#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
NBPF3	84224	broad.mit.edu	37	1	21807432	21807432	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:21807432A>G	ENST00000318249.5	+	12	1741	c.1391A>G	c.(1390-1392)aAg>aGg	p.K464R	NBPF3_ENST00000318220.6_Missense_Mutation_p.K408R|NBPF3_ENST00000342104.5_Missense_Mutation_p.K452R|NBPF3_ENST00000454000.2_Missense_Mutation_p.K394R	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	464	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGAATGAAAAAGGACCAAGAA	0.468																																					p.P464R													.	NBPF3	55		0			c.C1391G												87.0	127.0	114.0					1																	21807432		2185	4299	6484	SO:0001583	missense	84224	exon12			TGAAAAAGGACCA	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1391A>G	1.37:g.21807432A>G	ENSP00000316782:p.Lys464Arg		Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	258	0.02	4	NM_032264	1	0.00	0	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	6.286	0.420897	0.11928	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.04706	3.57;3.8;3.77;3.78;3.82	0.573	-1.15	0.09709	DUF1220 (1);	.	.	.	.	T	0.06826	0.0174	M	0.76328	2.33	0.09310	N	1	P;P;P	0.45594	0.61;0.862;0.813	B;B;B	0.41332	0.354;0.135;0.221	T	0.16424	-1.0403	8	0.62326	D	0.03	.	.	.	.	.	394;452;464	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	R	394;408;464;452;408	ENSP00000415711:K394R;ENSP00000316739:K408R;ENSP00000316782:K464R;ENSP00000340336:K452R;ENSP00000391865:K408R	ENSP00000316739:K408R	K	+	2	0	NBPF3	21680019	0.004000	0.15560	0.001000	0.08648	0.166000	0.22503	0.073000	0.14640	-0.553000	0.06158	0.102000	0.15555	AAG			0.468	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_032264	
GJA9	81025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	39340498	39340498	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:39340498T>C	ENST00000360786.3	-	1	1525	c.1273A>G	c.(1273-1275)Aca>Gca	p.T425A	GJA9_ENST00000454994.2_Missense_Mutation_p.T425A|MYCBP_ENST00000489803.1_5'UTR|MYCBP_ENST00000397572.2_5'Flank|RP5-864K19.4_ENST00000433671.2_RNA|RP5-864K19.4_ENST00000443161.1_RNA|GJA9_ENST00000357771.3_Missense_Mutation_p.T425A|RP5-864K19.4_ENST00000456813.1_RNA			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	425					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			GAACCCCATGTAGCTCTAAGC	0.512																																					p.T425A													.	.			0			c.A1273G												94.0	93.0	93.0					1																	39340498		2203	4300	6503	SO:0001583	missense	81025	exon2			CCCATGTAGCTCT	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.1273A>G	1.37:g.39340498T>C	ENSP00000354020:p.Thr425Ala		Somatic	193	0	0		WXS	Illumina HiSeq	.	238	0.14	33	NM_030772	0		0	B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000360786.3	37	CCDS432.1	.	.	.	.	.	.	.	.	.	.	T	10.04	1.241175	0.22711	.	.	ENSG00000131233	ENST00000454994;ENST00000357771;ENST00000360786	D;D;D	0.97710	-4.5;-4.38;-4.38	4.49	0.421	0.16451	.	76.416700	0.00520	U	0.000180	D	0.94072	0.8100	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	D	0.87135	0.2199	10	0.35671	T	0.21	.	6.0075	0.19554	0.0:0.0998:0.4758:0.4245	.	425	P57773	CXA9_HUMAN	A	425	ENSP00000406846:T425A;ENSP00000350415:T425A;ENSP00000354020:T425A	ENSP00000350415:T425A	T	-	1	0	GJA9	39113085	0.072000	0.21174	0.001000	0.08648	0.013000	0.08279	0.900000	0.28431	0.289000	0.22422	-0.256000	0.11100	ACA			0.512	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001205.1		NM_030772	
FUBP1	8880	broad.mit.edu	37	1	78430879	78430879	+	Silent	SNP	T	T	C			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:78430879T>C	ENST00000370768.2	-	8	591	c.510A>G	c.(508-510)aaA>aaG	p.K170K	FUBP1_ENST00000436586.2_Silent_p.K191K|FUBP1_ENST00000370767.1_Silent_p.K170K	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	170					positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CTGGTCTTCCTTTTTCAACAA	0.403			"""F, N"""		oligodendroglioma																																p.K170K				Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	112		0			c.A510G												122.0	118.0	119.0					1																	78430879		2203	4300	6503	SO:0001819	synonymous_variant	8880	exon8			TCTTCCTTTTTCA	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.510A>G	1.37:g.78430879T>C			Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	101	0.03	3	NM_003902	76	0.00	0	Q12828	Silent	SNP	ENST00000370768.2	37	CCDS683.1																																																																																					0.403	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098030.3		NM_003902	
SEC22B	9554	broad.mit.edu	37	1	145109284	145109292	+	RNA	DEL	AAAAAAAAA	AAAAAAAAA	-	rs373765269		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	AAAAAAAAA	AAAAAAAAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:145109284_145109292delAAAAAAAAA	ENST00000453618.1	+	0	512							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											actccgtctcaaaaaaaaagaaaaaaaaa	0.435																																					.													.	.			0			.																																											9554	.			CGTCTCAAAAAAA	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109284_145109292delAAAAAAAAA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K1G0	RNA	DEL	ENST00000453618.1	37																																																																																						0.435	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
VPS72	6944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151156791	151156791	+	Splice_Site	SNP	A	A	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:151156791A>T	ENST00000354473.4	-	4	599		c.e4+1		VPS72_ENST00000496809.1_Splice_Site			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)						chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCACAGACTTACCCAGTGACC	0.527																																					.	Pancreas(109;1131 2287 3209 24201)												.	.			0			c.562+2T>A												189.0	205.0	200.0					1																	151156791		2203	4300	6503	SO:0001630	splice_region_variant	6944	exon5			AGACTTACCCAGT	D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.562+1T>A	1.37:g.151156791A>T			Somatic	83	0	0		WXS	Illumina HiSeq	.	93	0.12	11	NM_005997	4	1.00	4	A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Splice_Site	SNP	ENST00000354473.4	37	CCDS59201.1	.	.	.	.	.	.	.	.	.	.	a	28.9	4.963883	0.92791	.	.	ENSG00000163159	ENST00000368892;ENST00000354473	.	.	.	6.0	6.0	0.97389	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.169	0.81790	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPS72	149423415	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.971000	0.93419	2.302000	0.77476	0.528000	0.53228	.			0.527	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000034394.3		NM_005997	Intron
TTC24	164118	hgsc.bcm.edu;mdanderson.org	37	1	156551835	156551835	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:156551835G>T	ENST00000368237.3	+	1	679	c.679G>T	c.(679-681)Gag>Tag	p.E227*	TTC24_ENST00000368236.3_Nonsense_Mutation_p.E227*			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	227										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGGCTTGCCGAGAGGAGCAC	0.627																																					p.E227X													.	.			0			c.G679T												8.0	9.0	9.0					1																	156551835		691	1588	2279	SO:0001587	stop_gained	164118	exon2			CTTGCCGAGAGGA		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.679G>T	1.37:g.156551835G>T	ENSP00000357220:p.Glu227*		Somatic	49	0	0		WXS	Illumina HiSeq	.	69	0.06	4	NM_001105669	0		0	Q5T3H7	Nonsense_Mutation	SNP	ENST00000368237.3	37	CCDS53379.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369750	0.82573	.	.	ENSG00000187862	ENST00000368236;ENST00000368237	.	.	.	4.58	2.68	0.31781	.	1.017200	0.07890	N	0.970985	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-3.4477	9.8473	0.41034	0.1696:0.0:0.8304:0.0	.	.	.	.	X	227	.	ENSP00000357219:E227X	E	+	1	0	TTC24	154818459	0.890000	0.30428	0.419000	0.26584	0.179000	0.23085	2.483000	0.45233	0.547000	0.28938	0.455000	0.32223	GAG			0.627	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000158547.1		XM_089384	
LOC101928372	101928372	broad.mit.edu	37	1	160905269	160905270	+	lincRNA	INS	-	-	A	rs80321913|rs56775134		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:160905269_160905270insA	ENST00000427339.1	-	0	0				RP11-544M22.1_ENST00000356006.3_RNA																							caaaacaaaacaaaaaaaaaaa	0.5																																					.													.	.			0			.																																											0	.			ACAAAACAAAAAA																													1.37:g.160905280_160905280dupA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000427339.1	37																																																																																						0.500	RP11-312J18.6-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000071456.1			
MRPS14	63931	mdanderson.org	37	1	174983908	174983908	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr1:174983908G>T	ENST00000476371.1	-	3	300	c.284C>A	c.(283-285)tCc>tAc	p.S95Y	MRPS14_ENST00000498253.1_5'UTR	NM_022100.2	NP_071383.1			mitochondrial ribosomal protein S14											large_intestine(2)|lung(5)|pancreas(1)|prostate(2)	10						ACGCGGACGGGACGTCATAAC	0.522																																					p.S95Y													.	.			0			c.C284A												156.0	145.0	149.0					1																	174983908		2203	4300	6503	SO:0001583	missense	63931	exon3			GGACGGGACGTCA	AB051350	CCDS1316.1	1q25.1	2012-09-13			ENSG00000120333	ENSG00000120333		"""Mitochondrial ribosomal proteins / small subunits"""	14049	protein-coding gene	gene with protein product		611978					Standard	NR_037606		Approved	HSMRPS14	uc001gkk.3	O60783	OTTHUMG00000034878	ENST00000476371.1:c.284C>A	1.37:g.174983908G>T	ENSP00000420714:p.Ser95Tyr		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	100	0.06	6	NM_022100	75	0.00	0		Missense_Mutation	SNP	ENST00000476371.1	37	CCDS1316.1	.	.	.	.	.	.	.	.	.	.	G	35	5.535043	0.96460	.	.	ENSG00000120333	ENST00000476371	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.85539	0.5720	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86440	0.1766	9	0.87932	D	0	-14.4346	20.6593	0.99626	0.0:0.0:1.0:0.0	.	95	O60783	RT14_HUMAN	Y	95	.	ENSP00000420714:S95Y	S	-	2	0	MRPS14	173250531	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.623000	0.98386	2.885000	0.99019	0.655000	0.94253	TCC			0.522	MRPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084416.2		NM_022100	
CASC10	399726	mdanderson.org	37	10	21784579	21784579	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr10:21784579G>T	ENST00000377113.5	-	2	808	c.361C>A	c.(361-363)Cag>Aag	p.Q121K	MIR1915_ENST00000410139.1_RNA	NM_001010911.2	NP_001010911.1	Q5T4H9	CSC10_HUMAN	cancer susceptibility candidate 10	121																	AAGAAGTCCTGGATGAGAGGT	0.582											OREG0020066	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q121K													.	.			0			c.C361A												83.0	98.0	93.0					10																	21784579		2203	4300	6503	SO:0001583	missense	399726	exon2			AGTCCTGGATGAG	BC040880	CCDS31163.1	10p12.31	2013-07-17	2013-07-17	2013-07-17	ENSG00000204682	ENSG00000204682			31448	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 114"""	C10orf114		21804547	Standard	NM_001010911		Approved	bA418C1.3	uc001iqn.4	Q5T4H9	OTTHUMG00000017795	ENST00000377113.5:c.361C>A	10.37:g.21784579G>T	ENSP00000366317:p.Gln121Lys		Somatic	47	0	0	751	WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001010911	4	0.00	0	A1L4M3	Missense_Mutation	SNP	ENST00000377113.5	37	CCDS31163.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.366371	0.24771	.	.	ENSG00000204682	ENST00000377113	T	0.50548	0.74	3.99	-1.5	0.08691	.	.	.	.	.	T	0.22126	0.0533	N	0.08118	0	0.09310	N	1	B	0.32573	0.376	B	0.30401	0.115	T	0.17167	-1.0378	9	0.87932	D	0	1.0065	3.5318	0.07779	0.4202:0.0:0.405:0.1748	.	121	Q5T4H9	CJ114_HUMAN	K	121	ENSP00000366317:Q121K	ENSP00000366317:Q121K	Q	-	1	0	C10orf114	21824585	0.007000	0.16637	0.023000	0.16930	0.020000	0.10135	0.207000	0.17395	-0.148000	0.11234	0.305000	0.20034	CAG			0.582	CASC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047130.2		NM_001010911	
ZRANB1	54764	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	126673488	126673488	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr10:126673488A>G	ENST00000359653.4	+	9	2425	c.2054A>G	c.(2053-2055)gAc>gGc	p.D685G		NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	685					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		AAATGGCTTGACCGCTACCGA	0.507																																					p.D685G													.	.			0			c.A2054G												58.0	52.0	54.0					10																	126673488		2203	4300	6503	SO:0001583	missense	54764	exon9			GGCTTGACCGCTA	AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.2054A>G	10.37:g.126673488A>G	ENSP00000352676:p.Asp685Gly		Somatic	84	0	0		WXS	Illumina HiSeq	.	99	0.05	5	NM_017580	55	0.00	0	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	37	CCDS7642.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.590284	0.86851	.	.	ENSG00000019995	ENST00000359653	T	0.20463	2.07	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.30634	0.0771	M	0.63843	1.955	0.80722	D	1	D	0.53462	0.96	P	0.46796	0.527	T	0.08269	-1.0730	10	0.66056	D	0.02	-25.1977	15.3459	0.74337	1.0:0.0:0.0:0.0	.	685	Q9UGI0	ZRAN1_HUMAN	G	685	ENSP00000352676:D685G	ENSP00000352676:D685G	D	+	2	0	ZRANB1	126663478	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.757000	0.91657	2.206000	0.71126	0.528000	0.53228	GAC			0.507	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050898.1		NM_017580	
MUC2	4583	mdanderson.org	37	11	1093324	1093324	+	Missense_Mutation	SNP	G	G	A	rs201143282		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:1093324G>A	ENST00000441003.2	+	30	5170	c.5143G>A	c.(5143-5145)Ggc>Agc	p.G1715S	MUC2_ENST00000333592.6_Missense_Mutation_p.G3S|MUC2_ENST00000359061.5_Missense_Mutation_p.G1682S|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																					p.G1715S													MUC2_ENST00000441003,uveal_tract,malignant_melanoma,0,2	MUC2_ENST00000441003	0	2	0			c.G5143A												178.0	224.0	208.0					11																	1093324		1930	3651	5581	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5143G>A	11.37:g.1093324G>A	ENSP00000415183:p.Gly1715Ser		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	7.149	0.583420	0.13749	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.11;3.17;2.32	1.64	0.221	0.15283	.	155.122000	0.02480	U	0.088379	T	0.09686	0.0238	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22556	-1.0213	9	0.19147	T	0.46	.	3.4701	0.07563	0.7575:0.0:0.2425:0.0	.	1715	E7EUV1	.	S	1715;1682;3	ENSP00000415183:G1715S;ENSP00000351956:G1682S;ENSP00000331373:G3S	ENSP00000331373:G3S	G	+	1	0	MUC2	1083324	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.131000	0.10482	-0.042000	0.13535	-1.076000	0.02234	GGC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
DNHD1	144132	mdanderson.org	37	11	6592605	6592605	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:6592605G>T	ENST00000527990.2	+	40	13863	c.13863G>T	c.(13861-13863)caG>caT	p.Q4621H	DNHD1_ENST00000254579.6_Missense_Mutation_p.Q4621H			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4621					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCTCCAGTCAGCTCCAGTATA	0.607																																					p.Q4621H													.	.			0			c.G13863T												27.0	31.0	29.0					11																	6592605		2013	4171	6184	SO:0001583	missense	144132	exon42			CAGTCAGCTCCAG	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.13863G>T	11.37:g.6592605G>T	ENSP00000436180:p.Gln4621His		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_144666	7	0.00	0	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	9.474	1.096339	0.20552	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000530197	T;T	0.08984	3.03;3.03	3.47	0.108	0.14548	Dynein heavy chain (1);	1.580870	0.03897	N	0.279685	T	0.07098	0.0180	L	0.36672	1.1	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.40232	-0.9574	10	0.44086	T	0.13	5.4223	1.0449	0.01568	0.142:0.2022:0.3781:0.2777	.	3709;674;4621	B0I1S4;Q9NSW8;Q96M86	.;.;DNHD1_HUMAN	H	4621;4621;889	ENSP00000254579:Q4621H;ENSP00000436180:Q4621H	ENSP00000254579:Q4621H	Q	+	3	2	DNHD1	6549181	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.411000	0.07142	0.009000	0.14813	0.544000	0.68410	CAG			0.607	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384673.2		NM_144666	
C11orf58	10944	mdanderson.org	37	11	16760382	16760382	+	Silent	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:16760382C>T	ENST00000228136.4	+	1	435	c.57C>T	c.(55-57)gaC>gaT	p.D19D	C11orf58_ENST00000422258.2_5'UTR|C11orf58_ENST00000525684.1_Silent_p.D19D|C11orf58_ENST00000527893.1_Intron			O00193	SMAP_HUMAN	chromosome 11 open reading frame 58	19										NS(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)	7						CCTCCCCAGACGACGATGTAA	0.602																																					p.D19D													.	.			0			c.C57T												49.0	50.0	50.0					11																	16760382		2200	4294	6494	SO:0001819	synonymous_variant	10944	exon1			CCCAGACGACGAT	BC007103	CCDS7822.1	11p15.1	2012-05-30			ENSG00000110696	ENSG00000110696			16990	protein-coding gene	gene with protein product	"""small acidic protein"""					9263035	Standard	NM_014267		Approved	SMAP	uc001mmk.2	O00193	OTTHUMG00000165910	ENST00000228136.4:c.57C>T	11.37:g.16760382C>T			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_014267	271	0.00	0	B2RD28	Silent	SNP	ENST00000228136.4	37	CCDS7822.1																																																																																					0.602	C11orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387023.2		NM_014267	
ABCC8	6833	mdanderson.org	37	11	17450161	17450161	+	Missense_Mutation	SNP	G	G	A	rs148709148	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:17450161G>A	ENST00000389817.3	-	13	1942	c.1874C>T	c.(1873-1875)gCc>gTc	p.A625V	ABCC8_ENST00000528202.1_5'Flank|ABCC8_ENST00000302539.4_Missense_Mutation_p.A625V			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	625					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTCATGGGGGGCACACTGCTC	0.642													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19621	0.0		0.0	False		,,,				2504	0.0				p.A625V													.	.			0			c.C1874T							G	VAL/ALA	11,4389	17.9+/-39.9	0,11,2189	80.0	76.0	77.0		1874	4.3	1.0	11	dbSNP_134	77	0,8586		0,0,4293	yes	missense	ABCC8	NM_000352.3	64	0,11,6482	AA,AG,GG		0.0,0.25,0.0847	benign	625/1582	17450161	11,12975	2200	4293	6493	SO:0001583	missense	6833	exon13			TGGGGGGCACACT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1874C>T	11.37:g.17450161G>A	ENSP00000374467:p.Ala625Val		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_000352	1	0.00	0	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	8.540	0.872965	0.17322	0.0025	0.0	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.91577	-2.87;-2.87	5.28	4.31	0.51392	ABC transporter, transmembrane domain, type 1 (1);	0.461271	0.21898	N	0.067487	T	0.78704	0.4325	N	0.08118	0	0.33753	D	0.620844	B	0.09022	0.002	B	0.12156	0.007	T	0.77135	-0.2699	10	0.33940	T	0.23	.	8.4482	0.32856	0.0:0.2794:0.5664:0.1542	.	625	Q09428	ABCC8_HUMAN	V	625;625;629	ENSP00000374467:A625V;ENSP00000303960:A625V	ENSP00000303960:A625V	A	-	2	0	ABCC8	17406737	0.465000	0.25815	0.955000	0.39395	0.092000	0.18411	0.664000	0.25068	2.490000	0.84030	0.561000	0.74099	GCC	0.001		0.642	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000389093.1		NM_000352	
ZDHHC13	54503	mdanderson.org	37	11	19174229	19174229	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:19174229G>T	ENST00000446113.2	+	8	992	c.871G>T	c.(871-873)Gag>Tag	p.E291*	ZDHHC13_ENST00000532812.1_3'UTR|ZDHHC13_ENST00000399351.3_Nonsense_Mutation_p.E161*	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	291					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						GCAGAAATGCGAGGTATTTTC	0.368																																					p.E291X													.	.			0			c.G871T												75.0	73.0	74.0					11																	19174229		1800	4062	5862	SO:0001587	stop_gained	54503	exon8			AAATGCGAGGTAT	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.871G>T	11.37:g.19174229G>T	ENSP00000400113:p.Glu291*		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_019028	19	0.00	0	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Nonsense_Mutation	SNP	ENST00000446113.2	37	CCDS44550.1	.	.	.	.	.	.	.	.	.	.	G	38	6.881632	0.97908	.	.	ENSG00000177054	ENST00000446113;ENST00000399351	.	.	.	5.43	5.43	0.79202	.	0.372047	0.31113	N	0.008223	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-1.9485	18.8981	0.92432	0.0:0.0:1.0:0.0	.	.	.	.	X	291;161	.	ENSP00000382288:E161X	E	+	1	0	ZDHHC13	19130805	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	4.970000	0.63742	2.571000	0.86741	0.644000	0.83932	GAG			0.368	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387821.1		NM_019028	
FOLH1	2346	bcgsc.ca	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																					p.Y277Y													.	FOLH1	141		0			c.T831C												61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346	exon7			ATAAGCATATTCT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			Somatic	131	0.0076335878	1		WXS	Illumina HiSeq	Phase_1	173	0.05	9	NM_004476	0		0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																					0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390896.1		NM_004476	
KLC2	64837	broad.mit.edu;ucsc.edu	37	11	66033608	66033608	+	Silent	SNP	C	C	A			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:66033608C>A	ENST00000417856.1	+	14	1890	c.1647C>A	c.(1645-1647)ctC>ctA	p.L549L	KLC2_ENST00000394066.2_Silent_p.L472L|KLC2_ENST00000394067.2_Silent_p.L549L|RAB1B_ENST00000311481.6_5'Flank|RP11-867G23.1_ENST00000530805.1_RNA|RAB1B_ENST00000527397.1_5'Flank|KLC2_ENST00000394065.2_Silent_p.L410L|RP11-867G23.2_ENST00000533287.1_RNA|KLC2_ENST00000394078.1_Intron|KLC2_ENST00000316924.5_Silent_p.L549L|KLC2_ENST00000421552.1_Silent_p.L472L	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	549					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TTGGGAAACTCCGGGATGCCC	0.672																																					p.L549L													.	KLC2	50		0			c.C1647A												36.0	39.0	38.0					11																	66033608		2200	4295	6495	SO:0001819	synonymous_variant	64837	exon14			GAAACTCCGGGAT	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.1647C>A	11.37:g.66033608C>A			Somatic	109	0.0275229358	3		WXS	Illumina HiSeq	Phase_I	120	0.16	19	NM_022822	43	0.30	13	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Silent	SNP	ENST00000417856.1	37	CCDS8130.1																																																																																					0.672	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258200.1		NM_022822	
ACY3	91703	mdanderson.org	37	11	67414472	67414472	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr11:67414472C>T	ENST00000255082.3	-	3	213	c.43G>A	c.(43-45)Gct>Act	p.A15T	ACY3_ENST00000529256.1_Intron	NM_080658.1	NP_542389.1	Q96HD9	ACY3_HUMAN	aspartoacylase (aminocyclase) 3	15	Hydrolytic domain. {ECO:0000250}.				viral process (GO:0016032)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			endometrium(1)|lung(5)|prostate(2)	8					L-Aspartic Acid(DB00128)	CCAGTCACAGCCACGCGACGC	0.682																																					p.A15T	GBM(56;346 1011 27014 29495 46841)												.	.			0			c.G43A												10.0	10.0	10.0					11																	67414472		2158	4244	6402	SO:0001583	missense	91703	exon3			TCACAGCCACGCG	BC008689	CCDS8175.1	11q13.2	2014-08-08			ENSG00000132744	ENSG00000132744			24104	protein-coding gene	gene with protein product		614413				14656720	Standard	NM_080658		Approved	HCBP1, MGC9740, ACY-3	uc001omq.3	Q96HD9	OTTHUMG00000167283	ENST00000255082.3:c.43G>A	11.37:g.67414472C>T	ENSP00000255082:p.Ala15Thr		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_080658	0		0		Missense_Mutation	SNP	ENST00000255082.3	37	CCDS8175.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069513	0.55539	.	.	ENSG00000132744	ENST00000255082	D	0.97906	-4.6	4.03	4.03	0.46877	.	0.066157	0.64402	D	0.000017	D	0.98570	0.9522	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.99379	1.0922	10	0.62326	D	0.03	.	15.3087	0.74014	0.0:1.0:0.0:0.0	.	15	Q96HD9	ACY3_HUMAN	T	15	ENSP00000255082:A15T	ENSP00000255082:A15T	A	-	1	0	ACY3	67171048	1.000000	0.71417	0.891000	0.34965	0.115000	0.19883	5.290000	0.65661	1.971000	0.57363	0.462000	0.41574	GCT			0.682	ACY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394002.1		NM_080658	
PIK3C2G	5288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	18573943	18573943	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr12:18573943T>C	ENST00000266497.5	+	15	2299	c.2261T>C	c.(2260-2262)cTg>cCg	p.L754P	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.L754P|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.L795P			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	754	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				GATGAACTACTGGAATATCTC	0.353																																					p.L754P													.	.			0			c.T2261C												116.0	110.0	112.0					12																	18573943		1823	4082	5905	SO:0001583	missense	5288	exon16			AACTACTGGAATA	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.2261T>C	12.37:g.18573943T>C	ENSP00000266497:p.Leu754Pro		Somatic	89	0	0		WXS	Illumina HiSeq	.	127	0.09	12	NM_004570	0		0	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	T	17.33	3.363413	0.61513	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.68765	-0.35;-0.35;-0.35	4.26	4.26	0.50523	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.216632	0.31721	N	0.007162	T	0.80628	0.4659	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.77004	0.989;0.981;0.989	T	0.82476	-0.0438	10	0.56958	D	0.05	-6.7533	11.9957	0.53201	0.0:0.0:0.0:1.0	.	794;795;754	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	P	754;754;795	ENSP00000404845:L754P;ENSP00000266497:L754P;ENSP00000445381:L795P	ENSP00000266497:L754P	L	+	2	0	PIK3C2G	18465210	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.937000	0.56575	2.147000	0.66899	0.455000	0.32223	CTG			0.353	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401316.1		NM_004570	
SP1	6667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53776737	53776737	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr12:53776737A>C	ENST00000327443.4	+	3	1104	c.1006A>C	c.(1006-1008)Atg>Ctg	p.M336L	SP1_ENST00000426431.2_Missense_Mutation_p.M329L	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	336	Ser/Thr-rich.|Transactivation domain B (Gln-rich).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		CACCAGCAACATGGGAATTAT	0.493																																					p.M336L													.	.			0			c.A1006C												135.0	126.0	129.0					12																	53776737		2203	4300	6503	SO:0001583	missense	6667	exon3			AGCAACATGGGAA	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1006A>C	12.37:g.53776737A>C	ENSP00000329357:p.Met336Leu		Somatic	106	0	0		WXS	Illumina HiSeq	.	132	0.13	17	NM_138473	11	0.09	1	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	37	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	A	1.971	-0.436483	0.04636	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.06371	3.31;3.31	4.25	4.25	0.50352	.	0.079472	0.51477	D	0.000083	T	0.03608	0.0103	N	0.22421	0.69	0.27164	N	0.96108	B	0.02656	0.0	B	0.01281	0.0	T	0.40117	-0.9580	10	0.15499	T	0.54	.	3.7648	0.08619	0.7095:0.0:0.1008:0.1897	.	336	P08047	SP1_HUMAN	L	336;329	ENSP00000329357:M336L;ENSP00000404263:M329L	ENSP00000329357:M336L	M	+	1	0	SP1	52063004	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.444000	0.35068	1.934000	0.56057	0.377000	0.23210	ATG			0.493	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407044.1			
TIMELESS	8914	mdanderson.org	37	12	56814371	56814371	+	Silent	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr12:56814371C>T	ENST00000553532.1	-	26	3360	c.3210G>A	c.(3208-3210)cgG>cgA	p.R1070R	TIMELESS_ENST00000229201.4_Silent_p.R1069R|TIMELESS_ENST00000554616.1_Silent_p.R567R					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						AGGCAGGGGGCCGAACCCCTA	0.527																																					p.R1070R													.	.			0			c.G3210A												111.0	96.0	101.0					12																	56814371		2203	4300	6503	SO:0001819	synonymous_variant	8914	exon26			AGGGGGCCGAACC	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.3210G>A	12.37:g.56814371C>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	73	0.05	4	NM_003920	68	0.00	0		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																					0.527	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000409771.1		NM_003920	
TIMELESS	8914	hgsc.bcm.edu;broad.mit.edu	37	12	56817448	56817448	+	Silent	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr12:56817448C>T	ENST00000553532.1	-	17	2160	c.2010G>A	c.(2008-2010)gaG>gaA	p.E670E	TIMELESS_ENST00000229201.4_Silent_p.E669E|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock									p.E670E(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						cctcctcctcctcttcttctt	0.527																																					p.E670E													TIMELESS,NS,carcinoma,0,1	TIMELESS	0	1	1	Substitution - coding silent(1)	kidney(1)	c.G2010A												51.0	49.0	50.0					12																	56817448		2203	4300	6503	SO:0001819	synonymous_variant	8914	exon17			CTCCTCCTCTTCT	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2010G>A	12.37:g.56817448C>T			Somatic	45	0.0222222222	1		WXS	Illumina HiSeq	.	90	0.04	4	NM_003920	40	0.00	0		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																					0.527	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000409771.1		NM_003920	
TCTN1	79600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	111052124	111052124	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr12:111052124G>A	ENST00000551590.1	+	1	293	c.137G>A	c.(136-138)gGa>gAa	p.G46E	TCTN1_ENST00000397655.3_Missense_Mutation_p.G46E|TCTN1_ENST00000471804.2_Missense_Mutation_p.G46E|TCTN1_ENST00000397659.4_Missense_Mutation_p.G46E|TCTN1_ENST00000377654.3_5'UTR|TCTN1_ENST00000550703.2_Missense_Mutation_p.G46E			Q2MV58	TECT1_HUMAN	tectonic family member 1	46					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						GCCACCTTCGGAACTTTCCCG	0.716																																					p.G46E													.	.			0			c.G137A												9.0	12.0	11.0					12																	111052124		1898	4089	5987	SO:0001583	missense	79600	exon1			CCTTCGGAACTTT	AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.137G>A	12.37:g.111052124G>A	ENSP00000448735:p.Gly46Glu		Somatic	85	0	0		WXS	Illumina HiSeq	.	129	0.12	16	NM_024549	15	0.20	3	A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Missense_Mutation	SNP	ENST00000551590.1	37	CCDS41835.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017639	0.35606	.	.	ENSG00000204852	ENST00000551590;ENST00000397655;ENST00000548095;ENST00000397659	T;T;T	0.75477	-0.94;-0.94;-0.94	5.28	3.42	0.39159	.	4.105310	0.01985	U	0.045110	T	0.57519	0.2059	N	0.14661	0.345	0.24342	N	0.994957	B;B;B;B	0.22909	0.011;0.025;0.077;0.043	B;B;B;B	0.19391	0.006;0.008;0.025;0.017	T	0.50259	-0.8849	10	0.02654	T	1	-0.035	8.9712	0.35908	0.1769:0.0:0.8231:0.0	.	46;46;46;46	B4DIB9;Q2MV58;Q2MV58-3;Q2MV58-2	.;TECT1_HUMAN;.;.	E	46	ENSP00000448735:G46E;ENSP00000380775:G46E;ENSP00000380779:G46E	ENSP00000380775:G46E	G	+	2	0	TCTN1	109536507	0.002000	0.14202	0.001000	0.08648	0.035000	0.12851	0.958000	0.29227	0.705000	0.31890	0.561000	0.74099	GGA			0.716	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000316016.2		NM_024549	
P2RX2	22953	mdanderson.org	37	12	133195575	133195575	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr12:133195575G>T	ENST00000389110.3	+	1	210	c.173G>T	c.(172-174)tGg>tTg	p.W58L	P2RX2_ENST00000343948.4_Splice_Site_p.W58L|P2RX2_ENST00000352418.4_Intron|P2RX2_ENST00000348800.5_Splice_Site_p.W58L|P2RX2_ENST00000351222.4_Intron|P2RX2_ENST00000350048.5_Splice_Site_p.W58L|P2RX2_ENST00000449132.2_Splice_Site_p.W58L	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	58					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		TACTTCGTGTGGTgcgcgggg	0.746																																					p.W58L													.	.			0			c.G173T												14.0	16.0	15.0					12																	133195575		2148	4215	6363	SO:0001630	splice_region_variant	22953	exon1			TCGTGTGGTGCGC	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.173+1G>T	12.37:g.133195575G>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_170683	0		0	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	ENST00000389110.3	37	CCDS31931.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	26.2|26.2|26.2	4.719111|4.719111|4.719111	0.89205|0.89205|0.89205	.|.|.	.|.|.	ENSG00000187848|ENSG00000187848|ENSG00000187848	ENST00000542301|ENST00000389110;ENST00000449132;ENST00000343948;ENST00000350048;ENST00000348800|ENST00000536121	.|T;T;T;T;T|.	.|0.03860|.	.|3.78;3.78;3.78;3.78;3.78|.	4.11|4.11|4.11	4.11|4.11|4.11	0.48088|0.48088|0.48088	.|.|.	.|0.069579|.	.|0.64402|.	.|D|.	.|0.000007|.	T|T|.	0.58075|0.58075|.	0.2097|0.2097|.	L|L|L	0.38838|0.38838|0.38838	1.175|1.175|1.175	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;P;P;D|.	.|0.89917|.	.|0.999;1.0;1.0;0.95;0.855;0.999|.	.|D;D;D;P;P;D|.	.|0.87578|.	.|0.977;0.988;0.998;0.56;0.609;0.962|.	T|T|.	0.56147|0.56147|.	-0.8027|-0.8027|.	5|10|.	.|0.35671|.	.|T|.	.|0.21|.	-11.8331|-11.8331|-11.8331	15.9135|15.9135|15.9135	0.79491|0.79491|0.79491	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|58;58;58;58;58;58|.	.|Q32MC3;Q9UBL9-7;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2|.	.|.;.;.;.;P2RX2_HUMAN;.|.	W|L|L	57|58|50	.|ENSP00000373762:W58L;ENSP00000405531:W58L;ENSP00000343339:W58L;ENSP00000343904:W58L;ENSP00000345095:W58L|.	.|ENSP00000343339:W58L|.	G|W|X	+|+|+	1|2|2	0|0|2	P2RX2|P2RX2|P2RX2	131705648|131705648|131705648	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.739000|0.739000|0.739000	0.42172|0.42172|0.42172	6.453000|6.453000|6.453000	0.73488|0.73488|0.73488	1.827000|1.827000|1.827000	0.53221|0.53221|0.53221	0.484000|0.484000|0.484000	0.47621|0.47621|0.47621	GGG|TGG|TGA			0.746	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000397542.1			Missense_Mutation
MYCBP2	23077	mdanderson.org	37	13	77900715	77900715	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr13:77900715G>T	ENST00000544440.2	-	1	99	c.82C>A	c.(82-84)Ctg>Atg	p.L28M	MYCBP2_ENST00000357337.6_Missense_Mutation_p.L28M|MYCBP2_ENST00000360084.5_De_novo_Start_InFrame|MYCBP2_ENST00000407578.2_Missense_Mutation_p.L66M					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GACAGCAGCAGCTGGTAGTGA	0.731																																					p.L66M													.	.			0			c.C196A												12.0	16.0	14.0					13																	77900715		2196	4291	6487	SO:0001583	missense	23077	exon1			GCAGCAGCTGGTA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.82C>A	13.37:g.77900715G>T	ENSP00000444596:p.Leu28Met		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_015057	0		0		Missense_Mutation	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	G	25.2	4.611618	0.87258	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.34275	1.39;1.37;1.39	3.94	3.94	0.45596	.	0.000000	0.53938	D	0.000054	T	0.48114	0.1482	L	0.36672	1.1	0.47698	D	0.99949	D	0.58970	0.984	D	0.70487	0.969	T	0.46498	-0.9187	10	0.49607	T	0.09	.	14.286	0.66247	0.0:0.0:1.0:0.0	.	28	O75592	MYCB2_HUMAN	M	28;66;28	ENSP00000349892:L28M;ENSP00000384288:L66M;ENSP00000444596:L28M	ENSP00000349892:L28M	L	-	1	2	MYCBP2	76798716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.496000	0.66918	2.189000	0.69895	0.655000	0.94253	CTG			0.731	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000045326.1		NM_015057	
PCCA	5095	mdanderson.org	37	13	100741384	100741384	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr13:100741384T>G	ENST00000376285.1	+	1	48	c.10T>G	c.(10-12)Ttc>Gtc	p.F4V	PCCA_ENST00000376286.4_Missense_Mutation_p.F4V|PCCA_ENST00000376279.3_Missense_Mutation_p.F4V	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	4					biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	AATGGCGGGGTTCTGGGTCGG	0.706																																					p.F4V													.	.			0			c.T10G												9.0	10.0	10.0					13																	100741384		2135	4170	6305	SO:0001583	missense	5095	exon1			GCGGGGTTCTGGG	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.10T>G	13.37:g.100741384T>G	ENSP00000365462:p.Phe4Val		Somatic	79	0.1012658228	8		WXS	Illumina HiSeq	Phase_I	86	0.22	19	NM_001178004	2	0.00	0	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	T	8.623	0.891969	0.17613	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.96802	-4.13;-4.05;-4.08	4.76	-0.195	0.13236	.	1.005770	0.08009	N	0.990109	D	0.88032	0.6328	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.0;0.0;0.002	T	0.78086	-0.2341	10	0.46703	T	0.11	-12.0946	1.3343	0.02142	0.1499:0.4433:0.1459:0.2609	.	4;4;4	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	V	4	ENSP00000365463:F4V;ENSP00000365456:F4V;ENSP00000365462:F4V	ENSP00000365456:F4V	F	+	1	0	PCCA	99539385	0.003000	0.15002	0.105000	0.21289	0.040000	0.13550	0.082000	0.14847	0.004000	0.14682	-0.252000	0.11476	TTC			0.706	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045627.2			
EFS	10278	broad.mit.edu	37	14	23828820	23828820	+	Silent	SNP	T	T	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr14:23828820T>G	ENST00000216733.3	-	4	1474	c.867A>C	c.(865-867)ccA>ccC	p.P289P	EFS_ENST00000351354.3_Silent_p.P196P|RP11-124D2.3_ENST00000554010.1_RNA|EFS_ENST00000429593.2_Silent_p.P120P	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	289	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		TGTGTGGGGGTGGGGGGCTTC	0.726																																					p.P289P													.	EFS	37		0			c.A867C												7.0	10.0	9.0					14																	23828820		1935	4040	5975	SO:0001819	synonymous_variant	0	exon4			TGGGGGTGGGGGG	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.867A>C	14.37:g.23828820T>G			Somatic	20	0.3	6		WXS	Illumina HiSeq	Phase_I	38	0.18	7	NM_005864	6	0.17	1	B2RAJ7|B4DJ56|E9PGU2|O43282	Silent	SNP	ENST00000216733.3	37	CCDS9595.1																																																																																					0.726	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071770.2			
MYH7	4625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23893198	23893198	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr14:23893198C>T	ENST00000355349.3	-	23	3002	c.2840G>A	c.(2839-2841)tGc>tAc	p.C947Y		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	947					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GAGCTCTGAGCACTCATCTTC	0.532																																					p.C947Y													.	.			0			c.G2840A												234.0	200.0	211.0					14																	23893198		2203	4300	6503	SO:0001583	missense	4625	exon23			TCTGAGCACTCAT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2840G>A	14.37:g.23893198C>T	ENSP00000347507:p.Cys947Tyr		Somatic	101	0	0		WXS	Illumina HiSeq	.	81	0.15	12	NM_000257	0		0	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577085	0.86645	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.91011	-2.77	5.33	5.33	0.75918	.	.	.	.	.	D	0.96516	0.8863	H	0.95079	3.62	0.80722	D	1	D	0.56287	0.975	P	0.59825	0.864	D	0.97337	0.9954	9	0.87932	D	0	.	19.212	0.93760	0.0:1.0:0.0:0.0	.	947	P12883	MYH7_HUMAN	Y	947	ENSP00000347507:C947Y	ENSP00000347507:C947Y	C	-	2	0	MYH7	22963038	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.466000	0.80914	2.778000	0.95560	0.655000	0.94253	TGC			0.532	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071798.3		NM_000257	
HIF1A	3091	mdanderson.org	37	14	62207590	62207590	+	Missense_Mutation	SNP	G	G	A	rs199775054		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr14:62207590G>A	ENST00000337138.4	+	12	2042	c.1777G>A	c.(1777-1779)Gca>Aca	p.A593T	HIF1A_ENST00000557538.1_Missense_Mutation_p.A534T|HIF1A_ENST00000323441.6_Missense_Mutation_p.A593T|HIF1A_ENST00000394997.1_Missense_Mutation_p.A594T|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000539097.1_Missense_Mutation_p.A617T|RP11-618G20.1_ENST00000555937.1_RNA	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	593	ID.|ODD.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	CCCTGAAAGCGCAAGTCCTCA	0.453																																					p.A617T													.	.			0			c.G1849A												134.0	125.0	128.0					14																	62207590		2203	4300	6503	SO:0001583	missense	3091	exon12			GAAAGCGCAAGTC	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1777G>A	14.37:g.62207590G>A	ENSP00000338018:p.Ala593Thr		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	137	0.04	5	NM_001243084	129	0.00	0	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	37	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	G	7.414	0.635390	0.14322	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73	5.6	1.66	0.24008	.	18.839200	0.00166	U	0.000006	T	0.32941	0.0846	L	0.29908	0.895	0.09310	N	1	B;B;B	0.26708	0.157;0.012;0.012	B;B;B	0.15870	0.014;0.002;0.002	T	0.11591	-1.0581	10	0.09338	T	0.73	.	6.0956	0.20019	0.2557:0.0:0.6235:0.1208	.	594;593;593	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	T	344;534;593;594;593;534;617	ENSP00000338018:A593T;ENSP00000378446:A594T;ENSP00000323326:A593T;ENSP00000451696:A534T;ENSP00000437955:A617T	ENSP00000323326:A593T	A	+	1	0	HIF1A	61277343	0.067000	0.21026	0.019000	0.16419	0.875000	0.50365	1.659000	0.37387	0.098000	0.17522	0.650000	0.86243	GCA			0.453	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000276977.2		NM_001530	
MESP2	145873	broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	90319955	90319955	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr15:90319955G>A	ENST00000341735.3	+	1	367	c.367G>A	c.(367-369)Gag>Aag	p.E123K	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	123	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			GACCAAGATCGAGACGCTGCG	0.706																																					p.E123K													.	MESP2	20		0			c.G367A												7.0	10.0	9.0					15																	90319955		2140	4224	6364	SO:0001583	missense	145873	exon1			AAGATCGAGACGC		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.367G>A	15.37:g.90319955G>A	ENSP00000342392:p.Glu123Lys		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	26	0.15	4	NM_001039958	1	0.00	0	Q7RTU2	Missense_Mutation	SNP	ENST00000341735.3	37	CCDS42078.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820333	0.50633	.	.	ENSG00000188095	ENST00000341735	D	0.98192	-4.78	3.59	2.64	0.31445	Helix-loop-helix DNA-binding (5);	.	.	.	.	D	0.98280	0.9430	M	0.64997	1.995	0.53688	D	0.999973	D	0.89917	1.0	D	0.76575	0.988	D	0.97947	1.0329	9	0.66056	D	0.02	-9.6817	10.8245	0.46625	0.0:0.0:0.8091:0.1909	.	123	Q0VG99	MESP2_HUMAN	K	123	ENSP00000342392:E123K	ENSP00000342392:E123K	E	+	1	0	MESP2	88120959	1.000000	0.71417	1.000000	0.80357	0.313000	0.28021	4.630000	0.61297	0.671000	0.31185	0.313000	0.20887	GAG			0.706	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416421.1		XM_085261	
OR2C1	4993	mdanderson.org	37	16	3406387	3406387	+	Silent	SNP	C	C	T	rs1218763	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr16:3406387C>T	ENST00000304936.2	+	1	499	c.447C>T	c.(445-447)tgC>tgT	p.C149C		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	149			C -> W (in dbSNP:rs1218763). {ECO:0000269|PubMed:14983052, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9847080, ECO:0000269|Ref.3}.		detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						TGATTGCCTGCCTGGGTGGCT	0.617																																					p.C149C													.	.			0			c.C447T												46.0	45.0	46.0					16																	3406387		2197	4300	6497	SO:0001819	synonymous_variant	4993	exon1			TGCCTGCCTGGGT	AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.447C>T	16.37:g.3406387C>T			Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_012368	0		0	A0AVA4|Q6IF34|Q6IF55	Silent	SNP	ENST00000304936.2	37	CCDS10502.1																																																																																					0.617	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206993.3			
CES1	1066	mdanderson.org	37	16	55853459	55853459	+	Silent	SNP	C	C	T	rs114275306	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr16:55853459C>T	ENST00000361503.4	-	7	1021	c.891G>A	c.(889-891)acG>acA	p.T297T	CES1_ENST00000566555.1_5'Flank|CES1_ENST00000360526.3_Silent_p.T298T|CES1_ENST00000422046.2_Silent_p.T297T			P23141	EST1_HUMAN	carboxylesterase 1	297					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	TTTTCAATGTCGTCTCCAAGA	0.512																																					p.T298T	NSCLC(162;1801 2756 42904 52896)												CES1_ENST00000360526,colon,carcinoma,-1,1	CES1_ENST00000360526	-1	1	0			c.G894A							C	,,	0,4396		0,0,2198	123.0	125.0	124.0		891,894,891	-7.6	0.0	16	dbSNP_132	124	2,8598		0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	CES1	NM_001025194.1,NM_001025195.1,NM_001266.4	,,	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	,,	297/568,298/569,297/567	55853459	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	1066	exon7			CAATGTCGTCTCC	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.891G>A	16.37:g.55853459C>T			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001025195	9	0.00	0	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Silent	SNP	ENST00000361503.4	37	CCDS45488.1																																																																																			0.001		0.512	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000433285.1		NM_001266	
NPIPB15	440348	broad.mit.edu	37	16	74425946	74425946	+	Nonsense_Mutation	SNP	C	C	T	rs369331764		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr16:74425946C>T	ENST00000429990.1	+	7	1396	c.1300C>T	c.(1300-1302)Caa>Taa	p.Q434*				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	434						extracellular region (GO:0005576)		p.Q373*(1)|p.Q434*(1)									aatcaaaaaacaaaaCAAAAC	0.338																																					.													NPIPL2_ENST00000429990,NS,carcinoma,0,2	.		2	2	Substitution - Nonsense(2)	endometrium(2)	.												1.0	2.0	1.0					16																	74425946		800	1861	2661	SO:0001587	stop_gained	440348	.			AAAAAACAAAACA	BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1300C>T	16.37:g.74425946C>T	ENSP00000411140:p.Gln434*		Somatic	39	0.0256410256	1		WXS	Illumina HiSeq	Phase_I	43	0.14	6	.	1	0.00	0	C9J9U8	Nonsense_Mutation	SNP	ENST00000429990.1	37		.	.	.	.	.	.	.	.	.	.	-	9.643	1.139392	0.21205	.	.	ENSG00000196436	ENST00000504746;ENST00000429990	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.25876	N	0.983642	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	2.8176	0.05461	0.4997:0.4997:3.0E-4:3.0E-4	.	.	.	.	X	298;434	.	ENSP00000411140:Q434X	Q	+	1	0	NPIPL2	72983447	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.000000	0.14550	0.000000	0.15137	CAA			0.338	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000346597.2		NM_001018059	
NPIPB15	440348	broad.mit.edu;mdanderson.org	37	16	74425961	74425961	+	Missense_Mutation	SNP	G	G	A	rs374113246		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr16:74425961G>A	ENST00000429990.1	+	7	1411	c.1315G>A	c.(1315-1317)Gct>Act	p.A439T				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	439						extracellular region (GO:0005576)											CAAAACCCACGCTCCAAAAAC	0.318																																					.													.	.			0			.												1.0	1.0	1.0					16																	74425961		453	1185	1638	SO:0001583	missense	440348	.			ACCCACGCTCCAA	BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1315G>A	16.37:g.74425961G>A	ENSP00000411140:p.Ala439Thr		Somatic	32	0.0625	2		WXS	Illumina HiSeq	Phase_I	32	0.13	4	.	0		0	C9J9U8	Missense_Mutation	SNP	ENST00000429990.1	37		.	.	.	.	.	.	.	.	.	.	-	0.014	-1.587738	0.00872	.	.	ENSG00000196436	ENST00000504746;ENST00000429990	T	0.47869	0.83	.	.	.	.	.	.	.	.	T	0.22399	0.0540	N	0.08118	0	0.19300	N	0.999975	B	0.17465	0.022	B	0.04013	0.001	T	0.15350	-1.0440	8	0.49607	T	0.09	.	2.8176	0.05461	3.0E-4:3.0E-4:0.4997:0.4997	.	378	A6NHN6	NPPL2_HUMAN	T	303;439	ENSP00000411140:A439T	ENSP00000411140:A439T	A	+	1	0	NPIPL2	72983462	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.000000	0.14550	0.000000	0.15137	GCT			0.318	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000346597.2		NM_001018059	
TRPV1	7442	mdanderson.org	37	17	3493259	3493259	+	Missense_Mutation	SNP	C	C	T	rs201089655		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr17:3493259C>T	ENST00000571088.1	-	6	1099	c.886G>A	c.(886-888)Gcc>Acc	p.A296T	TRPV1_ENST00000174621.6_Missense_Mutation_p.A294T|TRPV1_ENST00000399759.3_Missense_Mutation_p.A296T|SHPK_ENST00000572705.1_Missense_Mutation_p.A296T|TRPV1_ENST00000310522.5_Missense_Mutation_p.A296T|TRPV1_ENST00000399756.4_Missense_Mutation_p.A296T|TRPV1_ENST00000576351.1_Missense_Mutation_p.A296T|TRPV1_ENST00000425167.2_Missense_Mutation_p.A296T	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	296					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	gtgttgtcggccACCTCCACC	0.612																																					p.A296T	Melanoma(38;962 1762 15789)												.	.			0			c.G886A												34.0	40.0	38.0					17																	3493259		2148	4241	6389	SO:0001583	missense	7442	exon5			TGTCGGCCACCTC	AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.886G>A	17.37:g.3493259C>T	ENSP00000461007:p.Ala296Thr		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_080706	3	0.00	0	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Missense_Mutation	SNP	ENST00000571088.1	37	CCDS45576.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556534	0.86231	.	.	ENSG00000196689	ENST00000399759;ENST00000399756;ENST00000174621;ENST00000425167;ENST00000310522	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	4.88	4.88	0.63580	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.85843	0.5791	M	0.86178	2.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.91635	0.985;0.979;0.958;0.999	D	0.88379	0.3000	10	0.87932	D	0	-30.5474	17.4129	0.87492	0.0:1.0:0.0:0.0	.	296;294;296;296	Q8NER1;E7EQ80;E7ESJ2;E7EQ78	TRPV1_HUMAN;.;.;.	T	296;296;294;296;296	ENSP00000382661:A296T;ENSP00000382659:A296T;ENSP00000174621:A294T;ENSP00000409627:A296T;ENSP00000311692:A296T	ENSP00000174621:A294T	A	-	1	0	TRPV1	3440008	1.000000	0.71417	0.997000	0.53966	0.518000	0.34316	5.542000	0.67218	2.439000	0.82584	0.467000	0.42956	GCC			0.612	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438254.1		NM_018727	
SLC6A4	6532	broad.mit.edu	37	17	28548797	28548797	+	Silent	SNP	C	C	T	rs202193339		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr17:28548797C>T	ENST00000401766.2	-	2	692	c.180G>A	c.(178-180)cgG>cgA	p.R60R	SLC6A4_ENST00000261707.3_Silent_p.R60R			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	60					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	GGATAGAGTGCCGTGTGTCAT	0.557																																					p.R60R													.	SLC6A4	60		0			c.G180A												238.0	206.0	217.0					17																	28548797		2203	4300	6503	SO:0001819	synonymous_variant	6532	exon3			AGAGTGCCGTGTG	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.180G>A	17.37:g.28548797C>T			Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	203	0.03	6	NM_001045	0		0	Q5EE02	Silent	SNP	ENST00000401766.2	37	CCDS11256.1																																																																																					0.557	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256115.3		NM_001045	
LRRC37B	114659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	30374805	30374805	+	Silent	SNP	A	A	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr17:30374805A>G	ENST00000341671.7	+	9	2273	c.2268A>G	c.(2266-2268)ccA>ccG	p.P756P	LRRC37B_ENST00000394713.3_Silent_p.P705P|LRRC37B_ENST00000543378.2_Silent_p.P674P|LRRC37B_ENST00000327564.7_Silent_p.P783P|LRRC37B_ENST00000584368.1_Silent_p.P717P	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	756						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				TAGGGAATCCAGAAGGAGCGT	0.458																																					p.P756P													.	.			0			c.A2268G												100.0	105.0	103.0					17																	30374805		2203	4300	6503	SO:0001819	synonymous_variant	114659	exon9			GAATCCAGAAGGA	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2268A>G	17.37:g.30374805A>G			Somatic	66	0	0		WXS	Illumina HiSeq	.	82	0.12	10	NM_052888	15	0.20	3	Q17RC9|Q5YKG6	Silent	SNP	ENST00000341671.7	37	CCDS32609.1																																																																																					0.458	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446508.1		NM_052888	
C17orf64	124773	mdanderson.org	37	17	58506854	58506854	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr17:58506854G>T	ENST00000269127.4	+	5	645	c.561G>T	c.(559-561)atG>atT	p.M187I		NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64	187										breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			TGTCCAACATGCAGACCCCAG	0.607																																					p.M187I													.	.			0			c.G561T												52.0	50.0	51.0					17																	58506854		2203	4300	6503	SO:0001583	missense	124773	exon5			CAACATGCAGACC	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171	ENST00000269127.4:c.561G>T	17.37:g.58506854G>T	ENSP00000269127:p.Met187Ile		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	59	0.07	4	NM_181707	2	0.00	0	Q8IY87	Missense_Mutation	SNP	ENST00000269127.4	37	CCDS32698.2	.	.	.	.	.	.	.	.	.	.	G	9.630	1.136265	0.21123	.	.	ENSG00000141371	ENST00000269127	.	.	.	4.89	2.87	0.33458	.	0.178640	0.39759	N	0.001264	T	0.39489	0.1080	M	0.65975	2.015	0.28192	N	0.927729	B	0.26318	0.146	B	0.21360	0.034	T	0.26710	-1.0095	9	0.24483	T	0.36	-10.3931	6.7156	0.23302	0.0975:0.1793:0.7231:0.0	.	187	Q86WR6	CQ064_HUMAN	I	187	.	ENSP00000269127:M187I	M	+	3	0	C17orf64	55861636	1.000000	0.71417	0.970000	0.41538	0.216000	0.24613	2.971000	0.49248	0.465000	0.27167	0.561000	0.74099	ATG			0.607	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000347743.1		NM_181707	
ZBTB7C	201501	hgsc.bcm.edu	37	18	45567151	45567151	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr18:45567151C>T	ENST00000588982.1	-	3	829	c.328G>A	c.(328-330)Gca>Aca	p.A110T	ZBTB7C_ENST00000535628.2_Missense_Mutation_p.A110T|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.A110T|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.A110T|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.A110T			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	110							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						ATCCTGGCTGCGTTGAGGATG	0.597																																					p.A110T													ZBTB7C,NS,carcinoma,0,1	ZBTB7C	0	1	0			c.G328A												120.0	91.0	101.0					18																	45567151		2203	4300	6503	SO:0001583	missense	201501	exon2			TGGCTGCGTTGAG	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.328G>A	18.37:g.45567151C>T	ENSP00000468782:p.Ala110Thr		Somatic	87	0	0		WXS	Illumina HiSeq	.	74	0.04	3	NM_001039360	1	0.00	0	O73453	Missense_Mutation	SNP	ENST00000588982.1	37	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150622	0.78001	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.73789	-0.78;-0.78	5.34	5.34	0.76211	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.84866	0.5567	M	0.65320	2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.83799	0.0235	10	0.40728	T	0.16	.	19.0131	0.92882	0.0:1.0:0.0:0.0	.	110;110;110	B4DKU0;B2RG49;A1YPR0	.;.;ZBT7C_HUMAN	T	110	ENSP00000439781:A110T;ENSP00000328732:A110T	ENSP00000328732:A110T	A	-	1	0	ZBTB7C	43821149	1.000000	0.71417	0.941000	0.38009	0.536000	0.34869	7.818000	0.86416	2.491000	0.84063	0.561000	0.74099	GCA			0.597	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450731.1		NM_001039360	
TPM4	7171	mdanderson.org	37	19	16198892	16198892	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr19:16198892C>T	ENST00000300933.4	+	4	700	c.440C>T	c.(439-441)gCg>gTg	p.A147V	TPM4_ENST00000344824.6_Missense_Mutation_p.A183V|TPM4_ENST00000538887.1_Missense_Mutation_p.A183V	NM_003290.2	NP_003281.1	P67936	TPM4_HUMAN	tropomyosin 4	147					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|osteoblast differentiation (GO:0001649)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|membrane (GO:0016020)|muscle thin filament tropomyosin (GO:0005862)|podosome (GO:0002102)|stress fiber (GO:0001725)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.A183V(1)	TPM4/ALK(12)	breast(1)|large_intestine(3)	4						GAGGAGCGTGCGGAGGTGTCT	0.622			T	ALK	ALCL						OREG0025329	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A183V				Dom	yes		19	19p13.1	7171	tropomyosin 4		L	TPM4_ENST00000344824,colon,carcinoma,0,1	TPM4_ENST00000344824	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C548T												92.0	66.0	75.0					19																	16198892		2203	4300	6503	SO:0001583	missense	7171	exon5			AGCGTGCGGAGGT		CCDS12338.1, CCDS46007.1	19p13.1	2013-03-11			ENSG00000167460	ENSG00000167460		"""Tropomyosins"""	12013	protein-coding gene	gene with protein product		600317				8641132	Standard	NM_003290		Approved		uc002ndi.2	P67936	OTTHUMG00000182134	ENST00000300933.4:c.440C>T	19.37:g.16198892C>T	ENSP00000300933:p.Ala147Val		Somatic	56	0	0	708	WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_001145160	461	0.00	0	P07226|Q15659|Q5U0D9|Q9BU85|Q9H8Q3|Q9UCS1|Q9UCS2|Q9UCS3|Q9UCS4	Missense_Mutation	SNP	ENST00000300933.4	37	CCDS12338.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284861	0.80803	.	.	ENSG00000167460	ENST00000344824;ENST00000538887;ENST00000300933	T;T;T	0.78003	-1.14;-1.14;-1.14	4.76	4.76	0.60689	.	0.000000	0.53938	U	0.000056	D	0.84719	0.5534	M	0.78285	2.405	0.80722	D	1	B;B	0.33044	0.395;0.322	B;P	0.46172	0.13;0.506	D	0.85985	0.1485	10	0.59425	D	0.04	.	17.139	0.86748	0.0:1.0:0.0:0.0	.	147;183	P67936;P67936-2	TPM4_HUMAN;.	V	183;183;147	ENSP00000345230:A183V;ENSP00000439135:A183V;ENSP00000300933:A147V	ENSP00000300933:A147V	A	+	2	0	TPM4	16059892	1.000000	0.71417	0.848000	0.33437	0.904000	0.53231	7.677000	0.84024	2.345000	0.79718	0.643000	0.83706	GCG			0.622	TPM4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000459673.2		NM_003290	
CTC-260E6.6	0	broad.mit.edu	37	19	20242238	20242238	+	RNA	DEL	A	A	-			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr19:20242238delA	ENST00000590606.1	-	0	315				CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA																							AATTAAaaacaaaaaaataaa	0.373																																					.													.	.			0			.																																											0	.			AAAAACAAAAAAA																													19.37:g.20242238delA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	2	0.00	0		RNA	DEL	ENST00000590606.1	37																																																																																						0.373	CTC-260E6.6-005	KNOWN	basic	antisense	antisense		OTTHUMT00000452859.1			
DYRK1B	9149	mdanderson.org	37	19	40316581	40316581	+	Missense_Mutation	SNP	G	G	T	rs558804930		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr19:40316581G>T	ENST00000593685.1	-	11	2132	c.1664C>A	c.(1663-1665)cCa>cAa	p.P555Q	DYRK1B_ENST00000348817.3_Missense_Mutation_p.P527Q|DYRK1B_ENST00000597639.1_Missense_Mutation_p.P527Q|DYRK1B_ENST00000323039.5_Missense_Mutation_p.P555Q|DYRK1B_ENST00000430012.2_Missense_Mutation_p.P515Q			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	555					adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			TGGTGAGGTTGGTGATGGGGG	0.692																																					p.P555Q													.	.			0			c.C1664A												25.0	31.0	29.0					19																	40316581		2158	4251	6409	SO:0001583	missense	9149	exon11			GAGGTTGGTGATG	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1664C>A	19.37:g.40316581G>T	ENSP00000469863:p.Pro555Gln		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_004714	25	0.00	0	O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	37	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.330990	0.60853	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.57107	0.42;0.51;0.46	5.15	4.12	0.48240	.	0.457912	0.22753	N	0.056045	T	0.33118	0.0852	N	0.14661	0.345	0.39031	D	0.959947	P;B;P	0.36837	0.571;0.232;0.571	B;B;B	0.35688	0.208;0.103;0.208	T	0.14980	-1.0453	10	0.23302	T	0.38	.	11.2072	0.48775	0.09:0.0:0.91:0.0	.	515;555;527	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	Q	555;527;515	ENSP00000312789:P555Q;ENSP00000221803:P527Q;ENSP00000403182:P515Q	ENSP00000312789:P555Q	P	-	2	0	DYRK1B	45008421	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	4.250000	0.58772	1.156000	0.42514	0.462000	0.41574	CCA			0.692	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462874.2		NM_004714	
SCAF1	58506	mdanderson.org	37	19	50156724	50156724	+	Silent	SNP	G	G	A	rs570691668		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr19:50156724G>A	ENST00000360565.3	+	7	3202	c.3078G>A	c.(3076-3078)gaG>gaA	p.E1026E		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1026	Glu-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		aggaggaggaggaagaagaag	0.657																																					p.E1026E													.	.			0			c.G3078A												7.0	9.0	8.0					19																	50156724		2175	4258	6433	SO:0001819	synonymous_variant	58506	exon7			GGAGGAGGAAGAA	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3078G>A	19.37:g.50156724G>A			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_021228	26	0.00	0	Q7Z5V7|Q8WVA1|Q9NR59	Silent	SNP	ENST00000360565.3	37	CCDS33074.1																																																																																					0.657	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465764.1		NM_021228	
ZNF83	55769	bcgsc.ca	37	19	53116855	53116856	+	Missense_Mutation	DNP	CT	CT	TA	rs199873537|rs7247359		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr19:53116855_53116856CT>TA	ENST00000597597.1	-	2	3215_3216	c.962_963AG>TA	c.(961-963)gAG>gTA	p.E321V	ZNF83_ENST00000391789.4_Missense_Mutation_p.E293V|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000545872.1_Missense_Mutation_p.E321V|ZNF83_ENST00000544146.1_Missense_Mutation_p.E321V|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000301096.3_Missense_Mutation_p.E321V|ZNF83_ENST00000541777.2_Missense_Mutation_p.E321V|ZNF83_ENST00000536937.1_Missense_Mutation_p.E321V			P51522	ZNF83_HUMAN	zinc finger protein 83	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CCTTGCCACACTCATTACATTT	0.411																																					p.E321V													.	ZNF83	73		0			c.A962T																																									SO:0001583	missense	55769	exon3			GCCACACTCATTA	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.962_963delinsTA	19.37:g.53116855_53116856delinsTA	ENSP00000472619:p.Glu321Val		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_1	99	0.06	6	NM_018300	14	0.00	0	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	DNP	ENST00000597597.1	37	CCDS12854.1																																																																																					0.411	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463700.1		NM_018300	
ZNF83	55769	bcgsc.ca	37	19	53116865	53116865	+	Missense_Mutation	SNP	T	T	C	rs141749555		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr19:53116865T>C	ENST00000597597.1	-	2	3206	c.953A>G	c.(952-954)aAa>aGa	p.K318R	ZNF83_ENST00000391789.4_Missense_Mutation_p.K290R|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000545872.1_Missense_Mutation_p.K318R|ZNF83_ENST00000544146.1_Missense_Mutation_p.K318R|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000301096.3_Missense_Mutation_p.K318R|ZNF83_ENST00000541777.2_Missense_Mutation_p.K318R|ZNF83_ENST00000536937.1_Missense_Mutation_p.K318R			P51522	ZNF83_HUMAN	zinc finger protein 83	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTCATTACATTTGTAAGGTTT	0.413																																					p.K318R													.	ZNF83	73		0			c.A953G												98.0	104.0	102.0					19																	53116865		2203	4300	6503	SO:0001583	missense	55769	exon3			TTACATTTGTAAG	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.953A>G	19.37:g.53116865T>C	ENSP00000472619:p.Lys318Arg		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_1	95	0.06	6	NM_018300	11	0.00	0	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	37	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	N	8.722	0.914503	0.17907	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11	2.16	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22551	0.0544	N	0.16201	0.385	0.09310	N	1	B;D	0.69078	0.017;0.997	B;D	0.81914	0.01;0.995	T	0.10706	-1.0618	9	0.54805	T	0.06	.	3.4318	0.07432	0.0:0.144:0.2323:0.6237	.	290;318	P51522-2;P51522	.;ZNF83_HUMAN	R	318;318;318;290;318;318;290	ENSP00000445993:K318R;ENSP00000301096:K318R;ENSP00000445470:K318R;ENSP00000440713:K318R;ENSP00000439681:K318R;ENSP00000375666:K290R	ENSP00000301096:K318R	K	-	2	0	ZNF83	57808677	0.000000	0.05858	0.706000	0.30403	0.082000	0.17680	-0.250000	0.08830	0.101000	0.17610	-0.540000	0.04249	AAA			0.413	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463700.1		NM_018300	
LINC01119	100134259	bcgsc.ca	37	2	47083032	47083032	+	Intron	SNP	G	G	A	rs201553289|rs112990716|rs4953430|rs28711956|rs79545619|rs3835756		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr2:47083032G>A	ENST00000422294.1	+	2	216				AC016722.3_ENST00000453936.1_RNA|AC016722.2_ENST00000468141.1_Intron																							ctatatatatgtatatatata	0.463																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			ATATATGTATATA																												ENST00000422294.1:c.89-30G>A	2.37:g.47083032G>A			Somatic	35	0	0		WXS	Illumina HiSeq	Phase_1	33	0.30	10	.	0		0		RNA	SNP	ENST00000422294.1	37																																																																																						0.463	AC016722.2-004	PUTATIVE	mRNA_end_NF|cds_end_NF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000329426.1			
OBSL1	23363	mdanderson.org	37	2	220430187	220430187	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr2:220430187G>T	ENST00000404537.1	-	6	2240	c.2184C>A	c.(2182-2184)ttC>ttA	p.F728L	OBSL1_ENST00000265318.4_Missense_Mutation_p.F728L|OBSL1_ENST00000603926.1_Missense_Mutation_p.F728L|OBSL1_ENST00000373873.4_Missense_Mutation_p.F728L|OBSL1_ENST00000373876.1_Missense_Mutation_p.F728L|OBSL1_ENST00000289656.3_Missense_Mutation_p.F315L	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	728	Ig-like 5.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CTGAGGTTGTGAAGGTCAACG	0.607											OREG0003987	type=REGULATORY REGION|Gene=BC061909|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.F728L													.	.			0			c.C2184A												98.0	98.0	98.0					2																	220430187		2063	4205	6268	SO:0001583	missense	23363	exon6			GGTTGTGAAGGTC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2184C>A	2.37:g.220430187G>T	ENSP00000385636:p.Phe728Leu		Somatic	35	0	0	2266	WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001173431	108	0.00	0	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	G	8.839	0.941868	0.18281	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	5.95	4.15	0.48705	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49745	0.1575	L	0.45228	1.405	0.09310	N	1	B;B;P;B	0.43542	0.123;0.123;0.81;0.015	B;B;B;B	0.37015	0.142;0.142;0.239;0.026	T	0.31613	-0.9937	9	0.23891	T	0.37	.	10.3171	0.43743	0.2384:0.0:0.7616:0.0	.	729;728;315;728	A4KVA4;O75147;A8MSZ8;O75147-2	.;OBSL1_HUMAN;.;.	L	728;728;728;728;315	ENSP00000265318:F728L;ENSP00000385636:F728L;ENSP00000362983:F728L;ENSP00000362980:F728L;ENSP00000289656:F315L	ENSP00000265318:F728L	F	-	3	2	OBSL1	220138431	0.087000	0.21565	1.000000	0.80357	0.156000	0.22039	1.112000	0.31172	1.530000	0.49136	0.655000	0.94253	TTC			0.607	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322012.1			
GPC1	2817	mdanderson.org	37	2	241401916	241401916	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr2:241401916C>T	ENST00000264039.2	+	3	882	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W		NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1	212					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		GCTGCGCCTGCGGGCCACCCG	0.711																																					p.R212W													.	.			0			c.C634T												10.0	12.0	11.0					2																	241401916		2165	4256	6421	SO:0001583	missense	2817	exon3			CGCCTGCGGGCCA	AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.634C>T	2.37:g.241401916C>T	ENSP00000264039:p.Arg212Trp		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_002081	31	0.00	0	B3KTD1|Q53QM4	Missense_Mutation	SNP	ENST00000264039.2	37	CCDS2534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.86|16.86	3.239686|3.239686	0.58995|0.58995	.|.	.|.	ENSG00000063660|ENSG00000063660	ENST00000420138|ENST00000264039	.|T	.|0.53640	.|0.61	3.11|3.11	2.19|2.19	0.27852|0.27852	.|.	.|0.538029	.|0.17656	.|N	.|0.166494	T|T	0.62270|0.62270	0.2414|0.2414	M|M	0.70595|0.70595	2.14|2.14	0.32039|0.32039	N|N	0.598427|0.598427	.|D	.|0.89917	.|1.0	.|D	.|0.74348	.|0.983	T|T	0.66575|0.66575	-0.5889|-0.5889	5|10	.|0.87932	.|D	.|0	-9.2824|-9.2824	7.7881|7.7881	0.29103|0.29103	0.451:0.549:0.0:0.0|0.451:0.549:0.0:0.0	.|.	.|212	.|P35052	.|GPC1_HUMAN	V|W	251|212	.|ENSP00000264039:R212W	.|ENSP00000264039:R212W	A|R	+|+	2|1	0|2	GPC1|GPC1	241050589|241050589	0.177000|0.177000	0.23109|0.23109	0.998000|0.998000	0.56505|0.56505	0.951000|0.951000	0.60555|0.60555	0.216000|0.216000	0.17585|0.17585	0.615000|0.615000	0.30124|0.30124	0.591000|0.591000	0.81541|0.81541	GCG|CGG			0.711	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257179.3		NM_002081	
UBASH3A	53347	mdanderson.org	37	21	43867289	43867289	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr21:43867289G>T	ENST00000319294.6	+	15	2002	c.1971G>T	c.(1969-1971)tgG>tgT	p.W657C	UBASH3A_ENST00000291535.6_Missense_Mutation_p.W619C|UBASH3A_ENST00000398367.1_3'UTR	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	657	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						GGAGGAACTGGATCTCAGGCA	0.527																																					p.W657C													UBASH3A,bladder,carcinoma,0,1	UBASH3A	0	1	0			c.G1971T												118.0	121.0	120.0					21																	43867289		2203	4300	6503	SO:0001583	missense	53347	exon15			GAACTGGATCTCA	AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1971G>T	21.37:g.43867289G>T	ENSP00000317327:p.Trp657Cys		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_018961	18	0.00	0	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Missense_Mutation	SNP	ENST00000319294.6	37	CCDS13687.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429089	0.25726	.	.	ENSG00000160185	ENST00000291535;ENST00000319294	T;T	0.08008	3.14;3.14	4.98	4.09	0.47781	.	0.239499	0.30302	N	0.009929	T	0.08133	0.0203	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.53313	0.723;0.666	T	0.41822	-0.9487	10	0.39692	T	0.17	-11.7509	11.8935	0.52644	0.0:0.3389:0.661:0.0	.	619;657	P57075-2;P57075	.;UBS3A_HUMAN	C	619;657	ENSP00000291535:W619C;ENSP00000317327:W657C	ENSP00000291535:W619C	W	+	3	0	UBASH3A	42740358	0.998000	0.40836	0.943000	0.38184	0.004000	0.04260	1.464000	0.35288	1.065000	0.40693	-0.302000	0.09304	TGG			0.527	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000195382.1		NM_001001895	
DGCR8	54487	mdanderson.org	37	22	20073919	20073919	+	Missense_Mutation	SNP	C	C	T	rs118025402	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr22:20073919C>T	ENST00000351989.3	+	2	862	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	MIR1306_ENST00000408439.1_RNA|DGCR8_ENST00000407755.1_Missense_Mutation_p.R145W|MIR3618_ENST00000580330.1_RNA|DGCR8_ENST00000383024.2_Missense_Mutation_p.R145W	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	145	Necessary for interaction with NCL.|Necessary for nuclear localization and retention.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GCGCGACGTGCGGGCGGAGTG	0.577													C|||	3	0.000599042	0.0	0.0	5008	,	,		19838	0.003		0.0	False		,,,				2504	0.0				p.R145W													.	.			0			c.C433T							C	TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	113.0	100.0	104.0		433,433	3.2	0.2	22	dbSNP_133	104	0,8600		0,0,4300	yes	missense,missense	DGCR8	NM_001190326.1,NM_022720.6	101,101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging	145/741,145/774	20073919	2,13004	2203	4300	6503	SO:0001583	missense	54487	exon2			GACGTGCGGGCGG	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.433C>T	22.37:g.20073919C>T	ENSP00000263209:p.Arg145Trp		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001190326	21	0.00	0	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	ENST00000351989.3	37	CCDS13773.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	14.60	2.584463	0.46110	4.54E-4	0.0	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.32515	1.45;1.45;1.45	5.42	3.23	0.37069	.	0.449369	0.26546	N	0.023777	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	B;D	0.53885	0.005;0.963	B;B	0.43623	0.001;0.425	T	0.10314	-1.0635	10	0.72032	D	0.01	-10.8666	1.8807	0.03227	0.2078:0.494:0.1287:0.1696	.	145;145	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	W	145	ENSP00000263209:R145W;ENSP00000372488:R145W;ENSP00000384726:R145W	ENSP00000263209:R145W	R	+	1	2	DGCR8	18453919	1.000000	0.71417	0.218000	0.23776	0.852000	0.48524	2.438000	0.44837	1.527000	0.49086	0.491000	0.48974	CGG	0		0.577	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318654.1			
KDELR3	11015	broad.mit.edu;mdanderson.org	37	22	38881967	38881967	+	IGR	SNP	A	A	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr22:38881967A>G	ENST00000216014.4	+	0	1728				DDX17_ENST00000444597.1_Silent_p.P173P|DDX17_ENST00000381633.3_Silent_p.P644P|DDX17_ENST00000396821.3_Silent_p.P723P	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					gaggagggggaggaggaggag	0.478																																					p.P723P	Ovarian(11;103 529 24120 28493 32980)												.	DDX17	73		0			c.T2169C												129.0	119.0	122.0					22																	38881967		2203	4300	6503	SO:0001628	intergenic_variant	10521	exon13			AGGGGGAGGAGGA	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520		22.37:g.38881967A>G			Somatic	62	0.0161290323	1		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001098504	103	0.00	0	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Silent	SNP	ENST00000216014.4	37	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	A	0.782	-0.761790	0.02996	.	.	ENSG00000100201	ENST00000404499	.	.	.	5.42	-5.18	0.02840	.	.	.	.	.	T	0.46756	0.1409	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47032	-0.9148	4	.	.	.	-8.4598	5.7554	0.18170	0.2889:0.0:0.3497:0.3614	.	.	.	.	P	714	.	.	L	-	2	0	DDX17	37211913	0.000000	0.05858	0.459000	0.27081	0.396000	0.30629	-4.121000	0.00291	-0.684000	0.05183	-1.258000	0.01471	CTC			0.478	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331474.1			
CHST2	9435	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	3	142840933	142840933	+	Nonsense_Mutation	SNP	C	C	G	rs140050898	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr3:142840933C>G	ENST00000309575.3	+	2	2659	c.1275C>G	c.(1273-1275)taC>taG	p.Y425*		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	425					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						TGGTGCGGTACGAGGACCTGG	0.582																																					p.Y425X													CHST2,NS,carcinoma,0,1	CHST2	0	1	0			c.C1275G												64.0	61.0	62.0					3																	142840933		2203	4300	6503	SO:0001587	stop_gained	9435	exon2			GCGGTACGAGGAC	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1275C>G	3.37:g.142840933C>G	ENSP00000307911:p.Tyr425*		Somatic	72	0	0		WXS	Illumina HiSeq	.	89	0.04	4	NM_004267	166	0.01	1	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Nonsense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	C	48	14.296008	0.99789	.	.	ENSG00000175040	ENST00000309575	.	.	.	4.33	3.43	0.39272	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1177	9.2714	0.37673	0.0:0.8315:0.0:0.1685	.	.	.	.	X	425	.	ENSP00000307911:Y425X	Y	+	3	2	CHST2	144323623	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.653000	0.24902	2.233000	0.73108	0.407000	0.27541	TAC			0.582	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354850.1		NM_004267	
FGFRL1	53834	broad.mit.edu	37	4	1017489	1017489	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr4:1017489A>C	ENST00000398484.2	+	5	993	c.413A>C	c.(412-414)gAc>gCc	p.D138A	FGFRL1_ENST00000504138.1_Missense_Mutation_p.D138A|FGFRL1_ENST00000510644.1_Missense_Mutation_p.D138A|FGFRL1_ENST00000264748.6_Missense_Mutation_p.D138A			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	138					diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAAGAGGACCCCGCCAGC	0.697																																					p.D138A													.	FGFRL1	77		0			c.A413C												6.0	8.0	7.0					4																	1017489		2156	4227	6383	SO:0001583	missense	53834	exon4			AAGAGGACCCCGC		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.413A>C	4.37:g.1017489A>C	ENSP00000381498:p.Asp138Ala		Somatic	58	0.2068965517	12		WXS	Illumina HiSeq	Phase_I	72	0.28	20	NM_001004356	13	0.00	0	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	37	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	a	7.133	0.580375	0.13686	.	.	ENSG00000127418	ENST00000398484;ENST00000542622;ENST00000510644;ENST00000504138;ENST00000507339;ENST00000264748	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;0.08;-0.66	4.39	4.39	0.52855	.	0.765487	0.12236	N	0.487022	T	0.57330	0.2046	N	0.24115	0.695	0.44149	D	0.996949	B	0.16396	0.017	B	0.12156	0.007	T	0.49072	-0.8977	10	0.26408	T	0.33	-24.6479	12.834	0.57763	1.0:0.0:0.0:0.0	.	138	Q8N441	FGRL1_HUMAN	A	138;108;138;138;138;138	ENSP00000381498:D138A;ENSP00000425025:D138A;ENSP00000423091:D138A;ENSP00000424037:D138A;ENSP00000264748:D138A	ENSP00000264748:D138A	D	+	2	0	FGFRL1	1007489	0.247000	0.23920	0.998000	0.56505	0.806000	0.45545	0.568000	0.23623	1.620000	0.50308	0.358000	0.22013	GAC			0.697	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239195.2		NM_021923	
PTK7	5754	mdanderson.org	37	6	43126631	43126631	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr6:43126631C>T	ENST00000230419.4	+	18	3019	c.2798C>T	c.(2797-2799)gCg>gTg	p.A933V	PTK7_ENST00000481273.1_Missense_Mutation_p.A941V|PTK7_ENST00000349241.2_Missense_Mutation_p.A803V|PTK7_ENST00000345201.2_Missense_Mutation_p.A893V|PTK7_ENST00000352931.2_Missense_Mutation_p.A877V	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	933	Interaction with CTNNB1.|Protein kinase; inactive. {ECO:0000255|PROSITE-ProRule:PRU00159}.		A -> V (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A933V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GACTTGGCTGCGCGTAACTGC	0.587																																					p.A941V													PTK7,colon,carcinoma,0,4	PTK7	0	4	1	Substitution - Missense(1)	large_intestine(1)	c.C2822T												81.0	69.0	73.0					6																	43126631		2203	4300	6503	SO:0001583	missense	5754	exon18			TGGCTGCGCGTAA	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2798C>T	6.37:g.43126631C>T	ENSP00000230419:p.Ala933Val		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001270398	150	0.01	1	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	ENST00000230419.4	37	CCDS4884.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.571123|5.571123	0.96553|0.96553	.|.	.|.	ENSG00000112655|ENSG00000112655	ENST00000230419;ENST00000325774;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273;ENST00000473339|ENST00000489707	D;D;D;D;D;D|.	0.90069|.	-2.61;-2.61;-2.61;-2.61;-2.61;-2.61|.	5.93|5.93	5.93|5.93	0.95920|0.95920	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);|.	0.056753|.	0.64402|.	D|.	0.000001|.	D|D	0.85141|0.85141	0.5629|0.5629	M|M	0.91663|0.91663	3.23|3.23	0.80722|0.80722	D|D	1|1	D;P;D;D;D;D|.	0.71674|.	0.998;0.758;0.989;0.994;0.971;0.997|.	D;B;P;P;P;D|.	0.65874|.	0.939;0.153;0.896;0.799;0.758;0.922|.	D|D	0.86955|0.86955	0.2088|0.2088	10|5	0.87932|.	D|.	0|.	.|.	20.3465|20.3465	0.98790|0.98790	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	941;259;803;893;877;933|.	E9PFZ5;F8W9X8;Q13308-3;Q13308-2;Q13308-4;Q13308|.	.;.;.;.;.;PTK7_HUMAN|.	V|C	933;259;803;877;893;941;201|228	ENSP00000230419:A933V;ENSP00000325462:A803V;ENSP00000326029:A877V;ENSP00000325992:A893V;ENSP00000418754:A941V;ENSP00000420186:A201V|.	ENSP00000230419:A933V|.	A|R	+|+	2|1	0|0	PTK7|PTK7	43234609|43234609	1.000000|1.000000	0.71417|0.71417	0.069000|0.069000	0.20011|0.20011	0.884000|0.884000	0.51177|0.51177	7.775000|7.775000	0.85489|0.85489	2.798000|2.798000	0.96311|0.96311	0.655000|0.655000	0.94253|0.94253	GCG|CGC			0.587	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040580.2			
RP11-154D6.1	0	broad.mit.edu	37	6	71962414	71962416	+	RNA	DEL	CAA	CAA	-	rs566919324	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	CAA	CAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr6:71962414_71962416delCAA	ENST00000591156.1	-	0	1596				RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000602418.1_RNA																							aaggaaaaggcaaaaaaaaaaaa	0.291																																					.													.	.			0			.																																											0	.			AAAAGGCAAAAAA																													6.37:g.71962414_71962416delCAA			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0		RNA	DEL	ENST00000591156.1	37																																																																																						0.291	RP11-154D6.1-012	KNOWN	basic	antisense	antisense		OTTHUMT00000458947.1			
ECT2L	345930	mdanderson.org	37	6	139210141	139210141	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr6:139210141G>T	ENST00000423192.1	+	19	2548	c.2387G>T	c.(2386-2388)tGt>tTt	p.C796F	ECT2L_ENST00000541398.1_Missense_Mutation_p.C650F|ECT2L_ENST00000367682.2_Missense_Mutation_p.C796F			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	796							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						CTTCATTGCTGTGATGAAGAA	0.348			"""N, Splice, Mis"""		ETP ALL																																p.C796F				Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	.			0			c.G2387T												98.0	98.0	98.0					6																	139210141		1857	4111	5968	SO:0001583	missense	345930	exon19			ATTGCTGTGATGA		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.2387G>T	6.37:g.139210141G>T	ENSP00000387388:p.Cys796Phe		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001195037	0		0	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	G	9.187	1.025165	0.19433	.	.	ENSG00000203734	ENST00000423192;ENST00000367682;ENST00000541398	T;T;T	0.77229	-1.08;-1.08;-1.08	4.86	0.862	0.19056	.	0.125508	0.30771	U	0.008907	T	0.45377	0.1339	M	0.68317	2.08	0.25330	N	0.989041	B;B	0.33171	0.4;0.278	B;B	0.30401	0.115;0.033	T	0.43163	-0.9408	10	0.10902	T	0.67	1.0514	4.5112	0.11912	0.0831:0.2982:0.4786:0.1401	.	650;796	F5H7S9;Q008S8	.;ECT2L_HUMAN	F	796;796;650	ENSP00000387388:C796F;ENSP00000356655:C796F;ENSP00000442307:C650F	ENSP00000356655:C796F	C	+	2	0	ECT2L	139251834	0.830000	0.29337	0.992000	0.48379	0.995000	0.86356	0.026000	0.13599	-0.059000	0.13154	0.561000	0.74099	TGT			0.348	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042441.3		NM_001077706	
RAET1E	135250	bcgsc.ca	37	6	150202646	150202646	+	IGR	SNP	C	C	T	rs386706961|rs201497507|rs6908862	byFrequency	TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr6:150202646C>T	ENST00000532335.1	-	0	2099				RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000605899.1_RNA	NM_001243328.1	NP_001230257.1	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E						antigen processing and presentation (GO:0019882)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			cervix(1)|kidney(2)|large_intestine(3)|lung(3)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		ATCAAGAATCCGATTGACTGT	0.597													c|||	1213	0.242212	0.1316	0.1196	5008	,	,		17724	0.5516		0.159	False		,,,				2504	0.2454				.													.	.			0			.																																									SO:0001628	intergenic_variant	442267	.			AGAATCCGATTGA	AF359243	CCDS5221.1, CCDS59042.1, CCDS59043.1, CCDS59044.1	6q24.3	2011-02-09			ENSG00000164520	ENSG00000164520			16793	protein-coding gene	gene with protein product		609243				11827464	Standard	NM_139165		Approved	LETAL, bA350J20.7, ULBP4	uc003qnl.1	Q8TD07	OTTHUMG00000015796		6.37:g.150202646C>T			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_1	29	0.14	4	.	0		0	A6YF59|Q5VYB7|Q5VYB8|Q8TEZ2|Q96L41	RNA	SNP	ENST00000532335.1	37	CCDS59043.1																																																																																					0.597	RAET1E-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000384020.1		NM_139165	
SYNE1	23345	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	6	152589280	152589280	+	Silent	SNP	G	G	C			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr6:152589280G>C	ENST00000367255.5	-	100	19327	c.18726C>G	c.(18724-18726)gcC>gcG	p.A6242A	SYNE1_ENST00000265368.4_Silent_p.A6242A|SYNE1_ENST00000423061.1_Silent_p.A6171A|SYNE1_ENST00000356820.4_Silent_p.A766A|SYNE1_ENST00000448038.1_Silent_p.A6171A|SYNE1_ENST00000341594.5_Silent_p.A5854A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6242					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTCTGCTCGGCTAATTCCT	0.438										HNSCC(10;0.0054)																											p.A6242A													.	.			0			c.C18726G												94.0	94.0	94.0					6																	152589280		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon100			CTGCTCGGCTAAT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18726C>G	6.37:g.152589280G>C			Somatic	88	0	0		WXS	Illumina HiSeq	.	111	0.05	6	NM_182961	1	0.00	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																					0.438	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000334755.2		NM_182961	
TYW1B	441250	broad.mit.edu	37	7	72236860	72236860	+	RNA	DEL	T	T	-			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr7:72236860delT	ENST00000435769.2	-	0	1087				TYW1B_ENST00000438125.1_RNA|TYW1B_ENST00000438904.2_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										aaagaaatgattttttttttt	0.353																																					.													.	.			0			.																																											441250	.			AAATGATTTTTTT	BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72236860delT			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	36	0.25	9	.	0		0	A6NG09|B4DFY2|Q3KQX2	RNA	DEL	ENST00000435769.2	37																																																																																						0.353	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347346.2		NM_001145440	
LRWD1	222229	mdanderson.org	37	7	102108606	102108606	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr7:102108606G>A	ENST00000292616.5	+	6	928	c.776G>A	c.(775-777)aGc>aAc	p.S259N	MIR5090_ENST00000582533.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	259					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						GTGGAGGGCAGCCCTGTGGCA	0.687																																					p.S259N													.	.			0			c.G776A												43.0	45.0	44.0					7																	102108606		2194	4294	6488	SO:0001583	missense	222229	exon6			AGGGCAGCCCTGT	AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	ENST00000292616.5:c.776G>A	7.37:g.102108606G>A	ENSP00000292616:p.Ser259Asn		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_152892	57	0.00	0	A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Missense_Mutation	SNP	ENST00000292616.5	37	CCDS34715.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.951349	0.34471	.	.	ENSG00000161036	ENST00000292616	T	0.61392	0.11	4.21	2.4	0.29515	.	1.199060	0.05655	N	0.585803	T	0.50871	0.1641	L	0.54323	1.7	0.09310	N	1	B	0.27498	0.18	B	0.21546	0.035	T	0.34800	-0.9814	10	0.35671	T	0.21	-11.9846	5.9808	0.19405	0.2351:0.0:0.7649:0.0	.	259	Q9UFC0	LRWD1_HUMAN	N	259	ENSP00000292616:S259N	ENSP00000292616:S259N	S	+	2	0	LRWD1	101895611	0.001000	0.12720	0.100000	0.21137	0.315000	0.28087	0.433000	0.21477	0.433000	0.26313	0.462000	0.41574	AGC			0.687	LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349493.1		NM_152892	
NRCAM	4897	bcgsc.ca;mdanderson.org	37	7	107815786	107815786	+	Silent	SNP	A	A	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr7:107815786A>G	ENST00000425651.2	-	25	3167	c.3168T>C	c.(3166-3168)ccT>ccC	p.P1056P	NRCAM_ENST00000379022.4_Silent_p.P1056P|NRCAM_ENST00000413765.2_Intron|NRCAM_ENST00000379028.3_Silent_p.P1056P|NRCAM_ENST00000379024.4_Silent_p.P1037P|NRCAM_ENST00000351718.4_Intron	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1056					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CACCTACATCAGGTGGAAGAA	0.378																																					p.P1056P													.	NRCAM	267		0			c.T3168C												84.0	74.0	77.0					7																	107815786		1861	4084	5945	SO:0001819	synonymous_variant	4897	exon25			TACATCAGGTGGA		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3168T>C	7.37:g.107815786A>G			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_1	71	0.07	5	NM_001037132	0		0	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	37	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	A	9.208	1.030235	0.19512	.	.	ENSG00000091129	ENST00000445634	.	.	.	5.54	4.39	0.52855	.	.	.	.	.	T	0.62539	0.2436	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59408	-0.7460	4	.	.	.	.	11.215	0.48821	0.9283:0.0:0.0717:0.0	.	.	.	.	P	6	.	.	L	-	2	0	NRCAM	107603022	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.481000	0.45215	0.944000	0.37579	0.533000	0.62120	CTG			0.378	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337942.2		NM_001037132	
WASL	8976	mdanderson.org	37	7	123332847	123332847	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr7:123332847G>T	ENST00000223023.4	-	9	1233	c.901C>A	c.(901-903)Cct>Act	p.P301T		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	301	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)	p.P301A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						gcaggaggaggaggaggacct	0.602																																					p.P301T													WASL,bladder,carcinoma,0,1	WASL	0	1	1	Substitution - Missense(1)	urinary_tract(1)	c.C901A												46.0	50.0	49.0					7																	123332847		2203	4299	6502	SO:0001583	missense	8976	exon9			GAGGAGGAGGAGG	D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.901C>A	7.37:g.123332847G>T	ENSP00000223023:p.Pro301Thr		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_003941	56	0.00	0	A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	37	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.175607	0.57692	.	.	ENSG00000106299	ENST00000223023	D	0.92199	-2.99	5.39	5.39	0.77823	Wiscott-Aldrich syndrome, C-terminal (1);	0.164086	0.56097	D	0.000037	D	0.91456	0.7303	M	0.74467	2.265	0.80722	D	1	B	0.26635	0.155	B	0.25140	0.058	D	0.88685	0.3205	10	0.18276	T	0.48	-1.9531	19.209	0.93747	0.0:0.0:1.0:0.0	.	301	O00401	WASL_HUMAN	T	301	ENSP00000223023:P301T	ENSP00000223023:P301T	P	-	1	0	WASL	123120083	1.000000	0.71417	0.983000	0.44433	0.984000	0.73092	9.087000	0.94110	2.528000	0.85240	0.644000	0.83932	CCT			0.602	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348522.1		NM_003941	
TOX	9760	broad.mit.edu	37	8	59728032	59728032	+	Silent	SNP	A	A	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr8:59728032A>G	ENST00000361421.1	-	7	1477	c.1257T>C	c.(1255-1257)ccT>ccC	p.P419P	RNU4-50P_ENST00000364361.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	419	Poly-Pro.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TCTGGAGGGGAGGAGGAGGGG	0.587																																					p.P419P	Pancreas(161;610 1969 17913 21374 22725)												.	TOX	83		0			c.T1257C												104.0	100.0	101.0					8																	59728032		2203	4300	6503	SO:0001819	synonymous_variant	9760	exon7			GAGGGGAGGAGGA		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.1257T>C	8.37:g.59728032A>G			Somatic	94	0.1914893617	18		WXS	Illumina HiSeq	Phase_I	118	0.19	23	NM_014729	19	0.05	1	Q96AV5	Silent	SNP	ENST00000361421.1	37	CCDS34897.1																																																																																					0.587	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378307.1		NM_014729	
STAU2	27067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	74464275	74464275	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr8:74464275T>G	ENST00000521451.1	-	8	1218	c.842A>C	c.(841-843)gAa>gCa	p.E281A	STAU2_ENST00000519961.1_Missense_Mutation_p.E501A|STAU2_ENST00000355780.5_Missense_Mutation_p.E469A|STAU2_ENST00000522509.1_Missense_Mutation_p.E469A|STAU2_ENST00000521727.1_Missense_Mutation_p.E481A|STAU2_ENST00000517542.1_Missense_Mutation_p.E463A|STAU2_ENST00000524300.1_Missense_Mutation_p.E501A|STAU2_ENST00000523558.1_Missense_Mutation_p.E329A|STAU2_ENST00000522695.1_Missense_Mutation_p.E469A|STAU2_ENST00000521210.1_Missense_Mutation_p.E397A			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	501					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			TGCTAAATATTCCAGTTGTTT	0.363																																					p.E501A													.	.			0			c.A1502C												59.0	63.0	62.0					8																	74464275		2203	4297	6500	SO:0001583	missense	27067	exon13			AAATATTCCAGTT	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521451.1:c.842A>C	8.37:g.74464275T>G	ENSP00000428476:p.Glu281Ala		Somatic	142	0	0		WXS	Illumina HiSeq	.	136	0.14	19	NM_001164380	19	0.21	4	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	ENST00000521451.1	37		.	.	.	.	.	.	.	.	.	.	T	14.70	2.613167	0.46631	.	.	ENSG00000040341	ENST00000522695;ENST00000524300;ENST00000523558;ENST00000521210;ENST00000523533;ENST00000355780;ENST00000519961;ENST00000521727;ENST00000521451;ENST00000522509;ENST00000517542	T;T;T;D;T;T;T;T;T;T;T	0.81908	0.41;0.41;0.41;-1.55;0.41;0.41;0.41;0.41;0.41;0.41;0.41	4.6	4.6	0.57074	.	0.048930	0.85682	D	0.000000	D	0.83175	0.5197	L	0.42245	1.32	0.80722	D	1	P;P;D;P;P;P;P;B	0.56968	0.608;0.917;0.978;0.917;0.728;0.608;0.734;0.007	B;B;P;B;B;B;B;B	0.53809	0.142;0.345;0.735;0.345;0.275;0.099;0.321;0.016	T	0.81658	-0.0833	10	0.30078	T	0.28	-12.4942	14.4487	0.67370	0.0:0.0:0.0:1.0	.	481;397;329;397;469;501;469;501	E7EPX0;E9PEI3;E7ER74;B7Z8B4;F8VPI7;E7EVJ4;E9PH62;E9PF26	.;.;.;.;.;.;.;.	A	469;501;329;397;114;469;501;481;281;469;463	ENSP00000428456:E469A;ENSP00000428756:E501A;ENSP00000428741:E329A;ENSP00000429173:E397A;ENSP00000430511:E114A;ENSP00000348026:E469A;ENSP00000430907:E501A;ENSP00000429973:E481A;ENSP00000428476:E281A;ENSP00000427977:E469A;ENSP00000431111:E463A	ENSP00000344030:E329A	E	-	2	0	STAU2	74626829	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.389000	0.66255	2.054000	0.61138	0.528000	0.53228	GAA			0.363	STAU2-006	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000379006.4		NM_001164380	
RP11-149P24.1	0	broad.mit.edu	37	8	137071034	137071035	+	lincRNA	INS	-	-	C	rs529189099		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr8:137071034_137071035insC	ENST00000523150.1	+	0	159																											ccccatatgggccccccaggcc	0.574																																					.													.	.			0			.																																											0	.			ATATGGGCCCCCC																													8.37:g.137071040_137071040dupC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000523150.1	37																																																																																						0.574	RP11-149P24.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000377377.1			
PLEC	5339	mdanderson.org	37	8	144993788	144993788	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr8:144993788G>T	ENST00000322810.4	-	32	10781	c.10612C>A	c.(10612-10614)Ccc>Acc	p.P3538T	PLEC_ENST00000345136.3_Missense_Mutation_p.P3401T|PLEC_ENST00000356346.3_Missense_Mutation_p.P3387T|PLEC_ENST00000527096.1_Missense_Mutation_p.P3424T|PLEC_ENST00000436759.2_Missense_Mutation_p.P3428T|PLEC_ENST00000357649.2_Missense_Mutation_p.P3405T|PLEC_ENST00000398774.2_Missense_Mutation_p.P3369T|PLEC_ENST00000354958.2_Missense_Mutation_p.P3379T|PLEC_ENST00000354589.3_Missense_Mutation_p.P3401T	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3538	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TTCCGCACGGGGTCCACCAGG	0.692																																					p.P3538T													.	.			0			c.C10612A												11.0	14.0	13.0					8																	144993788		1940	4121	6061	SO:0001583	missense	5339	exon32			GCACGGGGTCCAC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10612C>A	8.37:g.144993788G>T	ENSP00000323856:p.Pro3538Thr		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_201380	66	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	G	9.426	1.084320	0.20309	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	D;D;D;D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	4.46	4.46	0.54185	.	0.000000	0.64402	U	0.000006	D	0.94765	0.8310	M	0.91249	3.19	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999	D	0.96002	0.8994	10	0.87932	D	0	.	16.9177	0.86155	0.0:0.0:1.0:0.0	.	3428;3387;3379;3538;3369;3401;3405;3401	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	T	3401;3405;3401;3369;3538;3379;3387;3428;3424	ENSP00000344848:P3401T;ENSP00000350277:P3405T;ENSP00000346602:P3401T;ENSP00000381756:P3369T;ENSP00000323856:P3538T;ENSP00000347044:P3379T;ENSP00000348702:P3387T;ENSP00000388180:P3428T;ENSP00000434583:P3424T	ENSP00000323856:P3538T	P	-	1	0	PLEC	145065776	1.000000	0.71417	0.996000	0.52242	0.207000	0.24258	5.394000	0.66285	2.304000	0.77564	0.448000	0.29417	CCC			0.692	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
NOTCH1	4851	mdanderson.org	37	9	139405668	139405668	+	Silent	SNP	G	G	A			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr9:139405668G>A	ENST00000277541.6	-	16	2598	c.2523C>T	c.(2521-2523)ggC>ggT	p.G841G		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	841	EGF-like 22. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TGCACTCCCCGCCGTTTCTGC	0.687			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.G841G				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	.			0			c.C2523T												29.0	37.0	34.0					9																	139405668		2060	4186	6246	SO:0001819	synonymous_variant	4851	exon16			CTCCCCGCCGTTT	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2523C>T	9.37:g.139405668G>A			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_017617	16	0.00	0	Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	37	CCDS43905.1																																																																																					0.687	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055087.1		NM_017617	
ENTPD2	954	mdanderson.org	37	9	139943414	139943414	+	Silent	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr9:139943414G>T	ENST00000355097.2	-	8	1310	c.1263C>A	c.(1261-1263)ggC>ggA	p.G421G	ENTPD2_ENST00000460614.1_5'UTR|NPDC1_ENST00000488145.1_5'Flank|NPDC1_ENST00000371601.4_5'Flank|ENTPD2_ENST00000312665.5_Silent_p.G398G	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	421					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGATCACGCCGCCGAAGGCGC	0.741																																					p.G421G													.	.			0			c.C1263A												2.0	2.0	2.0					9																	139943414		1382	2962	4344	SO:0001819	synonymous_variant	954	exon8			CACGCCGCCGAAG	U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.1263C>A	9.37:g.139943414G>T			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	13	0.23	3	NM_203468	0		0	O15464|Q5SPY6|Q5SPY7	Silent	SNP	ENST00000355097.2	37	CCDS7026.1																																																																																					0.741	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055169.1		NM_203468	
IQSEC2	23096	mdanderson.org	37	X	53279934	53279934	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chrX:53279934G>T	ENST00000375368.5	-	4	1994	c.1794C>A	c.(1792-1794)gaC>gaA	p.D598E	IQSEC2_ENST00000375365.2_Missense_Mutation_p.D403E|IQSEC2_ENST00000396435.3_Missense_Mutation_p.D608E			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	598	Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GATCTGAGCGGTCACTCAGGT	0.662																																					p.D608E													.	.			0			c.C1824A												19.0	17.0	18.0					X																	53279934		2200	4295	6495	SO:0001583	missense	23096	exon5			TGAGCGGTCACTC	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1794C>A	X.37:g.53279934G>T	ENSP00000364517:p.Asp598Glu		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001111125	5	0.00	0	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		.	.	.	.	.	.	.	.	.	.	g	18.06	3.538304	0.65085	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.35605	1.31;1.3;1.72	5.37	2.2	0.27929	.	.	.	.	.	T	0.30324	0.0761	L	0.52905	1.665	0.40381	D	0.979443	B;B	0.18863	0.031;0.003	B;B	0.19666	0.026;0.011	T	0.07083	-1.0791	9	0.46703	T	0.11	.	6.0851	0.19962	0.2105:0.1437:0.6458:0.0	.	608;403	Q5JU85-2;Q5JU85-3	.;.	E	608;598;403	ENSP00000379712:D608E;ENSP00000364517:D598E;ENSP00000364514:D403E	ENSP00000364514:D403E	D	-	3	2	IQSEC2	53296659	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	0.965000	0.29319	-0.001000	0.14495	0.597000	0.82753	GAC			0.662	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding				XM_291345	
FAM104B	90736	mdanderson.org	37	X	55172630	55172630	+	Nonsense_Mutation	SNP	G	G	A	rs113263757		TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chrX:55172630G>A	ENST00000358460.4	-	3	388	c.235C>T	c.(235-237)Cag>Tag	p.Q79*	FAM104B_ENST00000477847.2_Nonsense_Mutation_p.Q76*|FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000332132.4_Nonsense_Mutation_p.Q80*|FAM104B_ENST00000489298.1_Nonsense_Mutation_p.Q78*|FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000425133.2_Nonsense_Mutation_p.Q80*			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	79										endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						TGCAAGAACTGGGGAAAGTTT	0.493																																					p.Q80X													.	.			0			c.C238T												127.0	104.0	112.0					X																	55172630		2203	4300	6503	SO:0001587	stop_gained	90736	exon3			AGAACTGGGGAAA	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.235C>T	X.37:g.55172630G>A	ENSP00000364101:p.Gln79*		Somatic	23	0.0869565217	2		WXS	Illumina HiSeq	Phase_I	40	0.10	4	NM_001166700	34	0.03	1	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Nonsense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	g	11.17	1.559418	0.27827	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	.	.	.	1.6	1.6	0.23607	.	0.325359	0.21941	U	0.066869	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-0.2487	6.0913	0.19995	0.0:0.0:1.0:0.0	.	.	.	.	X	79;80;80;76;78	.	ENSP00000333394:Q80X	Q	-	1	0	FAM104B	55189355	0.905000	0.30787	0.015000	0.15790	0.033000	0.12548	1.600000	0.36762	1.084000	0.41184	0.436000	0.28706	CAG			0.493	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056851.1		NM_138362	
AR	367	mdanderson.org	37	X	66766585	66766585	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chrX:66766585G>T	ENST00000374690.3	+	1	2121	c.1597G>T	c.(1597-1599)Gga>Tga	p.G533*	AR_ENST00000396044.3_Nonsense_Mutation_p.G533*|AR_ENST00000504326.1_Nonsense_Mutation_p.G533*|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	532	Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TAGCTACTCCGGACCTTACGG	0.562									Androgen Insensitivity Syndrome																												p.G533X													.	.			0			c.G1597T												51.0	36.0	41.0					X																	66766585		2203	4300	6503	SO:0001587	stop_gained	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	TACTCCGGACCTT	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1597G>T	X.37:g.66766585G>T	ENSP00000363822:p.Gly533*		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_000044	0		0	A2RUN2|B1AKD7|Q9UD95	Nonsense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	g	43	10.370788	0.99392	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	.	.	.	5.06	5.06	0.68205	.	0.076358	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	14.701	0.69157	0.0:0.0:1.0:0.0	.	.	.	.	X	343;533;533;533;525	.	ENSP00000363822:G533X	G	+	1	0	AR	66683310	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	6.141000	0.71744	2.349000	0.79799	0.509000	0.49947	GGA			0.562	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057007.1		NM_000044	
PRKDC	5591	mdanderson.org	37	8	48711905	48711905	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALS-01A-12D-A42Y-10	TCGA-2G-AALS-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	34d1f451-0b1c-4caf-bd25-c4b7fc096820	120ca414-0a11-4d4b-8742-6e6b7532ab65	g.chr8:48711905G>T	ENST00000314191.2	-	73	10216	c.10160C>A	c.(10159-10161)gCt>gAt	p.A3387D	PRKDC_ENST00000338368.3_Missense_Mutation_p.A3387D|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3388	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CGCCTGCACAGCCTCAGAGAG	0.562								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)												.	.			0			.												90.0	92.0	91.0					8																	48711905		2004	4183	6187	SO:0001583	missense	5591	.			TGCACAGCCTCAG		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10160C>A	8.37:g.48711905G>T	ENSP00000313420:p.Ala3387Asp		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	.	56	0.00	0	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	G	28.8	4.951466	0.92660	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.70749	-0.51;-0.51	5.8	5.8	0.92144	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.059663	0.64402	D	0.000003	D	0.85401	0.5688	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85504	0.1193	10	0.59425	D	0.04	.	20.0609	0.97674	0.0:0.0:1.0:0.0	.	3387;3388	E7EUY0;P78527	.;PRKDC_HUMAN	D	3387	ENSP00000313420:A3387D;ENSP00000345182:A3387D	ENSP00000313420:A3387D	A	-	2	0	PRKDC	48874458	1.000000	0.71417	0.170000	0.22879	0.033000	0.12548	9.050000	0.93843	2.755000	0.94549	0.655000	0.94253	GCT			0.562	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001081640	
