#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PIK3CD	5293	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	9780069	9780069	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:9780069G>A	ENST00000377346.4	+	10	1528	c.1333G>A	c.(1333-1335)Gtc>Atc	p.V445I	PIK3CD_ENST00000536656.1_Missense_Mutation_p.V410I|PIK3CD_ENST00000543390.1_Missense_Mutation_p.V112I|PIK3CD_ENST00000361110.2_Missense_Mutation_p.V410I	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	445	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GTGGCCCTCCGTCCCAGGTCG	0.612																																					p.V445I													.	.			0			c.G1333A												102.0	96.0	98.0					1																	9780069		2203	4300	6503	SO:0001583	missense	5293	exon10			CCCTCCGTCCCAG		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.1333G>A	1.37:g.9780069G>A	ENSP00000366563:p.Val445Ile		Somatic	137	0	0		WXS	Illumina HiSeq	.	116	0.09	11	NM_005026	12	0.17	2	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711572	0.48517	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563;ENST00000543390	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.5	5.5	0.81552	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	1.915380	0.02596	N	0.100497	T	0.72179	0.3428	L	0.40543	1.245	0.22911	N	0.998579	B;P;P	0.48230	0.253;0.586;0.907	B;B;B	0.40375	0.117;0.149;0.327	T	0.58999	-0.7536	10	0.09843	T	0.71	-31.4328	12.5004	0.55952	0.0:0.0:0.7193:0.2807	.	445;410;445	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	I	410;445;410;410;112	ENSP00000446444:V410I;ENSP00000366563:V445I;ENSP00000354410:V410I;ENSP00000443811:V112I	ENSP00000353766:V410I	V	+	1	0	PIK3CD	9702656	0.988000	0.35896	0.213000	0.23690	0.416000	0.31233	4.465000	0.60141	2.590000	0.87494	0.462000	0.41574	GTC			0.612	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004235.1		NM_005026	
HTR6	3362	mdanderson.org	37	1	20005666	20005666	+	Silent	SNP	G	G	T	rs201944154		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:20005666G>T	ENST00000289753.1	+	3	1595	c.1128G>T	c.(1126-1128)ccG>ccT	p.P376P		NM_000871.1	NP_000862.1	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled	376					brain development (GO:0007420)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|long-term synaptic potentiation (GO:0060291)|negative regulation of acetylcholine secretion, neurotransmission (GO:0014058)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|synaptic transmission (GO:0007268)	cilium (GO:0005929)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)|serotonin receptor activity (GO:0004993)			endometrium(1)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Mianserin(DB06148)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Quetiapine(DB01224)|Sertindole(DB06144)|Ziprasidone(DB00246)	CCCTGCCGCCGGACTCAGATT	0.736																																					p.P376P	Esophageal Squamous(168;1879 2619 6848 21062)												.	.			0			c.G1128T												5.0	7.0	7.0					1																	20005666		2108	4164	6272	SO:0001819	synonymous_variant	3362	exon3			GCCGCCGGACTCA	L41147	CCDS197.1	1p36-p35	2012-08-08	2012-02-03		ENSG00000158748	ENSG00000158748		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5301	protein-coding gene	gene with protein product		601109	"""5-hydroxytryptamine (serotonin) receptor 6"""			8522988	Standard	NM_000871		Approved	5-HT6, 5-HT6R	uc001bcl.3	P50406	OTTHUMG00000002713	ENST00000289753.1:c.1128G>T	1.37:g.20005666G>T			Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_000871	0		0	Q13640|Q5TGZ1	Silent	SNP	ENST00000289753.1	37	CCDS197.1																																																																																					0.736	HTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007704.1		NM_000871	
TMEM39B	55116	mdanderson.org	37	1	32541383	32541383	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:32541383G>T	ENST00000336294.5	+	3	457	c.311G>T	c.(310-312)tGg>tTg	p.W104L	TMEM39B_ENST00000427288.1_5'UTR|TMEM39B_ENST00000456834.2_Missense_Mutation_p.W104L|RP11-277A4.4_ENST00000366152.3_RNA|TMEM39B_ENST00000487305.1_3'UTR|TMEM39B_ENST00000373634.4_5'UTR	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	104						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AAGACAGTGTGGTGGTATCCA	0.537																																					p.W104L													.	.			0			c.G311T												71.0	54.0	59.0					1																	32541383		692	1591	2283	SO:0001583	missense	55116	exon3			CAGTGTGGTGGTA	AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.311G>T	1.37:g.32541383G>T	ENSP00000338165:p.Trp104Leu		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_018056	30	0.00	0	B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Missense_Mutation	SNP	ENST00000336294.5	37	CCDS351.2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738367	0.89573	.	.	ENSG00000121775	ENST00000336294;ENST00000373633;ENST00000438825;ENST00000456834	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.83746	0.5321	M	0.82323	2.585	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.86313	0.1687	9	0.87932	D	0	-9.3944	18.7717	0.91894	0.0:0.0:1.0:0.0	.	104	Q9GZU3	TM39B_HUMAN	L	104	.	ENSP00000338165:W104L	W	+	2	0	TMEM39B	32313970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.385000	0.97223	2.511000	0.84671	0.555000	0.69702	TGG			0.537	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011489.2		NM_018056	
TMCO2	127391	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40713810	40713810	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:40713810C>G	ENST00000372766.3	+	1	238	c.145C>G	c.(145-147)Cca>Gca	p.P49A	TMCO2_ENST00000468258.1_Intron	NM_001008740.3	NP_001008740.1	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	49						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)	6	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			TAATCTTGCTCCAGCTGTGCA	0.378																																					p.P49A													TMCO2,NS,carcinoma,0,1	TMCO2	0	1	0			c.C145G												178.0	180.0	180.0					1																	40713810		2203	4300	6503	SO:0001583	missense	127391	exon1			CTTGCTCCAGCTG	AL050341	CCDS30684.1	1p34.2	2014-02-12			ENSG00000188800	ENSG00000188800			23312	protein-coding gene	gene with protein product							Standard	NM_001008740		Approved	dJ39G22.2	uc001cfe.2	Q7Z6W1	OTTHUMG00000005764	ENST00000372766.3:c.145C>G	1.37:g.40713810C>G	ENSP00000361852:p.Pro49Ala		Somatic	109	0	0		WXS	Illumina HiSeq	.	129	0.24	31	NM_001008740	0		0		Missense_Mutation	SNP	ENST00000372766.3	37	CCDS30684.1	.	.	.	.	.	.	.	.	.	.	C	7.851	0.724062	0.15439	.	.	ENSG00000188800	ENST00000372766	.	.	.	5.34	4.41	0.53225	.	0.000000	0.49916	D	0.000136	T	0.41259	0.1151	L	0.29908	0.895	0.31962	N	0.608231	D	0.60160	0.987	P	0.53518	0.728	T	0.48115	-0.9063	9	0.31617	T	0.26	-10.0752	11.8116	0.52185	0.0:0.8239:0.1761:0.0	.	49	Q7Z6W1	TMCO2_HUMAN	A	49	.	ENSP00000361852:P49A	P	+	1	0	TMCO2	40486397	0.995000	0.38212	0.989000	0.46669	0.023000	0.10783	1.990000	0.40717	1.467000	0.48044	0.650000	0.86243	CCA			0.378	TMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000015769.1		NM_001008740	
NFIA	4774	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	61548476	61548477	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:61548476_61548477delCT	ENST00000403491.3	+	1	497_498	c.13_14delCT	c.(13-15)ctcfs	p.L5fs	NFIA_ENST00000371185.2_Frame_Shift_Del_p.L5fs|NFIA_ENST00000485903.2_Frame_Shift_Del_p.L5fs|NFIA_ENST00000371187.3_Frame_Shift_Del_p.L5fs|NFIA_ENST00000407417.3_Intron|AC096534.1_ENST00000584315.1_RNA|NFIA_ENST00000371191.1_Intron|NFIA_ENST00000371189.4_Frame_Shift_Del_p.L50fs|NFIA_ENST00000479364.1_Intron|NFIA_ENST00000371184.2_Frame_Shift_Del_p.L5fs	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	5					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						GTATTCTCCGCTCTGTCTCACC	0.698																																					p.49_50del													.	NFIA	76		0			c.147_148del																																									SO:0001589	frameshift_variant	4774	exon2			TCTCCGCTCTGTC	U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.13_14delCT	1.37:g.61548478_61548479delCT	ENSP00000384523:p.Leu5fs		Somatic	294	0	0		WXS	Illumina HiSeq	.	351	0.27	94	NM_001145512	22	0.00	0	B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Frame_Shift_Del	DEL	ENST00000403491.3	37	CCDS44156.1																																																																																					0.698	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000023799.3		NM_005595	
CLCA1	1179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	86959124	86959124	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:86959124G>A	ENST00000234701.3	+	11	1873	c.1522G>A	c.(1522-1524)Gtg>Atg	p.V508M	CLCA1_ENST00000394711.1_Missense_Mutation_p.V508M			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	508					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CACAGTGATCGTGGACAGCAC	0.493																																					p.V508M													CLCA1,colon,carcinoma,-2,1	CLCA1	-2	1	0			c.G1522A												175.0	139.0	151.0					1																	86959124		2203	4300	6503	SO:0001583	missense	1179	exon10			GTGATCGTGGACA		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1522G>A	1.37:g.86959124G>A	ENSP00000234701:p.Val508Met		Somatic	148	0	0		WXS	Illumina HiSeq	.	138	0.07	9	NM_001285	0		0	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	CCDS709.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282018	0.59867	.	.	ENSG00000016490	ENST00000234701;ENST00000394711;ENST00000539889	T;T	0.38722	1.12;1.12	5.7	3.79	0.43588	Domain of unknown function DUF1973 (1);	0.247644	0.33610	N	0.004736	T	0.41465	0.1160	L	0.61036	1.89	0.30598	N	0.760844	D;D	0.76494	0.999;0.999	D;D	0.71656	0.974;0.974	T	0.38950	-0.9637	10	0.52906	T	0.07	-6.5351	6.6974	0.23207	0.1534:0.0:0.6998:0.1468	.	508;271	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	M	508;508;221	ENSP00000234701:V508M;ENSP00000378200:V508M	ENSP00000234701:V508M	V	+	1	0	CLCA1	86731712	0.956000	0.32656	0.870000	0.34147	0.919000	0.55068	1.550000	0.36223	0.727000	0.32360	0.557000	0.71058	GTG			0.493	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000028277.1		NM_001285	
CHRNB2	1141	mdanderson.org	37	1	154544318	154544318	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:154544318T>C	ENST00000368476.3	+	5	1283	c.1019T>C	c.(1018-1020)cTg>cCg	p.L340P		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	340					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	GTCGTCTTCCTGGAGAAGCTG	0.677																																					p.L340P													.	.			0			c.T1019C												55.0	38.0	44.0					1																	154544318		2203	4300	6503	SO:0001583	missense	1141	exon5			TCTTCCTGGAGAA	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.1019T>C	1.37:g.154544318T>C	ENSP00000357461:p.Leu340Pro		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_000748	1	0.00	0	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.085567	0.55861	.	.	ENSG00000160716	ENST00000368476	D	0.88509	-2.39	3.97	3.97	0.46021	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.96414	0.8830	H	0.99182	4.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97398	0.9994	10	0.87932	D	0	.	12.6654	0.56840	0.0:0.0:0.0:1.0	.	340	P17787	ACHB2_HUMAN	P	340	ENSP00000357461:L340P	ENSP00000357461:L340P	L	+	2	0	CHRNB2	152810942	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	7.771000	0.85420	1.645000	0.50612	0.260000	0.18958	CTG			0.677	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090697.1		NM_000748	
CD1E	913	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158324199	158324199	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:158324199G>T	ENST00000368167.3	+	2	330	c.91G>T	c.(91-93)Gca>Tca	p.A31S	CD1E_ENST00000368165.3_Missense_Mutation_p.A31S|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.A31S|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.A31S|CD1E_ENST00000368156.1_Missense_Mutation_p.A31S|CD1E_ENST00000368160.3_Missense_Mutation_p.A31S|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368155.3_Missense_Mutation_p.A31S|CD1E_ENST00000434258.1_Missense_Mutation_p.A29S	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	31					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.A31S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					TCATCTAGCAGCAGAGGAGCA	0.527																																					p.A31S													CD1E,NS,carcinoma,0,1	CD1E	0	1	1	Substitution - Missense(1)	lung(1)	c.G91T												137.0	140.0	139.0					1																	158324199		2132	4265	6397	SO:0001583	missense	913	exon2			CTAGCAGCAGAGG	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.91G>T	1.37:g.158324199G>T	ENSP00000357149:p.Ala31Ser		Somatic	119	0	0		WXS	Illumina HiSeq	.	164	0.06	10	NM_001185107	0		0	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	G	9.976	1.226841	0.22542	.	.	ENSG00000158488	ENST00000434258;ENST00000368167;ENST00000368165;ENST00000368163;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155	T;T;T;T;T;T;T;T	0.17213	2.29;2.29;3.5;2.29;2.29;2.29;3.7;3.62	3.57	0.504	0.16946	.	0.621077	0.13387	N	0.391694	T	0.02571	0.0078	N	0.17764	0.52	0.09310	N	1	B;B;B;B;B;B;B;B	0.33318	0.021;0.194;0.408;0.03;0.007;0.075;0.194;0.022	B;B;B;B;B;B;B;B	0.26416	0.013;0.056;0.056;0.02;0.005;0.069;0.056;0.054	T	0.40739	-0.9547	10	0.40728	T	0.16	-0.6013	5.5885	0.17287	0.3799:0.0:0.6201:0.0	.	29;31;31;31;31;31;31;31	E7ET31;P15812-5;P15812-7;P15812-2;P15812;P15812-3;P15812-6;P15812-4	.;.;.;.;CD1E_HUMAN;.;.;.	S	29;31;31;31;31;31;31;31	ENSP00000401957:A29S;ENSP00000357149:A31S;ENSP00000357147:A31S;ENSP00000357145:A31S;ENSP00000357142:A31S;ENSP00000357143:A31S;ENSP00000357138:A31S;ENSP00000357137:A31S	ENSP00000357137:A31S	A	+	1	0	CD1E	156590823	.	.	0.003000	0.11579	0.149000	0.21700	.	.	0.110000	0.17919	0.563000	0.77884	GCA			0.527	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000046353.3		NM_030893	
SPTA1	6708	hgsc.bcm.edu	37	1	158622412	158622412	+	Missense_Mutation	SNP	G	G	T	rs569406964		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:158622412G>T	ENST00000368147.4	-	23	3400	c.3220C>A	c.(3220-3222)Cgc>Agc	p.R1074S		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1074					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CGACGTCTGCGTTCTTCTGCC	0.438																																					p.R1074S													SPTA1,NS,carcinoma,+1,3	SPTA1	1	3	0			c.C3220A												102.0	94.0	96.0					1																	158622412		1881	4112	5993	SO:0001583	missense	6708	exon23			GTCTGCGTTCTTC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3220C>A	1.37:g.158622412G>T	ENSP00000357129:p.Arg1074Ser		Somatic	100	0	0		WXS	Illumina HiSeq	.	110	0.05	5	NM_003126	0		0	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863875	0.51482	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.76186	-1.0;-1.0	5.3	5.3	0.74995	.	0.000000	0.32703	N	0.005753	D	0.82467	0.5043	M	0.66939	2.045	0.53688	D	0.999972	D	0.71674	0.998	D	0.69142	0.962	D	0.83712	0.0188	10	0.87932	D	0	.	17.7085	0.88315	0.0:0.0:1.0:0.0	.	1074	P02549	SPTA1_HUMAN	S	1074	ENSP00000357130:R1074S;ENSP00000357129:R1074S	ENSP00000357129:R1074S	R	-	1	0	SPTA1	156889036	0.998000	0.40836	0.973000	0.42090	0.074000	0.17049	2.801000	0.47908	2.769000	0.95229	0.655000	0.94253	CGC			0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051851.3		NM_003126	
ITLN1	55600	ucsc.edu	37	1	160851880	160851880	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:160851880C>T	ENST00000326245.3	-	4	387	c.272G>A	c.(271-273)cGt>cAt	p.R91H	ITLN1_ENST00000487531.1_5'Flank	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	91	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GCACTTCCCACGCATGTCATT	0.602																																					p.R91H													.	ITLN1	45		0			c.G272A												121.0	103.0	110.0					1																	160851880		2203	4300	6503	SO:0001583	missense	55600	exon4			TTCCCACGCATGT	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.272G>A	1.37:g.160851880C>T	ENSP00000323587:p.Arg91His		Somatic	127	0	0		RNA-Seq	Illumina HiSeq		176	0.01	1	NM_017625	33	0.70	23	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	ENST00000326245.3	37	CCDS1211.1	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.550664	0.00140	.	.	ENSG00000179914	ENST00000326245	D	0.93189	-3.18	4.17	-8.34	0.00988	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	2.476460	0.02207	N	0.062839	T	0.56601	0.1996	N	0.10733	0.035	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.55341	-0.8156	10	0.15499	T	0.54	6.098	2.7539	0.05288	0.159:0.2493:0.1115:0.4803	.	91	Q8WWA0	ITLN1_HUMAN	H	91	ENSP00000323587:R91H	ENSP00000323587:R91H	R	-	2	0	ITLN1	159118504	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.756000	0.01813	-5.849000	0.00009	-3.525000	0.00032	CGT			0.602	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071462.1		NM_017625	
CAPN8	388743	bcgsc.ca	37	1	223853215	223853230	+	Frame_Shift_Del	DEL	AGGACCCCTGAGTCCA	AGGACCCCTGAGTCCA	-	rs78881520		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	AGGACCCCTGAGTCCA	AGGACCCCTGAGTCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr1:223853215_223853230delAGGACCCCTGAGTCCA	ENST00000366873.2	-	1	195_210	c.119_134delTGGACTCAGGGGTCCT	c.(118-135)ttggactcaggggtcctafs	p.LDSGVL40fs	CAPN8_ENST00000366872.5_Frame_Shift_Del_p.LDSGVL40fs			A6NHC0	CAN8_HUMAN	calpain 8	40					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						GTCCTTAAATAGGACCCCTGAGTCCAAGCACTGTTG	0.546																																					.													.	CAPN8	30		0			.																																									SO:0001589	frameshift_variant	388743	.			TTAAATAGGACCC		CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366873.2:c.119_134delTGGACTCAGGGGTCCT	1.37:g.223853215_223853230delAGGACCCCTGAGTCCA	ENSP00000355838:p.Leu40fs		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_1	122	0.05	6	.	0		0	B2RXL2	Frame_Shift_Del	DEL	ENST00000366873.2	37																																																																																						0.546	CAPN8-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000171394.3		NM_001143962	
USP6NL	9712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	11569522	11569522	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr10:11569522C>T	ENST00000609104.1	-	3	443	c.49G>A	c.(49-51)Gaa>Aaa	p.E17K	USP6NL_ENST00000277575.5_Missense_Mutation_p.E34K|USP6NL_ENST00000379237.2_Missense_Mutation_p.E40K	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	17					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						GCAACTATTTCAGCTCGCTCC	0.338																																					p.E34K													.	.			0			c.G100A												54.0	51.0	52.0					10																	11569522		1854	4100	5954	SO:0001583	missense	9712	exon2			CTATTTCAGCTCG	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.49G>A	10.37:g.11569522C>T	ENSP00000476462:p.Glu17Lys		Somatic	57	0	0		WXS	Illumina HiSeq	.	44	0.25	11	NM_001080491	8	0.50	4	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	ENST00000609104.1	37	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159861	0.94727	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.30182	1.54;1.54	5.92	5.92	0.95590	.	0.048079	0.85682	D	0.000000	T	0.45756	0.1358	L	0.50333	1.59	0.80722	D	1	P;P	0.39044	0.656;0.589	P;P	0.50378	0.517;0.639	T	0.07462	-1.0771	10	0.40728	T	0.16	.	19.9242	0.97098	0.0:1.0:0.0:0.0	.	17;34	Q92738;Q92738-2	US6NL_HUMAN;.	K	17;34;17	ENSP00000277575:E34K;ENSP00000368539:E17K	ENSP00000277575:E34K	E	-	1	0	USP6NL	11609528	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.243000	0.72384	2.814000	0.96858	0.585000	0.79938	GAA			0.338	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000046764.3		NM_014688	
EIF5AL1	143244	bcgsc.ca	37	10	81272627	81272627	+	Silent	SNP	G	G	A	rs200689309		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr10:81272627G>A	ENST00000520547.2	+	1	271	c.222G>A	c.(220-222)ccG>ccA	p.P74P	AL133481.1_ENST00000538322.1_5'Flank	NM_001099692.1	NP_001093162.1	Q6IS14	IF5AL_HUMAN	eukaryotic translation initiation factor 5A-like 1	74					mRNA transport (GO:0051028)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of translational elongation (GO:0045901)|positive regulation of translational termination (GO:0045905)|protein transport (GO:0015031)|translational frameshifting (GO:0006452)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)	ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			endometrium(1)	1	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			ATATCTGCCCGTCAACTCATA	0.498																																					p.P74P													.	EIF5AL1	24		0			c.G222A												30.0	32.0	32.0					10																	81272627		2202	4289	6491	SO:0001819	synonymous_variant	143244	exon1			CTGCCCGTCAACT		CCDS53546.1	10q22.3	2012-04-19			ENSG00000253626	ENSG00000253626			17419	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 5A pseudogene 1"""	EIF5AP1			Standard	NM_001099692		Approved	bA342M3.3	uc009xrx.3	Q6IS14	OTTHUMG00000018563	ENST00000520547.2:c.222G>A	10.37:g.81272627G>A			Somatic	145	0.1379310345	20		WXS	Illumina HiSeq	Phase_1	94	0.45	42	NM_001099692	622	0.00	0		Silent	SNP	ENST00000520547.2	37	CCDS53546.1																																																																																					0.498	EIF5AL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048954.4		NM_001099692	
OBFC1	79991	mdanderson.org	37	10	105651979	105651979	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr10:105651979G>T	ENST00000224950.3	-	8	952	c.785C>A	c.(784-786)gCa>gAa	p.A262E	OBFC1_ENST00000466828.1_5'UTR|OBFC1_ENST00000369764.1_Missense_Mutation_p.A262E	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	262	Winged helix-turn-helix (wHTH) 1.				positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		ACTATGAATTGCCTTGGAAGT	0.358																																					p.A262E													.	.			0			c.C785A												93.0	94.0	94.0					10																	105651979		2203	4300	6503	SO:0001583	missense	79991	exon8			TGAATTGCCTTGG	BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.785C>A	10.37:g.105651979G>T	ENSP00000224950:p.Ala262Glu		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_024928	41	0.00	0	D3DR99|Q5TCZ0	Missense_Mutation	SNP	ENST00000224950.3	37	CCDS7552.1	.	.	.	.	.	.	.	.	.	.	G	3.627	-0.076425	0.07184	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.43294	0.95;0.95	5.52	4.61	0.57282	Domain of unknown function DUF1879, CTS complex STN1 subunit (1);	0.369310	0.31697	N	0.007201	T	0.28134	0.0694	L	0.46157	1.445	0.25732	N	0.985258	P	0.39717	0.684	B	0.37780	0.258	T	0.23119	-1.0197	10	0.02654	T	1	-4.5535	6.5687	0.22527	0.0929:0.0:0.7288:0.1783	.	262	Q9H668	STN1_HUMAN	E	262	ENSP00000224950:A262E;ENSP00000358779:A262E	ENSP00000224950:A262E	A	-	2	0	OBFC1	105641969	0.998000	0.40836	0.699000	0.30290	0.972000	0.66771	0.938000	0.28965	1.292000	0.44672	0.555000	0.69702	GCA			0.358	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050174.1		NM_024928	
C10orf90	118611	mdanderson.org	37	10	128202503	128202503	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr10:128202503G>A	ENST00000284694.7	-	2	148	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	C10orf90_ENST00000454341.1_Missense_Mutation_p.R10W|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000392694.1_De_novo_Start_OutOfFrame|C10orf90_ENST00000544758.1_Missense_Mutation_p.R107W|C10orf90_ENST00000356858.3_De_novo_Start_OutOfFrame	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	10					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.R10W(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TAGCTGTCCCGTAATCCTAGG	0.343																																					p.R10W													C10orf90,colon,carcinoma,0,1	C10orf90	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C28T												145.0	134.0	137.0					10																	128202503		2203	4300	6503	SO:0001583	missense	118611	exon2			TGTCCCGTAATCC	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.28C>T	10.37:g.128202503G>A	ENSP00000284694:p.Arg10Trp		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001004298	0		0	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615126	0.28712	.	.	ENSG00000154493	ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642	T;T;T;T	0.20069	2.11;2.1;2.11;2.11	5.2	2.04	0.26737	.	1.179070	0.06493	N	0.735003	T	0.20210	0.0486	L	0.54323	1.7	0.09310	N	0.999998	B;B;B	0.25007	0.01;0.116;0.01	B;B;B	0.15484	0.003;0.013;0.003	T	0.32052	-0.9921	10	0.87932	D	0	-0.6891	4.4792	0.11759	0.1985:0.0:0.6307:0.1708	.	107;107;10	F5GZL2;B4DMQ6;Q96M02	.;.;CJ090_HUMAN	W	10;10;107;10	ENSP00000284694:R10W;ENSP00000398786:R10W;ENSP00000444369:R107W;ENSP00000405995:R10W	ENSP00000284694:R10W	R	-	1	2	C10orf90	128192493	0.000000	0.05858	0.001000	0.08648	0.080000	0.17528	0.432000	0.21461	0.243000	0.21327	0.643000	0.83706	CGG			0.343	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001004298	
MUC6	4588	bcgsc.ca	37	11	1017519	1017519	+	Missense_Mutation	SNP	A	A	G	rs112553306	byFrequency	TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:1017519A>G	ENST00000421673.2	-	31	5332	c.5282T>C	c.(5281-5283)gTc>gCc	p.V1761A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1761	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTTGAGGTGACTTCAGGATG	0.577																																					p.V1761A													.	MUC6	408		0			c.T5282C												739.0	706.0	718.0					11																	1017519		2202	4293	6495	SO:0001583	missense	4588	exon31			GAGGTGACTTCAG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5282T>C	11.37:g.1017519A>G	ENSP00000406861:p.Val1761Ala		Somatic	146	0.0068493151	1		WXS	Illumina HiSeq	Phase_1	158	0.06	10	NM_005961	169	0.02	3	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	-	6.930	0.541302	0.13250	.	.	ENSG00000184956	ENST00000421673	T	0.17854	2.25	2.8	-3.98	0.04082	.	.	.	.	.	T	0.09905	0.0243	N	0.12182	0.205	0.09310	N	1	D	0.54207	0.965	P	0.55508	0.777	T	0.16748	-1.0392	9	0.08599	T	0.76	.	0.9064	0.01285	0.2478:0.327:0.2605:0.1646	.	1761	Q6W4X9	MUC6_HUMAN	A	1761	ENSP00000406861:V1761A	ENSP00000406861:V1761A	V	-	2	0	MUC6	1007519	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.503000	0.22610	-0.334000	0.08463	-0.736000	0.03550	GTC			0.577	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
SCUBE2	57758	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	9096033	9096033	+	Missense_Mutation	SNP	G	G	A	rs72549241	byFrequency	TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:9096033G>A	ENST00000309263.3	-	4	584	c.512C>T	c.(511-513)tCg>tTg	p.S171L	SCUBE2_ENST00000450649.2_Missense_Mutation_p.S171L|SCUBE2_ENST00000520467.1_Missense_Mutation_p.S171L|SCUBE2_ENST00000457346.2_Missense_Mutation_p.S171L			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	171						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		GGTACCTTCCGAGCGGTGAAT	0.582																																					p.S171L													SCUBE2_ENST00000457346,NS,malignant_melanoma,+1,5	SCUBE2_ENST00000457346	1	5	0			c.C512T												126.0	107.0	113.0					11																	9096033		2201	4296	6497	SO:0001583	missense	57758	exon4			CCTTCCGAGCGGT	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.512C>T	11.37:g.9096033G>A	ENSP00000310658:p.Ser171Leu		Somatic	68	0	0		WXS	Illumina HiSeq	.	76	0.05	4	NM_001170690	4	0.00	0	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		.	.	.	.	.	.	.	.	.	.	G	11.09	1.537285	0.27475	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	5.08	1.12	0.20585	.	0.188859	0.48286	N	0.000189	T	0.81711	0.4880	L	0.56769	1.78	0.54753	D	0.99998	B;B;B	0.31931	0.347;0.012;0.03	B;B;B	0.28232	0.087;0.019;0.012	T	0.74003	-0.3804	10	0.46703	T	0.11	.	9.751	0.40475	0.2824:0.0:0.7176:0.0	.	171;171;171	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	L	171	ENSP00000390481:S171L;ENSP00000310658:S171L;ENSP00000415187:S171L;ENSP00000429969:S171L	ENSP00000310658:S171L	S	-	2	0	SCUBE2	9052609	1.000000	0.71417	0.123000	0.21794	0.308000	0.27856	4.066000	0.57520	-0.044000	0.13491	-0.258000	0.10820	TCG	0.005		0.582	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000385812.2		NM_020974	
CRY2	1408	mdanderson.org	37	11	45892069	45892069	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:45892069G>A	ENST00000443527.2	+	9	1620	c.1598G>A	c.(1597-1599)cGc>cAc	p.R533H	CRY2_ENST00000417225.2_Missense_Mutation_p.R451H	NM_021117.3	NP_066940.2	Q49AN0	CRY2_HUMAN	cryptochrome circadian clock 2	512					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|glucose homeostasis (GO:0042593)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of sodium-dependent phosphate transport (GO:2000118)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|FAD binding (GO:0071949)|phosphatase binding (GO:0019902)|single-stranded DNA binding (GO:0003697)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(2)	15						CAGCTTTCGCGCTACCGGGGA	0.547																																					p.R533H	Esophageal Squamous(106;91 1499 8126 12599 39610)												.	.			0			c.G1598A												60.0	53.0	56.0					11																	45892069		2203	4299	6502	SO:0001583	missense	1408	exon9			TTTCGCGCTACCG	AB014558	CCDS7915.2, CCDS44576.1	11p11.2	2014-01-17	2014-01-17		ENSG00000121671	ENSG00000121671			2385	protein-coding gene	gene with protein product		603732	"""cryptochrome 2 (photolyase-like)"""			8909283	Standard	NM_021117		Approved		uc010rgn.2	Q49AN0	OTTHUMG00000153225	ENST00000443527.2:c.1598G>A	11.37:g.45892069G>A	ENSP00000406751:p.Arg533His		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_021117	50	0.00	0	B4DH32|B4DZD6|O75148|Q8IV71	Missense_Mutation	SNP	ENST00000443527.2	37	CCDS7915.2	.	.	.	.	.	.	.	.	.	.	G	14.06	2.421456	0.42918	.	.	ENSG00000121671	ENST00000417225;ENST00000443527	.	.	.	5.63	5.63	0.86233	.	0.108674	0.64402	D	0.000005	T	0.54224	0.1845	L	0.27053	0.805	0.43485	D	0.995713	B;B;B	0.15930	0.004;0.015;0.013	B;B;B	0.18263	0.004;0.008;0.021	T	0.48502	-0.9030	9	0.51188	T	0.08	-21.012	19.6936	0.96012	0.0:0.0:1.0:0.0	.	512;533;451	Q49AN0;B4DZD6;Q49AN0-2	CRY2_HUMAN;.;.	H	451;533	.	ENSP00000397419:R451H	R	+	2	0	CRY2	45848645	0.971000	0.33674	0.393000	0.26258	0.874000	0.50279	2.442000	0.44873	2.665000	0.90641	0.655000	0.94253	CGC			0.547	CRY2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000330235.2		NM_021117	
NDUFS3	4722	broad.mit.edu;mdanderson.org	37	11	47600657	47600657	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:47600657C>T	ENST00000263774.4	+	1	96	c.14C>T	c.(13-15)gCg>gTg	p.A5V	NDUFS3_ENST00000534208.1_Missense_Mutation_p.A5V|KBTBD4_ENST00000395288.2_5'Flank|KBTBD4_ENST00000525720.1_5'Flank|NDUFS3_ENST00000528192.1_Missense_Mutation_p.A5V|NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000526005.1_5'Flank|NDUFS3_ENST00000534716.2_Missense_Mutation_p.A5V|NDUFS3_ENST00000529276.1_Missense_Mutation_p.A5V|KBTBD4_ENST00000430070.2_5'Flank|RNU5E-10P_ENST00000363506.1_RNA|KBTBD4_ENST00000533290.1_5'Flank	NM_004551.2	NP_004542.1	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)	5				MAAAAVA -> MAAGRY (in Ref. 3). {ECO:0000305}.	cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)	9					Doxorubicin(DB00997)	GCGGCGGCGGCGGTAGCCAGG	0.692																																					p.A5V	Pancreas(15;551 601 22438 23457 52512)												.	NDUFS3	19		0			c.C14T												14.0	15.0	15.0					11																	47600657		2147	4214	6361	SO:0001583	missense	4722	exon1			CGGCGGCGGTAGC	AF067139	CCDS7941.1	11p11.11	2011-08-03	2002-08-29		ENSG00000213619	ENSG00000213619	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7710	protein-coding gene	gene with protein product	"""complex I 30kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial"""	603846	"""NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004551		Approved	CI-30	uc001nga.2	O75489	OTTHUMG00000166893	ENST00000263774.4:c.14C>T	11.37:g.47600657C>T	ENSP00000263774:p.Ala5Val		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_004551	134	0.00	0	B2R9J1|B4DFM8|Q9UNQ8	Missense_Mutation	SNP	ENST00000263774.4	37	CCDS7941.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.751818	0.49362	.	.	ENSG00000213619	ENST00000263774;ENST00000529276;ENST00000528192;ENST00000530295;ENST00000534208;ENST00000534716	T;T	0.77489	-1.1;1.42	5.47	4.56	0.56223	.	0.470662	0.23918	N	0.043262	T	0.69949	0.3168	L	0.58101	1.795	0.09310	N	0.999992	B;B	0.20550	0.012;0.046	B;B	0.10450	0.003;0.005	T	0.53704	-0.8401	10	0.09338	T	0.73	-33.586	11.8687	0.52509	0.0:0.9179:0.0:0.0821	.	5;5	B4DFM8;O75489	.;NDUS3_HUMAN	V	5	ENSP00000263774:A5V;ENSP00000432099:A5V	ENSP00000263774:A5V	A	+	2	0	NDUFS3	47557233	0.003000	0.15002	0.016000	0.15963	0.001000	0.01503	0.010000	0.13242	1.455000	0.47813	-0.119000	0.15052	GCG			0.692	NDUFS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391749.1		NM_004551	
FNBP4	23360	broad.mit.edu	37	11	47744606	47744606	+	Silent	SNP	A	A	T	rs546179833	byFrequency	TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:47744606A>T	ENST00000263773.5	-	15	2739	c.2727T>A	c.(2725-2727)ccT>ccA	p.P909P		NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	909	Pro-rich.					nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						gaggaggaggaggtggtggtg	0.493													A|||	3	0.000599042	0.0	0.0	5008	,	,		13818	0.001		0.0	False		,,,				2504	0.002				p.P909P													FNBP4,colon,carcinoma,0,2	FNBP4	99	2	0			c.T2727A												19.0	20.0	20.0					11																	47744606		2032	4174	6206	SO:0001819	synonymous_variant	23360	exon15			AGGAGGAGGTGGT	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2727T>A	11.37:g.47744606A>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_015308	95	0.00	0	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	ENST00000263773.5	37	CCDS41644.1																																																																																					0.493	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390237.3			
C11orf95	65998	mdanderson.org	37	11	63533633	63533633	+	lincRNA	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:63533633G>T	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							CCAGGGATGCGGCTCTTTCCA	0.652																																					p.R95S													.	.			0			c.C283A												42.0	45.0	44.0					11																	63533633		692	1591	2283			65998	exon2			GGATGCGGCTCTT																													11.37:g.63533633G>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001144936	53	0.00	0		Missense_Mutation	SNP	ENST00000546282.2	37																																																																																						0.652	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000396567.2			
SPDYC	387778	broad.mit.edu	37	11	64943049	64943050	+	IGR	INS	-	-	T	rs529153118|rs185303412		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:64943049_64943050insT	ENST00000377185.2	+	0	991				AP003068.18_ENST00000534819.1_RNA	NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C											breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						cgcccggctaattttttttttg	0.525																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CGGCTAATTTTTT	AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611		11.37:g.64943059_64943059dupT			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	3	0.00	0		RNA	INS	ENST00000377185.2	37	CCDS31606.1																																																																																					0.525	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385299.1		NM_001008778	
KDM2A	22992	hgsc.bcm.edu	37	11	67018078	67018078	+	Silent	SNP	A	A	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:67018078A>G	ENST00000529006.2	+	17	3023	c.2577A>G	c.(2575-2577)gaA>gaG	p.E859E	KDM2A_ENST00000530342.1_Silent_p.E420E|KDM2A_ENST00000308783.5_Silent_p.E317E|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Intron	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	859					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						aggaggaggaagaggaggagg	0.657																																					p.E859E													.	.			0			c.A2577G												22.0	26.0	25.0					11																	67018078		2104	4223	6327	SO:0001819	synonymous_variant	22992	exon17			GGAGGAAGAGGAG	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2577A>G	11.37:g.67018078A>G			Somatic	36	0	0		WXS	Illumina HiSeq	.	56	0.11	6	NM_012308	11	0.00	0	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	ENST00000529006.2	37	CCDS44657.1																																																																																					0.657	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393140.2		NM_012308	
APOA5	116519	mdanderson.org	37	11	116661077	116661077	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr11:116661077G>T	ENST00000227665.4	-	3	902	c.868C>A	c.(868-870)Cag>Aag	p.Q290K	APOA5_ENST00000542499.1_Missense_Mutation_p.Q290K|ZNF259_ENST00000227322.3_5'Flank			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	290					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		TAGGTGTCCTGGCGGAAAGCC	0.662																																					p.Q290K													.	.			0			c.C868A												80.0	84.0	83.0					11																	116661077		2201	4296	6497	SO:0001583	missense	116519	exon4			TGTCCTGGCGGAA	AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.868C>A	11.37:g.116661077G>T	ENSP00000227665:p.Gln290Lys		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_052968	1	0.00	0	B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Missense_Mutation	SNP	ENST00000227665.4	37	CCDS8376.2	.	.	.	.	.	.	.	.	.	.	G	2.636	-0.285184	0.05605	.	.	ENSG00000110243	ENST00000227665;ENST00000542499	T;T	0.73469	-0.75;-0.75	4.75	4.75	0.60458	Apolipoprotein/apolipophorin (1);	1.024920	0.07818	N	0.959247	T	0.64193	0.2576	N	0.25647	0.755	0.09310	N	1	B;B	0.28820	0.224;0.08	B;B	0.29077	0.098;0.067	T	0.50083	-0.8869	10	0.23302	T	0.38	-2.6722	11.9995	0.53222	0.0:0.0:0.8274:0.1726	.	287;290	B0YIW1;Q6Q788	.;APOA5_HUMAN	K	290	ENSP00000227665:Q290K;ENSP00000445002:Q290K	ENSP00000227665:Q290K	Q	-	1	0	APOA5	116166287	0.076000	0.21285	0.882000	0.34594	0.952000	0.60782	2.188000	0.42612	2.446000	0.82766	0.655000	0.94253	CAG			0.662	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106285.2			
SLC2A14	144195	broad.mit.edu	37	12	7982382	7982382	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:7982382T>C	ENST00000543909.1	-	10	1321	c.562A>G	c.(562-564)Att>Gtt	p.I188V	SLC2A14_ENST00000539924.1_Missense_Mutation_p.I203V|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000340749.5_Missense_Mutation_p.I165V|SLC2A14_ENST00000542546.1_Missense_Mutation_p.I79V|SLC2A14_ENST00000396589.2_Missense_Mutation_p.I188V|SLC2A14_ENST00000431042.2_Missense_Mutation_p.I165V|SLC2A14_ENST00000535295.1_Missense_Mutation_p.I79V			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	188					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AGAATTCCAATAACTATGCCC	0.463													t|||	1	0.000199681	0.0	0.0014	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0				p.I188V													.	SLC2A14	78		0			c.A562G												59.0	57.0	58.0					12																	7982382		2203	4300	6503	SO:0001583	missense	144195	exon6			TTCCAATAACTAT	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.562A>G	12.37:g.7982382T>C	ENSP00000440480:p.Ile188Val		Somatic	308	0	0		WXS	Illumina HiSeq	Phase_I	647	0.01	8	NM_153449	20	0.65	13	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.560790	0.00136	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924;ENST00000546234	T;T;T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	3.41	-3.45	0.04781	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.484851	0.22386	N	0.060748	T	0.57917	0.2086	N	0.13235	0.315	0.09310	N	1	B;B;B;B	0.09022	0.0;0.0;0.0;0.002	B;B;B;B	0.19666	0.006;0.003;0.002;0.026	T	0.49163	-0.8968	10	0.08381	T	0.77	.	11.1472	0.48436	0.0:0.6949:0.0:0.3051	.	203;79;165;188	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	V	165;188;165;188;79;79;203;165	ENSP00000340450:I165V;ENSP00000440480:I188V;ENSP00000407287:I165V;ENSP00000379834:I188V;ENSP00000440492:I79V;ENSP00000443903:I79V;ENSP00000445929:I203V;ENSP00000440043:I165V	ENSP00000340450:I165V	I	-	1	0	SLC2A14	7873649	0.000000	0.05858	0.356000	0.25785	0.227000	0.25037	-0.807000	0.04520	-0.528000	0.06366	-0.621000	0.04028	ATT			0.463	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000399836.2	rescued with RNA-seq	NM_153449	
SLC2A14	144195	broad.mit.edu	37	12	7982386	7982386	+	Silent	SNP	T	T	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:7982386T>G	ENST00000543909.1	-	10	1317	c.558A>C	c.(556-558)atA>atC	p.I186I	SLC2A14_ENST00000539924.1_Silent_p.I201I|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000340749.5_Silent_p.I163I|SLC2A14_ENST00000542546.1_Silent_p.I77I|SLC2A14_ENST00000396589.2_Silent_p.I186I|SLC2A14_ENST00000431042.2_Silent_p.I163I|SLC2A14_ENST00000535295.1_Silent_p.I77I			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	186					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		TTCCAATAACTATGCCCAGCT	0.463																																					p.I186I													.	SLC2A14	78		0			c.A558C												62.0	59.0	60.0					12																	7982386		2203	4300	6503	SO:0001819	synonymous_variant	144195	exon6			AATAACTATGCCC	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.558A>C	12.37:g.7982386T>G			Somatic	315	0	0		WXS	Illumina HiSeq	Phase_I	665	0.01	8	NM_153449	24	0.71	17	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Silent	SNP	ENST00000543909.1	37	CCDS8585.1																																																																																					0.463	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000399836.2	rescued with RNA-seq	NM_153449	
SLC2A3	6515	broad.mit.edu;mdanderson.org	37	12	8083900	8083900	+	Silent	SNP	G	G	T	rs138143062		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:8083900G>T	ENST00000075120.7	-	4	691	c.451C>A	c.(451-453)Cgg>Agg	p.R151R		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	151					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)	p.R151R(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		AAGGCACCCCGCAGGGCAGTA	0.507																																					p.R151R	Colon(96;424 1461 14416 20933 23688)												SLC2A3,bladder,carcinoma,0,1	SLC2A3	83	1	1	Substitution - coding silent(1)	urinary_tract(1)	c.C451A							G		2,4404	4.2+/-10.8	0,2,2201	81.0	76.0	78.0		451	3.5	1.0	12	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC2A3	NM_006931.2		0,3,6500	TT,TG,GG		0.0116,0.0454,0.0231		151/497	8083900	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	6515	exon4			CACCCCGCAGGGC	M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.451C>A	12.37:g.8083900G>T			Somatic	325	0	0		WXS	Illumina HiSeq	Phase_I	680	0.03	18	NM_006931	1127	0.02	17	B2R606|D3DUU6|Q6I9U2|Q9UG15	Silent	SNP	ENST00000075120.7	37	CCDS8586.1																																																																																					0.507	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257914.1		NM_006931	
SLC2A3	6515	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	8084046	8084046	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:8084046A>G	ENST00000075120.7	-	4	545	c.305T>C	c.(304-306)gTc>gCc	p.V102A		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	102					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		GCCACCAGTGACAGCCAACAG	0.468																																					p.V102A	Colon(96;424 1461 14416 20933 23688)												.	SLC2A3	83		0			c.T305C												95.0	90.0	92.0					12																	8084046		2203	4300	6503	SO:0001583	missense	6515	exon4			CCAGTGACAGCCA	M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.305T>C	12.37:g.8084046A>G	ENSP00000075120:p.Val102Ala		Somatic	250	0	0		WXS	Illumina HiSeq	Phase_I	576	0.03	20	NM_006931	1203	0.02	23	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	37	CCDS8586.1	.	.	.	.	.	.	.	.	.	.	A	9.255	1.041674	0.19748	.	.	ENSG00000059804	ENST00000075120;ENST00000540978;ENST00000544291	T;T	0.77877	-1.13;-1.13	4.37	4.37	0.52481	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.734607	0.13196	N	0.406350	T	0.71904	0.3395	L	0.37850	1.14	0.09310	N	1	B;B	0.24651	0.108;0.016	B;B	0.31946	0.138;0.102	T	0.65817	-0.6076	10	0.59425	D	0.04	.	11.8539	0.52427	1.0:0.0:0.0:0.0	.	28;102	F5H2H8;P11169	.;GTR3_HUMAN	A	102;28;71	ENSP00000075120:V102A;ENSP00000440750:V71A	ENSP00000075120:V102A	V	-	2	0	SLC2A3	7975313	0.914000	0.31030	0.002000	0.10522	0.004000	0.04260	8.312000	0.89976	1.965000	0.57142	0.454000	0.30748	GTC			0.468	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257914.1		NM_006931	
GUCY2C	2984	broad.mit.edu;bcgsc.ca	37	12	14836167	14836167	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:14836167delG	ENST00000261170.3	-	4	556	c.420delC	c.(418-420)cccfs	p.P140fs	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	140					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CTGAGATCATGGGGTAGCTCA	0.388																																					p.P140fs													.	GUCY2C	126		0			c.420delC												78.0	71.0	74.0					12																	14836167		2203	4300	6503	SO:0001589	frameshift_variant	2984	exon4			GATCATGGGGTAG		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.420delC	12.37:g.14836167delG	ENSP00000261170:p.Pro140fs		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	145	0.17	25	NM_004963	1	0.00	0	B2RMY6	Frame_Shift_Del	DEL	ENST00000261170.3	37	CCDS8664.1																																																																																					0.388	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400835.1			
ERBB3	2065	mdanderson.org	37	12	56495768	56495768	+	Missense_Mutation	SNP	G	G	T	rs376777418		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:56495768G>T	ENST00000267101.3	+	28	4398	c.3958G>T	c.(3958-3960)Gac>Tac	p.D1320Y	ERBB3_ENST00000553131.1_Missense_Mutation_p.D561Y|PA2G4_ENST00000552766.1_5'Flank|PA2G4_ENST00000303305.6_5'Flank|ERBB3_ENST00000450146.2_Missense_Mutation_p.D677Y|ERBB3_ENST00000415288.2_Missense_Mutation_p.D1261Y|RP11-603J24.9_ENST00000548861.1_Intron|RP11-603J24.17_ENST00000548595.1_RNA|ERBB3_ENST00000549832.1_Missense_Mutation_p.D440Y	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1320					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AGAGGCTACAGACTCTGCCTT	0.527																																					p.D1320Y													.	.			0			c.G3958T												155.0	165.0	161.0					12																	56495768		2203	4299	6502	SO:0001583	missense	2065	exon28			GCTACAGACTCTG	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3958G>T	12.37:g.56495768G>T	ENSP00000267101:p.Asp1320Tyr		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001982	111	0.00	0	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772310	0.31411	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.81078	-1.26;-1.22;-1.25;-1.45;-1.13	5.39	3.48	0.39840	.	0.163796	0.41001	D	0.000964	T	0.73257	0.3564	L	0.27053	0.805	0.40747	D	0.98288	P;P;P	0.49090	0.919;0.498;0.664	B;B;B	0.43701	0.428;0.312;0.166	T	0.79371	-0.1831	10	0.72032	D	0.01	.	16.0675	0.80893	0.0:0.2687:0.7312:0.0	.	1261;440;1320	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	Y	1320;677;1261;443;561;440	ENSP00000267101:D1320Y;ENSP00000399178:D677Y;ENSP00000408340:D1261Y;ENSP00000449129:D561Y;ENSP00000448729:D440Y	ENSP00000267101:D1320Y	D	+	1	0	ERBB3	54782035	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	4.298000	0.59067	1.491000	0.48482	-0.175000	0.13238	GAC			0.527	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407619.3			
GRIP1	23426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	66765536	66765536	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:66765536G>T	ENST00000398016.3	-	22	2862	c.2794C>A	c.(2794-2796)Ctg>Atg	p.L932M	GRIP1_ENST00000359742.4_Missense_Mutation_p.L984M|GRIP1_ENST00000286445.7_Missense_Mutation_p.L969M	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		ATTTTTCTCAGGGTTACTGAC	0.502																																					p.L932M													.	.			0			c.C2794A												179.0	184.0	183.0					12																	66765536		1990	4168	6158	SO:0001583	missense	23426	exon22			TTCTCAGGGTTAC	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2794C>A	12.37:g.66765536G>T	ENSP00000381098:p.Leu932Met		Somatic	71	0	0		WXS	Illumina HiSeq	.	74	0.23	17	NM_021150	9	0.33	3	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	37	CCDS41807.1	.	.	.	.	.	.	.	.	.	.	G	3.569	-0.087933	0.07097	.	.	ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;1.92	6.13	5.25	0.73442	PDZ/DHR/GLGF (1);	0.048077	0.85682	D	0.000000	T	0.19886	0.0478	N	0.02011	-0.69	0.29077	N	0.882939	B;B;B;B	0.14012	0.005;0.009;0.005;0.004	B;B;B;B	0.14578	0.009;0.005;0.009;0.011	T	0.15178	-1.0446	9	.	.	.	-10.3502	9.5681	0.39411	0.0652:0.0:0.6895:0.2453	.	917;984;932;969	F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2	.;GRIP1_HUMAN;.;.	M	932;984;969;917;876	ENSP00000381098:L932M;ENSP00000352780:L984M;ENSP00000286445:L969M;ENSP00000446047:L917M;ENSP00000446024:L876M	.	L	-	1	2	GRIP1	65051803	1.000000	0.71417	0.997000	0.53966	0.058000	0.15608	1.041000	0.30291	1.632000	0.50472	0.650000	0.86243	CTG			0.502	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401975.2			
SELPLG	6404	bcgsc.ca	37	12	109017399	109017399	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:109017399T>G	ENST00000550948.1	-	2	909	c.685A>C	c.(685-687)Atg>Ctg	p.M229L	SELPLG_ENST00000388962.3_Missense_Mutation_p.M219L|SELPLG_ENST00000228463.6_Missense_Mutation_p.M245L			Q14242	SELPL_HUMAN	selectin P ligand	229	12 X 10 AA tandem repeats.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						TGTGCCTCCATGGCTGTGGTT	0.622																																					p.M245L													.	SELPLG	138		0			c.A733C												207.0	165.0	180.0					12																	109017399		2203	4300	6503	SO:0001583	missense	6404	exon2			CCTCCATGGCTGT		CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.685A>C	12.37:g.109017399T>G	ENSP00000447752:p.Met229Leu		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_1	123	0.09	11	NM_001206609	10	0.00	0	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	ENST00000550948.1	37	CCDS31895.2	.	.	.	.	.	.	.	.	.	.	T	12.66	2.004459	0.35320	.	.	ENSG00000110876	ENST00000388962;ENST00000550948;ENST00000228463	T;T;T	0.13196	2.61;2.61;2.61	3.59	1.15	0.20763	.	0.562534	0.14927	N	0.290313	T	0.08044	0.0201	N	0.19112	0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.28713	-1.0035	10	0.72032	D	0.01	0.0106	5.5683	0.17182	0.1524:0.0881:0.0:0.7595	.	245;229;189	B7Z5C7;Q14242;B4DHR9	.;SELPL_HUMAN;.	L	219;229;245	ENSP00000373614:M219L;ENSP00000447752:M229L;ENSP00000228463:M245L	ENSP00000228463:M245L	M	-	1	0	SELPLG	107541528	0.000000	0.05858	0.004000	0.12327	0.012000	0.07955	0.222000	0.17699	0.231000	0.21079	0.533000	0.62120	ATG			0.622	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403904.1			
SELPLG	6404	bcgsc.ca	37	12	109017401	109017401	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr12:109017401G>C	ENST00000550948.1	-	2	907	c.683C>G	c.(682-684)gCc>gGc	p.A228G	SELPLG_ENST00000388962.3_Missense_Mutation_p.A218G|SELPLG_ENST00000228463.6_Missense_Mutation_p.A244G			Q14242	SELPL_HUMAN	selectin P ligand	228	12 X 10 AA tandem repeats.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						TGCCTCCATGGCTGTGGTTTG	0.627																																					p.A244G													.	SELPLG	138		0			c.C731G												205.0	164.0	178.0					12																	109017401		2203	4300	6503	SO:0001583	missense	6404	exon2			TCCATGGCTGTGG		CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.683C>G	12.37:g.109017401G>C	ENSP00000447752:p.Ala228Gly		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_1	121	0.09	11	NM_001206609	10	0.00	0	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	ENST00000550948.1	37	CCDS31895.2	.	.	.	.	.	.	.	.	.	.	G	8.958	0.969886	0.18659	.	.	ENSG00000110876	ENST00000388962;ENST00000550948;ENST00000228463	T;T;T	0.32753	1.44;1.44;1.44	3.59	1.75	0.24633	.	1.738900	0.03373	N	0.199271	T	0.27559	0.0677	L	0.46157	1.445	0.09310	N	1	P;P;P	0.42518	0.782;0.782;0.782	B;B;B	0.37650	0.255;0.255;0.255	T	0.21042	-1.0257	10	0.32370	T	0.25	-1.7241	6.39	0.21581	0.1906:0.191:0.6184:0.0	.	244;228;188	B7Z5C7;Q14242;B4DHR9	.;SELPL_HUMAN;.	G	218;228;244	ENSP00000373614:A218G;ENSP00000447752:A228G;ENSP00000228463:A244G	ENSP00000228463:A244G	A	-	2	0	SELPLG	107541530	0.001000	0.12720	0.003000	0.11579	0.015000	0.08874	0.534000	0.23098	0.507000	0.28148	0.655000	0.94253	GCC			0.627	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403904.1			
MPHOSPH8	54737	bcgsc.ca	37	13	20208029	20208029	+	Silent	SNP	C	C	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr13:20208029C>A	ENST00000361479.5	+	1	209	c.141C>A	c.(139-141)gcC>gcA	p.A47A	MPHOSPH8_ENST00000414242.2_Silent_p.A47A	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	47					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		GAGCGGAGGCCTTTGGCGACA	0.617																																					p.A47A													.	MPHOSPH8	58		0			c.C141A												53.0	42.0	46.0					13																	20208029		2202	4300	6502	SO:0001819	synonymous_variant	54737	exon1			GGAGGCCTTTGGC	AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.141C>A	13.37:g.20208029C>A			Somatic	120	0	0		WXS	Illumina HiSeq	Phase_1	67	0.21	14	NM_017520	26	0.00	0	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Silent	SNP	ENST00000361479.5	37	CCDS9287.1																																																																																					0.617	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044028.2		NM_017520	
PABPC3	5042	bcgsc.ca	37	13	25671311	25671315	+	Frame_Shift_Del	DEL	TATGA	TATGA	-	rs371130768|rs373128241		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	TATGA	TATGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr13:25671311_25671315delTATGA	ENST00000281589.3	+	1	1012_1016	c.975_979delTATGA	c.(973-981)gttatgatgfs	p.MM326fs		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	326	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GTGCAAAGGTTATGATGGAAGGTGG	0.415																																					p.325_327del													.	PABPC3	129		0			c.975_979del																																									SO:0001589	frameshift_variant	5042	exon1			AAAGGTTATGATG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.975_979delTATGA	13.37:g.25671311_25671315delTATGA	ENSP00000281589:p.Met326fs		Somatic	185	0	0		WXS	Illumina HiSeq	Phase_1	122	0.03	4	NM_030979	12	0.00	0	Q8NHV0|Q9H086	Frame_Shift_Del	DEL	ENST00000281589.3	37	CCDS9311.1																																																																																					0.415	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044220.2		NM_030979	
SMOC1	64093	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	70496970	70496970	+	Missense_Mutation	SNP	G	G	C	rs192204434		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr14:70496970G>C	ENST00000381280.4	+	12	1553	c.1300G>C	c.(1300-1302)Gtc>Ctc	p.V434L	SMOC1_ENST00000361956.3_Missense_Mutation_p.V435L	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	434					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		AGGACGCCTCGTCTAAGGAGC	0.502																																					p.V435L													.	SMOC1	61		0			c.G1303C												97.0	93.0	94.0					14																	70496970		2203	4300	6503	SO:0001583	missense	64093	exon12			CGCCTCGTCTAAG	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.1300G>C	14.37:g.70496970G>C	ENSP00000370680:p.Val434Leu		Somatic	181	0.0165745856	3		WXS	Illumina HiSeq	Phase_I	197	0.27	54	NM_001034852	169	0.28	47	A8K1S3|B2R7P5|Q96F78	Missense_Mutation	SNP	ENST00000381280.4	37	CCDS9798.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320411	0.23994	.	.	ENSG00000198732	ENST00000361956;ENST00000381280	T;T	0.56103	0.48;0.49	5.6	4.71	0.59529	.	1.160520	0.06115	N	0.667978	T	0.36690	0.0976	N	0.08118	0	0.27523	N	0.951345	P;P	0.38565	0.637;0.504	B;B	0.33295	0.161;0.077	T	0.40534	-0.9558	10	0.56958	D	0.05	.	13.939	0.64043	0.0728:0.0:0.9272:0.0	.	435;434	Q9H4F8-2;Q9H4F8	.;SMOC1_HUMAN	L	435;434	ENSP00000355110:V435L;ENSP00000370680:V434L	ENSP00000355110:V435L	V	+	1	0	SMOC1	69566723	1.000000	0.71417	0.998000	0.56505	0.125000	0.20455	2.047000	0.41269	1.501000	0.48654	-0.145000	0.13849	GTC			0.502	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000412467.1			
Unknown	0	bcgsc.ca	37	15	20482111	20482111	+	IGR	SNP	G	G	A	rs11629632		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr15:20482111G>A								RP11-173D3.1 (128905 upstream) : CHEK2P2 (5885 downstream)																							TTGGGTTCGCGGCCACTCTGT	0.582																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GTTCGCGGCCACT																													15.37:g.20482111G>A			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_1	7	0.57	4	.	0		0		RNA	SNP		37																																																																																					0	0.582										
IGHV1OR15-3	646370	bcgsc.ca	37	15	22466343	22466343	+	IGR	SNP	T	T	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr15:22466343T>C								AC010760.1 (5992 upstream) : IGHV4OR15-8 (6574 downstream)																							ACTACACCAGTTGGACCTGGG	0.562																																					.													.	.			0			.												139.0	127.0	131.0					15																	22466343		1959	4138	6097	SO:0001628	intergenic_variant	0	.			CACCAGTTGGACC																													15.37:g.22466343T>C			Somatic	598	0.008361204	5		WXS	Illumina HiSeq	Phase_1	254	0.09	23	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.562										
UNC13C	440279	mdanderson.org	37	15	54307876	54307876	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr15:54307876G>A	ENST00000260323.11	+	1	2776	c.2776G>A	c.(2776-2778)Gca>Aca	p.A926T	UNC13C_ENST00000545554.1_Missense_Mutation_p.A926T|UNC13C_ENST00000537900.1_Missense_Mutation_p.A926T	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	926					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGATGGTCCAGCAGATGATAT	0.388																																					p.A926T													.	.			0			c.G2776A												90.0	87.0	88.0					15																	54307876		1868	4099	5967	SO:0001583	missense	440279	exon1			GGTCCAGCAGATG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2776G>A	15.37:g.54307876G>A	ENSP00000260323:p.Ala926Thr		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	81	0.05	4	NM_001080534	2	0.00	0	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	8.575	0.880891	0.17467	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.78924	-1.22;-1.22;-1.22	5.69	3.77	0.43336	.	.	.	.	.	T	0.55625	0.1932	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38824	-0.9643	9	0.12430	T	0.62	.	4.3587	0.11192	0.0786:0.1256:0.5425:0.2533	.	926	Q8NB66	UN13C_HUMAN	T	926	ENSP00000260323:A926T;ENSP00000438156:A926T;ENSP00000442569:A926T	ENSP00000260323:A926T	A	+	1	0	UNC13C	52095168	0.400000	0.25295	0.983000	0.44433	0.891000	0.51852	1.553000	0.36255	0.721000	0.32231	0.650000	0.86243	GCA			0.388	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000419028.3		NM_173166	
RPLP1	6176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69747557	69747557	+	Missense_Mutation	SNP	G	G	T	rs200917641		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr15:69747557G>T	ENST00000260379.6	+	3	361	c.196G>T	c.(196-198)Ggt>Tgt	p.G66C	U3_ENST00000384391.1_RNA|RPLP1_ENST00000560274.1_Intron|RPLP1_ENST00000357790.5_Missense_Mutation_p.G41C	NM_001003.2	NP_000994.1	P05386	RLA1_HUMAN	ribosomal protein, large, P1	66					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			ovary(1)	1						TGTAGGGGCCGGTGGACCTGC	0.562																																					p.G66C													.	.			0			c.G196T												54.0	56.0	55.0					15																	69747557		2199	4298	6497	SO:0001583	missense	6176	exon3			GGGGCCGGTGGAC		CCDS10233.1, CCDS10234.1	15q22	2011-07-29			ENSG00000137818	ENSG00000137818		"""L ribosomal proteins"""	10372	protein-coding gene	gene with protein product		180520					Standard	NM_001003		Approved	LP1	uc002asd.1	P05386	OTTHUMG00000133359	ENST00000260379.6:c.196G>T	15.37:g.69747557G>T	ENSP00000346037:p.Gly66Cys		Somatic	141	0	0		WXS	Illumina HiSeq	.	97	0.32	31	NM_001003	14447	0.25	3576	A6NIB2	Missense_Mutation	SNP	ENST00000260379.6	37	CCDS10233.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310966	0.81358	.	.	ENSG00000137818	ENST00000260379;ENST00000357790	.	.	.	5.5	4.59	0.56863	.	0.061477	0.64402	D	0.000003	D	0.85208	0.5644	H	0.95004	3.61	0.80722	D	1	D;D	0.69078	0.986;0.997	P;D	0.74674	0.879;0.984	D	0.88075	0.2803	9	0.62326	D	0.03	.	11.9829	0.53129	0.0842:0.0:0.9158:0.0	.	41;66	A6NIB2;P05386	.;RLA1_HUMAN	C	66;41	.	ENSP00000346037:G66C	G	+	1	0	RPLP1	67534611	1.000000	0.71417	0.975000	0.42487	0.842000	0.47809	8.867000	0.92314	1.320000	0.45209	0.557000	0.71058	GGT			0.562	RPLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257195.2		NM_001003	
ATP6V0C	527	mdanderson.org	37	16	2569648	2569648	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr16:2569648C>T	ENST00000330398.4	+	3	604	c.370C>T	c.(370-372)Cag>Tag	p.Q124*	RP11-20I23.1_ENST00000564543.1_3'UTR|ATP6C_ENST00000569317.1_Intron|AMDHD2_ENST00000293971.6_5'Flank|AMDHD2_ENST00000302956.4_5'Flank|ATP6V0C_ENST00000568562.1_3'UTR|ATP6V0C_ENST00000564973.1_Nonsense_Mutation_p.Q81*|AMDHD2_ENST00000413459.3_5'Flank|ATP6V0C_ENST00000565223.1_Nonsense_Mutation_p.Q81*	NM_001198569.1|NM_001694.3	NP_001185498.1|NP_001685.1	P27449	VATL_HUMAN	ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c	124					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|lung(1)|ovary(1)	3		Ovarian(90;0.17)				CACCGCCCAGCAGCCCCGACT	0.672																																					p.Q124X													.	.			0			c.C370T												43.0	41.0	42.0					16																	2569648		2198	4300	6498	SO:0001587	stop_gained	527	exon3			GCCCAGCAGCCCC	M62762	CCDS10470.1	16p13.3	2010-04-21	2002-08-29	2002-05-10	ENSG00000185883	ENSG00000185883	3.6.3.14	"""ATPases / V-type"""	855	protein-coding gene	gene with protein product		108745	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16kD"""	ATPL, ATP6C, ATP6L		1709739, 8250920	Standard	NM_001694		Approved	VATL, Vma3	uc021tav.1	P27449	OTTHUMG00000128865	ENST00000330398.4:c.370C>T	16.37:g.2569648C>T	ENSP00000329757:p.Gln124*		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001694	701	0.00	0	Q6FH26	Nonsense_Mutation	SNP	ENST00000330398.4	37	CCDS10470.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.503807	0.44558	.	.	ENSG00000185883	ENST00000330398	.	.	.	4.92	3.96	0.45880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.4524	11.4475	0.50131	0.0:0.9109:0.0:0.0891	.	.	.	.	X	124	.	ENSP00000329757:Q124X	Q	+	1	0	ATP6V0C	2509649	1.000000	0.71417	1.000000	0.80357	0.124000	0.20399	5.996000	0.70639	2.297000	0.77311	0.306000	0.20318	CAG			0.672	ATP6V0C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250810.1		NM_001694	
LOC653786	653786	broad.mit.edu	37	16	22588015	22588015	+	RNA	SNP	A	A	G	rs460493	byFrequency	TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr16:22588015A>G	ENST00000550753.1	+	0	2490					NR_003676.2																						TGGCCTGAGCACATCGTCCTG	0.557													G|||	7	0.00139776	0.0015	0.0	5008	,	,		24848	0.004		0.0	False		,,,				2504	0.001				.													.	.			0			.																																											0	.			CTGAGCACATCGT																													16.37:g.22588015A>G			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	32	0.13	4	.	8	0.25	2		RNA	SNP	ENST00000550753.1	37																																																																																						0.557	RP11-368J21.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409041.1			
RABEP2	79874	mdanderson.org	37	16	28925602	28925602	+	Silent	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr16:28925602G>T	ENST00000358201.4	-	5	1437	c.849C>A	c.(847-849)ggC>ggA	p.G283G	RABEP2_ENST00000544477.1_Silent_p.G212G|RABEP2_ENST00000357573.6_Silent_p.G283G|RABEP2_ENST00000561803.1_5'Flank	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	283					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CGAGCTGGTAGCCAGGAGGGG	0.652																																					p.G283G	Pancreas(66;639 1284 10093 31061 49099)												.	.			0			c.C849A												25.0	30.0	28.0					16																	28925602		2030	4179	6209	SO:0001819	synonymous_variant	79874	exon5			CTGGTAGCCAGGA	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.849C>A	16.37:g.28925602G>T			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_024816	41	0.00	0		Silent	SNP	ENST00000358201.4	37	CCDS42140.1																																																																																					0.652	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000432691.1		NM_024816	
SLC38A7	55238	mdanderson.org	37	16	58713788	58713788	+	Silent	SNP	G	G	A	rs373479233		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr16:58713788G>A	ENST00000570101.1	-	2	1126	c.243C>T	c.(241-243)ggC>ggT	p.G81G	SLC38A7_ENST00000564100.1_Silent_p.G81G|SLC38A7_ENST00000566953.1_Intron|SLC38A7_ENST00000219320.4_Silent_p.G81G|SLC38A7_ENST00000564391.1_Silent_p.G81G|SLC38A7_ENST00000564010.1_Intron			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	81					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						CTGCTGCCACGCCCCCCGCAG	0.627																																					p.G81G													.	.			0			c.C243T							G		2,4394	4.2+/-10.8	1,0,2197	44.0	41.0	42.0		243	-5.6	0.8	16		42	0,8600		0,0,4300	no	coding-synonymous	SLC38A7	NM_018231.1		1,0,6497	AA,AG,GG		0.0,0.0455,0.0154		81/463	58713788	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	55238	exon3			TGCCACGCCCCCC	BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.243C>T	16.37:g.58713788G>A			Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_018231	28	0.00	0	Q53GJ9|Q9H9I5	Silent	SNP	ENST00000570101.1	37	CCDS10800.1																																																																																					0.627	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000422206.2		NM_018231	
SMPD3	55512	mdanderson.org	37	16	68398787	68398787	+	Silent	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr16:68398787C>T	ENST00000219334.5	-	5	2025	c.1422G>A	c.(1420-1422)ggG>ggA	p.G474G	SMPD3_ENST00000563226.1_Silent_p.G474G|SMPD3_ENST00000568373.1_Silent_p.G474G|SMPD3_ENST00000566009.1_5'UTR	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	474					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GGTCCAGCTGCCCACACCGGA	0.607																																					p.G474G													.	.			0			c.G1422A												44.0	38.0	40.0					16																	68398787		2198	4300	6498	SO:0001819	synonymous_variant	55512	exon5			CAGCTGCCCACAC	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1422G>A	16.37:g.68398787C>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_018667	5	0.00	0	B7ZL82|Q2M1S8	Silent	SNP	ENST00000219334.5	37	CCDS10867.1																																																																																					0.607	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268895.3		NM_018667	
SLC38A8	146167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84075679	84075679	+	Silent	SNP	G	G	T	rs140582456		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr16:84075679G>T	ENST00000299709.3	-	1	83	c.84C>A	c.(82-84)ggC>ggA	p.G28G	RNA5SP432_ENST00000362480.1_RNA	NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	28					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TGAAGACAGCGCCCATCGAGG	0.647																																					p.G28G													.	.			0			c.C84A												89.0	100.0	96.0					16																	84075679		2200	4300	6500	SO:0001819	synonymous_variant	146167	exon1			GACAGCGCCCATC		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.84C>A	16.37:g.84075679G>T			Somatic	55	0	0		WXS	Illumina HiSeq	.	71	0.34	24	NM_001080442	2	0.00	0		Silent	SNP	ENST00000299709.3	37	CCDS32495.1																																																																																					0.647	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000432623.1		NM_001080442	
EMC6	83460	hgsc.bcm.edu	37	17	3571757	3571757	+	5'Flank	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr17:3571757G>A	ENST00000397133.2	+	0	0				EMC6_ENST00000248378.5_5'Flank|P2RX5-TAX1BP3_ENST00000550383.1_Intron|TAX1BP3_ENST00000225525.3_Intron	NM_001014764.1	NP_001014764.1	Q9BV81	EMC6_HUMAN	ER membrane protein complex subunit 6							ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CCAAGACGAGGAGGAGCCCGC	0.692																																					.													.	.			0			.												21.0	28.0	26.0					17																	3571757		2201	4296	6497	SO:0001631	upstream_gene_variant	0	.			GACGAGGAGGAGC		CCDS11033.1	17p13.2	2012-05-23	2012-05-23	2012-05-23		ENSG00000127774			28430	protein-coding gene	gene with protein product			"""transmembrane protein 93"""	TMEM93		22119785	Standard	NM_001014764		Approved	MGC2963	uc002fwg.1	Q9BV81			17.37:g.3571757G>A	Exception_encountered		Somatic	76	0	0		WXS	Illumina HiSeq	.	108	0.14	15	.	0		0		RNA	SNP	ENST00000397133.2	37	CCDS11033.1																																																																																					0.692	EMC6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450159.1		NM_031298	
TP53I13	90313	mdanderson.org	37	17	27899194	27899194	+	Missense_Mutation	SNP	G	G	T	rs577200698		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr17:27899194G>T	ENST00000301057.7	+	6	663	c.548G>T	c.(547-549)cGg>cTg	p.R183L	RP11-68I3.2_ENST00000581474.1_RNA|RP11-68I3.4_ENST00000579050.1_RNA	NM_138349.2	NP_612358.3	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	183						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(3;0.236)		CGGAGCTGGCGGCCCCCTGGC	0.657																																					p.R183L													.	.			0			c.G548T												24.0	26.0	25.0					17																	27899194		1998	4154	6152	SO:0001583	missense	90313	exon6			GCTGGCGGCCCCC	AK075341	CCDS42289.1	17q11.2	2006-01-16				ENSG00000167543			25102	protein-coding gene	gene with protein product						14767535	Standard	NM_138349		Approved	DSCP1	uc002hee.3	Q8NBR0		ENST00000301057.7:c.548G>T	17.37:g.27899194G>T	ENSP00000301057:p.Arg183Leu		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_138349	289	0.00	0	Q7L5U3	Missense_Mutation	SNP	ENST00000301057.7	37	CCDS42289.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.754752	0.31046	.	.	ENSG00000167543	ENST00000301057	.	.	.	3.94	2.94	0.34122	.	0.594604	0.14918	N	0.290860	T	0.46946	0.1419	M	0.68317	2.08	0.31318	N	0.686334	P	0.46064	0.872	B	0.42593	0.392	T	0.56667	-0.7941	9	0.62326	D	0.03	-8.6848	9.5052	0.39042	0.0:0.2159:0.7841:0.0	.	183	Q8NBR0	P5I13_HUMAN	L	183	.	ENSP00000301057:R183L	R	+	2	0	TP53I13	24923320	0.488000	0.25996	0.993000	0.49108	0.769000	0.43574	0.574000	0.23714	0.961000	0.38030	0.462000	0.41574	CGG			0.657	TP53I13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447804.2		NM_138349	
RP11-271K11.5	0	broad.mit.edu	37	17	29371989	29371990	+	RNA	INS	-	-	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr17:29371989_29371990insA	ENST00000583112.1	-	0	628																		p.?(1)									aaaaaaaagagaaaaaaaagaa	0.356																																					.													.	.			1	Unknown(1)	central_nervous_system(1)	.																																											0	.			AAAAGAGAAAAAA																													17.37:g.29371997_29371997dupA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	5	0.20	1	.	0		0		RNA	INS	ENST00000583112.1	37																																																																																						0.356	RP11-271K11.5-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000444574.1			
CCR10	2826	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	40831978	40831978	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr17:40831978C>G	ENST00000332438.4	-	2	701	c.682G>C	c.(682-684)Gcg>Ccg	p.A228P	PLEKHH3_ENST00000412503.1_5'Flank|CCR10_ENST00000591765.1_Missense_Mutation_p.A6P|CNTNAP1_ENST00000264638.4_5'Flank|PLEKHH3_ENST00000293349.6_5'Flank|CTD-3193K9.4_ENST00000593139.1_RNA	NM_016602.2	NP_057686.2	P46092	CCR10_HUMAN	chemokine (C-C motif) receptor 10	228					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			lung(1)|ovary(1)|skin(1)	3		Breast(137;0.000153)		BRCA - Breast invasive adenocarcinoma(366;0.14)		CCCAGAAGCGCGTAGCAGGCT	0.751																																					p.A228P													.	.			0			c.G682C												5.0	5.0	5.0					17																	40831978		2020	4008	6028	SO:0001583	missense	2826	exon2			GAAGCGCGTAGCA	AF215981	CCDS11435.1	17q21.1-q21.3	2012-08-08	2004-11-12	2004-11-12	ENSG00000184451	ENSG00000184451		"""GPCR / Class A : Chemokine receptors : C-C motif"""	4474	protein-coding gene	gene with protein product		600240	"""G protein-coupled receptor 2"""	GPR2		7851889	Standard	NM_016602		Approved		uc002iax.4	P46092	OTTHUMG00000132301	ENST00000332438.4:c.682G>C	17.37:g.40831978C>G	ENSP00000332504:p.Ala228Pro		Somatic	14	0	0		WXS	Illumina HiSeq	.	23	0.26	6	NM_016602	6	0.17	1	Q4V749|Q6T7X2|Q9NZG2	Missense_Mutation	SNP	ENST00000332438.4	37	CCDS11435.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506301	0.44558	.	.	ENSG00000184451	ENST00000332438	T	0.72835	-0.69	4.24	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40469	N	0.001096	T	0.72104	0.3419	M	0.83774	2.66	0.23731	N	0.996999	P	0.35050	0.482	B	0.40534	0.332	T	0.65368	-0.6185	10	0.49607	T	0.09	.	8.3883	0.32514	0.0:0.7332:0.0:0.2668	.	228	P46092	CCR10_HUMAN	P	228	ENSP00000332504:A228P	ENSP00000332504:A228P	A	-	1	0	CCR10	38085504	0.000000	0.05858	0.996000	0.52242	0.518000	0.34316	-1.138000	0.03216	1.001000	0.39076	-0.448000	0.05591	GCG			0.751	CCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255406.1		NM_016602	
RUNDC1	146923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41141537	41141537	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr17:41141537G>A	ENST00000361677.1	+	3	849	c.837G>A	c.(835-837)atG>atA	p.M279I		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	279										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		ACCTTGAGATGTTTATCAACT	0.443																																					p.M279I													.	.			0			c.G837A												77.0	70.0	72.0					17																	41141537		2203	4300	6503	SO:0001583	missense	146923	exon3			TGAGATGTTTATC	AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.837G>A	17.37:g.41141537G>A	ENSP00000354622:p.Met279Ile		Somatic	75	0	0		WXS	Illumina HiSeq	.	108	0.28	30	NM_173079	24	0.13	3	Q6Y2K8|Q8IXT9|Q8N3W1	Missense_Mutation	SNP	ENST00000361677.1	37	CCDS11448.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793378	0.90453	.	.	ENSG00000198863	ENST00000361677	T	0.18338	2.22	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.42200	0.1192	M	0.65975	2.015	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.09122	-1.0689	10	0.51188	T	0.08	-35.7151	19.2405	0.93881	0.0:0.0:1.0:0.0	.	279	Q96C34	RUND1_HUMAN	I	279	ENSP00000354622:M279I	ENSP00000354622:M279I	M	+	3	0	RUNDC1	38395063	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.657000	0.98554	2.780000	0.95670	0.655000	0.94253	ATG			0.443	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452464.1		NM_173079	
SDK2	54549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	71387578	71387578	+	Splice_Site	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr17:71387578C>T	ENST00000392650.3	-	28	3998		c.e28+1		SDK2_ENST00000388726.3_Splice_Site	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CAAAGGCTTACCAAGAATGAT	0.617																																					.													.	.			0			c.3997+1G>A												20.0	20.0	20.0					17																	71387578		2200	4299	6499	SO:0001630	splice_region_variant	54549	exon29			GGCTTACCAAGAA	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.3997+1G>A	17.37:g.71387578C>T			Somatic	98	0	0		WXS	Illumina HiSeq	.	130	0.14	18	NM_001144952	0		0	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Splice_Site	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379211	0.82682	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.227	0.86973	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SDK2	68899173	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.244000	0.78228	2.353000	0.79882	0.561000	0.74099	.			0.617	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327598.2		NM_019064	Intron
SLC16A3	9123	mdanderson.org	37	17	80195738	80195738	+	Silent	SNP	G	G	A	rs536867522		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr17:80195738G>A	ENST00000581287.1	+	3	3414	c.1092G>A	c.(1090-1092)gcG>gcA	p.A364A	SLC16A3_ENST00000392341.1_Silent_p.A364A|SLC16A3_ENST00000582743.1_Silent_p.A364A|SLC16A3_ENST00000392339.1_Silent_p.A364A	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	364					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	TGATGGAGGCGGTGGCCGTGC	0.692																																					p.A364A	Pancreas(52;652 1135 19190 37282 52456)												.	.			0			c.G1092A												30.0	26.0	27.0					17																	80195738		2197	4295	6492	SO:0001819	synonymous_variant	9123	exon4			GGAGGCGGTGGCC	U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.1092G>A	17.37:g.80195738G>A			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001206952	307	0.00	1	B3KXG8|Q2M1P8	Silent	SNP	ENST00000581287.1	37	CCDS11804.1																																																																																					0.692	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443498.1		NM_004207	
SMAD7	4092	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	46474772	46474772	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr18:46474772C>A	ENST00000262158.2	-	2	935	c.649G>T	c.(649-651)Gat>Tat	p.D217Y	SMAD7_ENST00000589634.1_Missense_Mutation_p.D217Y|SMAD7_ENST00000591805.1_Missense_Mutation_p.D2Y	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	217	Important for interaction with SMURF2.				adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					TTGAGAAAATCCATCGGGTAT	0.393																																					p.D217Y													.	.			0			c.G649T												43.0	50.0	47.0					18																	46474772		2203	4300	6503	SO:0001583	missense	4092	exon2			GAAAATCCATCGG	AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.649G>T	18.37:g.46474772C>A	ENSP00000262158:p.Asp217Tyr		Somatic	149	0	0		WXS	Illumina HiSeq	.	128	0.09	11	NM_005904	64	0.08	5	B7Z773|K7EQ10|O14740|Q6DK23	Missense_Mutation	SNP	ENST00000262158.2	37	CCDS11936.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360044	0.82353	.	.	ENSG00000101665	ENST00000545051;ENST00000262158	D	0.96885	-4.16	5.01	5.01	0.66863	SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	D	0.97232	0.9095	L	0.60455	1.87	0.80722	D	1	D	0.64830	0.994	P	0.61201	0.885	D	0.97868	1.0284	10	0.66056	D	0.02	.	17.9442	0.89035	0.0:1.0:0.0:0.0	.	217	O15105	SMAD7_HUMAN	Y	2;217	ENSP00000262158:D217Y	ENSP00000262158:D217Y	D	-	1	0	SMAD7	44728770	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.042000	0.76565	2.333000	0.79357	0.563000	0.77884	GAT			0.393	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255906.1		NM_005904	
SMAD7	4092	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	46474783	46474783	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr18:46474783C>G	ENST00000262158.2	-	2	924	c.638G>C	c.(637-639)aGa>aCa	p.R213T	SMAD7_ENST00000589634.1_Missense_Mutation_p.R213T|SMAD7_ENST00000591805.1_5'UTR	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	213	Important for interaction with SMURF2.				adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					CATCGGGTATCTGGAGTAAGG	0.388																																					p.R213T													.	SMAD7	22		0			c.G638C												38.0	46.0	44.0					18																	46474783		2203	4300	6503	SO:0001583	missense	4092	exon2			GGGTATCTGGAGT	AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.638G>C	18.37:g.46474783C>G	ENSP00000262158:p.Arg213Thr		Somatic	139	0.0143884892	2		WXS	Illumina HiSeq	Phase_I	120	0.09	11	NM_005904	70	0.01	1	B7Z773|K7EQ10|O14740|Q6DK23	Missense_Mutation	SNP	ENST00000262158.2	37	CCDS11936.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254403	0.59212	.	.	ENSG00000101665	ENST00000262158	D	0.97161	-4.27	5.01	5.01	0.66863	MAD homology, MH1 (1);SMAD/FHA domain (1);	0.164121	0.50627	D	0.000113	D	0.96275	0.8785	M	0.71581	2.175	0.80722	D	1	P	0.41420	0.749	B	0.43225	0.412	D	0.96105	0.9072	10	0.54805	T	0.06	.	12.7516	0.57312	0.0:0.9183:0.0:0.0817	.	213	O15105	SMAD7_HUMAN	T	213	ENSP00000262158:R213T	ENSP00000262158:R213T	R	-	2	0	SMAD7	44728781	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.365000	0.66116	2.333000	0.79357	0.563000	0.77884	AGA			0.388	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255906.1		NM_005904	
AMH	268	ucsc.edu	37	19	2249633	2249633	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:2249633G>T	ENST00000221496.4	+	1	324	c.302G>T	c.(301-303)gGg>gTg	p.G101V	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	101			G -> V (in PMDS1). {ECO:0000269|PubMed:8162013}.		aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCACCTTCGGGGTCTGCAAC	0.731									Persistant Mullerian Duct Syndrome (type I and II)																												p.G101V													.	AMH	12		0			c.G302T	GRCh37	CM940046	AMH	M								4.0	5.0	5.0					19																	2249633		2017	3989	6006	SO:0001583	missense	268	exon1	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	CCTTCGGGGTCTG	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.302G>T	19.37:g.2249633G>T	ENSP00000221496:p.Gly101Val		Somatic	15	0	0		RNA-Seq	Illumina HiSeq		7	0.29	2	NM_000479	56	0.41	23	O75246|Q6GTN3	Missense_Mutation	SNP	ENST00000221496.4	37	CCDS12085.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556265	0.45487	.	.	ENSG00000104899	ENST00000221496	D	0.90732	-2.72	3.91	2.84	0.33178	Anti-Mullerian hormone, N-terminal (1);	0.067026	0.64402	D	0.000012	D	0.92893	0.7739	M	0.69823	2.125	0.49687	D	0.999814	D	0.54601	0.967	P	0.58013	0.831	D	0.92530	0.6032	10	0.87932	D	0	-14.1632	11.9415	0.52903	0.0:0.1776:0.8224:0.0	.	101	P03971	MIS_HUMAN	V	101	ENSP00000221496:G101V	ENSP00000221496:G101V	G	+	2	0	AMH	2200633	1.000000	0.71417	0.033000	0.17914	0.081000	0.17604	3.682000	0.54656	0.622000	0.30249	0.456000	0.33151	GGG			0.731	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451276.3		NM_000479	
ADAMTS10	81794	mdanderson.org	37	19	8649876	8649876	+	Silent	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:8649876G>T	ENST00000597188.1	-	25	3375	c.3105C>A	c.(3103-3105)ggC>ggA	p.G1035G	ADAMTS10_ENST00000595838.1_Silent_p.G522G|ADAMTS10_ENST00000270328.4_Silent_p.G1035G|AC130469.2_ENST00000597256.1_RNA	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	1035	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						GCGACGCCTGGCCCGTGTGGC	0.731																																					p.G1035G													.	.			0			c.C3105A												3.0	3.0	3.0					19																	8649876		1648	3012	4660	SO:0001819	synonymous_variant	81794	exon25			CGCCTGGCCCGTG	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.3105C>A	19.37:g.8649876G>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_030957	27	0.00	0	M0QZE4	Silent	SNP	ENST00000597188.1	37	CCDS12206.1																																																																																					0.731	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460085.3		NM_030957	
PGLYRP2	114770	mdanderson.org	37	19	15582890	15582890	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:15582890C>T	ENST00000340880.4	-	3	1634	c.1154G>A	c.(1153-1155)cGc>cAc	p.R385H	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.R385H	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	385					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						CCAGCGGCAGCGGGGGTGGAT	0.642																																					p.R385H													.	.			0			c.G1154A												19.0	20.0	20.0					19																	15582890		2199	4294	6493	SO:0001583	missense	114770	exon3			CGGCAGCGGGGGT	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1154G>A	19.37:g.15582890C>T	ENSP00000345968:p.Arg385His		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_052890	5	0.00	0	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	37	CCDS12330.2	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492765	0.64074	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.35421	1.31;1.31	4.73	4.73	0.59995	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (2);	0.000000	0.85682	D	0.000000	T	0.67627	0.2913	M	0.91140	3.18	0.50813	D	0.99989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.76680	-0.2870	10	0.87932	D	0	-23.6244	15.1901	0.73038	0.0:1.0:0.0:0.0	.	385;385	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	H	385	ENSP00000345968:R385H;ENSP00000292609:R385H	ENSP00000292609:R385H	R	-	2	0	PGLYRP2	15443890	1.000000	0.71417	0.982000	0.44146	0.011000	0.07611	5.174000	0.65015	2.179000	0.69175	0.561000	0.74099	CGC			0.642	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319626.1		NM_052890	
ANKLE1	126549	broad.mit.edu	37	19	17397498	17397501	+	3'UTR	DEL	TGTT	TGTT	-	rs71180380|rs563327402|rs534658778|rs1465582	byFrequency	TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	TGTT	TGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:17397498_17397501delTGTT	ENST00000394458.3	+	0	2261_2264				ANKLE1_ENST00000598347.1_Frame_Shift_Del_p.CL590fs|ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000594072.1_3'UTR	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtgtttgtgtgtgtg	0.529																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTGTTTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TGTT>-	19.37:g.17397498_17397501delTGTT			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	11	0.73	8	.	22	0.00	0	A8VU82|Q8N8J8	Frame_Shift_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.529	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
SLC27A1	376497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17598309	17598309	+	Silent	SNP	G	G	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:17598309G>C	ENST00000252595.7	+	4	862	c.765G>C	c.(763-765)ctG>ctC	p.L255L	SLC27A1_ENST00000442725.1_Silent_p.L255L|CTD-3131K8.2_ENST00000596643.1_lincRNA|SLC27A1_ENST00000598424.1_Silent_p.L76L	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	255	Sufficient for oligomerization. {ECO:0000250}.				adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CCACCGGGCTGCCCAAGGCTG	0.617																																					p.L255L													.	.			0			c.G765C												34.0	34.0	34.0					19																	17598309		2203	4300	6503	SO:0001819	synonymous_variant	376497	exon4			CGGGCTGCCCAAG	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.765G>C	19.37:g.17598309G>C			Somatic	50	0	0		WXS	Illumina HiSeq	.	31	0.35	11	NM_198580	54	0.44	24	A6NIH2|B7Z662	Silent	SNP	ENST00000252595.7	37	CCDS32953.1																																																																																					0.617	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464145.1		NM_198580	
FCHO1	23149	mdanderson.org	37	19	17889000	17889000	+	Silent	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:17889000G>A	ENST00000596536.1	+	19	1597	c.1314G>A	c.(1312-1314)ccG>ccA	p.P438P	FCHO1_ENST00000595033.1_Silent_p.P388P|FCHO1_ENST00000389133.4_Silent_p.P438P|FCHO1_ENST00000596951.1_Silent_p.P438P|FCHO1_ENST00000539407.1_Silent_p.P438P|FCHO1_ENST00000600676.1_Silent_p.P438P|FCHO1_ENST00000594202.1_Silent_p.P438P|FCHO1_ENST00000252771.7_Silent_p.P438P|FCHO1_ENST00000597512.1_Silent_p.P445P	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	438	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						TCTTTGGGCCGCCCCTGGAGT	0.572																																					p.P438P													.	.			0			c.G1314A												76.0	70.0	72.0					19																	17889000		2203	4300	6503	SO:0001819	synonymous_variant	23149	exon18			TGGGCCGCCCCTG	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1314G>A	19.37:g.17889000G>A			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001161358	5	0.00	0	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Silent	SNP	ENST00000596536.1	37	CCDS32955.1																																																																																					0.572	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466946.2		NM_015122	
RASGRP4	115727	mdanderson.org	37	19	38905583	38905583	+	Missense_Mutation	SNP	G	G	T	rs527416058		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:38905583G>T	ENST00000587738.1	-	9	1205	c.1135C>A	c.(1135-1137)Ctg>Atg	p.L379M	RASGRP4_ENST00000586305.1_Missense_Mutation_p.L365M|RASGRP4_ENST00000433821.2_Intron|RASGRP4_ENST00000587753.1_Intron|RASGRP4_ENST00000454404.2_Missense_Mutation_p.L345M|RASGRP4_ENST00000293062.9_Missense_Mutation_p.L282M|RASGRP4_ENST00000426920.2_Intron			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	379	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGGTTGTTCAGCTTGGGTAGG	0.642																																					p.L379M													.	.			0			c.C1135A												22.0	28.0	26.0					19																	38905583		2047	4189	6236	SO:0001583	missense	115727	exon9			TGTTCAGCTTGGG	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1135C>A	19.37:g.38905583G>T	ENSP00000465772:p.Leu379Met		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	72	0.06	4	NM_170604	4	0.00	0	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	ENST00000587738.1	37	CCDS46068.1	.	.	.	.	.	.	.	.	.	.	G	9.821	1.185671	0.21870	.	.	ENSG00000171777	ENST00000293062;ENST00000405332;ENST00000454404	T;T	0.66638	1.47;-0.22	4.96	2.83	0.33086	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.143112	0.48767	D	0.000177	T	0.61451	0.2348	N	0.05534	-0.03	0.45502	D	0.998468	B;D;D;D	0.89917	0.044;0.995;0.994;1.0	B;D;D;D	0.91635	0.275;0.982;0.95;0.999	T	0.54735	-0.8249	10	0.16896	T	0.51	-21.7435	12.1152	0.53861	0.1595:0.0:0.8405:0.0	.	282;345;365;379	C0LTP7;C0LTP4;Q8TDF6-2;Q8TDF6	.;.;.;GRP4_HUMAN	M	282;379;379	ENSP00000293062:L282M;ENSP00000416463:L379M	ENSP00000293062:L282M	L	-	1	2	RASGRP4	43597423	1.000000	0.71417	0.961000	0.40146	0.835000	0.47333	2.674000	0.46867	0.296000	0.22592	-1.134000	0.01955	CTG			0.642	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460540.1		NM_170604	
SPTBN4	57731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41072264	41072264	+	Splice_Site	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:41072264C>T	ENST00000352632.3	+	30	6421	c.6335C>T	c.(6334-6336)aCg>aTg	p.T2112M	SPTBN4_ENST00000598249.1_Splice_Site_p.T2112M|SPTBN4_ENST00000338932.3_Splice_Site_p.T2112M|SPTBN4_ENST00000392025.1_Splice_Site_p.T855M			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2112					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGCCTGACCACGGTCAGCTCC	0.612																																					p.T2112M													.	.			0			c.C6335T												13.0	15.0	14.0					19																	41072264		2192	4279	6471	SO:0001630	splice_region_variant	57731	exon30			TGACCACGGTCAG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6336+1C>T	19.37:g.41072264C>T			Somatic	36	0	0		WXS	Illumina HiSeq	.	25	0.16	4	NM_020971	0		0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.646036	0.87958	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025	T;T;T	0.78707	0.7;-1.2;0.7	4.95	4.95	0.65309	.	0.000000	0.64402	D	0.000004	D	0.85566	0.5726	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.77557	0.749;0.99	D	0.86750	0.1960	10	0.72032	D	0.01	.	17.0938	0.86628	0.0:1.0:0.0:0.0	.	855;2112	C9JY79;Q9H254	.;SPTN4_HUMAN	M	2112;2112;2112;855	ENSP00000263373:T2112M;ENSP00000340345:T2112M;ENSP00000375879:T855M	ENSP00000340345:T2112M	T	+	2	0	SPTBN4	45764104	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.474000	0.81024	2.566000	0.86566	0.561000	0.74099	ACG			0.612	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462559.2			Missense_Mutation
RSPH6A	81492	mdanderson.org	37	19	46299149	46299149	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:46299149T>C	ENST00000221538.3	-	6	2274	c.2132A>G	c.(2131-2133)gAg>gGg	p.E711G	RSPH6A_ENST00000600188.1_Missense_Mutation_p.E447G|RSPH6A_ENST00000597055.1_3'UTR	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	711	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						ctcctcgccctcctcctcctc	0.557																																					p.E711G													.	.			0			c.A2132G												71.0	74.0	73.0					19																	46299149		2202	4300	6502	SO:0001583	missense	81492	exon6			TCGCCCTCCTCCT	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.2132A>G	19.37:g.46299149T>C	ENSP00000221538:p.Glu711Gly		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	29	0.07	2	NM_030785	1	0.00	0	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	37	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	t	13.10	2.135003	0.37728	.	.	ENSG00000104941	ENST00000221538	T	0.17528	2.27	4.16	4.16	0.48862	.	0.118988	0.56097	D	0.000036	T	0.37758	0.1015	M	0.67953	2.075	0.40521	D	0.980837	D	0.89917	1.0	D	0.83275	0.996	T	0.23655	-1.0182	10	0.62326	D	0.03	-8.1457	11.5188	0.50539	0.0:0.0:0.0:1.0	.	711	Q9H0K4	RSH6A_HUMAN	G	711	ENSP00000221538:E711G	ENSP00000221538:E711G	E	-	2	0	RSPH6A	50990989	1.000000	0.71417	0.719000	0.30619	0.052000	0.14988	5.577000	0.67444	1.891000	0.54761	0.451000	0.29950	GAG			0.557	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461657.1			
RCN3	57333	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50045926	50045926	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:50045926G>T	ENST00000270645.3	+	6	1243	c.796G>T	c.(796-798)Gtg>Ttg	p.V266L		NM_020650.2	NP_065701.2	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	266	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		TGGGAGTGAGGTGGGCCACTG	0.677																																					p.V266L													.	RCN3	28		0			c.G796T												34.0	33.0	33.0					19																	50045926		2202	4298	6500	SO:0001583	missense	57333	exon6			AGTGAGGTGGGCC	AY195859	CCDS12771.1	19q13.33	2013-01-10				ENSG00000142552		"""EF-hand domain containing"""	21145	protein-coding gene	gene with protein product							Standard	NM_020650		Approved	RLP49	uc002poj.3	Q96D15		ENST00000270645.3:c.796G>T	19.37:g.50045926G>T	ENSP00000270645:p.Val266Leu		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	72	0.11	8	NM_020650	55	0.13	7	Q9HBZ8	Missense_Mutation	SNP	ENST00000270645.3	37	CCDS12771.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.501863	0.26949	.	.	ENSG00000142552	ENST00000270645	T	0.39787	1.06	5.07	4.01	0.46588	EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	T	0.27559	0.0677	L	0.45285	1.41	0.44289	D	0.997151	B	0.15719	0.014	B	0.18263	0.021	T	0.09037	-1.0693	10	0.02654	T	1	-38.1356	7.7824	0.29072	0.246:0.0:0.754:0.0	.	266	Q96D15	RCN3_HUMAN	L	266	ENSP00000270645:V266L	ENSP00000270645:V266L	V	+	1	0	RCN3	54737738	1.000000	0.71417	0.937000	0.37676	0.045000	0.14185	2.524000	0.45589	2.373000	0.80994	0.585000	0.79938	GTG			0.677	RCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465261.1		NM_020650	
PTPRH	5794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55698956	55698956	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr19:55698956C>T	ENST00000376350.3	-	14	2513	c.2491G>A	c.(2491-2493)Ggc>Agc	p.G831S	PTPRH_ENST00000263434.5_Missense_Mutation_p.G653S	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	831	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.		G -> D (in dbSNP:rs36092369).		apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TGGCTGTGGCCCACCAGGGAG	0.582																																					p.G831S													.	.			0			c.G2491A												84.0	70.0	75.0					19																	55698956		2203	4300	6503	SO:0001583	missense	5794	exon14			TGTGGCCCACCAG		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2491G>A	19.37:g.55698956C>T	ENSP00000365528:p.Gly831Ser		Somatic	116	0	0		WXS	Illumina HiSeq	.	112	0.39	44	NM_002842	5	0.60	3	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978262	0.34942	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.10573	2.86;2.86	5.11	0.537	0.17144	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.972561	0.08370	N	0.956268	T	0.10508	0.0257	L	0.41356	1.27	0.46823	D	0.999212	B;B	0.27498	0.18;0.18	B;B	0.27380	0.044;0.079	T	0.09818	-1.0657	10	0.54805	T	0.06	.	8.9445	0.35751	0.0:0.6904:0.0:0.3096	.	653;831	C9JCH2;Q9HD43	.;PTPRH_HUMAN	S	831;653	ENSP00000365528:G831S;ENSP00000263434:G653S	ENSP00000263434:G653S	G	-	1	0	PTPRH	60390768	0.001000	0.12720	0.004000	0.12327	0.005000	0.04900	1.583000	0.36579	0.023000	0.15187	-0.793000	0.03317	GGC			0.582	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452649.1			
GPD2	2820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	157435487	157435487	+	Silent	SNP	T	T	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr2:157435487T>C	ENST00000310454.6	+	14	2226	c.1854T>C	c.(1852-1854)atT>atC	p.I618I	GPD2_ENST00000409674.1_Silent_p.I618I|GPD2_ENST00000409125.4_Silent_p.I391I|GPD2_ENST00000438166.2_Silent_p.I618I|GPD2_ENST00000540309.1_Intron	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	618					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						GCTCTGAAATTAGCCTACTGC	0.328																																					p.I618I													.	.			0			c.T1854C												121.0	122.0	122.0					2																	157435487		2203	4299	6502	SO:0001819	synonymous_variant	2820	exon14			TGAAATTAGCCTA		CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.1854T>C	2.37:g.157435487T>C			Somatic	77	0	0		WXS	Illumina HiSeq	.	52	0.12	6	NM_001083112	15	0.27	4	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Silent	SNP	ENST00000310454.6	37	CCDS2202.1																																																																																					0.328	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254910.3			
TTN	7273	broad.mit.edu	37	2	179449465	179449465	+	Missense_Mutation	SNP	G	G	T	rs201614524		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr2:179449465G>T	ENST00000591111.1	-	260	60204	c.59980C>A	c.(59980-59982)Cgt>Agt	p.R19994S	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R12762S|TTN_ENST00000589042.1_Missense_Mutation_p.R21635S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R12695S|TTN_ENST00000460472.2_Missense_Mutation_p.R12570S|TTN_ENST00000342992.6_Missense_Mutation_p.R19067S|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19994	Fibronectin type-III 44. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCAGCACGGACCCGGAAG	0.488																																					p.R21635S													TTN_ENST00000359218,NS,carcinoma,+1,9	TTN	18412	9	0			c.C64903A												179.0	178.0	178.0					2																	179449465		1918	4120	6038	SO:0001583	missense	7273	exon310			CAGCACGGACCCG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59980C>A	2.37:g.179449465G>T	ENSP00000465570:p.Arg19994Ser		Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	144	0.02	3	NM_001267550	0		0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	23.2	4.385386	0.82792	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	6.17	6.17	0.99709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.63988	0.2558	N	0.25031	0.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.65780	-0.6085	9	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	12570;12695;12762;19994	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	19067;12570;12762;12695;12568	ENSP00000343764:R19067S;ENSP00000434586:R12570S;ENSP00000340554:R12762S;ENSP00000352154:R12695S	ENSP00000340554:R12762S	R	-	1	0	TTN	179157711	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.941000	0.99782	0.655000	0.94253	CGT			0.488	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
ABCA12	26154	mdanderson.org	37	2	215910734	215910734	+	Silent	SNP	G	G	T	rs529282465		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr2:215910734G>T	ENST00000272895.7	-	7	918	c.699C>A	c.(697-699)tcC>tcA	p.S233S		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	233					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGGGGTCACTGGATAGCTTAA	0.358																																					p.S233S	Ovarian(66;664 1488 5121 34295)												.	.			0			c.C699A												71.0	76.0	74.0					2																	215910734		2203	4300	6503	SO:0001819	synonymous_variant	26154	exon7			GTCACTGGATAGC	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.699C>A	2.37:g.215910734G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_173076	1	0.00	0	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	CCDS33372.1																																																																																					0.358	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337111.1		NM_173076	
UBE2F	140739	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	238881845	238881846	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr2:238881845_238881846delGA	ENST00000272930.4	+	2	290_291	c.96_97delGA	c.(94-99)gtgagafs	p.R33fs	UBE2F_ENST00000414443.1_Frame_Shift_Del_p.R33fs|UBE2F_ENST00000409332.1_Frame_Shift_Del_p.R33fs|UBE2F-SCLY_ENST00000449191.1_Frame_Shift_Del_p.R33fs|UBE2F_ENST00000409633.1_Frame_Shift_Del_p.R33fs|UBE2F_ENST00000409953.1_Intron	NM_001278305.1|NM_080678.2	NP_001265234.1|NP_542409.1	Q969M7	UBE2F_HUMAN	ubiquitin-conjugating enzyme E2F (putative)	33					protein neddylation (GO:0045116)		ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)			endometrium(1)|large_intestine(1)	2		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;6.7e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|Kidney(56;3.53e-09)|KIRC - Kidney renal clear cell carcinoma(57;9.79e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000136)|Lung(119;0.0126)|LUSC - Lung squamous cell carcinoma(224;0.0301)		GGGTTTCTGTGAGAGACAAATT	0.45																																					p.32_32del													.	UBE2F	11		0			c.95_96del																																									SO:0001589	frameshift_variant	140739	exon2			TTCTGTGAGAGAC	BC010549	CCDS2523.1, CCDS63175.1, CCDS63176.1, CCDS63177.1	2q37.3	2008-02-05	2005-12-15		ENSG00000184182	ENSG00000184182		"""Ubiquitin-conjugating enzymes E2"""	12480	protein-coding gene	gene with protein product	"""NEDD8 conjugating enzyme"""					12477932	Standard	NM_080678		Approved	NCE2	uc031rrz.1	Q969M7	OTTHUMG00000133341	ENST00000272930.4:c.96_97delGA	2.37:g.238881849_238881850delGA	ENSP00000272930:p.Arg33fs		Somatic	51	0	0		WXS	Illumina HiSeq	.	35	0.40	14	NM_080678	72	0.00	0	A8K1Z8|B4DDT9|B4DFI1|B4DMK3|B4DZU2|B8ZZG2|C9J212|H9KVB9	Frame_Shift_Del	DEL	ENST00000272930.4	37	CCDS2523.1																																																																																					0.450	UBE2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257171.2		NM_080678	
SLC23A2	9962	broad.mit.edu;mdanderson.org	37	20	4843482	4843482	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr20:4843482G>T	ENST00000379333.1	-	14	1820	c.1428C>A	c.(1426-1428)agC>agA	p.S476R	SLC23A2_ENST00000338244.1_Missense_Mutation_p.S476R|SLC23A2_ENST00000424750.2_Missense_Mutation_p.S362R	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	476					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CAAAGAGGGCGCTGAACTTCC	0.572																																					p.S476R													.	SLC23A2	62		0			c.C1428A												65.0	63.0	63.0					20																	4843482		2203	4300	6503	SO:0001583	missense	9962	exon14			GAGGGCGCTGAAC	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1428C>A	20.37:g.4843482G>T	ENSP00000368637:p.Ser476Arg		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_203327	15	0.00	0	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	37	CCDS13085.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.34|13.34	2.208979|2.208979	0.39003|0.39003	.|.	.|.	ENSG00000089057|ENSG00000089057	ENST00000423430|ENST00000379333;ENST00000338244;ENST00000424750	.|T;T;T	.|0.19250	.|2.16;2.16;2.16	5.61|5.61	-2.9|-2.9	0.05648|0.05648	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38214|0.38214	0.1032|0.1032	M|M	0.67569|0.67569	2.06|2.06	0.47584|0.47584	D|D	0.999464|0.999464	.|D;D	.|0.69078	.|0.994;0.997	.|D;D	.|0.67382	.|0.951;0.94	T|T	0.27191|0.27191	-1.0081|-1.0081	5|10	.|0.87932	.|D	.|0	-30.0766|-30.0766	14.4312|14.4312	0.67251|0.67251	0.5015:0.0:0.4985:0.0|0.5015:0.0:0.4985:0.0	.|.	.|362;476	.|B4DJZ1;Q9UGH3	.|.;S23A2_HUMAN	S|R	233|476;476;362	.|ENSP00000368637:S476R;ENSP00000344322:S476R;ENSP00000406601:S362R	.|ENSP00000344322:S476R	R|S	-|-	1|3	0|2	SLC23A2|SLC23A2	4791482|4791482	0.003000|0.003000	0.15002|0.15002	0.953000|0.953000	0.39169|0.39169	0.154000|0.154000	0.21943|0.21943	-0.955000|-0.955000	0.03869|0.03869	-0.664000|-0.664000	0.05324|0.05324	-1.814000|-1.814000	0.00607|0.00607	CGC|AGC			0.572	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077832.1			
KIAA1755	85449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36841586	36841586	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr20:36841586A>C	ENST00000279024.4	-	14	3732	c.3461T>G	c.(3460-3462)cTt>cGt	p.L1154R		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1154										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GGTGGTGGCAAGCAAATGCTC	0.652																																					p.L1154R													.	.			0			c.T3461G												45.0	48.0	47.0					20																	36841586		2203	4300	6503	SO:0001583	missense	85449	exon14			GTGGCAAGCAAAT	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3461T>G	20.37:g.36841586A>C	ENSP00000279024:p.Leu1154Arg		Somatic	32	0	0		WXS	Illumina HiSeq	.	37	0.46	17	NM_001029864	31	0.48	15	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	A	10.23	1.292915	0.23564	.	.	ENSG00000149633	ENST00000279024	T	0.12361	2.69	4.88	0.0738	0.14392	.	0.832724	0.10020	N	0.726076	T	0.10508	0.0257	L	0.40543	1.245	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.33929	-0.9849	10	0.49607	T	0.09	.	4.5089	0.11901	0.3035:0.2126:0.4839:0.0	.	1154	Q5JYT7	K1755_HUMAN	R	1154	ENSP00000279024:L1154R	ENSP00000279024:L1154R	L	-	2	0	KIAA1755	36275000	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.245000	0.18142	-0.190000	0.10465	0.459000	0.35465	CTT			0.652	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079144.3		NM_001029864	
SEMG1	6406	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	43836447	43836447	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr20:43836447G>A	ENST00000372781.3	+	2	566	c.509G>A	c.(508-510)gGa>gAa	p.G170E	SEMG1_ENST00000244069.6_Missense_Mutation_p.G170E	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	170	Interaction with EPPIN.|Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TGGGTTCATGGACTAAGTAAA	0.438																																					p.G170E													.	.			0			c.G509A												89.0	80.0	83.0					20																	43836447		2203	4300	6503	SO:0001583	missense	6406	exon2			TTCATGGACTAAG		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.509G>A	20.37:g.43836447G>A	ENSP00000361867:p.Gly170Glu		Somatic	119	0	0		WXS	Illumina HiSeq	.	89	0.07	6	NM_003007	0		0	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	ENST00000372781.3	37	CCDS13345.1	.	.	.	.	.	.	.	.	.	.	G	9.621	1.133859	0.21123	.	.	ENSG00000124233	ENST00000244069;ENST00000372781	T;T	0.18960	2.18;2.18	0.556	0.556	0.17253	.	.	.	.	.	T	0.41190	0.1148	M	0.74647	2.275	0.09310	N	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.12319	-1.0552	8	0.44086	T	0.13	.	.	.	.	.	170;170;170	P04279-2;P04279;E7EPD3	.;SEMG1_HUMAN;.	E	170	ENSP00000244069:G170E;ENSP00000361867:G170E	ENSP00000244069:G170E	G	+	2	0	SEMG1	43269861	0.004000	0.15560	0.006000	0.13384	0.008000	0.06430	0.522000	0.22909	0.550000	0.28991	0.557000	0.71058	GGA			0.438	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079416.3		NM_003007	
MSANTD2P1	100130310	broad.mit.edu	37	21	24474481	24474482	+	lincRNA	INS	-	-	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr21:24474481_24474482insA	ENST00000421604.1	+	0	297																											gactccatctcaaaaaaaaaat	0.401																																					.													.	.			0			.																																											0	.			CCATCTCAAAAAA																													21.37:g.24474491_24474491dupA			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	INS	ENST00000421604.1	37																																																																																						0.401	AP001255.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000171055.1			
INPP5J	27124	mdanderson.org	37	22	31522467	31522467	+	Silent	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr22:31522467C>T	ENST00000331075.5	+	3	1426	c.1377C>T	c.(1375-1377)atC>atT	p.I459I	INPP5J_ENST00000401755.1_5'Flank|INPP5J_ENST00000412277.2_Silent_p.I392I|INPP5J_ENST00000402238.1_5'Flank|INPP5J_ENST00000405300.1_Silent_p.I92I|INPP5J_ENST00000404390.3_Silent_p.I91I|INPP5J_ENST00000404453.1_5'Flank|INPP5J_ENST00000400294.2_Silent_p.I92I	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	459	Catalytic. {ECO:0000255}.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						CAGACATGATCGCCATAGGGT	0.667																																					p.I91I													.	.			0			c.C273T												113.0	119.0	117.0					22																	31522467		2140	4229	6369	SO:0001819	synonymous_variant	27124	exon3			CATGATCGCCATA	U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.1377C>T	22.37:g.31522467C>T			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001002837	8	0.00	0	B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Silent	SNP	ENST00000331075.5	37																																																																																						0.667	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000321784.1		NM_001002837	
NCF4	4689	ucsc.edu	37	22	37261054	37261054	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr22:37261054G>T	ENST00000248899.6	+	3	395	c.211G>T	c.(211-213)Gag>Tag	p.E71*	CTA-833B7.2_ENST00000330602.2_RNA|NCF4_ENST00000397147.4_Nonsense_Mutation_p.E71*|CTA-833B7.2_ENST00000431290.1_RNA	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	71	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	CAAGCTGGAGGAGCGCTTCGG	0.597																																					p.E71X													.	NCF4	66		0			c.G211T												87.0	74.0	78.0					22																	37261054		2203	4300	6503	SO:0001587	stop_gained	4689	exon3			CTGGAGGAGCGCT	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.211G>T	22.37:g.37261054G>T	ENSP00000248899:p.Glu71*		Somatic	58	0	0		WXS	Illumina HiSeq		39	0.10	4	NM_000631	30	0.00	0	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Nonsense_Mutation	SNP	ENST00000248899.6	37	CCDS13934.1	.	.	.	.	.	.	.	.	.	.	G	38	6.814323	0.97857	.	.	ENSG00000100365	ENST00000248899;ENST00000397147	.	.	.	5.52	5.52	0.82312	.	0.397165	0.28772	N	0.014191	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-37.4449	18.2118	0.89872	0.0:0.0:1.0:0.0	.	.	.	.	X	71	.	ENSP00000248899:E71X	E	+	1	0	NCF4	35591000	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.038000	0.41184	2.586000	0.87340	0.561000	0.74099	GAG			0.597	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318863.1		NM_000631	
SUN2	25777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	39148563	39148563	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr22:39148563C>T	ENST00000405510.1	-	3	429	c.71G>A	c.(70-72)gGg>gAg	p.G24E	SUN2_ENST00000216064.4_Missense_Mutation_p.G24E|SUN2_ENST00000411587.2_Missense_Mutation_p.G59E|SUN2_ENST00000405018.1_Missense_Mutation_p.G24E|SUN2_ENST00000406622.1_Missense_Mutation_p.G24E	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	24	LMNA-binding. {ECO:0000250}.|Ser-rich.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						CACCGAGCTCCCTCCGCTGCT	0.617																																					p.G24E													.	.			0			c.G71A												53.0	46.0	48.0					22																	39148563		2203	4300	6503	SO:0001583	missense	25777	exon3			GAGCTCCCTCCGC	AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.71G>A	22.37:g.39148563C>T	ENSP00000385740:p.Gly24Glu		Somatic	40	0	0		WXS	Illumina HiSeq	.	37	0.43	16	NM_001199580	86	0.29	25	B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Missense_Mutation	SNP	ENST00000405510.1	37	CCDS13978.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765573	0.69878	.	.	ENSG00000100242	ENST00000405510;ENST00000216064;ENST00000405018;ENST00000406622;ENST00000411587;ENST00000438058;ENST00000456894;ENST00000420859;ENST00000452294;ENST00000433561;ENST00000417332;ENST00000439339	T;T;T;T;T;T;T;T;T;T;T;T	0.34275	2.8;2.8;2.68;2.8;2.54;1.42;1.47;1.43;1.45;1.46;1.37;1.46	4.72	3.67	0.42095	.	0.406828	0.23351	N	0.049127	T	0.35770	0.0943	N	0.24115	0.695	0.24093	N	0.995905	P;D;D;D;D	0.59767	0.845;0.986;0.974;0.974;0.974	B;B;B;P;B	0.53450	0.306;0.444;0.444;0.726;0.444	T	0.14615	-1.0466	10	0.59425	D	0.04	-28.0159	12.0698	0.53609	0.0:0.8177:0.1823:0.0	.	59;59;24;24;24	B4DIU6;B4E2A6;Q2T9F7;B0QY62;Q9UH99	.;.;.;.;SUN2_HUMAN	E	24;24;24;24;59;24;24;24;24;24;24;24	ENSP00000385740:G24E;ENSP00000216064:G24E;ENSP00000385616:G24E;ENSP00000383992:G24E;ENSP00000395601:G59E;ENSP00000406941:G24E;ENSP00000415588:G24E;ENSP00000408834:G24E;ENSP00000414950:G24E;ENSP00000411615:G24E;ENSP00000412928:G24E;ENSP00000393271:G24E	ENSP00000216064:G24E	G	-	2	0	SUN2	37478509	0.045000	0.20229	0.798000	0.32154	0.902000	0.53008	2.625000	0.46452	1.058000	0.40530	0.650000	0.86243	GGG			0.617	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321057.1		XM_039332	
TTLL12	23170	ucsc.edu	37	22	43579063	43579063	+	Silent	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr22:43579063C>T	ENST00000216129.6	-	2	333	c.270G>A	c.(268-270)caG>caA	p.Q90Q		NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	90					cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				CCGGGTTGGGCTGCTGCTTCC	0.642																																					p.Q90Q													.	TTLL12	50		0			c.G270A												139.0	132.0	134.0					22																	43579063		2203	4300	6503	SO:0001819	synonymous_variant	23170	exon2			GTTGGGCTGCTGC	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.270G>A	22.37:g.43579063C>T			Somatic	102	0	0		RNA-Seq	Illumina HiSeq		91	0.05	5	NM_015140	91	0.11	10	Q20WK5|Q9UGU3	Silent	SNP	ENST00000216129.6	37	CCDS14047.1																																																																																					0.642	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319611.1		NM_015140	
ZNF502	91392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	44762585	44762585	+	Silent	SNP	A	A	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr3:44762585A>G	ENST00000296091.4	+	4	532	c.276A>G	c.(274-276)gaA>gaG	p.E92E	ZNF502_ENST00000436624.2_Silent_p.E92E|ZNF502_ENST00000449836.1_Silent_p.E92E	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	92					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		TCCACAAAGAAGCACCCCCTG	0.423																																					p.E92E													.	.			0			c.A276G												61.0	63.0	62.0					3																	44762585		2203	4300	6503	SO:0001819	synonymous_variant	91392	exon4			CAAAGAAGCACCC	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.276A>G	3.37:g.44762585A>G			Somatic	116	0	0		WXS	Illumina HiSeq	.	106	0.10	11	NM_001134440	8	0.63	5		Silent	SNP	ENST00000296091.4	37	CCDS2719.1																																																																																					0.423	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256744.4		NM_033210	
LINC00971	440970	broad.mit.edu	37	3	84741222	84741222	+	lincRNA	DEL	A	A	-			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr3:84741222delA	ENST00000484892.1	-	0	2354					NR_033860.1				long intergenic non-protein coding RNA 971																		AACCTGATCCAAAAGGCAGCA	0.423																																					.													.	.			0			.																																											0	.			TGATCCAAAAGGC			3p12.1	2013-06-07			ENSG00000242641	ENSG00000242641		"""Long non-coding RNAs"""	48737	non-coding RNA	RNA, long non-coding							Standard	NR_033860		Approved				OTTHUMG00000158981		3.37:g.84741222delA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000484892.1	37																																																																																						0.423	LINC00971-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000352776.2			
NLGN1	22871	hgsc.bcm.edu	37	3	173525625	173525627	+	Intron	DEL	AAG	AAG	-			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr3:173525625_173525627delAAG	ENST00000457714.1	+	4	1075				NLGN1_ENST00000545397.1_Intron|NLGN1_ENST00000401917.3_Intron|NLGN1_ENST00000361589.4_Intron	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AGTACTCGGTAAGAAGAGTCTCT	0.365																																					.													.	NLGN1	209		0			.																																									SO:0001627	intron_variant	22871	.			CTCGGTAAGAAGA	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.646+3AAG>-	3.37:g.173525628_173525630delAAG			Somatic	81	0	0		WXS	Illumina HiSeq	.	123	0.15	19	.	0		0	Q9UPT2	Splice_Site	DEL	ENST00000457714.1	37	CCDS3222.1																																																																																					0.365	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000347054.3		NM_014932	
MUC4	4585	broad.mit.edu	37	3	195509143	195509143	+	Missense_Mutation	SNP	G	G	A	rs200380706	byFrequency	TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr3:195509143G>A	ENST00000463781.3	-	2	9767	c.9308C>T	c.(9307-9309)aCg>aTg	p.T3103M	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3103M|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGCGTGGTGTCACC	0.602													.|||	2	0.000399361	0.0	0.0	5008	,	,		11875	0.001		0.0	False		,,,				2504	0.001				p.T3103M													.	MUC4	1505		0			c.C9308T												13.0	9.0	10.0					3																	195509143		654	1532	2186	SO:0001583	missense	4585	exon2			AGAGGCGTGGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9308C>T	3.37:g.195509143G>A	ENSP00000417498:p.Thr3103Met		Somatic	95	0.0105263158	1		WXS	Illumina HiSeq	Phase_I	175	0.02	4	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	6.033	0.374389	0.11409	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.42;1.48	1.18	1.18	0.20946	.	.	.	.	.	T	0.12305	0.0299	N	0.19112	0.55	0.09310	N	1	P	0.37352	0.591	B	0.18263	0.021	T	0.14309	-1.0477	8	.	.	.	.	3.8139	0.08808	0.2653:0.0:0.7347:0.0	.	2975	E7ESK3	.	M	3103	ENSP00000417498:T3103M;ENSP00000420243:T3103M	.	T	-	2	0	MUC4	196993922	0.134000	0.22483	0.041000	0.18516	0.000000	0.00434	2.562000	0.45914	0.694000	0.31654	0.000000	0.15137	ACG			0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
HOPX	84525	mdanderson.org	37	4	57516927	57516927	+	Intron	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr4:57516927G>T	ENST00000337881.7	-	3	801				HOPX_ENST00000503639.3_Intron|HOPX_ENST00000381260.3_Missense_Mutation_p.Q66K|HOPX_ENST00000556376.2_Intron|HOPX_ENST00000420433.1_Intron|HOPX_ENST00000554144.1_Missense_Mutation_p.Q84K|HOPX_ENST00000555760.2_Intron|HOPX_ENST00000381255.3_Intron|HOPX_ENST00000556614.2_Intron|HOPX_ENST00000553379.2_Intron|HOPX_ENST00000317745.7_Intron|HOPX_ENST00000508121.1_Intron	NM_139212.3	NP_631958.1	Q9BPY8	HOP_HUMAN	HOP homeobox						heart development (GO:0007507)|histone deacetylation (GO:0016575)|lung alveolus development (GO:0048286)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of heart contraction (GO:0008016)|regulation of protein binding (GO:0043393)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(5)|skin(1)	8	Glioma(25;0.08)|all_neural(26;0.101)					CCTTCTCTTTGGGGGCTACTT	0.458																																					p.Q84K													.	.			0			c.C250A												64.0	62.0	63.0					4																	57516927		692	1591	2283	SO:0001627	intron_variant	84525	exon4			CTCTTTGGGGGCT		CCDS3507.1, CCDS47062.1, CCDS54767.1	4q12	2011-06-20			ENSG00000171476	ENSG00000171476		"""Homeoboxes / PRD class"""	24961	protein-coding gene	gene with protein product	"""homeobox only domain"""	607275				12297045	Standard	NM_032495		Approved	LAGY, HOP, OB1, NECC1, SMAP31	uc003hbz.2	Q9BPY8	OTTHUMG00000128768	ENST00000337881.7:c.145-1964C>A	4.37:g.57516927G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	51	0.08	4	NM_001145460	0		0	A8K0Z2|E9PB55|G3V294|Q8N0V6|Q96CI1	Missense_Mutation	SNP	ENST00000337881.7	37	CCDS3507.1	.	.	.	.	.	.	.	.	.	.	G	4.183	0.032505	0.08101	.	.	ENSG00000171476	ENST00000554144;ENST00000381260;ENST00000503864;ENST00000509435	.	.	.	2.99	2.99	0.34606	.	1.920750	0.02839	N	0.127758	T	0.20088	0.0483	N	0.16478	0.41	0.09310	N	1	P	0.46512	0.879	B	0.36092	0.217	T	0.21861	-1.0233	9	0.33940	T	0.23	-2.8182	9.6901	0.40123	0.0:0.0:1.0:0.0	.	84	G3V294	.	K	84;66;66;66	.	ENSP00000370659:Q84K	Q	-	1	0	HOPX	57211684	0.001000	0.12720	0.074000	0.20217	0.018000	0.09664	0.696000	0.25541	1.999000	0.58509	0.557000	0.71058	CAA			0.458	HOPX-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250689.4			
ADH1B	125	broad.mit.edu	37	4	100235056	100235056	+	Silent	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr4:100235056G>A	ENST00000305046.8	-	6	817	c.750C>T	c.(748-750)ccC>ccT	p.P250P	ADH1B_ENST00000394887.3_Silent_p.P210P			P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide	250					ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	CTTCCTGAATGGGTTTCTTGT	0.468																																					p.P250P													.	ADH1B	68		0			c.C750T												203.0	204.0	204.0					4																	100235056		2203	4290	6493	SO:0001819	synonymous_variant	125	exon6			CTGAATGGGTTTC	AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000305046.8:c.750C>T	4.37:g.100235056G>A			Somatic	253	0	0		WXS	Illumina HiSeq	Phase_I	199	0.09	17	NM_000668	8	0.25	2	A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	Silent	SNP	ENST00000305046.8	37	CCDS34033.1																																																																																					0.468	ADH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364853.1		NM_000668	
CTNND2	1501	mdanderson.org	37	5	11346670	11346670	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:11346670G>A	ENST00000304623.8	-	9	1631	c.1442C>T	c.(1441-1443)gCc>gTc	p.A481V	CTNND2_ENST00000503622.1_Missense_Mutation_p.A144V|CTNND2_ENST00000359640.2_Missense_Mutation_p.A481V|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Missense_Mutation_p.A48V|CTNND2_ENST00000511377.1_Missense_Mutation_p.A390V	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	481					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGCCGCGGCGGCATTCTGTGG	0.617																																					p.A481V													.	.			0			c.C1442T												42.0	46.0	45.0					5																	11346670		2203	4299	6502	SO:0001583	missense	1501	exon9			GCGGCGGCATTCT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1442C>T	5.37:g.11346670G>A	ENSP00000307134:p.Ala481Val		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001332	9	0.00	0	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316068	0.60524	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.77229	-0.95;-1.02;-0.95;-1.08;-1.06	5.8	5.8	0.92144	.	0.353249	0.25096	N	0.033170	T	0.69351	0.3101	L	0.29908	0.895	0.32782	N	0.502308	B;B;B	0.32620	0.378;0.171;0.012	B;B;B	0.26864	0.074;0.074;0.015	T	0.73652	-0.3915	10	0.44086	T	0.13	-7.7885	20.1139	0.97919	0.0:0.0:1.0:0.0	.	144;48;481	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	V	481;481;390;48;144	ENSP00000307134:A481V;ENSP00000352661:A481V;ENSP00000426510:A390V;ENSP00000391155:A48V;ENSP00000426887:A144V	ENSP00000307134:A481V	A	-	2	0	CTNND2	11399670	1.000000	0.71417	0.136000	0.22124	0.896000	0.52359	7.598000	0.82745	2.763000	0.94921	0.585000	0.79938	GCC			0.617	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206999.1		NM_001332	
DAB2	1601	broad.mit.edu	37	5	39390003	39390003	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:39390003A>G	ENST00000320816.6	-	6	961	c.494T>C	c.(493-495)cTt>cCt	p.L165P	DAB2_ENST00000512525.1_5'UTR|DAB2_ENST00000339788.6_Missense_Mutation_p.L165P|DAB2_ENST00000545653.1_Missense_Mutation_p.L165P|DAB2_ENST00000509337.1_Missense_Mutation_p.L165P	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	165	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			AACTTGAAAAAGGTCTTTAAG	0.323																																					p.L165P													.	DAB2	124		0			c.T494C												38.0	40.0	39.0					5																	39390003		2203	4299	6502	SO:0001583	missense	1601	exon6			TGAAAAAGGTCTT	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.494T>C	5.37:g.39390003A>G	ENSP00000313391:p.Leu165Pro		Somatic	522	0	0		WXS	Illumina HiSeq	Phase_I	414	0.02	7	NM_001343	27	0.00	0	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	37	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.571431	0.86542	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	5.94	5.94	0.96194	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.48768	0.1518	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.50701	-0.8797	10	0.87932	D	0	-19.2721	16.4075	0.83691	1.0:0.0:0.0:0.0	.	165;165	P98082;P98082-3	DAB2_HUMAN;.	P	165	ENSP00000313391:L165P;ENSP00000345508:L165P;ENSP00000439919:L165P;ENSP00000426245:L165P	ENSP00000313391:L165P	L	-	2	0	DAB2	39425760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.012000	0.88631	2.275000	0.75901	0.528000	0.53228	CTT			0.323	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367014.1		NM_001343	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	90016770	90016770	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:90016770C>G	ENST00000405460.2	+	45	9738	c.9642C>G	c.(9640-9642)atC>atG	p.I3214M		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3214					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCATAGACATCGAAGAAGCCA	0.378																																					p.I3214M													.	.			0			c.C9642G												167.0	167.0	167.0					5																	90016770		1896	4129	6025	SO:0001583	missense	84059	exon45			AGACATCGAAGAA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.9642C>G	5.37:g.90016770C>G	ENSP00000384582:p.Ile3214Met		Somatic	119	0	0		WXS	Illumina HiSeq	.	78	0.49	38	NM_032119	1	1.00	1	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.52|15.52	2.858143|2.858143	0.51376|0.51376	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.29397|.	1.57|.	5.76|5.76	-10.7|-10.7	0.00240|0.00240	.|.	0.423578|.	0.27275|.	N|.	0.020112|.	T|T	0.33818|0.33818	0.0876|0.0876	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D;P|.	0.56746|.	0.977;0.938|.	P;P|.	0.52189|.	0.692;0.612|.	T|T	0.44982|0.44982	-0.9292|-0.9292	10|5	0.37606|.	T|.	0.19|.	.|.	4.2039|4.2039	0.10480|0.10480	0.0805:0.1072:0.1625:0.6498|0.0805:0.1072:0.1625:0.6498	.|.	3214;3214|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	M|W	3214|780	ENSP00000384582:I3214M|.	ENSP00000296619:I3214M|.	I|S	+|+	3|2	3|0	GPR98|GPR98	90052526|90052526	0.000000|0.000000	0.05858|0.05858	0.004000|0.004000	0.12327|0.12327	0.027000|0.027000	0.11550|0.11550	-0.940000|-0.940000	0.03929|0.03929	-1.334000|-1.334000	0.02244|0.02244	-0.808000|-0.808000	0.03180|0.03180	ATC|TCG			0.378	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369993.2		NM_032119	
APC	324	hgsc.bcm.edu;broad.mit.edu	37	5	112179374	112179374	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:112179374A>G	ENST00000457016.1	+	16	8463	c.8083A>G	c.(8083-8085)Aaa>Gaa	p.K2695E	APC_ENST00000257430.4_Missense_Mutation_p.K2695E|APC_ENST00000508376.2_Missense_Mutation_p.K2695E|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	2695	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCCAAACATTAAAGATTCAAA	0.428		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.K2695E	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.			1	Unknown(1)	skin(1)	c.A8083G												87.0	90.0	89.0					5																	112179374		2202	4299	6501	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	AACATTAAAGATT	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.8083A>G	5.37:g.112179374A>G	ENSP00000413133:p.Lys2695Glu		Somatic	100	0	0		WXS	Illumina HiSeq	.	98	0.04	4	NM_001127510	42	0.10	4	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	8.700	0.909596	0.17833	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	T;T;T	0.76448	-1.02;-1.02;-1.02	5.99	5.99	0.97316	EB-1 binding (1);	0.285219	0.42548	D	0.000691	T	0.60483	0.2272	N	0.14661	0.345	0.36462	D	0.866738	B;B	0.18166	0.026;0.005	B;B	0.18561	0.022;0.016	T	0.61481	-0.7054	9	.	.	.	-28.0182	10.7713	0.46325	0.9298:0.0:0.0701:0.0	.	2697;2695	Q4LE70;P25054	.;APC_HUMAN	E	2695	ENSP00000413133:K2695E;ENSP00000257430:K2695E;ENSP00000427089:K2695E	.	K	+	1	0	APC	112207273	0.996000	0.38824	0.936000	0.37596	0.978000	0.69477	3.278000	0.51662	2.291000	0.77112	0.533000	0.62120	AAA			0.428	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250738.2		NM_000038	
ZNF300	91975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150276491	150276491	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:150276491T>A	ENST00000274599.5	-	6	730	c.310A>T	c.(310-312)Aca>Tca	p.T104S	ZNF300_ENST00000446148.2_Missense_Mutation_p.T120S|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Missense_Mutation_p.T104S|ZNF300_ENST00000418587.2_Missense_Mutation_p.T68S	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGGAAACTGTCCCCAAAATA	0.393																																					p.T120S													.	.			0			c.A358T												57.0	55.0	56.0					5																	150276491		2203	4299	6502	SO:0001583	missense	91975	exon7			AAACTGTCCCCAA	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.310A>T	5.37:g.150276491T>A	ENSP00000274599:p.Thr104Ser		Somatic	108	0	0		WXS	Illumina HiSeq	.	105	0.38	40	NM_001172831	14	0.43	6	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	ENST00000274599.5	37	CCDS4311.2	.	.	.	.	.	.	.	.	.	.	T	0.066	-1.211720	0.01555	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.07567	3.27;3.28;3.18;3.27	2.58	-1.5	0.08691	.	.	.	.	.	T	0.02727	0.0082	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46414	-0.9193	9	0.18710	T	0.47	.	3.3209	0.07049	0.4264:0.1316:0.0:0.4421	.	104	Q96RE9	ZN300_HUMAN	S	120;104;68;104	ENSP00000397178:T120S;ENSP00000274599:T104S;ENSP00000392593:T68S;ENSP00000377773:T104S	ENSP00000274599:T104S	T	-	1	0	ZNF300	150256684	0.000000	0.05858	0.029000	0.17559	0.031000	0.12232	-0.025000	0.12413	-0.306000	0.08818	-0.475000	0.04921	ACA			0.393	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_052860	
GABRP	2568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170235654	170235654	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:170235654T>C	ENST00000518525.1	+	9	1194	c.730T>C	c.(730-732)Tat>Cat	p.Y244H	GABRP_ENST00000519598.1_Missense_Mutation_p.Y244H|GABRP_ENST00000265294.4_Missense_Mutation_p.Y244H|GABRP_ENST00000519385.1_Missense_Mutation_p.Y244H			O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	244					signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(4)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	29	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAATGTTCTGTATTTCATTTT	0.423																																					p.Y244H													.	.			0			c.T730C												243.0	215.0	225.0					5																	170235654		2203	4300	6503	SO:0001583	missense	2568	exon8			GTTCTGTATTTCA	U95367	CCDS4375.1, CCDS75368.1	5q35.1	2012-06-22			ENSG00000094755	ENSG00000094755		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4089	protein-coding gene	gene with protein product	"""GABA(A) receptor, pi"""	602729				9182563	Standard	NM_014211		Approved		uc003mau.3	O00591	OTTHUMG00000130443	ENST00000518525.1:c.730T>C	5.37:g.170235654T>C	ENSP00000430100:p.Tyr244His		Somatic	136	0	0		WXS	Illumina HiSeq	.	123	0.36	44	NM_014211	0		0	A8KA36|D3DQL2|Q32MJ1	Missense_Mutation	SNP	ENST00000518525.1	37	CCDS4375.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.455204	0.84209	.	.	ENSG00000094755	ENST00000518525;ENST00000539175;ENST00000265294;ENST00000519385;ENST00000519598	D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15	4.94	4.94	0.65067	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.107470	0.64402	D	0.000004	D	0.92731	0.7689	M	0.75884	2.315	0.53005	D	0.999961	D;D	0.89917	0.999;1.0	P;D	0.76071	0.897;0.987	D	0.93652	0.6974	10	0.87932	D	0	.	14.5722	0.68218	0.0:0.0:0.0:1.0	.	244;244	E7EWG0;O00591	.;GBRP_HUMAN	H	244;142;244;244;244	ENSP00000430100:Y244H;ENSP00000265294:Y244H;ENSP00000430727:Y244H;ENSP00000430772:Y244H	ENSP00000265294:Y244H	Y	+	1	0	GABRP	170168232	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.987000	0.88182	1.970000	0.57323	0.533000	0.62120	TAT			0.423	GABRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252834.3		NM_014211	
CLTB	1212	mdanderson.org	37	5	175823488	175823488	+	Silent	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:175823488G>T	ENST00000310418.4	-	5	715	c.510C>A	c.(508-510)atC>atA	p.I170I	CLTB_ENST00000345807.2_Intron	NM_007097.3	NP_009028.1	P09497	CLCB_HUMAN	clathrin, light chain B	170					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	ciliary membrane (GO:0060170)|clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|trans-Golgi network (GO:0005802)	peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			lung(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		ACACGTAGCCGATGATATCAG	0.507																																					p.I170I													CLTB,NS,carcinoma,0,1	CLTB	0	1	0			c.C510A												181.0	144.0	156.0					5																	175823488		2203	4300	6503	SO:0001819	synonymous_variant	1212	exon5			GTAGCCGATGATA	M20470	CCDS4402.1, CCDS4403.1	5q35.2	2010-05-11	2010-05-11		ENSG00000175416	ENSG00000175416			2091	protein-coding gene	gene with protein product		118970	"""clathrin, light polypeptide (Lcb)"""			7713494	Standard	NM_007097		Approved	Lcb	uc003meh.4	P09497	OTTHUMG00000130662	ENST00000310418.4:c.510C>A	5.37:g.175823488G>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_007097	11	0.00	0	Q53Y37|Q6FHW1	Silent	SNP	ENST00000310418.4	37	CCDS4403.1																																																																																					0.507	CLTB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000253153.1			
MGAT4B	11282	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	179228562	179228562	+	Missense_Mutation	SNP	C	C	T	rs372861672		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr5:179228562C>T	ENST00000292591.7	-	3	766	c.416G>A	c.(415-417)cGc>cAc	p.R139H	MGAT4B_ENST00000521305.1_5'UTR|MGAT4B_ENST00000337755.5_Missense_Mutation_p.R154H	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	139					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCTCCGGTGCGGCCCTGGCC	0.721																																					p.R154H	GBM(13;414 434 4098 22176 23230)												.	MGAT4B	41		0			c.G461A												18.0	18.0	18.0					5																	179228562		2193	4287	6480	SO:0001583	missense	11282	exon2			CCGGTGCGGCCCT	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.416G>A	5.37:g.179228562C>T	ENSP00000292591:p.Arg139His		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	37	0.11	4	NM_054013	174	0.00	0	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	ENST00000292591.7	37	CCDS4448.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.360460|5.360460	0.95877|0.95877	.|.	.|.	ENSG00000161013|ENSG00000161013	ENST00000519836|ENST00000337755;ENST00000292591	.|T;T	.|0.51325	.|0.71;0.71	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73737|0.73737	0.3625|0.3625	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.998	.|D;P	.|0.66847	.|0.947;0.883	T|T	0.80219|0.80219	-0.1473|-0.1473	5|10	.|0.87932	.|D	.|0	-24.3015|-24.3015	18.5104|18.5104	0.90914|0.90914	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|139;154	.|Q9UQ53;A8MPR0	.|MGT4B_HUMAN;.	T|H	87|154;139	.|ENSP00000338487:R154H;ENSP00000292591:R139H	.|ENSP00000292591:R139H	A|R	-|-	1|2	0|0	MGAT4B|MGAT4B	179161168|179161168	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.879000|0.879000	0.50718|0.50718	7.368000|7.368000	0.79567|0.79567	2.373000|2.373000	0.80994|0.80994	0.471000|0.471000	0.43371|0.43371	GCA|CGC			0.721	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253503.3		NM_014275	
HFE	3077	broad.mit.edu	37	6	26091799	26091799	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr6:26091799G>C	ENST00000357618.5	+	3	720	c.598G>C	c.(598-600)Ggt>Cgt	p.G200R	HFE_ENST00000336625.8_Intron|HFE_ENST00000309234.6_Missense_Mutation_p.G200R|HFE_ENST00000349999.4_Missense_Mutation_p.G112R|HFE_ENST00000317896.7_Intron|HFE_ENST00000488199.1_Missense_Mutation_p.G112R|HFE_ENST00000397022.3_Missense_Mutation_p.G177R|HFE_ENST00000470149.1_Missense_Mutation_p.G200R|HFE_ENST00000352392.4_Intron|HFE_ENST00000461397.1_Missense_Mutation_p.G200R|HFE_ENST00000353147.5_Intron	NM_000410.3|NM_139006.2	NP_000401.1|NP_620575.1	Q30201	HFE_HUMAN	hemochromatosis	200	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular iron ion homeostasis (GO:0006879)|cellular response to iron ion starvation (GO:0010106)|female pregnancy (GO:0007565)|hormone biosynthetic process (GO:0042446)|immune response (GO:0006955)|iron ion import into cell (GO:0097459)|multicellular organismal iron ion homeostasis (GO:0060586)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein complex assembly (GO:0006461)	apical part of cell (GO:0045177)|basal part of cell (GO:0045178)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|MHC class I protein complex (GO:0042612)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	peptide antigen binding (GO:0042605)|receptor binding (GO:0005102)			endometrium(3)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCTGGGGAGAGGTGTTTTGGA	0.582									Hemochromatosis																												p.G200R													.	HFE	37		0			c.G598C												38.0	37.0	37.0					6																	26091799		2203	4300	6503	SO:0001583	missense	3077	exon3	Familial Cancer Database		GGGAGAGGTGTTT		CCDS4578.1, CCDS4579.1, CCDS4580.1, CCDS4581.1, CCDS4582.1, CCDS47386.1, CCDS47387.1, CCDS54974.1, CCDS54975.1, CCDS75412.1	6p21.3	2014-09-17			ENSG00000010704	ENSG00000010704		"""Immunoglobulin superfamily / C1-set domain containing"""	4886	protein-coding gene	gene with protein product	"""high Fe"""	613609				3460331	Standard	XR_241893		Approved	HLA-H	uc003nfx.1	Q30201	OTTHUMG00000016348	ENST00000357618.5:c.598G>C	6.37:g.26091799G>C	ENSP00000417404:p.Gly200Arg		Somatic	336	0.0029761905	1		WXS	Illumina HiSeq	Phase_I	298	0.02	6	NM_139006	7	0.00	0	B2CKL0|O75929|O75930|O75931|Q17RT0|Q96KU5|Q96KU6|Q96KU7|Q96KU8|Q9HC64|Q9HC68|Q9HC70|Q9HC83	Missense_Mutation	SNP	ENST00000357618.5	37	CCDS4578.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.361094	0.41801	.	.	ENSG00000010704	ENST00000349999;ENST00000397022;ENST00000539147;ENST00000357618;ENST00000470149;ENST00000461397;ENST00000488199;ENST00000309234	T;D;D;D;D;T;D	0.89415	3.27;-2.51;-2.51;-2.51;-2.51;3.27;-2.51	5.13	3.3	0.37823	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.495281	0.18652	N	0.134966	D	0.86339	0.5909	L	0.41415	1.275	0.09310	N	1	D;B;D;D;D;D	0.89917	1.0;0.044;0.999;0.999;0.996;1.0	D;B;D;D;P;D	0.77004	0.989;0.026;0.973;0.973;0.907;0.984	T	0.78851	-0.2041	10	0.87932	D	0	.	8.3828	0.32481	0.0865:0.1569:0.7567:0.0	.	200;112;200;112;177;200	Q6B0J5;Q30201-4;Q30201-3;Q30201-2;Q30201-5;Q30201	.;.;.;.;.;HFE_HUMAN	R	112;177;95;200;200;200;112;200	ENSP00000259699:G112R;ENSP00000380217:G177R;ENSP00000417404:G200R;ENSP00000419725:G200R;ENSP00000420802:G200R;ENSP00000420559:G112R;ENSP00000311698:G200R	ENSP00000311698:G200R	G	+	1	0	HFE	26199778	0.221000	0.23642	0.050000	0.19076	0.723000	0.41478	2.712000	0.47186	0.707000	0.31934	0.655000	0.94253	GGT			0.582	HFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000356133.1			
MUC21	394263	hgsc.bcm.edu	37	6	30954870	30954870	+	Silent	SNP	T	T	C	rs9262377		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr6:30954870T>C	ENST00000376296.3	+	2	1159	c.918T>C	c.(916-918)agT>agC	p.S306S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	306	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CTGAGTCCAGTACGACCTCCA	0.597																																					p.S306S													MUC21,rectum,carcinoma,0,1	MUC21	0	1	0			c.T918C												171.0	164.0	167.0					6																	30954870		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			GTCCAGTACGACC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.918T>C	6.37:g.30954870T>C			Somatic	40	0.025	1		WXS	Illumina HiSeq	.	47	0.04	2	NM_001010909	0		0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																					0.597	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
HLA-DRB6	3128	broad.mit.edu	37	6	32521955	32521956	+	RNA	INS	-	-	T	rs368756652|rs141382595|rs200834195		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr6:32521955_32521956insT	ENST00000411500.1	-	0	740					NR_001298.1				major histocompatibility complex, class II, DR beta 6 (pseudogene)																		CATCAAACTCATTCAAATATTA	0.361																																					.													.	.			0			.																																											0	.			AAACTCATTCAAA	L76566		6p21.3	2011-07-08			ENSG00000229391	ENSG00000229391		"""Histocompatibility complex"""	4954	pseudogene	pseudogene						1529427, 10436177	Standard	NR_001298		Approved		uc003obn.1		OTTHUMG00000031028		6.37:g.32521957_32521957dupT			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	16	0.56	9	.	0		0		RNA	INS	ENST00000411500.1	37																																																																																						0.361	HLA-DRB6-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000272900.1		NR_001298	
MB21D1	115004	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	74135079	74135079	+	Silent	SNP	A	A	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr6:74135079A>C	ENST00000370315.3	-	5	1534	c.1440T>G	c.(1438-1440)ctT>ctG	p.L480L	MB21D1_ENST00000370318.1_Intron	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	480					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						AATAATTCTCAAGTTTTTCTG	0.388																																					p.L480L													.	MB21D1	33		0			c.T1440G												58.0	58.0	58.0					6																	74135079		2203	4300	6503	SO:0001819	synonymous_variant	115004	exon5			ATTCTCAAGTTTT	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.1440T>G	6.37:g.74135079A>C			Somatic	99	0.0101010101	1		WXS	Illumina HiSeq	Phase_I	81	0.07	6	NM_138441	1	0.00	0	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Silent	SNP	ENST00000370315.3	37	CCDS4978.1																																																																																					0.388	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041221.5		NM_138441	
LAMA2	3908	mdanderson.org	37	6	129637314	129637314	+	Silent	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr6:129637314C>T	ENST00000421865.2	+	27	4105	c.4056C>T	c.(4054-4056)agC>agT	p.S1352S		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1352	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGCGACAAAGCAGGTAAACTC	0.333																																					p.S1352S													.	.			0			c.C4056T												48.0	54.0	52.0					6																	129637314		2202	4299	6501	SO:0001819	synonymous_variant	3908	exon27			ACAAAGCAGGTAA	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4056C>T	6.37:g.129637314C>T			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_001079823	9	0.00	0	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	CCDS5138.1																																																																																					0.333	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042180.1			
GPR146	115330	mdanderson.org	37	7	1097842	1097842	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr7:1097842G>A	ENST00000397095.1	+	2	914	c.691G>A	c.(691-693)Gca>Aca	p.A231T	C7orf50_ENST00000488073.1_Intron|C7orf50_ENST00000397098.3_Intron|GPR146_ENST00000297468.3_Missense_Mutation_p.A231T|C7orf50_ENST00000397100.2_Intron|RP11-449P15.1_ENST00000549241.1_RNA|C7orf50_ENST00000357429.6_Intron			Q96CH1	GP146_HUMAN	G protein-coupled receptor 146	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|ovary(1)|skin(1)	8		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GGAGCCCTCGGCACACAGGCT	0.682																																					p.A231T													.	.			0			c.G691A												22.0	18.0	20.0					7																	1097842		2196	4286	6482	SO:0001583	missense	115330	exon1			CCCTCGGCACACA	BC014241	CCDS5321.1	7p22.3	2012-08-21			ENSG00000164849	ENSG00000164849		"""GPCR / Class A : Orphans"""	21718	protein-coding gene	gene with protein product							Standard	NM_138445		Approved	PGR8	uc003sjy.1	Q96CH1	OTTHUMG00000023934	ENST00000397095.1:c.691G>A	7.37:g.1097842G>A	ENSP00000380283:p.Ala231Thr		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_138445	8	0.00	0	Q86SP5	Missense_Mutation	SNP	ENST00000397095.1	37	CCDS5321.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.785825	0.49997	.	.	ENSG00000164849	ENST00000444847;ENST00000397095;ENST00000500070;ENST00000297468	T;T;T	0.38077	1.16;1.16;1.16	4.94	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.318703	0.32868	N	0.005557	T	0.24547	0.0595	N	0.19112	0.55	0.22156	N	0.999324	B	0.18310	0.027	B	0.14578	0.011	T	0.22836	-1.0205	10	0.72032	D	0.01	-9.5182	11.5092	0.50484	0.092:0.0:0.908:0.0	.	231	Q96CH1	GP146_HUMAN	T	231;231;149;231	ENSP00000410743:A231T;ENSP00000380283:A231T;ENSP00000297468:A231T	ENSP00000297468:A231T	A	+	1	0	GPR146	1064368	1.000000	0.71417	0.897000	0.35233	0.861000	0.49209	4.701000	0.61810	1.044000	0.40200	0.561000	0.74099	GCA			0.682	GPR146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206855.1		NM_138445	
PHKG1	5260	mdanderson.org	37	7	56155460	56155460	+	Silent	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr7:56155460G>A	ENST00000297373.2	-	3	287	c.93C>T	c.(91-93)agC>agT	p.S31S	PHKG1_ENST00000452681.2_Silent_p.S31S|PHKG1_ENST00000489604.1_5'UTR|PHKG1_ENST00000537360.1_5'UTR	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	31	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGACCACACTGCTAACGCCCC	0.652																																					p.S31S	Melanoma(184;580 2064 5329 24177 35303)												.	.			0			c.C93T												49.0	42.0	45.0					7																	56155460		2203	4300	6503	SO:0001819	synonymous_variant	5260	exon3			CACACTGCTAACG	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.93C>T	7.37:g.56155460G>A			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_006213	2	0.00	0	B7Z1D0|F5H2S1|Q75LP5	Silent	SNP	ENST00000297373.2	37	CCDS5525.1																																																																																					0.652	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251587.1		NM_006213	
TRRAP	8295	mdanderson.org	37	7	98553773	98553773	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr7:98553773A>G	ENST00000359863.4	+	41	6130	c.5921A>G	c.(5920-5922)tAc>tGc	p.Y1974C	TRRAP_ENST00000446306.3_Missense_Mutation_p.Y1955C|TRRAP_ENST00000355540.3_Missense_Mutation_p.Y1956C	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1974					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CCGCAGGTGTACTACCCGGTA	0.652																																					p.Y1974C													.	.			0			c.A5921G												48.0	41.0	43.0					7																	98553773		2203	4300	6503	SO:0001583	missense	8295	exon41			AGGTGTACTACCC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.5921A>G	7.37:g.98553773A>G	ENSP00000352925:p.Tyr1974Cys		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001244580	12	0.00	0	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.8|23.8	4.464407|4.464407	0.84425|0.84425	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.59502	.|0.26;0.26	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77718|0.77718	0.4172|0.4172	M|M	0.82923|0.82923	2.615|2.615	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.81914	.|0.995;0.985;0.991	T|T	0.81773|0.81773	-0.0779|-0.0779	5|10	.|0.87932	.|D	.|0	.|.	15.4609|15.4609	0.75356|0.75356	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1956;1695;1974	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	A|C	1696|1974;1956;1954	.|ENSP00000352925:Y1974C;ENSP00000347733:Y1956C	.|ENSP00000347733:Y1956C	T|Y	+|+	1|2	0|0	TRRAP|TRRAP	98391709|98391709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	9.287000|9.287000	0.95975|0.95975	2.119000|2.119000	0.64992|0.64992	0.459000|0.459000	0.35465|0.35465	ACT|TAC			0.652	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317978.1		NM_003496	
TEX15	56154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	30700548	30700548	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr8:30700548C>T	ENST00000256246.2	-	1	6060	c.5986G>A	c.(5986-5988)Gct>Act	p.A1996T		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1996					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GCAAATTCAGCCTGATCCAAT	0.303																																					p.A1996T													.	.			0			c.G5986A												37.0	39.0	38.0					8																	30700548		2201	4293	6494	SO:0001583	missense	56154	exon1			ATTCAGCCTGATC	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.5986G>A	8.37:g.30700548C>T	ENSP00000256246:p.Ala1996Thr		Somatic	126	0	0		WXS	Illumina HiSeq	.	148	0.24	36	NM_031271	2	0.00	0		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872959	0.72180	.	.	ENSG00000133863	ENST00000256246	T	0.15603	2.41	5.73	5.73	0.89815	.	0.109017	0.40908	D	0.000984	T	0.41143	0.1146	L	0.56769	1.78	0.39552	D	0.968999	D	0.89917	1.0	D	0.77557	0.99	T	0.17440	-1.0369	10	0.87932	D	0	.	18.6784	0.91537	0.0:1.0:0.0:0.0	.	1996	Q9BXT5	TEX15_HUMAN	T	1996	ENSP00000256246:A1996T	ENSP00000256246:A1996T	A	-	1	0	TEX15	30820090	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	3.425000	0.52771	2.718000	0.92993	0.585000	0.79938	GCT			0.303	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376193.1			
ZFP41	286128	mdanderson.org	37	8	144332576	144332576	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr8:144332576G>A	ENST00000330701.4	+	2	932	c.563G>A	c.(562-564)cGc>cAc	p.R188H	ZFP41_ENST00000522452.1_Missense_Mutation_p.R188H|ZFP41_ENST00000520584.1_Missense_Mutation_p.R188H	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	188					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			TGTCTCATCCGCCATCAGAAA	0.637																																					p.R188H													.	.			0			c.G563A												62.0	72.0	68.0					8																	144332576		2202	4300	6502	SO:0001583	missense	286128	exon2			TCATCCGCCATCA		CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.563G>A	8.37:g.144332576G>A	ENSP00000327427:p.Arg188His		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_173832	30	0.00	0	D3DWJ5	Missense_Mutation	SNP	ENST00000330701.4	37	CCDS6397.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.605035	0.28623	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.25414	1.8;1.8;1.8	3.38	-1.89	0.07689	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23094	0.0558	M	0.74881	2.28	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.31943	-0.9925	9	0.27082	T	0.32	-14.9516	4.7226	0.12926	0.544:0.1773:0.2787:0.0	.	188	Q8N8Y5	ZFP41_HUMAN	H	188	ENSP00000430465:R188H;ENSP00000327427:R188H;ENSP00000428966:R188H	ENSP00000327427:R188H	R	+	2	0	ZFP41	144403951	0.000000	0.05858	0.000000	0.03702	0.716000	0.41182	-1.577000	0.02127	-0.318000	0.08665	0.467000	0.42956	CGC			0.637	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381114.2		NM_173832	
TTC39B	158219	mdanderson.org	37	9	15192619	15192619	+	Missense_Mutation	SNP	C	C	A	rs560744000	byFrequency	TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:15192619C>A	ENST00000512701.2	-	9	935	c.899G>T	c.(898-900)gGt>gTt	p.G300V	TTC39B_ENST00000507285.1_Missense_Mutation_p.G135V|TTC39B_ENST00000297615.5_Missense_Mutation_p.G231V|TTC39B_ENST00000380850.4_Missense_Mutation_p.G300V|TTC39B_ENST00000355694.2_Missense_Mutation_p.G234V|TTC39B_ENST00000507993.1_Missense_Mutation_p.G135V|TTC39B_ENST00000541445.1_3'UTR			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	300								p.G234V(1)|p.G300V(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						AAGCTTGACACCCCCTTCAAA	0.408																																					p.G300V													TTC39B_ENST00000512701,NS,carcinoma,0,2	TTC39B_ENST00000512701	0	2	2	Substitution - Missense(2)	lung(2)	c.G899T												95.0	95.0	95.0					9																	15192619		2203	4300	6503	SO:0001583	missense	158219	exon9			TTGACACCCCCTT	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.899G>T	9.37:g.15192619C>A	ENSP00000422496:p.Gly300Val		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	109	0.05	5	NM_152574	6	0.17	1	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	ENST00000512701.2	37	CCDS6477.2	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772585	0.90108	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.83436	0.5254	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;0.999	D	0.85537	0.1213	10	0.66056	D	0.02	-14.6308	19.8379	0.96666	0.0:1.0:0.0:0.0	.	231;300;300;232;234	F5H705;E9PAQ9;E9PE60;A5PLN1;Q5VTQ0	.;.;.;.;TT39B_HUMAN	V	300;231;234;300;135;135	ENSP00000370231:G300V;ENSP00000297615:G231V;ENSP00000347920:G234V;ENSP00000422496:G300V;ENSP00000426539:G135V;ENSP00000423392:G135V	ENSP00000297615:G231V	G	-	2	0	TTC39B	15182619	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.288000	0.78691	2.765000	0.95021	0.655000	0.94253	GGT			0.408	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051758.3		NM_152574	
MLLT3	4300	broad.mit.edu	37	9	20414311	20414313	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:20414311_20414313delCTG	ENST00000380338.4	-	5	817_819	c.531_533delCAG	c.(529-534)agcagt>agt	p.177_178SS>S	MLLT3_ENST00000429426.2_In_Frame_Del_p.174_175SS>S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	177	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		gctgctgctactgctgctgctgc	0.532			T	MLL	ALL																																p.177_178del				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,caecum,carcinoma,+1,1	MLLT3	125	1	0			c.531_533del																																									SO:0001651	inframe_deletion	4300	exon5			CTGCTACTGCTGC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.531_533delCAG	9.37:g.20414320_20414322delCTG	ENSP00000369695:p.Ser190del		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	96	0.07	7	NM_004529	20	0.00	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	In_Frame_Del	DEL	ENST00000380338.4	37	CCDS6494.1																																																																																					0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051872.1		NM_004529	
NFX1	4799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33307242	33307242	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:33307242G>C	ENST00000379540.3	+	5	1383	c.1321G>C	c.(1321-1323)Ggt>Cgt	p.G441R	NFX1_ENST00000318524.6_Missense_Mutation_p.G441R|NFX1_ENST00000379521.4_Missense_Mutation_p.G441R	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	441					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		ACATAGCTGTGGTGAGGTTTG	0.448																																					p.G441R													.	.			0			c.G1321C												165.0	161.0	162.0					9																	33307242		2203	4300	6503	SO:0001583	missense	4799	exon5			AGCTGTGGTGAGG	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1321G>C	9.37:g.33307242G>C	ENSP00000368856:p.Gly441Arg		Somatic	93	0	0		WXS	Illumina HiSeq	.	76	0.08	6	NM_147134	33	0.15	5	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.896086	0.91962	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.55588	0.51;0.51;0.51	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.81148	0.4762	H	0.95780	3.72	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.997;1.0;0.999	D	0.86675	0.1913	10	0.87932	D	0	-7.1113	16.8219	0.85748	0.0:0.0:1.0:0.0	.	441;325;441;441;441	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	R	441	ENSP00000368856:G441R;ENSP00000368836:G441R;ENSP00000317695:G441R	ENSP00000317695:G441R	G	+	1	0	NFX1	33297242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.507000	0.97996	2.588000	0.87417	0.585000	0.79938	GGT			0.448	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052069.1			
FANCG	2189	mdanderson.org	37	9	35074208	35074208	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:35074208A>G	ENST00000378643.3	-	14	2257	c.1766T>C	c.(1765-1767)cTc>cCc	p.L589P	VCP_ENST00000358901.6_5'Flank|FANCG_ENST00000476212.1_5'UTR	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	589					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GTACAGGGGGAGAGACCTGGA	0.512			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																													p.L589P			yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	.	.			0			c.T1766C												57.0	56.0	56.0					9																	35074208		2203	4300	6503	SO:0001583	missense	2189	exon14			AGGGGGAGAGACC	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.1766T>C	9.37:g.35074208A>G	ENSP00000367910:p.Leu589Pro		Somatic	61	0.0163934426	1		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_004629	256	0.00	0		Missense_Mutation	SNP	ENST00000378643.3	37	CCDS6574.1	.	.	.	.	.	.	.	.	.	.	A	17.01	3.278178	0.59758	.	.	ENSG00000221829	ENST00000378643	T	0.68181	-0.31	5.08	2.7	0.31948	.	.	.	.	.	T	0.59032	0.2164	M	0.61703	1.905	0.80722	D	1	B	0.25904	0.137	B	0.21151	0.033	T	0.55547	-0.8124	9	0.87932	D	0	-0.0605	6.5964	0.22677	0.8039:0.0:0.1961:0.0	.	589	O15287	FANCG_HUMAN	P	589	ENSP00000367910:L589P	ENSP00000367910:L589P	L	-	2	0	FANCG	35064208	1.000000	0.71417	0.993000	0.49108	0.832000	0.47134	2.789000	0.47813	0.272000	0.22027	0.374000	0.22700	CTC			0.512	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052269.1		NM_004629	
LOC403323	403323	bcgsc.ca	37	9	66513491	66513491	+	IGR	SNP	A	A	T	rs199925660		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:66513491A>T								RP11-262H14.1 (44181 upstream) : RP11-262H14.7 (3714 downstream)																							CTCAGAATACAGCAAAGCACA	0.473																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	392335	.			GAATACAGCAAAG																													9.37:g.66513491A>T			Somatic	54	0.2407407407	13		WXS	Illumina HiSeq	Phase_1	57	0.37	21	.	0		0		RNA	SNP		37																																																																																					0	0.473										
ANKRD20A1	84210	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	67968313	67968313	+	Silent	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:67968313G>A	ENST00000377477.2	+	15	1984	c.1872G>A	c.(1870-1872)gtG>gtA	p.V624V	RP11-195B21.3_ENST00000417488.1_5'Flank	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	624						plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						GTGAAAGTGTGAAAACAGAAA	0.368																																					p.V624V													.	ANKRD20A1	16		0			c.G1872A												1.0	1.0	1.0					9																	67968313		215	455	670	SO:0001819	synonymous_variant	84210	exon15			AAGTGTGAAAACA	AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.1872G>A	9.37:g.67968313G>A			Somatic	329	0	0		WXS	Illumina HiSeq	Phase_I	269	0.22	60	NM_032250	0		0	Q9H0H6	Silent	SNP	ENST00000377477.2	37	CCDS6620.1																																																																																					0.368	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083800.1			
LOC440173	440173	bcgsc.ca	37	9	89626712	89626712	+	lincRNA	SNP	G	G	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:89626712G>A	ENST00000602579.1	-	0	256					NR_027471.1																						GCCGCCAACCGATCCCACAGC	0.642																																					.													.	.			0			.																																											157956	.			CCAACCGATCCCA																													9.37:g.89626712G>A			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_1	20	0.20	4	.	5	0.00	0		RNA	SNP	ENST00000602579.1	37																																																																																						0.642	RP11-276H19.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000052931.2			
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113169776	113169776	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:113169776C>T	ENST00000401783.2	-	38	8440	c.8104G>A	c.(8104-8106)Gat>Aat	p.D2702N	SVEP1_ENST00000374469.1_Missense_Mutation_p.D2679N|SVEP1_ENST00000297826.5_Missense_Mutation_p.D628N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2702	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CAAGTTCCATCTTCCTGGCAG	0.438																																					p.D2702N													.	.			0			c.G8104A												160.0	157.0	158.0					9																	113169776		1940	4169	6109	SO:0001583	missense	79987	exon38			TTCCATCTTCCTG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8104G>A	9.37:g.113169776C>T	ENSP00000384917:p.Asp2702Asn		Somatic	76	0	0		WXS	Illumina HiSeq	.	54	0.33	18	NM_153366	7	0.29	2	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.623269	0.66901	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826;ENST00000374463	T;T;T	0.63913	-0.07;-0.07;-0.07	5.87	5.87	0.94306	Complement control module (2);Sushi/SCR/CCP (3);	0.044969	0.85682	D	0.000000	T	0.70937	0.3281	L	0.41961	1.31	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61579	-0.7034	10	0.02654	T	1	.	20.2119	0.98289	0.0:1.0:0.0:0.0	.	2702	Q4LDE5	SVEP1_HUMAN	N	2702;2679;628;374	ENSP00000384917:D2702N;ENSP00000363593:D2679N;ENSP00000297826:D628N	ENSP00000297826:D628N	D	-	1	0	SVEP1	112209597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.891000	0.69782	2.784000	0.95788	0.585000	0.79938	GAT			0.438	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
ENG	2022	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130578304	130578304	+	Silent	SNP	G	G	A	rs370943570		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:130578304G>A	ENST00000373203.4	-	14	2170	c.1770C>T	c.(1768-1770)ccC>ccT	p.P590P	RP11-228B15.4_ENST00000425991.1_RNA|ENG_ENST00000344849.3_Silent_p.P590P|RP11-228B15.4_ENST00000439298.1_RNA|ENG_ENST00000480266.1_5'Flank	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	590					artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						CCAGCACGGCGGGCAGGACGA	0.647									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																												p.P590P													.	.			0			c.C1770T							G	,	0,4406		0,0,2203	85.0	64.0	71.0		1770,1770	2.4	1.0	9		71	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ENG	NM_000118.2,NM_001114753.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	590/626,590/659	130578304	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2022	exon14	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	CACGGCGGGCAGG	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.1770C>T	9.37:g.130578304G>A			Somatic	95	0	0		WXS	Illumina HiSeq	.	70	0.39	27	NM_001114753	153	0.20	30	Q14248|Q14926|Q5T9C0	Silent	SNP	ENST00000373203.4	37	CCDS48029.1																																																																																					0.647	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054313.1			
USP20	10868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	132631164	132631164	+	Missense_Mutation	SNP	C	C	T	rs540729891		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chr9:132631164C>T	ENST00000315480.4	+	12	1317	c.1159C>T	c.(1159-1161)Cgc>Tgc	p.R387C	USP20_ENST00000358355.1_Missense_Mutation_p.R387C|USP20_ENST00000372429.3_Missense_Mutation_p.R387C			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	387	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				TGCTCACCTACGCAGCTCCTC	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		15409	0.001		0.0	False		,,,				2504	0.0				p.R387C													.	.			0			c.C1159T												45.0	55.0	52.0					9																	132631164		2166	4260	6426	SO:0001583	missense	10868	exon12			CACCTACGCAGCT	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.1159C>T	9.37:g.132631164C>T	ENSP00000313811:p.Arg387Cys		Somatic	45	0	0		WXS	Illumina HiSeq	.	47	0.32	15	NM_001008563	23	0.22	5	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867262	0.51588	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.18657	2.2;2.2;2.2	4.94	2.08	0.27032	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.772930	0.02471	N	0.087502	T	0.16300	0.0392	N	0.14661	0.345	0.47511	D	0.999443	B	0.16396	0.017	B	0.10450	0.005	T	0.04103	-1.0977	10	0.48119	T	0.1	.	9.9462	0.41611	0.0:0.7739:0.0:0.2261	.	387	Q9Y2K6	UBP20_HUMAN	C	387	ENSP00000361506:R387C;ENSP00000313811:R387C;ENSP00000351122:R387C	ENSP00000313811:R387C	R	+	1	0	USP20	131670985	1.000000	0.71417	0.229000	0.23960	0.601000	0.36947	1.706000	0.37878	0.140000	0.18849	-0.224000	0.12420	CGC			0.672	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054604.2			
NUDT10	170685	mdanderson.org	37	X	51075901	51075901	+	Silent	SNP	G	G	A	rs2801627		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chrX:51075901G>A	ENST00000376006.3	+	2	304	c.84G>A	c.(82-84)gaG>gaA	p.E28E	NUDT10_ENST00000356450.2_Silent_p.E28E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	0					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E28E(2)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TCCGGAGCGAGCGCGAGGACG	0.687																																					p.E28E	NSCLC(90;1817 2035 37909 38249)												.	.			2	Substitution - coding silent(2)	upper_aerodigestive_tract(1)|prostate(1)	c.G84A												41.0	35.0	37.0					X																	51075901		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			GAGCGAGCGCGAG	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.84G>A	X.37:g.51075901G>A			Somatic	194	0.0154639175	3		WXS	Illumina HiSeq	Phase_I	264	0.08	20	NM_153183	26	0.00	0	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																					0.687	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056578.1		NM_153183	
SATL1	340562	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	84349179	84349179	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chrX:84349179T>G	ENST00000395409.3	-	4	1830	c.1270A>C	c.(1270-1272)Aag>Cag	p.K424Q	SATL1_ENST00000509231.1_Missense_Mutation_p.K611Q|SATL1_ENST00000332921.5_Missense_Mutation_p.K424Q			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	424	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TAAAGTACCTTGCCAGTCCAT	0.348																																					p.K611Q													.	.			0			c.A1831C												124.0	102.0	109.0					X																	84349179		2203	4300	6503	SO:0001583	missense	340562	exon4			GTACCTTGCCAGT	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.1270A>C	X.37:g.84349179T>G	ENSP00000378804:p.Lys424Gln		Somatic	219	0	0		WXS	Illumina HiSeq	.	324	0.06	21	NM_001012980	0		0	A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	ENST00000395409.3	37		.	.	.	.	.	.	.	.	.	.	T	17.19	3.326326	0.60743	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.45276	1.91;0.9;0.9	5.03	5.03	0.67393	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.33364	N	0.004999	T	0.58595	0.2133	M	0.62723	1.935	0.32722	N	0.510202	D;P	0.89917	1.0;0.456	D;P	0.73708	0.981;0.598	T	0.70317	-0.4905	10	0.72032	D	0.01	-26.6159	10.3639	0.44012	0.0:0.0:0.0:1.0	.	424;611	Q86VE3;E9PB72	SATL1_HUMAN;.	Q	424;424;611	ENSP00000378804:K424Q;ENSP00000329115:K424Q;ENSP00000425421:K611Q	ENSP00000329115:K424Q	K	-	1	0	SATL1	84235835	1.000000	0.71417	0.998000	0.56505	0.489000	0.33432	3.067000	0.50010	1.786000	0.52430	0.486000	0.48141	AAG			0.348	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_291339	
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	123184103	123184103	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chrX:123184103G>T	ENST00000371160.1	+	11	1251	c.961G>T	c.(961-963)Gat>Tat	p.D321Y	STAG2_ENST00000371157.3_Missense_Mutation_p.D321Y|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000371145.3_Missense_Mutation_p.D321Y|STAG2_ENST00000218089.9_Missense_Mutation_p.D321Y|STAG2_ENST00000371144.3_Missense_Mutation_p.D321Y|STAG2_ENST00000354548.5_Missense_Mutation_p.D252Y	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	321	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GATGTATAGTGATGCCTTTCT	0.388																																					p.D321Y													.	.			0			c.G961T												280.0	233.0	249.0					X																	123184103		2203	4300	6503	SO:0001583	missense	10735	exon11			TATAGTGATGCCT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.961G>T	X.37:g.123184103G>T	ENSP00000360202:p.Asp321Tyr		Somatic	38	0	0		WXS	Illumina HiSeq	.	57	0.32	18	NM_001042749	19	0.32	6	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645187	0.87859	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32;1.32	5.54	5.54	0.83059	Stromalin conservative domain (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.048644	0.85682	D	0.000000	T	0.62478	0.2431	M	0.81112	2.525	0.80722	D	1	D;P	0.56746	0.977;0.836	D;P	0.63381	0.914;0.62	T	0.67133	-0.5747	10	0.72032	D	0.01	-13.8301	18.6859	0.91563	0.0:0.0:1.0:0.0	.	321;321	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	Y	321;321;252;321;321;321;321	ENSP00000218089:D321Y;ENSP00000397265:D321Y;ENSP00000346555:D252Y;ENSP00000360202:D321Y;ENSP00000360199:D321Y;ENSP00000360187:D321Y;ENSP00000360186:D321Y	ENSP00000218089:D321Y	D	+	1	0	STAG2	123011784	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.965000	0.87945	2.444000	0.82710	0.600000	0.82982	GAT			0.388	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000156159.2		NM_006603	
ARHGEF6	9459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135763031	135763031	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chrX:135763031G>C	ENST00000250617.6	-	15	2768	c.1563C>G	c.(1561-1563)aaC>aaG	p.N521K	ARHGEF6_ENST00000370620.1_Missense_Mutation_p.N367K|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.N394K|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.N367K	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	521	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					TCTCCACTGTGTTACCTACAT	0.433																																					p.N521K													.	.			0			c.C1563G												171.0	132.0	145.0					X																	135763031		2203	4300	6503	SO:0001583	missense	9459	exon15			CACTGTGTTACCT	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1563C>G	X.37:g.135763031G>C	ENSP00000250617:p.Asn521Lys		Somatic	75	0	0		WXS	Illumina HiSeq	.	113	0.14	16	NM_004840	5	0.00	0	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	37	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	G	4.894	0.166188	0.09339	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	4.9	4.9	0.64082	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.699263	0.15465	N	0.260929	T	0.59689	0.2212	L	0.44542	1.39	0.09310	N	1	B;B	0.16802	0.008;0.019	B;B	0.29176	0.027;0.099	T	0.47560	-0.9108	10	0.11182	T	0.66	.	6.982	0.24708	0.092:0.0:0.7339:0.1741	.	394;521	B7Z3C7;Q15052	.;ARHG6_HUMAN	K	521;367;367;367;394	ENSP00000250617:N521K;ENSP00000359654:N367K;ENSP00000359656:N367K;ENSP00000439483:N394K	ENSP00000250617:N521K	N	-	3	2	ARHGEF6	135590697	0.828000	0.29307	0.055000	0.19348	0.011000	0.07611	3.689000	0.54706	2.149000	0.67028	0.415000	0.27848	AAC			0.433	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058511.2		NM_004840	
ZNF185	7739	hgsc.bcm.edu;mdanderson.org	37	X	152110348	152110348	+	Intron	SNP	C	C	A			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chrX:152110348C>A	ENST00000370268.4	+	16	1245				ZNF185_ENST00000324823.6_Intron|ZNF185_ENST00000535861.1_Intron|ZNF185_ENST00000454925.1_Silent_p.P32P|ZNF185_ENST00000449285.2_Intron|ZNF185_ENST00000318529.8_Intron|ZNF185_ENST00000318504.7_Intron|ZNF185_ENST00000539731.1_Intron|ZNF185_ENST00000370270.2_Intron			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CGAATGGGCCCGAGGAGCTGG	0.721																																					p.P32P													.	.			0			c.C96A																																									SO:0001627	intron_variant	7739	exon1			TGGGCCCGAGGAG	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1209-3463C>A	X.37:g.152110348C>A			Somatic	28	0	0		WXS	Illumina HiSeq	.	58	0.09	5	NM_001178115	0		0	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Silent	SNP	ENST00000370268.4	37	CCDS48184.1	.	.	.	.	.	.	.	.	.	.	C	4.665	0.123727	0.08931	.	.	ENSG00000147394	ENST00000454925	.	.	.	2.42	-0.735	0.11137	.	.	.	.	.	T	0.28566	0.0707	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.36792	-0.9733	5	0.87932	D	0	.	0.7827	0.01043	0.1985:0.3324:0.2879:0.1812	.	.	.	.	Q	35	.	ENSP00000392984:P35Q	P	+	2	0	ZNF185	151861004	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-4.366000	0.00245	-0.314000	0.08716	0.523000	0.50628	CCG			0.721	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000377480.1		NM_007150	
ZNF275	10838	mdanderson.org	37	X	152612977	152612977	+	Silent	SNP	C	C	T	rs372792162		TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chrX:152612977C>T	ENST00000421401.3	+	4	1011	c.834C>T	c.(832-834)aaC>aaT	p.N278N	ZNF275_ENST00000370249.2_Silent_p.N225N|ZNF275_ENST00000370251.3_Silent_p.N278N|ZNF275_ENST00000440091.1_Silent_p.N308N			Q9NSD4	ZN275_HUMAN	zinc finger protein 275	278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAGGGGTCAACGGGCTGGCCG	0.642																																					p.N278N													.	.			0			c.C834T							C		0,3807		0,0,1618,571	22.0	24.0	24.0		834	-1.8	0.0	X		24	1,6711		0,1,2425,1860	no	coding-synonymous	ZNF275	NM_001080485.3		0,1,4043,2431	TT,TC,CC,C		0.0149,0.0,0.0095		278/330	152612977	1,10518	2189	4286	6475	SO:0001819	synonymous_variant	10838	exon4			GGTCAACGGGCTG	BC041602		Xq28	2013-01-08			ENSG00000063587	ENSG00000063587		"""Zinc fingers, C2H2-type"", ""-"""	13069	protein-coding gene	gene with protein product							Standard	NM_001080485		Approved		uc004fhg.2	Q9NSD4	OTTHUMG00000067450	ENST00000421401.3:c.834C>T	X.37:g.152612977C>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001080485	8	0.00	0	A6NE92	Silent	SNP	ENST00000421401.3	37																																																																																						0.642	ZNF275-201	KNOWN	basic	protein_coding	protein_coding				NM_001080485	
ABCD1	215	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	153001577	153001577	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALR-01A-21D-A42Y-10	TCGA-2G-AALR-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e341fe71-7bdf-465a-8db7-644efb9ea2f6	5e1c1269-3ba2-4319-ab56-c708c5bb0939	g.chrX:153001577G>C	ENST00000218104.3	+	3	1492	c.1093G>C	c.(1093-1095)Gtg>Ctg	p.V365L	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	365	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGCAGAGGCCGTGAAGAAGGC	0.617																																					p.V365L													.	.			0			c.G1093C												68.0	65.0	66.0					X																	153001577		2203	4299	6502	SO:0001583	missense	215	exon3			GAGGCCGTGAAGA	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1093G>C	X.37:g.153001577G>C	ENSP00000218104:p.Val365Leu		Somatic	67	0	0		WXS	Illumina HiSeq	.	150	0.11	16	NM_000033	62	0.06	4	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	G	5.013	0.188129	0.09547	.	.	ENSG00000101986	ENST00000218104	D	0.93547	-3.24	4.53	-0.227	0.13102	.	0.368036	0.23622	N	0.046228	D	0.83751	0.5322	L	0.34521	1.04	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.67484	-0.5659	10	0.07030	T	0.85	-3.8596	5.2706	0.15622	0.2507:0.0:0.6051:0.1442	.	365	P33897	ABCD1_HUMAN	L	365	ENSP00000218104:V365L	ENSP00000218104:V365L	V	+	1	0	ABCD1	152654771	0.965000	0.33210	0.000000	0.03702	0.010000	0.07245	1.570000	0.36439	-0.456000	0.07043	-0.407000	0.06327	GTG			0.617	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061041.1		NM_000033	
