.239000	0.65371	1.237000	0.43756	0.655000	0.94253	AGC			0.617	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257531.2		NM_015692	
NCCRP1	342897	mdanderson.org	37	19	39691041	39691041	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr19:39691041G>T	ENST00000339852.4	+	5	626	c.604G>T	c.(604-606)Gcg>Tcg	p.A202S		NM_001001414.1	NP_001001414.1	Q6ZVX7	FBX50_HUMAN	non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)	202	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	10						CTGGCTGCTGGCGGCCGACCG	0.667																																					p.A202S	Melanoma(107;1207 1556 14956 29427 52130)												NCCRP1,colon,carcinoma,-1,1	NCCRP1	-1	1	0			c.G604T												67.0	77.0	74.0					19																	39691041		2203	4300	6503	SO:0001583	missense	342897	exon5			CTGCTGGCGGCCG	AK123941, BC067874	CCDS12529.1	19q13.2	2013-07-31	2008-11-19		ENSG00000188505	ENSG00000188505			33739	protein-coding gene	gene with protein product		615901					Standard	NM_001001414		Approved	LOC342897, NCCRP-1, FBXO50	uc002okq.1	Q6ZVX7		ENST00000339852.4:c.604G>T	19.37:g.39691041G>T	ENSP00000342137:p.Ala202Ser		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001001414	15	0.00	0	Q6NVV5	Missense_Mutation	SNP	ENST00000339852.4	37	CCDS12529.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154528	0.38021	.	.	ENSG00000188505	ENST00000339852	T	0.27557	1.66	5.23	4.12	0.48240	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.246767	0.39475	N	0.001349	T	0.26011	0.0634	N	0.11106	0.095	0.39503	D	0.96823	D	0.56287	0.975	P	0.59012	0.85	T	0.02484	-1.1152	10	0.06891	T	0.86	-20.2361	12.9656	0.58481	0.0:0.164:0.836:0.0	.	202	Q6ZVX7	NCRP1_HUMAN	S	202	ENSP00000342137:A202S	ENSP00000342137:A202S	A	+	1	0	NCCRP1	44382881	1.000000	0.71417	0.991000	0.47740	0.059000	0.15707	5.499000	0.66937	2.455000	0.83008	0.561000	0.74099	GCG			0.667	NCCRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463829.1		NM_001001414	
FIZ1	84922	mdanderson.org	37	19	56109217	56109217	+	Silent	SNP	G	G	T	rs537566398		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr19:56109217G>T	ENST00000221665.3	-	2	104	c.15C>A	c.(13-15)ccC>ccA	p.P5P	ZNF524_ENST00000301073.3_5'Flank|FIZ1_ENST00000592585.1_Silent_p.P5P	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	5					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GGGTTGGGGCGGGGACGTCAT	0.662																																					p.P5P													.	.			0			c.C15A												9.0	10.0	10.0					19																	56109217		2188	4272	6460	SO:0001819	synonymous_variant	84922	exon2			TGGGGCGGGGACG	AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.15C>A	19.37:g.56109217G>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_032836	10	0.00	0	A2RU72|Q6ZMJ7	Silent	SNP	ENST00000221665.3	37	CCDS12928.1																																																																																					0.662	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453350.1		NM_032836	
ZSCAN18	65982	mdanderson.org	37	19	58600117	58600117	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr19:58600117C>G	ENST00000240727.6	-	3	890	c.491G>C	c.(490-492)gGc>gCc	p.G164A	ZSCAN18_ENST00000601144.1_Missense_Mutation_p.G164A|ZSCAN18_ENST00000600404.1_Missense_Mutation_p.G220A|ZSCAN18_ENST00000421612.2_Missense_Mutation_p.G29A	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	164					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CGCGAGCTCGCCTGGTAGCAG	0.642																																					p.G220A													.	.			0			c.G659C												42.0	40.0	41.0					19																	58600117		2203	4300	6503	SO:0001583	missense	65982	exon3			AGCTCGCCTGGTA	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.491G>C	19.37:g.58600117C>G	ENSP00000240727:p.Gly164Ala		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	30	0.07	2	NM_001145542	41	0.00	0	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Missense_Mutation	SNP	ENST00000240727.6	37	CCDS12971.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.589787	0.00864	.	.	ENSG00000121413	ENST00000433686;ENST00000240727;ENST00000421612	T;T	0.02140	4.61;4.43	2.43	1.35	0.21983	.	.	.	.	.	T	0.01124	0.0037	N	0.14661	0.345	0.09310	N	1	B;P;B;B;P	0.39216	0.127;0.601;0.049;0.201;0.664	B;B;B;B;B	0.32393	0.091;0.091;0.005;0.115;0.145	T	0.38628	-0.9652	9	0.07325	T	0.83	0.5303	6.2885	0.21047	0.3373:0.6627:0.0:0.0	.	220;29;234;164;164	B4DG23;E9PBI0;Q6ZMK6;Q8TBC5-2;Q8TBC5	.;.;.;.;ZSC18_HUMAN	A	220;164;29	ENSP00000240727:G164A;ENSP00000392653:G29A	ENSP00000240727:G164A	G	-	2	0	ZSCAN18	63291929	0.001000	0.12720	0.003000	0.11579	0.003000	0.03518	0.278000	0.18753	0.540000	0.28808	-0.397000	0.06425	GGC			0.642	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000466706.1		NM_023926	
RIF1	55183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152321277	152321277	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr2:152321277G>C	ENST00000243326.5	+	29	5726	c.5243G>C	c.(5242-5244)gGg>gCg	p.G1748A	RIF1_ENST00000453091.2_Missense_Mutation_p.G1748A|RIF1_ENST00000444746.2_Missense_Mutation_p.G1748A|RIF1_ENST00000428287.2_Missense_Mutation_p.G1748A|RIF1_ENST00000430328.2_Missense_Mutation_p.G1748A			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.I1747_N1754del(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TCACTCATTGGGTTAAAGAAT	0.408																																					p.G1748A													.	.			1	Deletion - In frame(1)	lung(1)	c.G5243C												42.0	44.0	43.0					2																	152321277		2203	4298	6501	SO:0001583	missense	55183	exon30			TCATTGGGTTAAA	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.5243G>C	2.37:g.152321277G>C	ENSP00000243326:p.Gly1748Ala		Somatic	107	0	0		WXS	Illumina HiSeq	.	143	0.30	43	NM_018151	7	0.57	4	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	G	4.585	0.108612	0.08780	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.10192	2.91;2.9;2.9;2.91;2.9	5.24	1.0	0.19881	.	0.650776	0.16150	N	0.227295	T	0.07638	0.0192	L	0.34521	1.04	0.09310	N	1	P;P	0.46512	0.807;0.879	B;P	0.45639	0.294;0.488	T	0.18304	-1.0341	10	0.33141	T	0.24	-1.1988	0.1159	0.00060	0.2617:0.1758:0.2533:0.3093	.	1748;1748	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	A	1748	ENSP00000390181:G1748A;ENSP00000414615:G1748A;ENSP00000415691:G1748A;ENSP00000243326:G1748A;ENSP00000416123:G1748A	ENSP00000243326:G1748A	G	+	2	0	RIF1	152029523	0.973000	0.33851	0.772000	0.31596	0.182000	0.23217	0.648000	0.24828	0.554000	0.29061	0.505000	0.49811	GGG			0.408	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254836.3			
ZDBF2	57683	mdanderson.org	37	2	207162013	207162013	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr2:207162013G>T	ENST00000374423.3	+	4	490	c.104G>T	c.(103-105)aGa>aTa	p.R35I		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	35							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGACAGAGTAGACGTCAAATA	0.383																																					p.R35I													.	.			0			c.G104T												128.0	116.0	119.0					2																	207162013		1871	4120	5991	SO:0001583	missense	57683	exon4			AGAGTAGACGTCA	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.104G>T	2.37:g.207162013G>T	ENSP00000363545:p.Arg35Ile		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	112	0.04	5	NM_020923	3	0.00	0	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047097	0.75846	.	.	ENSG00000204186	ENST00000374423	T	0.54675	0.56	4.73	4.73	0.59995	Zinc finger, DBF-type (1);	.	.	.	.	T	0.63117	0.2484	L	0.32530	0.975	0.31898	N	0.616309	D	0.89917	1.0	D	0.91635	0.999	T	0.68561	-0.5376	9	0.87932	D	0	.	14.9649	0.71184	0.0:0.0:1.0:0.0	.	35	Q9HCK1	ZDBF2_HUMAN	I	35	ENSP00000363545:R35I	ENSP00000363545:R35I	R	+	2	0	ZDBF2	206870258	1.000000	0.71417	0.113000	0.21522	0.192000	0.23643	6.028000	0.70889	2.341000	0.79615	0.484000	0.47621	AGA			0.383	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336458.1		NM_020923	
IRS1	3667	broad.mit.edu;mdanderson.org	37	2	227662443	227662443	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr2:227662443G>A	ENST00000305123.5	-	1	2032	c.1012C>T	c.(1012-1014)Cgc>Tgc	p.R338C	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	338	Ser-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GAGGCTGGGCGGGACATGGTG	0.711											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R338C													.	IRS1	141		0			c.C1012T												49.0	55.0	53.0					2																	227662443		2196	4281	6477	SO:0001583	missense	3667	exon1			CTGGGCGGGACAT		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1012C>T	2.37:g.227662443G>A	ENSP00000304895:p.Arg338Cys		Somatic	17	0	0	2321	WXS	Illumina HiSeq	Phase_I	10	0.40	4	NM_005544	16	0.44	7		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061859	0.55432	.	.	ENSG00000169047	ENST00000305123	T	0.62788	-0.0	5.66	4.76	0.60689	.	0.000000	0.64402	D	0.000001	T	0.75451	0.3851	M	0.64404	1.975	0.54753	D	0.999988	D	0.89917	1.0	D	0.91635	0.999	T	0.77067	-0.2725	10	0.59425	D	0.04	-21.1424	12.8597	0.57906	0.0:0.0:0.5535:0.4465	.	338	P35568	IRS1_HUMAN	C	338	ENSP00000304895:R338C	ENSP00000304895:R338C	R	-	1	0	IRS1	227370687	1.000000	0.71417	0.978000	0.43139	0.671000	0.39405	4.951000	0.63610	1.340000	0.45581	0.462000	0.41574	CGC			0.711	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256886.3		NM_005544	
PTPRT	11122	broad.mit.edu;mdanderson.org	37	20	40730919	40730919	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr20:40730919G>T	ENST00000373187.1	-	26	3558	c.3559C>A	c.(3559-3561)Ccc>Acc	p.P1187T	PTPRT_ENST00000373198.4_Missense_Mutation_p.P1206T|PTPRT_ENST00000373190.1_Missense_Mutation_p.P1186T|PTPRT_ENST00000356100.2_Missense_Mutation_p.P1196T|PTPRT_ENST00000373201.1_Missense_Mutation_p.P1177T|PTPRT_ENST00000373193.3_Missense_Mutation_p.P1190T|PTPRT_ENST00000373184.1_Missense_Mutation_p.P1197T			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1187	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CGCACACGGGGTGTCACAATG	0.567																																					p.P1206T													.	PTPRT	372		0			c.C3616A												52.0	55.0	54.0					20																	40730919		2050	4220	6270	SO:0001583	missense	11122	exon27			CACGGGGTGTCAC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3559C>A	20.37:g.40730919G>T	ENSP00000362283:p.Pro1187Thr		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	66	0.06	4	NM_133170	3	0.00	0	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.502139	0.85176	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5;2.5;2.5	5.49	5.49	0.81192	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	D	0.000000	T	0.39172	0.1068	M	0.67517	2.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	T	0.11867	-1.0570	10	0.87932	D	0	.	19.3736	0.94500	0.0:0.0:1.0:0.0	.	1209;1187	O14522-1;O14522	.;PTPRT_HUMAN	T	1186;1187;1190;1196;1209;1197;1177	ENSP00000362286:P1186T;ENSP00000362283:P1187T;ENSP00000362289:P1190T;ENSP00000348408:P1196T;ENSP00000362294:P1209T;ENSP00000362280:P1197T;ENSP00000362297:P1177T	ENSP00000348408:P1196T	P	-	1	0	PTPRT	40164333	1.000000	0.71417	0.615000	0.29064	0.791000	0.44710	9.869000	0.99810	2.592000	0.87571	0.655000	0.94253	CCC			0.567	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000080315.1			
ELMO2	63916	mdanderson.org	37	20	45000326	45000326	+	Silent	SNP	G	G	A	rs149080790		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr20:45000326G>A	ENST00000290246.6	-	18	1779	c.1585C>T	c.(1585-1587)Ctg>Ttg	p.L529L	ELMO2_ENST00000396391.1_Silent_p.L529L|ELMO2_ENST00000352077.2_Silent_p.L527L|ELMO2_ENST00000372176.1_Silent_p.L441L|ELMO2_ENST00000454865.2_Silent_p.L261L|ELMO2_ENST00000445496.2_Silent_p.L346L|ELMO2_ENST00000488853.1_5'Flank|ELMO2_ENST00000439931.2_Silent_p.L541L	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	529					apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				TTCTCCCTCAGCTCCCTGGGG	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		19624	0.0		0.001	False		,,,				2504	0.0				p.L529L													.	.			0			c.C1585T							G	,	1,4405	2.1+/-5.4	0,1,2202	38.0	39.0	39.0		1585,1585	3.7	1.0	20	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ELMO2	NM_133171.3,NM_182764.1	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	529/721,529/721	45000326	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	63916	exon18			CCCTCAGCTCCCT	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.1585C>T	20.37:g.45000326G>A			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_133171	49	0.00	0	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Silent	SNP	ENST00000290246.6	37	CCDS13398.1																																																																																			0		0.627	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080466.1		NM_022086	
CHEK2	11200	broad.mit.edu	37	22	29091840	29091841	+	Missense_Mutation	DNP	TG	TG	CA	rs142470496|rs146546850	byFrequency	TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr22:29091840_29091841TG>CA	ENST00000405598.1	-	12	1307_1308	c.1116_1117CA>TG	c.(1114-1119)tcCAag>tcTGag	p.K373E	CHEK2_ENST00000403642.1_Missense_Mutation_p.K282E|CHEK2_ENST00000328354.6_Missense_Mutation_p.K373E|CHEK2_ENST00000544772.1_Missense_Mutation_p.K152E|CHEK2_ENST00000402731.1_Missense_Mutation_p.K344E|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000382580.2_Missense_Mutation_p.K416E|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000404276.1_Missense_Mutation_p.K373E|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000382578.1_Missense_Mutation_p.K282E|CHEK2_ENST00000348295.3_Missense_Mutation_p.K344E			O96017	CHK2_HUMAN	checkpoint kinase 2	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.K373E(9)|p.S372S(8)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCCAAAATCTTGGAGTGCCCAA	0.416			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.K416E			yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	CHEK2,bladder,carcinoma,0,38	CHEK2	438	38	17	Substitution - Missense(9)|Substitution - coding silent(8)	kidney(8)|prostate(4)|endometrium(2)|central_nervous_system(2)|stomach(1)	c.C1245T																																									SO:0001583	missense	11200	exon12			AAATCTTGGAGTG	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1116_1117delinsCA	22.37:g.29091840_29091841delinsCA	ENSP00000386087:p.Lys373Glu		Somatic	217	0	0		WXS	Illumina HiSeq	Phase_I	279	0.03	7	NM_001005735	32	0.00	0	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	DNP	ENST00000405598.1	37	CCDS13843.1																																																																																					0.416	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000321150.1		NM_001005735	
TRMU	55687	mdanderson.org	37	22	46731700	46731700	+	Silent	SNP	C	C	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr22:46731700C>T	ENST00000290846.4	+	1	379	c.39C>T	c.(37-39)ggC>ggT	p.G13G	TRMU_ENST00000381019.3_Silent_p.G13G|TRMU_ENST00000424260.2_5'Flank	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	13					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		CCCTGTCCGGCGGCGTGGACA	0.726																																					p.G13G													.	.			0			c.C39T												7.0	8.0	8.0					22																	46731700		2071	4048	6119	SO:0001819	synonymous_variant	55687	exon1			GTCCGGCGGCGTG	AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.39C>T	22.37:g.46731700C>T			Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_018006	23	0.00	0	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Silent	SNP	ENST00000290846.4	37	CCDS14075.1																																																																																					0.726	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318042.2		NM_018006	
USP4	7375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49318243	49318243	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr3:49318243C>G	ENST00000265560.4	-	20	2624	c.2578G>C	c.(2578-2580)Gca>Cca	p.A860P	C3orf62_ENST00000343010.3_5'Flank|USP4_ENST00000351842.4_Missense_Mutation_p.A813P	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	860	USP.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TAAGGCCTTGCTGACAGGTTA	0.423																																					p.A860P													.	.			0			c.G2578C												152.0	125.0	134.0					3																	49318243		2203	4300	6503	SO:0001583	missense	7375	exon20			GCCTTGCTGACAG	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.2578G>C	3.37:g.49318243C>G	ENSP00000265560:p.Ala860Pro		Somatic	84	0	0		WXS	Illumina HiSeq	.	79	0.32	25	NM_003363	85	0.40	34	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.294404|4.294404	0.81025|0.81025	.|.	.|.	ENSG00000114316|ENSG00000114316	ENST00000351842;ENST00000265560|ENST00000431357	T;T|T	0.31769|0.03065	1.48;1.48|4.06	5.58|5.58	5.58|5.58	0.84498|0.84498	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);|.	0.051328|.	0.85682|.	D|.	0.000000|.	T|T	0.10465|0.10465	0.0256|0.0256	L|L	0.45137|0.45137	1.4|1.4	0.80722|0.80722	D|D	1|1	D;B;D|.	0.63880|.	0.993;0.055;0.988|.	P;B;P|.	0.58820|.	0.815;0.035;0.846|.	T|T	0.01591|0.01591	-1.1317|-1.1317	10|7	0.33141|0.51188	T|T	0.24|0.08	-4.303|-4.303	18.1481|18.1481	0.89665|0.89665	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	813;860;860|.	Q13107-2;Q13107;Q08AK7|.	.;UBP4_HUMAN;.|.	P|T	813;860|598	ENSP00000341028:A813P;ENSP00000265560:A860P|ENSP00000399079:S598T	ENSP00000265560:A860P|ENSP00000399079:S598T	A|S	-|-	1|2	0|0	USP4|USP4	49293247|49293247	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.884000|0.884000	0.51177|0.51177	6.033000|6.033000	0.70925|0.70925	2.629000|2.629000	0.89072|0.89072	0.563000|0.563000	0.77884|0.77884	GCA|AGC			0.423	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346069.1		NM_199443	
MUC4	4585	broad.mit.edu	37	3	195512457	195512457	+	Silent	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr3:195512457G>A	ENST00000463781.3	-	2	6453	c.5994C>T	c.(5992-5994)gcC>gcT	p.A1998A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.A1998A|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAAGAGGGGTGGCATGACCTG	0.602																																					p.A1998A													.	MUC4	1505		0			c.C5994T												38.0	39.0	39.0					3																	195512457		684	1588	2272	SO:0001819	synonymous_variant	4585	exon2			AGGGGTGGCATGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5994C>T	3.37:g.195512457G>A			Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_I	105	0.05	5	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																					0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
BRD9	65980	mdanderson.org	37	5	865672	865672	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr5:865672G>T	ENST00000467963.1	-	15	1716	c.1550C>A	c.(1549-1551)cCt>cAt	p.P517H	BRD9_ENST00000483173.1_Missense_Mutation_p.P464H|BRD9_ENST00000388890.4_Missense_Mutation_p.P401H|BRD9_ENST00000323510.4_Missense_Mutation_p.P421H	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	517					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GCTGTCGTCAGGGTCCAGCTC	0.627																																					p.P517H													.	.			0			c.C1550A												174.0	171.0	172.0					5																	865672		2203	4300	6503	SO:0001583	missense	65980	exon15			TCGTCAGGGTCCA	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1550C>A	5.37:g.865672G>T	ENSP00000419765:p.Pro517His		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_023924	57	0.00	0	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	37	CCDS34127.2	.	.	.	.	.	.	.	.	.	.	g	1.791	-0.479623	0.04383	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.36	-6.16	0.02098	.	0.507714	0.23407	N	0.048514	T	0.11707	0.0285	N	0.01267	-0.92	0.19575	N	0.999966	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.21759	-1.0236	10	0.22706	T	0.39	.	10.4274	0.44387	0.0:0.1246:0.5687:0.3067	.	464;517;421;401	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	H	421;401;464;517	ENSP00000323557:P421H;ENSP00000373542:P401H;ENSP00000419845:P464H;ENSP00000419765:P517H	ENSP00000323557:P421H	P	-	2	0	BRD9	918672	0.961000	0.32948	0.001000	0.08648	0.030000	0.12068	1.626000	0.37039	-1.471000	0.01886	-1.086000	0.02197	CCT			0.627	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354113.1		NM_023924	
IRX2	153572	mdanderson.org	37	5	2751510	2751510	+	Silent	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr5:2751510G>T	ENST00000382611.6	-	1	266	c.18C>A	c.(16-18)ggC>ggA	p.G6G	C5orf38_ENST00000505778.1_5'Flank|C5orf38_ENST00000457752.2_5'Flank|C5orf38_ENST00000397835.4_5'Flank|C5orf38_ENST00000515640.1_5'Flank|IRX2_ENST00000302057.5_Silent_p.G6G|IRX2_ENST00000502957.1_Intron|C5orf38_ENST00000334000.3_5'Flank	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	6					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		GGTACAGGTAGCCCTGCGGGT	0.796																																					p.G6G													.	.			0			c.C18A												2.0	2.0	2.0					5																	2751510		1357	2978	4335	SO:0001819	synonymous_variant	153572	exon1			CAGGTAGCCCTGC	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.18C>A	5.37:g.2751510G>T			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_001134222	0		0	Q68A19|Q7Z2I7	Silent	SNP	ENST00000382611.6	37	CCDS3868.1																																																																																					0.796	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206749.2			
IRX1	79192	broad.mit.edu;mdanderson.org	37	5	3600194	3600194	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr5:3600194G>A	ENST00000302006.3	+	2	1184	c.1132G>A	c.(1132-1134)Gca>Aca	p.A378T	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	378					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A378T(1)		biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GACCAACAGCGCATTCCTCGC	0.687																																					p.A378T													IRX1,rectum,carcinoma,0,1	IRX1	106	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1132A												49.0	41.0	43.0					5																	3600194		2201	4300	6501	SO:0001583	missense	79192	exon2			AACAGCGCATTCC	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1132G>A	5.37:g.3600194G>A	ENSP00000305244:p.Ala378Thr		Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	133	0.04	5	NM_024337	22	0.00	0	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895790	0.52121	.	.	ENSG00000170549	ENST00000302006	T	0.64438	-0.1	4.3	4.3	0.51218	.	0.055128	0.64402	D	0.000001	T	0.77691	0.4168	M	0.70275	2.135	0.53688	D	0.999973	D	0.89917	1.0	D	0.83275	0.996	T	0.78568	-0.2154	10	0.40728	T	0.16	.	16.7647	0.85521	0.0:0.0:1.0:0.0	.	378	P78414	IRX1_HUMAN	T	378	ENSP00000305244:A378T	ENSP00000305244:A378T	A	+	1	0	IRX1	3653194	1.000000	0.71417	0.995000	0.50966	0.113000	0.19764	6.847000	0.75404	1.900000	0.55004	0.563000	0.77884	GCA			0.687	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365546.1		NM_024337	
ARHGEF28	64283	mdanderson.org	37	5	73205560	73205560	+	Silent	SNP	C	C	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr5:73205560C>A	ENST00000426542.2	+	33	4505	c.4485C>A	c.(4483-4485)ctC>ctA	p.L1495L	ARHGEF28_ENST00000545377.1_Silent_p.L1495L|ARHGEF28_ENST00000437974.1_Silent_p.L1495L|ARHGEF28_ENST00000296799.4_Silent_p.L1182L|ARHGEF28_ENST00000513042.2_Silent_p.L1495L|ARHGEF28_ENST00000287898.5_Silent_p.L1451L|ARHGEF28_ENST00000296794.6_Silent_p.L1495L|ARHGEF28_ENST00000512883.1_Silent_p.L415L			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1495	Interaction with microtubules. {ECO:0000250}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										AGCTGGACCTCCAGCTCCAGG	0.726																																					p.L1495L													.	.			0			c.C4485A												3.0	5.0	4.0					5																	73205560		1810	3811	5621	SO:0001819	synonymous_variant	64283	exon34			GGACCTCCAGCTC		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.4485C>A	5.37:g.73205560C>A			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_001177693	7	0.00	0	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	ENST00000426542.2	37	CCDS54870.1																																																																																					0.726	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000368975.1			
ERAP1	51752	hgsc.bcm.edu;bcgsc.ca	37	5	96119761	96119761	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr5:96119761T>C	ENST00000443439.2	-	14	2033	c.1967A>G	c.(1966-1968)aAg>aGg	p.K656R	ERAP1_ENST00000514604.1_5'UTR|CTD-2260A17.1_ENST00000512856.1_RNA|ERAP1_ENST00000296754.3_Missense_Mutation_p.K656R|CTD-2260A17.1_ENST00000602972.1_RNA	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	656					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		ATCCAAGGCCTTTTCAATGGA	0.363																																					p.K656R													.	.			0			c.A1967G												105.0	101.0	102.0					5																	96119761		2203	4300	6503	SO:0001583	missense	51752	exon14			AAGGCCTTTTCAA	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.1967A>G	5.37:g.96119761T>C	ENSP00000406304:p.Lys656Arg		Somatic	107	0	0		WXS	Illumina HiSeq	.	83	0.05	4	NM_001198541	16	0.00	0	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	37	CCDS47250.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.926977	0.52759	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.05199	3.48;3.48	5.68	5.68	0.88126	.	0.143883	0.64402	D	0.000008	T	0.11836	0.0288	L	0.60904	1.88	0.50171	D	0.999856	B;P;P	0.46395	0.086;0.764;0.877	B;P;B	0.46389	0.042;0.515;0.38	T	0.16778	-1.0391	10	0.21540	T	0.41	.	15.5946	0.76569	0.0:0.0:0.0:1.0	.	656;656;656	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	R	656	ENSP00000296754:K656R;ENSP00000406304:K656R	ENSP00000296754:K656R	K	-	2	0	ERAP1	96145517	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.732000	0.55021	2.172000	0.68678	0.533000	0.62120	AAG			0.363	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370699.1		NM_016442	
ALDH5A1	7915	ucsc.edu;bcgsc.ca	37	6	24520647	24520647	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr6:24520647G>A	ENST00000357578.3	+	6	1034	c.889G>A	c.(889-891)Gca>Aca	p.A297T	ALDH5A1_ENST00000491546.1_Missense_Mutation_p.A269T|ALDH5A1_ENST00000348925.2_Missense_Mutation_p.A310T|ALDH5A1_ENST00000546278.1_Missense_Mutation_p.A209T	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	297					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	GCACCACGCAGCAAACTCTGT	0.478																																					p.A310T													.	ALDH5A1	42		0			c.G928A												131.0	141.0	137.0					6																	24520647		2203	4300	6503	SO:0001583	missense	7915	exon7			CACGCAGCAAACT	L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.889G>A	6.37:g.24520647G>A	ENSP00000350191:p.Ala297Thr		Somatic	57	0	0		WXS	Illumina HiSeq		41	0.10	4	NM_170740	19	0.00	0	B2RD26|G5E949|Q546H9|Q8N3W6	Missense_Mutation	SNP	ENST00000357578.3	37	CCDS4555.1	.	.	.	.	.	.	.	.	.	.	G	32	5.152267	0.94645	.	.	ENSG00000112294	ENST00000357578;ENST00000546278;ENST00000491546;ENST00000348925	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.5	5.5	0.81552	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.90249	0.6951	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91338	0.5095	10	0.87932	D	0	-18.7045	19.6014	0.95563	0.0:0.0:1.0:0.0	.	297;310	P51649;G5E949	SSDH_HUMAN;.	T	297;209;269;310	ENSP00000350191:A297T;ENSP00000438193:A209T;ENSP00000417687:A269T;ENSP00000314649:A310T	ENSP00000314649:A310T	A	+	1	0	ALDH5A1	24628626	1.000000	0.71417	0.932000	0.37286	0.867000	0.49689	9.513000	0.98010	2.854000	0.98071	0.655000	0.94253	GCA			0.478	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040007.2			
VWA7	80737	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31740800	31740800	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr6:31740800G>T	ENST00000375688.4	-	7	1218	c.1018C>A	c.(1018-1020)Ctt>Att	p.L340I	VWA7_ENST00000375686.3_Missense_Mutation_p.L340I|VWA7_ENST00000447450.1_Missense_Mutation_p.L340I|VWA7_ENST00000467576.1_5'UTR			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	340	VWFA.					extracellular region (GO:0005576)											TGCTCCACAAGGTGGCGAGCC	0.602																																					p.L340I													.	.			0			c.C1018A												49.0	40.0	43.0					6																	31740800		1510	2709	4219	SO:0001583	missense	80737	exon7			CCACAAGGTGGCG		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1018C>A	6.37:g.31740800G>T	ENSP00000364840:p.Leu340Ile		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	36	0.17	6	NM_025258	3	0.00	0	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	T	1.675	-0.507871	0.04231	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	D;D;D	0.98280	-4.84;-4.84;-4.84	5.74	5.74	0.90152	von Willebrand factor, type A (1);	0.000000	0.85682	N	0.000000	T	0.72293	0.3442	N	0.00056	-2.365	0.23765	N	0.9969	B	0.02656	0.0	B	0.01281	0.0	T	0.65315	-0.6198	10	0.02654	T	1	-8.7759	11.4371	0.50074	0.0:0.0:0.1514:0.8486	.	340	Q9Y334	G7C_HUMAN	I	340	ENSP00000364840:L340I;ENSP00000364838:L340I;ENSP00000390554:L340I	ENSP00000364838:L340I	L	-	1	0	C6orf27	31848779	1.000000	0.71417	0.893000	0.35052	0.042000	0.13812	4.106000	0.57804	1.003000	0.39130	-0.374000	0.07098	CTT			0.602	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076233.2		NM_025258	
NELFE	7936	mdanderson.org	37	6	31922451	31922451	+	Missense_Mutation	SNP	C	C	T	rs377559803|rs559007998|rs556062290	byFrequency	TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr6:31922451C>T	ENST00000375429.3	-	7	849	c.623G>A	c.(622-624)cGg>cAg	p.R208Q	NELFE_ENST00000444811.2_Missense_Mutation_p.R178Q|NELFE_ENST00000375425.5_Missense_Mutation_p.R215Q|MIR1236_ENST00000408340.1_RNA	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	208	30 X 2 AA approximate tandem repeats of R-[DSNE].				gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R208_D211delRDRD(1)									gtctcgatcccggtctcgatc	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		18138	0.001		0.0	False		,,,				2504	0.0				p.R208Q													.	.			1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.G623A												38.0	36.0	37.0					6																	31922451		2203	4299	6502	SO:0001583	missense	7936	exon7			CGATCCCGGTCTC	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.623G>A	6.37:g.31922451C>T	ENSP00000364578:p.Arg208Gln		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	92	0.04	4	NM_002904	316	0.00	0	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Missense_Mutation	SNP	ENST00000375429.3	37	CCDS4730.1	.	.	.	.	.	.	.	.	.	.	C	1.159	-0.644297	0.03531	.	.	ENSG00000204356	ENST00000375429;ENST00000375425;ENST00000444811;ENST00000441998;ENST00000454913;ENST00000436289	T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15	1.42	0.467	0.16721	.	0.267390	0.27792	N	0.017824	T	0.33962	0.0881	M	0.87547	2.89	0.09310	N	1	B;B;B;B	0.25235	0.037;0.015;0.121;0.037	B;B;B;B	0.09377	0.002;0.002;0.004;0.002	T	0.37572	-0.9700	10	0.54805	T	0.06	-0.6062	3.7352	0.08508	0.0:0.7268:0.0:0.2732	.	178;203;203;208	B4DUN1;A2ABK1;E9PCL7;P18615	.;.;.;NELFE_HUMAN	Q	208;215;178;203;208;203	ENSP00000364578:R208Q;ENSP00000364574:R215Q;ENSP00000388400:R178Q;ENSP00000397914:R203Q;ENSP00000409389:R208Q;ENSP00000414029:R203Q	ENSP00000364574:R215Q	R	-	2	0	RDBP	32030430	0.031000	0.19500	0.001000	0.08648	0.115000	0.19883	2.529000	0.45632	-0.247000	0.09597	-0.244000	0.11960	CGG			0.672	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000076047.4			
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65596686	65596686	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr6:65596686C>G	ENST00000370621.3	-	19	3422	c.2896G>C	c.(2896-2898)Gat>Cat	p.D966H	EYS_ENST00000503581.1_Missense_Mutation_p.D966H|EYS_ENST00000370616.2_Missense_Mutation_p.D966H			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	966	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTATTTACATCAAGTTCACAG	0.378																																					p.D966H													.	.			0			c.G2896C												141.0	118.0	125.0					6																	65596686		692	1590	2282	SO:0001583	missense	346007	exon19			TTACATCAAGTTC		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2896G>C	6.37:g.65596686C>G	ENSP00000359655:p.Asp966His		Somatic	122	0	0		WXS	Illumina HiSeq	.	85	0.40	34	NM_001142800	0		0	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	C	11.12	1.545261	0.27652	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.87334	-2.24;-2.24;-2.24	4.08	-3.73	0.04398	.	.	.	.	.	T	0.60958	0.2309	L	0.46819	1.47	0.26740	N	0.970403	B	0.12630	0.006	B	0.09377	0.004	T	0.44651	-0.9314	9	0.54805	T	0.06	.	1.1023	0.01687	0.141:0.3163:0.2765:0.2663	.	966	Q5T1H1-1	.	H	966	ENSP00000424243:D966H;ENSP00000359655:D966H;ENSP00000359650:D966H	ENSP00000359650:D966H	D	-	1	0	EYS	65653407	0.318000	0.24598	0.000000	0.03702	0.008000	0.06430	0.463000	0.21972	-1.272000	0.02427	0.462000	0.41574	GAT			0.378	EYS-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000351351.3		XM_294050	
ZNF292	23036	mdanderson.org	37	6	87966328	87966328	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr6:87966328G>T	ENST00000369577.3	+	8	3024	c.2981G>T	c.(2980-2982)tGc>tTc	p.C994F	ZNF292_ENST00000339907.4_Missense_Mutation_p.C989F	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	994						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAACAAGATTGCTTTAATGAT	0.393																																					p.C994F													.	.			0			c.G2981T												89.0	86.0	87.0					6																	87966328		1870	4093	5963	SO:0001583	missense	23036	exon8			AAGATTGCTTTAA	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2981G>T	6.37:g.87966328G>T	ENSP00000358590:p.Cys994Phe		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_015021	3	0.00	0	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	G	9.581	1.123597	0.20959	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07444	3.19;3.2	5.25	5.25	0.73442	.	0.413247	0.31392	N	0.007732	T	0.06416	0.0165	L	0.50333	1.59	0.45087	D	0.998106	D	0.56035	0.974	P	0.45913	0.497	T	0.42498	-0.9448	10	0.12430	T	0.62	.	19.19	0.93663	0.0:0.0:1.0:0.0	.	994	O60281	ZN292_HUMAN	F	994;989	ENSP00000358590:C994F;ENSP00000342847:C989F	ENSP00000342847:C989F	C	+	2	0	ZNF292	88023047	0.997000	0.39634	0.998000	0.56505	0.134000	0.20937	2.679000	0.46909	2.612000	0.88384	0.591000	0.81541	TGC			0.393	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000376192.2		NM_015021	
SAMD5	389432	mdanderson.org	37	6	147830332	147830332	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr6:147830332G>T	ENST00000367474.1	+	1	270	c.268G>T	c.(268-270)Gtc>Ttc	p.V90F		NM_001030060.2	NP_001025231.1	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	90													Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		cgccgacgccgtccccaccgg	0.821																																					p.V90F													.	.			0			c.G268T												1.0	1.0	1.0					6																	147830332		513	1172	1685	SO:0001583	missense	389432	exon1			GACGCCGTCCCCA	AL354880	CCDS34548.1	6q24.3	2013-01-10			ENSG00000203727	ENSG00000203727		"""Sterile alpha motif (SAM) domain containing"""	21180	protein-coding gene	gene with protein product							Standard	NM_001030060		Approved	dJ875H10.1	uc003qmc.2	Q5TGI4	OTTHUMG00000015767	ENST00000367474.1:c.268G>T	6.37:g.147830332G>T	ENSP00000356444:p.Val90Phe		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_001030060	0		0		Missense_Mutation	SNP	ENST00000367474.1	37	CCDS34548.1	.	.	.	.	.	.	.	.	.	.	G	4.427	0.078981	0.08533	.	.	ENSG00000203727	ENST00000367474	T	0.66460	-0.21	3.55	0.594	0.17485	.	0.759301	0.11074	U	0.602548	T	0.26048	0.0635	L	0.40543	1.245	0.09310	N	1	P	0.37781	0.608	B	0.35470	0.203	T	0.13388	-1.0511	10	0.11794	T	0.64	-15.8074	4.449	0.11611	0.2215:0.3569:0.4216:0.0	.	90	Q5TGI4	SAMD5_HUMAN	F	90	ENSP00000356444:V90F	ENSP00000356444:V90F	V	+	1	0	SAMD5	147872025	0.001000	0.12720	0.001000	0.08648	0.100000	0.18952	-0.542000	0.06091	0.189000	0.20188	0.305000	0.20034	GTC			0.821	SAMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042610.1		NM_001030060	
DPY19L2P1	554236	broad.mit.edu	37	7	35131521	35131521	+	RNA	SNP	G	G	A	rs200009436		TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr7:35131521G>A	ENST00000436258.1	-	0	1848							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ACAGCTTGACGCTTGCCATTG	0.398																																					.													.	.			0			.																																											0	.			CTTGACGCTTGCC	BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35131521G>A			Somatic	213	0.0046948357	1		WXS	Illumina HiSeq	Phase_I	241	0.05	13	.	0		0	B4E2E3	RNA	SNP	ENST00000436258.1	37																																																																																						0.398	DPY19L2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338113.1			
DPY19L2P1	554236	hgsc.bcm.edu	37	7	35163774	35163774	+	IGR	SNP	A	A	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr7:35163774A>T								DPY19L2P1 (16428 upstream) : TBX20 (78267 downstream)																							ATGACATAGAAAAAATTTAAT	0.264																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	554236	.			CATAGAAAAAATT																													7.37:g.35163774A>T			Somatic	62	0	0		WXS	Illumina HiSeq	.	83	0.41	34	.	0		0		RNA	SNP		37																																																																																					0	0.264										
LMTK2	22853	mdanderson.org	37	7	97823823	97823823	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr7:97823823G>T	ENST00000297293.5	+	11	4339	c.4046G>T	c.(4045-4047)tGg>tTg	p.W1349L		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1349					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CCCGAGGACTGGAAGAAGGAA	0.532																																					p.W1349L													.	.			0			c.G4046T												96.0	85.0	89.0					7																	97823823		2203	4300	6503	SO:0001583	missense	22853	exon11			AGGACTGGAAGAA	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4046G>T	7.37:g.97823823G>T	ENSP00000297293:p.Trp1349Leu		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_014916	10	0.00	0	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788068	0.31593	.	.	ENSG00000164715	ENST00000297293	T	0.73258	-0.73	5.86	4.98	0.66077	.	0.616358	0.18327	N	0.144620	T	0.48960	0.1529	N	0.16743	0.435	0.09310	N	1	B	0.30763	0.294	B	0.22152	0.038	T	0.29852	-0.9998	10	0.13470	T	0.59	.	10.0391	0.42146	0.1512:0.0:0.8488:0.0	.	1349	Q8IWU2	LMTK2_HUMAN	L	1349	ENSP00000297293:W1349L	ENSP00000297293:W1349L	W	+	2	0	LMTK2	97661759	0.881000	0.30235	0.243000	0.24186	0.849000	0.48306	1.882000	0.39648	1.489000	0.48450	0.655000	0.94253	TGG			0.532	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334560.1		NM_014916	
TMEM209	84928	broad.mit.edu	37	7	129843940	129843940	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr7:129843940T>C	ENST00000397622.2	-	2	136	c.14A>G	c.(13-15)gAg>gGg	p.E5G	TMEM209_ENST00000473456.1_Missense_Mutation_p.E5G|TMEM209_ENST00000462753.1_Missense_Mutation_p.E4G|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_Missense_Mutation_p.E4G	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	5						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					AGGGTGTGCCTCCCCCTGCAT	0.403																																					p.E5G													.	TMEM209	31		0			c.A14G												79.0	69.0	72.0					7																	129843940		1864	4077	5941	SO:0001583	missense	84928	exon2			TGTGCCTCCCCCT		CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.14A>G	7.37:g.129843940T>C	ENSP00000380747:p.Glu5Gly		Somatic	54	0.0185185185	1		WXS	Illumina HiSeq	Phase_I	61	0.05	3	NM_032842	4	0.00	0	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	ENST00000397622.2	37	CCDS47712.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.345358	0.41498	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804;ENST00000484249;ENST00000471985;ENST00000471077	T;T;T;T;T	0.36340	1.29;1.32;1.26;1.29;2.28	5.66	5.66	0.87406	.	0.355072	0.34676	N	0.003773	T	0.27278	0.0669	N	0.24115	0.695	0.32747	N	0.506876	B;B;B	0.25609	0.122;0.13;0.018	B;B;B	0.25405	0.06;0.022;0.025	T	0.28964	-1.0027	10	0.30078	T	0.28	-8.6705	15.3831	0.74676	0.0:0.0:0.0:1.0	.	5;5;5	Q96SK2-3;Q96SK2-4;Q96SK2	.;.;TM209_HUMAN	G	5;4;5;4;5;48;4	ENSP00000380747:E5G;ENSP00000419697:E4G;ENSP00000417258:E5G;ENSP00000338388:E4G;ENSP00000419852:E48G	ENSP00000338388:E4G	E	-	2	0	TMEM209	129631176	0.971000	0.33674	0.903000	0.35520	0.146000	0.21551	3.683000	0.54663	2.285000	0.76669	0.533000	0.62120	GAG			0.403	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349339.1		NM_032842	
RIMS2	9699	broad.mit.edu;mdanderson.org	37	8	105261745	105261745	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr8:105261745A>G	ENST00000436393.2	+	26	3915	c.3674A>G	c.(3673-3675)aAg>aGg	p.K1225R	RIMS2_ENST00000339750.2_Missense_Mutation_p.K143R|RIMS2_ENST00000406091.3_Missense_Mutation_p.K1207R|RIMS2_ENST00000507740.1_Missense_Mutation_p.K1021R|RIMS2_ENST00000262231.10_Missense_Mutation_p.K1046R			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1269					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ATGGACAAAAAGGGACAGCTG	0.403										HNSCC(12;0.0054)																											p.K1207R													.	RIMS2	1357		0			c.A3620G												72.0	75.0	74.0					8																	105261745		1864	4087	5951	SO:0001583	missense	9699	exon22			ACAAAAAGGGACA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3674A>G	8.37:g.105261745A>G	ENSP00000390665:p.Lys1225Arg		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	94	0.04	4	NM_001100117	0		0	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	A	25.6	4.654243	0.88056	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;0.99;-1.01;-1.01;-1.01	5.6	5.6	0.85130	C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.80768	0.4686	L	0.28192	0.835	0.80722	D	1	P;P;B;D;D	0.53312	0.709;0.839;0.287;0.959;0.959	B;P;P;D;D	0.67382	0.284;0.836;0.651;0.951;0.951	T	0.80589	-0.1315	9	0.38643	T	0.18	.	15.7857	0.78300	1.0:0.0:0.0:0.0	.	1269;1225;1046;1021;1207	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	R	1244;1207;1269;1046;1021;1214;1225;143;143	ENSP00000384892:K1207R;ENSP00000262231:K1046R;ENSP00000423559:K1021R;ENSP00000386228:K1214R;ENSP00000390665:K1225R;ENSP00000428478:K143R;ENSP00000342051:K143R	ENSP00000262231:K1046R	K	+	2	0	RIMS2	105330921	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.306000	0.78905	2.142000	0.66516	0.528000	0.53228	AAG			0.403	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000367217.1		NM_001100117	
PTK2	5747	mdanderson.org	37	8	141684497	141684497	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr8:141684497G>A	ENST00000522684.1	-	29	2838	c.2609C>T	c.(2608-2610)gCa>gTa	p.A870V	PTK2_ENST00000395218.2_Missense_Mutation_p.A880V|PTK2_ENST00000340930.3_Missense_Mutation_p.A880V|PTK2_ENST00000538769.1_Missense_Mutation_p.A538V|PTK2_ENST00000517887.1_Missense_Mutation_p.A914V|PTK2_ENST00000521059.1_Missense_Mutation_p.A870V|PTK2_ENST00000535192.1_Missense_Mutation_p.A824V|PTK2_ENST00000519419.1_Missense_Mutation_p.A914V|PTK2_ENST00000430260.2_Missense_Mutation_p.A180V|PTK2_ENST00000519465.1_Missense_Mutation_p.A498V	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	870	Interaction with TGFB1I1.|Pro-rich.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TGGTGGAGCTGCAGGATCTGG	0.542																																					p.A892V													.	.			0			c.C2675T												43.0	38.0	40.0					8																	141684497		2203	4300	6503	SO:0001583	missense	5747	exon29			GGAGCTGCAGGAT	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2609C>T	8.37:g.141684497G>A	ENSP00000429911:p.Ala870Val		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_005607	131	0.00	0	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.294650	0.40594	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000430260;ENST00000521986	T;T;T;T;T;T;T;T;T;T;T;T	0.75938	-0.94;-0.98;-0.94;-0.94;-0.94;-0.98;-0.93;-0.95;-0.93;-0.94;1.51;-0.93	5.84	4.97	0.65823	.	0.157610	0.56097	N	0.000030	T	0.55609	0.1931	N	0.08118	0	0.44337	D	0.997222	B;B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B	0.12156	0.001;0.001;0.001;0.0;0.001;0.001;0.002;0.007;0.0;0.0	T	0.50092	-0.8868	10	0.22706	T	0.39	.	14.9284	0.70896	0.0684:0.0:0.9316:0.0	.	880;565;790;870;892;824;822;697;538;498	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.;.;.;FAK1_HUMAN;.;.;.;.;.;.	V	870;824;498;914;870;822;880;791;565;542;880;538;914;180;568	ENSP00000429911:A870V;ENSP00000438009:A824V;ENSP00000429170:A498V;ENSP00000429082:A914V;ENSP00000429474:A870V;ENSP00000378644:A880V;ENSP00000428492:A542V;ENSP00000341189:A880V;ENSP00000445742:A538V;ENSP00000429129:A914V;ENSP00000403416:A180V;ENSP00000430603:A568V	ENSP00000341189:A880V	A	-	2	0	PTK2	141753679	0.998000	0.40836	1.000000	0.80357	0.968000	0.65278	3.594000	0.54008	1.484000	0.48361	-0.262000	0.10625	GCA			0.542	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378054.5		NM_005607	
MROH6	642475	mdanderson.org	37	8	144650356	144650356	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr8:144650356G>T	ENST00000398882.3	-	11	1976	c.1720C>A	c.(1720-1722)Cac>Aac	p.H574N	MROH6_ENST00000524906.1_5'UTR|MROH6_ENST00000532704.1_5'Flank|MROH6_ENST00000533679.1_Intron|MROH6_ENST00000534459.1_5'UTR	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	574																	CTGTCATAGTGGGCCACGGTG	0.642																																					p.H574N													.	.			0			c.C1720A												24.0	27.0	26.0					8																	144650356		1952	4146	6098	SO:0001583	missense	642475	exon11			CATAGTGGGCCAC	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1720C>A	8.37:g.144650356G>T	ENSP00000381857:p.His574Asn		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	130	0.04	5	NM_001100878	9	0.00	0	A8MWB1	Missense_Mutation	SNP	ENST00000398882.3	37	CCDS47928.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548611	0.27652	.	.	ENSG00000204839	ENST00000398882	T	0.27890	1.64	4.82	4.82	0.62117	Armadillo-type fold (1);	.	.	.	.	T	0.35913	0.0948	M	0.62723	1.935	0.80722	D	1	B	0.32245	0.361	B	0.39904	0.313	T	0.10613	-1.0622	9	0.13108	T	0.6	-30.0989	15.3899	0.74735	0.0:0.0:1.0:0.0	.	574	A6NGR9	CH073_HUMAN	N	574	ENSP00000381857:H574N	ENSP00000381857:H574N	H	-	1	0	C8orf73	144721499	0.993000	0.37304	1.000000	0.80357	0.195000	0.23768	4.236000	0.58675	2.228000	0.72767	0.442000	0.29010	CAC			0.642	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382330.3		NM_001100878	
PLEC	5339	mdanderson.org	37	8	144993851	144993851	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr8:144993851G>T	ENST00000322810.4	-	32	10718	c.10549C>A	c.(10549-10551)Ctg>Atg	p.L3517M	PLEC_ENST00000354958.2_Missense_Mutation_p.L3358M|PLEC_ENST00000357649.2_Missense_Mutation_p.L3384M|PLEC_ENST00000398774.2_Missense_Mutation_p.L3348M|PLEC_ENST00000345136.3_Missense_Mutation_p.L3380M|PLEC_ENST00000527096.1_Missense_Mutation_p.L3403M|PLEC_ENST00000354589.3_Missense_Mutation_p.L3380M|PLEC_ENST00000436759.2_Missense_Mutation_p.L3407M|PLEC_ENST00000356346.3_Missense_Mutation_p.L3366M	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3517	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTGGCTCTCAGCAGGCCCCGG	0.687																																					p.L3517M													.	.			0			c.C10549A												14.0	17.0	16.0					8																	144993851		2013	4129	6142	SO:0001583	missense	5339	exon32			CTCTCAGCAGGCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10549C>A	8.37:g.144993851G>T	ENSP00000323856:p.Leu3517Met		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_201380	41	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	G	7.060	0.566264	0.13560	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	4.73	4.73	0.59995	.	0.000000	0.48767	U	0.000173	D	0.82328	0.5013	M	0.64997	1.995	0.47547	D	0.99945	P;P;P;D;P;P;P;P	0.53745	0.952;0.952;0.952;0.962;0.952;0.952;0.952;0.952	P;P;P;P;P;P;P;P	0.51866	0.476;0.476;0.554;0.682;0.554;0.554;0.554;0.554	D	0.85036	0.0920	10	0.72032	D	0.01	.	17.4986	0.87725	0.0:0.0:1.0:0.0	.	3407;3366;3358;3517;3348;3380;3384;3380	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	M	3380;3384;3380;3348;3517;3358;3366;3407;3403	ENSP00000344848:L3380M;ENSP00000350277:L3384M;ENSP00000346602:L3380M;ENSP00000381756:L3348M;ENSP00000323856:L3517M;ENSP00000347044:L3358M;ENSP00000348702:L3366M;ENSP00000388180:L3407M;ENSP00000434583:L3403M	ENSP00000323856:L3517M	L	-	1	2	PLEC	145065839	1.000000	0.71417	0.996000	0.52242	0.563000	0.35712	3.625000	0.54238	2.455000	0.83008	0.448000	0.29417	CTG			0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
LRRC14	9684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	145741150	145741150	+	5'Flank	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr8:145741150G>A	ENST00000292524.1	+	0	0				RECQL4_ENST00000532237.1_5'UTR|LRRC14_ENST00000529022.1_5'Flank|RECQL4_ENST00000428558.2_Missense_Mutation_p.P419L|CTD-2517M22.17_ENST00000580385.1_RNA	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14											endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGTCTCACCTGGCCGGGGACA	0.587																																					p.P419L													.	.			0			c.C1256T												31.0	34.0	33.0					8																	145741150		2023	4155	6178	SO:0001631	upstream_gene_variant	9401	exon6			TCACCTGGCCGGG	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179		8.37:g.145741150G>A	Exception_encountered		Somatic	74	0	0		WXS	Illumina HiSeq	.	97	0.33	32	NM_004260	40	0.18	7	A8K0A8|D3DWM8	Missense_Mutation	SNP	ENST00000292524.1	37	CCDS6432.1																																																																																					0.587	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382494.1		NM_014665	
COL5A1	1289	broad.mit.edu	37	9	137676839	137676839	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chr9:137676839A>G	ENST00000371817.3	+	30	2903	c.2489A>G	c.(2488-2490)gAg>gGg	p.E830G		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	830	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TTGCAGGGGGAGATCGGCCCA	0.637																																					p.E830G													.	COL5A1	323		0			c.A2489G												31.0	38.0	36.0					9																	137676839		2203	4300	6503	SO:0001583	missense	1289	exon30			AGGGGGAGATCGG	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2489A>G	9.37:g.137676839A>G	ENSP00000360882:p.Glu830Gly		Somatic	233	0.008583691	2		WXS	Illumina HiSeq	Phase_I	190	0.02	4	NM_000093	191	0.00	0	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	a	20.2	3.945235	0.73672	.	.	ENSG00000130635	ENST00000371817	D	0.93906	-3.31	4.39	4.39	0.52855	.	0.000000	0.64402	U	0.000001	D	0.95130	0.8422	L	0.55017	1.72	0.58432	D	0.999999	D	0.65815	0.995	D	0.79108	0.992	D	0.95115	0.8241	10	0.59425	D	0.04	.	12.6117	0.56554	1.0:0.0:0.0:0.0	.	830	P20908	CO5A1_HUMAN	G	830	ENSP00000360882:E830G	ENSP00000360882:E830G	E	+	2	0	COL5A1	136816660	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	7.998000	0.88491	1.626000	0.50381	0.248000	0.18094	GAG			0.637	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054954.2		NM_000093	
MT-CYB	4519	hgsc.bcm.edu	37	M	15575	15575	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chrM:15575G>A	ENST00000361789.2	+	1	829	c.829G>A	c.(829-831)Gcc>Acc	p.A277T	MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	277					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ATTTCCTATTCGCCTACACAA	0.483											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.A277T													.	.			0			c.G829A																																									SO:0001583	missense	0	exon1			CTATTCGCCTACA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.829G>A	M.37:g.15575G>A	ENSP00000354554:p.Ala277Thr		Somatic	8	0	0	585	WXS	Illumina HiSeq	.	12	0.83	10	ENST00000361789	0		0	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																						0.483	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024038	
SUPT20HL1	100130302	hgsc.bcm.edu;mdanderson.org	37	X	24382423	24382423	+	IGR	SNP	G	G	C			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chrX:24382423G>C								AC004552.1 (15400 upstream) : PDK3 (100914 downstream)																							tgctgctgctgctgctcctgc	0.617																																					p.A516P													.	.			0			c.G1546C																																									SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTGCTC																													X.37:g.24382423G>C			Somatic	53	0	0		WXS	Illumina HiSeq	.	150	0.07	10	NM_001136234	0		0		Missense_Mutation	SNP		37																																																																																					0	0.617										
OCRL	4952	broad.mit.edu	37	X	128691868	128691868	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chrX:128691868A>G	ENST00000371113.4	+	6	545	c.380A>G	c.(379-381)aAg>aGg	p.K127R	OCRL_ENST00000486673.1_3'UTR|OCRL_ENST00000357121.5_Missense_Mutation_p.K127R	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	127					cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						CCAGAGCAAAAGGACTCATCT	0.403																																					p.K127R													.	OCRL	117		0			c.A380G												192.0	178.0	183.0					X																	128691868		2203	4300	6503	SO:0001583	missense	4952	exon6			AGCAAAAGGACTC	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.380A>G	X.37:g.128691868A>G	ENSP00000360154:p.Lys127Arg		Somatic	357	0.0028011204	1		WXS	Illumina HiSeq	Phase_I	708	0.01	8	NM_000276	18	0.00	0	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	A	10.75	1.438854	0.25900	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.94376	-3.41;-3.41	5.03	2.29	0.28610	.	0.208135	0.36893	N	0.002357	D	0.83119	0.5185	N	0.17082	0.46	0.34427	D	0.698088	B;B	0.14438	0.01;0.003	B;B	0.11329	0.006;0.003	T	0.74213	-0.3738	10	0.07325	T	0.83	.	8.5421	0.33399	0.797:0.0:0.203:0.0	.	127;127	Q01968-2;Q01968	.;OCRL_HUMAN	R	127	ENSP00000360154:K127R;ENSP00000349635:K127R	ENSP00000349635:K127R	K	+	2	0	OCRL	128519549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.424000	0.34848	0.605000	0.29947	0.486000	0.48141	AAG			0.403	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058917.1		NM_000276	
GPC3	2719	broad.mit.edu	37	X	133119396	133119396	+	Silent	SNP	C	C	G			TCGA-2G-AALQ-01A-12D-A42Y-10	TCGA-2G-AALQ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a396cd3-efe4-4bfb-9ade-41334932b612	0cd78c24-0592-4be8-8ef7-6b1c1858fc01	g.chrX:133119396C>G	ENST00000370818.3	-	1	526	c.81G>C	c.(79-81)ccG>ccC	p.P27P	GPC3_ENST00000543339.1_Silent_p.P27P|GPC3_ENST00000394299.2_Silent_p.P27P	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	27					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					GCGGCGGCGGCGGGGGCTGCG	0.687			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.P27P			yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	GPC3	88		0			c.G81C												14.0	14.0	14.0					X																	133119396		2189	4277	6466	SO:0001819	synonymous_variant	2719	exon1	Familial Cancer Database	SGBS	CGGCGGCGGGGGC	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.81G>C	X.37:g.133119396C>G			Somatic	139	0.0071942446	1		WXS	Illumina HiSeq	Phase_I	245	0.02	5	NM_001164617	869	0.00	2	C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	CCDS14638.1																																																																																					0.687	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058356.1		NM_004484	
