#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CEP85	64793	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	26584633	26584633	+	Splice_Site	SNP	G	G	C			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr1:26584633G>C	ENST00000252992.4	+	6	1168		c.e6-1		CEP85_ENST00000451429.2_Splice_Site	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa							centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						GGCTTGTGCAGGCAGAGGAAA	0.527																																					.													.	CEP85	61		0			c.1038-1G>C												93.0	90.0	91.0					1																	26584633		2203	4300	6503	SO:0001630	splice_region_variant	64793	exon6			TGTGCAGGCAGAG	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.1038-1G>C	1.37:g.26584633G>C			Somatic	69	0.0144927536	1		WXS	Illumina HiSeq	Phase_I	95	0.18	17	NM_022778	0		0	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Splice_Site	SNP	ENST00000252992.4	37	CCDS277.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550002	0.86127	.	.	ENSG00000130695	ENST00000451429;ENST00000252992;ENST00000453146	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CEP85	26457220	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.476000	0.97823	2.873000	0.98535	0.563000	0.77884	.			0.527	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009492.2		NM_022778	Intron
KPNA6	23633	mdanderson.org	37	1	32635499	32635499	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr1:32635499G>T	ENST00000373625.3	+	13	1354	c.1261G>T	c.(1261-1263)Ggc>Tgc	p.G421C	RP4-622L5.2_ENST00000515055.1_RNA|KPNA6_ENST00000537234.1_Missense_Mutation_p.G418C|KPNA6_ENST00000545542.1_Missense_Mutation_p.G426C	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	421					maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GGTCTCACTGGGCTGCATCAA	0.532																																					p.G421C													.	.			0			c.G1261T												164.0	151.0	155.0					1																	32635499		2203	4300	6503	SO:0001583	missense	23633	exon13			TCACTGGGCTGCA	AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.1261G>T	1.37:g.32635499G>T	ENSP00000362728:p.Gly421Cys		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	66	0.06	4	NM_012316	7	0.00	0	B2RDC7|D3DPP5|Q5VVU3	Missense_Mutation	SNP	ENST00000373625.3	37	CCDS352.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663000	0.88251	.	.	ENSG00000025800	ENST00000373625;ENST00000537234;ENST00000545542	D;D;D	0.83992	-1.79;-1.79;-1.79	5.24	5.24	0.73138	Armadillo-like helical (1);Armadillo-type fold (1);	0.089181	0.85682	D	0.000000	D	0.94341	0.8181	H	0.96365	3.81	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.77557	0.921;0.953;0.99	D	0.95541	0.8612	10	0.87932	D	0	-13.684	19.7013	0.96054	0.0:0.0:1.0:0.0	.	426;426;421	F5GYL8;B4DWX3;O60684	.;.;IMA7_HUMAN	C	421;418;426	ENSP00000362728:G421C;ENSP00000444930:G418C;ENSP00000440609:G426C	ENSP00000362728:G421C	G	+	1	0	KPNA6	32408086	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.858000	0.99539	2.831000	0.97527	0.655000	0.94253	GGC			0.532	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000012527.4		NM_012316	
KIAA0754	643314	broad.mit.edu	37	1	39879055	39879055	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr1:39879055A>G	ENST00000530275.1	+	1	2905	c.2710A>G	c.(2710-2712)Acc>Gcc	p.T904A	MACF1_ENST00000567887.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000317713.7_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	904	Ala-rich.							p.T904A(1)		central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGGAGCCCACCTCCCCAGC	0.721																																					p.T1040A													KIAA0754,rectum,carcinoma,0,1	KIAA0754	93	1	1	Substitution - Missense(1)	large_intestine(1)	c.A3118G												3.0	4.0	4.0					1																	39879055		1652	3673	5325	SO:0001583	missense	643314	exon1			GAGCCCACCTCCC			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2710A>G	1.37:g.39879055A>G	ENSP00000431179:p.Thr904Ala		Somatic	25	0.08	2		WXS	Illumina HiSeq	Phase_I	25	0.20	5	NM_015038	0		0	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		.	.	.	.	.	.	.	.	.	.	a	0.018	-1.486764	0.01018	.	.	ENSG00000255103	ENST00000530275	T	0.21543	2.0	4.34	-4.58	0.03410	.	.	.	.	.	T	0.06234	0.0161	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39035	-0.9633	9	0.08381	T	0.77	.	2.8824	0.05652	0.3663:0.1097:0.4125:0.1114	.	904	O94854	K0754_HUMAN	A	904	ENSP00000431179:T904A	ENSP00000431179:T904A	T	+	1	0	RP4-562N20.1	39651642	0.023000	0.18921	0.000000	0.03702	0.001000	0.01503	0.349000	0.20055	-0.695000	0.05105	-2.895000	0.00094	ACC			0.721	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000392100.1		NM_015038	
FAM129A	116496	mdanderson.org	37	1	184764457	184764457	+	Missense_Mutation	SNP	T	T	C	rs150071238	byFrequency	TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr1:184764457T>C	ENST00000367511.3	-	14	2634	c.2441A>G	c.(2440-2442)gAg>gGg	p.E814G	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	814	Glu-rich.				negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						TCCTGGGAGCTCCCCCTCCAT	0.652													T|||	13	0.00259585	0.0091	0.0014	5008	,	,		16065	0.0		0.0	False		,,,				2504	0.0				p.E814G													.	.			0			c.A2441G							T	GLY/GLU	19,4387		0,19,2184	53.0	55.0	54.0		2441	-0.2	0.1	1	dbSNP_134	54	0,8600		0,0,4300	yes	missense	FAM129A	NM_052966.2	98	0,19,6484	CC,CT,TT		0.0,0.4312,0.1461	benign	814/929	184764457	19,12987	2203	4300	6503	SO:0001583	missense	116496	exon14			GGGAGCTCCCCCT	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2441A>G	1.37:g.184764457T>C	ENSP00000356481:p.Glu814Gly		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_052966	6	0.00	0	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	CCDS1364.1	8	0.003663003663003663	8	0.016260162601626018	0	0.0	0	0.0	0	0.0	T	12.53	1.966555	0.34659	0.004312	0.0	ENSG00000135842	ENST00000367511	T	0.14144	2.53	5.25	-0.206	0.13193	.	0.795470	0.11491	N	0.558744	T	0.03390	0.0098	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37174	-0.9717	10	0.32370	T	0.25	-12.7741	1.3804	0.02229	0.3079:0.087:0.1497:0.4554	.	814	Q9BZQ8	NIBAN_HUMAN	G	814	ENSP00000356481:E814G	ENSP00000356481:E814G	E	-	2	0	FAM129A	183031080	0.105000	0.21958	0.050000	0.19076	0.082000	0.17680	1.501000	0.35693	0.001000	0.14605	-0.689000	0.03729	GAG	0.003		0.652	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085786.1			
EPRS	2058	broad.mit.edu	37	1	220195789	220195789	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr1:220195789G>A	ENST00000366923.3	-	9	1284	c.1015C>T	c.(1015-1017)Cga>Tga	p.R339*		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	339	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)	p.R339*(1)		breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	ATTTTTGCTCGCAAACAACAG	0.363																																					p.R339X													EPRS,NS,carcinoma,0,1	EPRS	140	1	1	Substitution - Nonsense(1)	endometrium(1)	c.C1015T												246.0	229.0	234.0					1																	220195789		2203	4300	6503	SO:0001587	stop_gained	2058	exon9			TTGCTCGCAAACA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.1015C>T	1.37:g.220195789G>A	ENSP00000355890:p.Arg339*		Somatic	199	0.0050251256	1		WXS	Illumina HiSeq	Phase_I	263	0.02	6	NM_004446	0		0	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Nonsense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	G	39	7.825130	0.98510	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	.	.	.	5.74	0.95	0.19572	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.8565	16.4461	0.83932	0.0:0.0:0.5283:0.4717	.	.	.	.	X	339;339;363	.	ENSP00000355890:R339X	R	-	1	2	EPRS	218262412	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	2.552000	0.45828	0.277000	0.22141	0.561000	0.74099	CGA			0.363	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091133.2		NM_004446	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659372	43659372	+	Nonsense_Mutation	SNP	C	C	T	rs76607193	byFrequency	TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr10:43659372C>T	ENST00000374466.3	+	5	1374	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	347					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.R347*(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TAATCGTGGACGAGGACTAAA	0.408																																					p.R347X													CSGALNACT2,trunk,malignant_melanoma,0,1	CSGALNACT2	0	1	1	Substitution - Nonsense(1)	skin(1)	c.C1039T												191.0	181.0	184.0					10																	43659372		2203	4300	6503	SO:0001587	stop_gained	55454	exon5			CGTGGACGAGGAC	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1039C>T	10.37:g.43659372C>T	ENSP00000363590:p.Arg347*		Somatic	122	0	0		WXS	Illumina HiSeq	.	119	0.04	5	NM_018590	5	0.00	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Nonsense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	41	8.712957	0.98925	.	.	ENSG00000169826	ENST00000374466	.	.	.	6.08	4.19	0.49359	.	0.110120	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.2438	15.5126	0.75795	0.253:0.747:0.0:0.0	.	.	.	.	X	347	.	ENSP00000363590:R347X	R	+	1	2	CSGALNACT2	42979378	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.226000	0.32563	0.852000	0.35287	0.591000	0.81541	CGA	0.003		0.408	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047693.1		NM_018590	
HPS6	79803	mdanderson.org	37	10	103826001	103826001	+	Missense_Mutation	SNP	G	G	T	rs373015076		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr10:103826001G>T	ENST00000299238.5	+	1	855	c.770G>T	c.(769-771)gGc>gTc	p.G257V		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	257					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		CTGCTCCGAGGCCTTCCTGGG	0.632									Hermansky-Pudlak syndrome																												p.G257V													.	.			0			c.G770T												54.0	60.0	58.0					10																	103826001		2203	4300	6503	SO:0001583	missense	79803	exon1	Familial Cancer Database	HPS, HPS1-8	TCCGAGGCCTTCC	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.770G>T	10.37:g.103826001G>T	ENSP00000299238:p.Gly257Val		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_024747	8	0.00	0	Q5VV69|Q9H685	Missense_Mutation	SNP	ENST00000299238.5	37	CCDS7527.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324901	0.60634	.	.	ENSG00000166189	ENST00000299238	T	0.78595	-1.19	5.52	4.61	0.57282	.	0.222462	0.46442	D	0.000298	T	0.79387	0.4437	L	0.60455	1.87	0.51767	D	0.999934	P	0.41188	0.741	P	0.46825	0.528	T	0.81837	-0.0749	10	0.72032	D	0.01	-4.7213	13.7595	0.62956	0.0735:0.0:0.9265:0.0	.	257	Q86YV9	HPS6_HUMAN	V	257	ENSP00000299238:G257V	ENSP00000299238:G257V	G	+	2	0	HPS6	103815991	0.998000	0.40836	0.994000	0.49952	0.854000	0.48673	5.518000	0.67068	2.579000	0.87056	0.561000	0.74099	GGC			0.632	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050018.2		NM_024747	
MTCH2	23788	mdanderson.org	37	11	47647283	47647283	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr11:47647283C>T	ENST00000302503.3	-	11	849	c.692G>A	c.(691-693)aGt>aAt	p.S231N	MTCH2_ENST00000534074.1_5'UTR|MTCH2_ENST00000542981.1_Missense_Mutation_p.S83N	NM_014342.3	NP_055157.1	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	231					protein localization to mitochondrion (GO:0070585)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11						GGTCAACATACTCGCAAAAAA	0.403																																					p.S231N													.	.			0			c.G692A												181.0	163.0	169.0					11																	47647283		2201	4298	6499	SO:0001583	missense	23788	exon11			AACATACTCGCAA	AF085361	CCDS7943.1	11p11.2	2013-05-22	2011-05-19		ENSG00000109919	ENSG00000109919		"""Solute carriers"""	17587	protein-coding gene	gene with protein product	"""solute carrier family 25, member 50"""	613221	"""mitochondrial carrier homolog 2 (C. elegans)"""				Standard	NM_014342		Approved	SLC25A50	uc010rho.2	Q9Y6C9	OTTHUMG00000166926	ENST00000302503.3:c.692G>A	11.37:g.47647283C>T	ENSP00000303222:p.Ser231Asn		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_014342	112	0.00	0	B2R7L8	Missense_Mutation	SNP	ENST00000302503.3	37	CCDS7943.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899271	0.52227	.	.	ENSG00000109919	ENST00000302503;ENST00000542981;ENST00000530428	T;T;T	0.79352	-1.26;0.78;-1.26	5.59	5.59	0.84812	Mitochondrial carrier domain (2);	0.038122	0.85682	D	0.000000	T	0.74906	0.3778	L	0.52364	1.645	0.52099	D	0.999942	B	0.27679	0.185	B	0.29942	0.109	T	0.72225	-0.4355	10	0.45353	T	0.12	-15.7775	16.5628	0.84570	0.0:1.0:0.0:0.0	.	231	Q9Y6C9	MTCH2_HUMAN	N	231;83;222	ENSP00000303222:S231N;ENSP00000439013:S83N;ENSP00000432043:S222N	ENSP00000303222:S231N	S	-	2	0	MTCH2	47603859	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.002000	0.57053	2.648000	0.89879	0.485000	0.47835	AGT			0.403	MTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391921.2		NM_014342	
SPTBN2	6712	mdanderson.org	37	11	66454940	66454940	+	Missense_Mutation	SNP	C	C	T	rs370257588		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr11:66454940C>T	ENST00000533211.1	-	35	7011	c.6680G>A	c.(6679-6681)cGc>cAc	p.R2227H	SPTBN2_ENST00000529997.1_Missense_Mutation_p.R2227H|SPTBN2_ENST00000309996.2_Missense_Mutation_p.R2227H			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	2227	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTCCTGCTTGCGGCACAGCAT	0.642																																					p.R2227H													.	.			0			c.G6680A							C	HIS/ARG	0,4398		0,0,2199	67.0	71.0	70.0		6680	4.6	1.0	11		70	1,8589	1.2+/-3.3	0,1,4294	no	missense	SPTBN2	NM_006946.2	29	0,1,6493	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	2227/2391	66454940	1,12987	2199	4295	6494	SO:0001583	missense	6712	exon34			TGCTTGCGGCACA	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.6680G>A	11.37:g.66454940C>T	ENSP00000432568:p.Arg2227His		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_006946	4	0.00	0	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.924473	0.73213	0.0	1.16E-4	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262	T;T;T	0.35236	1.32;1.32;1.32	4.6	4.6	0.57074	Pleckstrin homology-type (1);Pleckstrin homology domain, spectrin-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000003	T	0.68081	0.2962	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77104	-0.2711	10	0.87932	D	0	.	16.3781	0.83412	0.0:1.0:0.0:0.0	.	2227	O15020	SPTN2_HUMAN	H	2227;2227;2227;771	ENSP00000432568:R2227H;ENSP00000311489:R2227H;ENSP00000433593:R2227H	ENSP00000311489:R2227H	R	-	2	0	SPTBN2	66211516	1.000000	0.71417	0.999000	0.59377	0.126000	0.20510	7.463000	0.80869	2.396000	0.81511	0.655000	0.94253	CGC			0.642	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393892.2		NM_006946	
ANO1	55107	mdanderson.org	37	11	70026139	70026139	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr11:70026139G>T	ENST00000355303.5	+	23	2685	c.2380G>T	c.(2380-2382)Ggg>Tgg	p.G794W	ANO1_ENST00000538023.1_Missense_Mutation_p.G794W|ANO1_ENST00000530676.1_Missense_Mutation_p.G648W|ANO1_ENST00000398543.2_Missense_Mutation_p.G648W|ANO1_ENST00000531349.1_Missense_Mutation_p.G503W|ANO1_ENST00000525494.1_3'UTR	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	794					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CAGAGGCATTGGGAAGCTTGC	0.527																																					p.G794W													.	.			0			c.G2380T												132.0	127.0	128.0					11																	70026139		1918	4128	6046	SO:0001583	missense	55107	exon23			GGCATTGGGAAGC	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.2380G>T	11.37:g.70026139G>T	ENSP00000347454:p.Gly794Trp		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_018043	3	0.00	0	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630691	0.67015	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000530676;ENST00000531349;ENST00000539321	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	4.41	3.48	0.39840	.	0.343710	0.29579	N	0.011747	D	0.83289	0.5222	M	0.89601	3.045	0.49483	D	0.999799	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.86356	0.1714	9	.	.	.	.	12.6356	0.56681	0.0828:0.0:0.9171:0.0	.	503;794	E9PNA7;Q5XXA6	.;ANO1_HUMAN	W	794;794;648;552;648;503;121	ENSP00000347454:G794W;ENSP00000444689:G794W;ENSP00000381551:G648W;ENSP00000435797:G648W;ENSP00000432843:G503W	.	G	+	1	0	ANO1	69703787	1.000000	0.71417	0.950000	0.38849	0.903000	0.53119	3.267000	0.51577	2.018000	0.59344	0.462000	0.41574	GGG			0.527	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000393685.1		NM_018043	
CPM	1368	broad.mit.edu	37	12	69264140	69264140	+	Silent	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr12:69264140G>T	ENST00000551568.1	-	5	531	c.471C>A	c.(469-471)ccC>ccA	p.P157P	CPM_ENST00000338356.3_Silent_p.P157P|CPM_ENST00000546373.1_Silent_p.P157P	NM_001005502.2|NM_198320.3	NP_001005502.1|NP_938079.1	P14384	CBPM_HUMAN	carboxypeptidase M	157					anatomical structure morphogenesis (GO:0009653)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)|prostate(2)	9	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			CAAAAGCATCGGGGAAATTTC	0.398																																					p.P157P													.	CPM	30		0			c.C471A												76.0	78.0	78.0					12																	69264140		2203	4300	6503	SO:0001819	synonymous_variant	1368	exon5			AGCATCGGGGAAA	AF368463	CCDS8987.1	12q15	2012-02-10			ENSG00000135678	ENSG00000135678	3.4.17.12		2311	protein-coding gene	gene with protein product	"""renal carboxypeptidase"", ""urinary carboxypeptidase B"""	114860				8586455	Standard	NM_001874		Approved		uc001suq.3	P14384	OTTHUMG00000169300	ENST00000551568.1:c.471C>A	12.37:g.69264140G>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	87	0.05	4	NM_001005502	0		0	B2R800|Q9H2K9	Silent	SNP	ENST00000551568.1	37	CCDS8987.1																																																																																					0.398	CPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403355.1		NM_198320	
TAOK3	51347	mdanderson.org	37	12	118590215	118590215	+	Splice_Site	SNP	C	C	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr12:118590215C>A	ENST00000392533.3	-	20	2843		c.e20-1		TAOK3_ENST00000543709.1_Splice_Site|TAOK3_ENST00000537952.1_Splice_Site|TAOK3_ENST00000419821.2_Splice_Site|TAOK3_ENST00000536979.1_5'UTR	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTAGCCGTAACTGCGGACACA	0.532																																					.													.	.			0			c.2353-1G>T												103.0	84.0	90.0					12																	118590215		2203	4300	6503	SO:0001630	splice_region_variant	51347	exon21			CCGTAACTGCGGA	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.2353-1G>T	12.37:g.118590215C>A			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_016281	1	0.00	0	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Splice_Site	SNP	ENST00000392533.3	37	CCDS9188.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841333	0.71488	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000537952	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9339	0.79686	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TAOK3	117074598	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.619000	0.83057	2.418000	0.82041	0.460000	0.39030	.			0.532	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401456.2		NM_016281	Intron
NCOR2	9612	hgsc.bcm.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000397355.1_Silent_p.Q499Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2_ENST00000405201	0	11	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A												9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			Somatic	60	0.0333333333	2		WXS	Illumina HiSeq	.	72	0.07	5	NM_006312	4	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
TPTE2P1	646405	broad.mit.edu	37	13	25527621	25527623	+	RNA	DEL	AAC	AAC	-	rs199758569		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr13:25527621_25527623delAAC	ENST00000429698.1	-	0	282							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		TGCAATCTATAACAATACACTCA	0.276																																					.													.	.			0			.																																											0	.			ATCTATAACAATA			13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25527621_25527623delAAC			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	8	0.50	4	.	0		0	B3KST4|B4DMH9	RNA	DEL	ENST00000429698.1	37																																																																																						0.276	TPTE2P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000044206.1			
PDX1	3651	broad.mit.edu	37	13	28494404	28494404	+	Silent	SNP	G	G	C			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr13:28494404G>C	ENST00000381033.4	+	1	248	c.129G>C	c.(127-129)ccG>ccC	p.P43P	PDX1-AS1_ENST00000499662.2_RNA	NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	0					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		gccagcccccgccgccgccgc	0.761																																					p.P43P													.	PDX1	7		0			c.G129C												2.0	2.0	2.0					13																	28494404		1135	2350	3485	SO:0001819	synonymous_variant	3651	exon1			GCCCCCGCCGCCG	AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.129G>C	13.37:g.28494404G>C			Somatic	95	0.0105263158	1		WXS	Illumina HiSeq	Phase_I	97	0.04	4	NM_000209	0		0	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Silent	SNP	ENST00000381033.4	37	CCDS9327.1																																																																																					0.761	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044310.2		NM_000209	
NKX2-8	26257	broad.mit.edu	37	14	37050568	37050568	+	Silent	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr14:37050568G>T	ENST00000258829.5	-	2	476	c.259C>A	c.(259-261)Cgg>Agg	p.R87R		NM_014360.2	NP_055175.2	O15522	NKX28_HUMAN	NK2 homeobox 8	87					axonogenesis (GO:0007409)|liver development (GO:0001889)|lung development (GO:0030324)|negative regulation of epithelial cell proliferation (GO:0050680)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			upper_aerodigestive_tract(1)	1	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0171)		AGCACCCGCCGCTTCTTCCTT	0.701																																					p.R87R													.	NKX2-8	13		0			c.C259A												5.0	7.0	6.0					14																	37050568		2114	4213	6327	SO:0001819	synonymous_variant	26257	exon2			CCCGCCGCTTCTT		CCDS9660.1	14q13.3	2012-03-09	2007-07-09	2002-10-04	ENSG00000136327	ENSG00000136327		"""Homeoboxes / ANTP class : NKL subclass"""	16364	protein-coding gene	gene with protein product		603245	"""NK-2 homolog H (Drosophila)"", ""NK2 transcription factor related, locus 8 (Drosophila)"""	NKX2H		9446603	Standard	NM_014360		Approved	NKX2.8, Nkx2-9	uc001wtx.3	O15522	OTTHUMG00000028772	ENST00000258829.5:c.259C>A	14.37:g.37050568G>T			Somatic	94	0.0106382979	1		WXS	Illumina HiSeq	Phase_I	97	0.03	3	NM_014360	0		0	Q8IUT7	Silent	SNP	ENST00000258829.5	37	CCDS9660.1																																																																																					0.701	NKX2-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071844.6			
SIX4	51804	mdanderson.org	37	14	61190581	61190581	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr14:61190581G>A	ENST00000216513.4	-	1	271	c.212C>T	c.(211-213)gCa>gTa	p.A71V		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	71	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		cgccgccactgccCCTTCCTC	0.771																																					p.A71V													.	.			0			c.C212T												5.0	7.0	6.0					14																	61190581		1437	2809	4246	SO:0001583	missense	51804	exon1			GCCACTGCCCCTT	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.212C>T	14.37:g.61190581G>A	ENSP00000216513:p.Ala71Val		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_017420	0		0	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	37	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	G	9.721	1.159727	0.21454	.	.	ENSG00000100625	ENST00000216513;ENST00000556952	D	0.92048	-2.96	2.99	2.09	0.27110	.	6.588460	0.00805	N	0.001459	D	0.86360	0.5914	N	0.08118	0	0.24640	N	0.993577	P;P	0.51057	0.941;0.903	P;B	0.48488	0.579;0.375	T	0.79222	-0.1892	10	0.46703	T	0.11	.	3.8092	0.08789	0.1359:0.0:0.628:0.2361	.	63;71	G3V2N2;Q9UIU6	.;SIX4_HUMAN	V	71;63	ENSP00000216513:A71V	ENSP00000216513:A71V	A	-	2	0	SIX4	60260334	0.946000	0.32159	0.930000	0.37139	0.667000	0.39255	0.082000	0.14847	0.582000	0.29556	0.551000	0.68910	GCA			0.771	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000072397.2			
HIF1A	3091	mdanderson.org	37	14	62162532	62162532	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr14:62162532G>T	ENST00000337138.4	+	1	275	c.10G>T	c.(10-12)Gcc>Tcc	p.A4S	HIF1A-AS1_ENST00000557544.1_lincRNA|HIF1A_ENST00000539097.1_5'Flank|HIF1A_ENST00000557538.1_5'Flank|HIF1A_ENST00000323441.6_Missense_Mutation_p.A4S|HIF1A_ENST00000394997.1_Missense_Mutation_p.A4S	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	4	Interaction with TSGA10. {ECO:0000250}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	CATGGAGGGCGCCGGCGGCGC	0.726																																					p.A4S													.	.			0			c.G10T												20.0	25.0	23.0					14																	62162532		2191	4288	6479	SO:0001583	missense	3091	exon1			GAGGGCGCCGGCG	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.10G>T	14.37:g.62162532G>T	ENSP00000338018:p.Ala4Ser		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001530	4	0.00	0	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	37	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483857	0.63962	.	.	ENSG00000100644	ENST00000337138;ENST00000394997;ENST00000323441	T;T;T	0.53640	0.73;0.7;0.61	4.61	4.61	0.57282	.	1.010150	0.07928	N	0.976991	T	0.36552	0.0971	N	0.00483	-1.445	0.80722	D	1	D;B;B	0.63880	0.993;0.007;0.007	D;B;B	0.69479	0.964;0.005;0.005	T	0.50294	-0.8845	10	0.27082	T	0.32	.	12.7932	0.57545	0.0:0.0:1.0:0.0	.	4;4;4	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	S	4	ENSP00000338018:A4S;ENSP00000378446:A4S;ENSP00000323326:A4S	ENSP00000323326:A4S	A	+	1	0	HIF1A	61232285	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.495000	0.45337	2.397000	0.81536	0.491000	0.48974	GCC			0.726	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000276977.2		NM_001530	
GPATCH2L	55668	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	76644260	76644261	+	Intron	DEL	AG	AG	-			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr14:76644260_76644261delAG	ENST00000261530.7	+	7	1118				GPATCH2L_ENST00000553588.1_5'Flank|GPATCH2L_ENST00000312858.5_Frame_Shift_Del_p.R360fs	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like																		AGCTGGGAAAAGAGAACGAAAT	0.337																																					p.359_360del													.	.			0			c.1077_1078del																																									SO:0001627	intron_variant	55668	exon7			GGGAAAAGAGAAC	AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.1053-70AG>-	14.37:g.76644262_76644263delAG			Somatic	109	0	0		WXS	Illumina HiSeq	.	144	0.19	28	NM_017972	0		0	B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Frame_Shift_Del	DEL	ENST00000261530.7	37	CCDS9848.1																																																																																					0.337	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000413698.2		NM_017926	
JAG2	3714	mdanderson.org	37	14	105615089	105615089	+	Nonsense_Mutation	SNP	G	G	T	rs370664484		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr14:105615089G>T	ENST00000331782.3	-	15	2416	c.2013C>A	c.(2011-2013)tgC>tgA	p.C671*	JAG2_ENST00000347004.2_Nonsense_Mutation_p.C633*	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	671	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CACTGGTGTCGCAGAGCTCGC	0.682																																					p.C671X													.	.			0			c.C2013A												21.0	17.0	19.0					14																	105615089		2150	4251	6401	SO:0001587	stop_gained	3714	exon15			GGTGTCGCAGAGC	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.2013C>A	14.37:g.105615089G>T	ENSP00000328169:p.Cys671*		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_002226	4	0.00	0	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Nonsense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	G	43	9.920542	0.99295	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	.	.	.	4.37	-4.26	0.03755	.	0.107041	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6278	0.56640	0.7591:0.0:0.2409:0.0	.	.	.	.	X	671;633	.	ENSP00000328169:C671X	C	-	3	2	JAG2	104686134	0.286000	0.24305	0.974000	0.42286	0.991000	0.79684	-0.154000	0.10130	-0.916000	0.03818	0.555000	0.69702	TGC			0.682	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276506.2			
IGHG1	3500	broad.mit.edu	37	14	106206919	106206920	+	RNA	INS	-	-	C	rs587704280|rs67232680	byFrequency	TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr14:106206919_106206920insC	ENST00000390548.2	-	0	985							P01857	IGHG1_HUMAN	immunoglobulin heavy constant gamma 1 (G1m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										CTGCAGGGGCACCTTGTGAGAG	0.678													|||unknown(NO_COVERAGE)	2109	0.421126	0.5	0.4035	5008	,	,		17354	0.5248		0.2376	False		,,,				2504	0.409				.													.	.			0			.																																											0	.			AGGGGCACCTTGT	J00228		14q32.33	2012-10-02			ENSG00000211896	ENSG00000211896		"""Immunoglobulins / IGH locus"""	5525	other	immunoglobulin gene		147100					Standard	NG_001019		Approved		uc001yse.3	P01857	OTTHUMG00000152495		14.37:g.106206921_106206921dupC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	10	0.30	3	.	0		0		RNA	INS	ENST00000390548.2	37																																																																																						0.678	IGHG1-002	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	IG_C_gene	IG_C_gene		OTTHUMT00000326504.1		NG_001019	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7727167	7727167	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr17:7727167C>A	ENST00000572933.1	+	75	12805	c.11345C>A	c.(11344-11346)gCc>gAc	p.A3782D	DNAH2_ENST00000389173.2_Missense_Mutation_p.A3782D			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3782					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGGGAAAATGCCTGCAATGAA	0.592																																					p.A3782D													.	.			0			c.C11345A												88.0	77.0	81.0					17																	7727167		2203	4300	6503	SO:0001583	missense	146754	exon74			AAAATGCCTGCAA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11345C>A	17.37:g.7727167C>A	ENSP00000458355:p.Ala3782Asp		Somatic	70	0	0		WXS	Illumina HiSeq	.	84	0.17	14	NM_020877	0		0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157662	0.38119	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.08282	3.11	4.96	4.96	0.65561	Dynein heavy chain (1);	0.358596	0.29293	N	0.012579	T	0.09555	0.0235	L	0.31420	0.93	0.80722	D	1	B;B	0.19935	0.032;0.04	B;B	0.29440	0.062;0.102	T	0.21518	-1.0243	10	0.37606	T	0.19	.	16.9608	0.86272	0.0:1.0:0.0:0.0	.	3743;3782	Q9P225-2;Q9P225	.;DYH2_HUMAN	D	3743;3782	ENSP00000373825:A3782D	ENSP00000353818:A3743D	A	+	2	0	DNAH2	7667892	0.031000	0.19500	0.999000	0.59377	0.997000	0.91878	1.900000	0.39828	2.309000	0.77851	0.609000	0.83330	GCC			0.592	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440241.1		NM_020877	
SMCR2	140768	broad.mit.edu	37	17	17579800	17579801	+	lincRNA	DEL	TA	TA	-	rs76450870|rs368236112		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr17:17579800_17579801delTA	ENST00000456090.2	-	0	114									Smith-Magenis syndrome chromosome region, candidate 2 (non-protein coding)																		tgtgtgtgtgtatgtgtgtgtg	0.52																																					.													.	.			0			.																																											0	.			TGTGTGTATGTGT	AI821758		17p11.2	2012-10-16	2011-06-10		ENSG00000223979	ENSG00000223979		"""Long non-coding RNAs"""	17914	non-coding RNA	RNA, long non-coding			"""Smith-Magenis syndrome chromosome region, candidate 2"""			11997338	Standard			Approved				OTTHUMG00000059291		17.37:g.17579800_17579801delTA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	DEL	ENST00000456090.2	37																																																																																						0.520	SMCR2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000131667.2			
SREBF1	6720	mdanderson.org	37	17	17716904	17716904	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr17:17716904G>T	ENST00000261646.5	-	17	3265	c.3081C>A	c.(3079-3081)agC>agA	p.S1027R	SREBF1_ENST00000395757.1_Missense_Mutation_p.S773R|SREBF1_ENST00000338854.5_Missense_Mutation_p.S1027R|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000355815.4_Missense_Mutation_p.S1057R	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	1027					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CGGGCCGGAAGCTCTGTGCCA	0.692																																					p.S1057R													.	.			0			c.C3171A												7.0	10.0	9.0					17																	17716904		2159	4256	6415	SO:0001583	missense	6720	exon18			CCGGAAGCTCTGT	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.3081C>A	17.37:g.17716904G>T	ENSP00000261646:p.Ser1027Arg		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_001005291	71	0.01	1	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	37	CCDS11189.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.419490|4.419490	0.83559|0.83559	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000395751|ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161	.|T;T;T;T	.|0.20069	.|2.1;2.1;2.1;2.1	5.47|5.47	3.46|3.46	0.39613|0.39613	.|.	.|0.342781	.|0.33670	.|N	.|0.004669	T|T	0.27866|0.27866	0.0686|0.0686	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.51791	.|0.716;0.944;0.948	.|B;P;P	.|0.51135	.|0.319;0.603;0.66	T|T	0.01528|0.01528	-1.1332|-1.1332	5|10	.|0.48119	.|T	.|0.1	-8.8478|-8.8478	7.703|7.703	0.28634|0.28634	0.1526:0.1342:0.7132:0.0|0.1526:0.1342:0.7132:0.0	.|.	.|1027;1057;646	.|P36956;P36956-4;A8MTU8	.|SRBP1_HUMAN;.;.	I|R	1035|1027;1057;1027;773;646;864;953	.|ENSP00000345822:S1027R;ENSP00000348069:S1057R;ENSP00000261646:S1027R;ENSP00000379106:S773R	.|ENSP00000261646:S1027R	L|S	-|-	1|3	0|2	SREBF1|SREBF1	17657629|17657629	0.976000|0.976000	0.34144|0.34144	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.715000|1.715000	0.37971|0.37971	0.655000|0.655000	0.30866|0.30866	0.561000|0.561000	0.74099|0.74099	CTT|AGC			0.692	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131771.1		NM_004176	
NOS2P1	645740	broad.mit.edu	37	17	25988693	25988702	+	lincRNA	DEL	CACAGGTGGC	CACAGGTGGC	-	rs147959873|rs200074028|rs3217511	byFrequency	TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	CACAGGTGGC	CACAGGTGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr17:25988693_25988702delCACAGGTGGC	ENST00000583179.1	-	0	1982_1991																											GATGTAAAAGCACAGGTGGCCACAGGTTAC	0.5														1161	0.231829	0.1165	0.3098	5008	,	,		20228	0.2738		0.2435	False		,,,				2504	0.2771				.													.	.			0			.																																											0	.			TAAAAGCACAGGT																													17.37:g.25988693_25988702delCACAGGTGGC			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0		RNA	DEL	ENST00000583179.1	37																																																																																						0.500	RP11-19P22.5-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000445273.1			
KRT14	3861	mdanderson.org	37	17	39743003	39743003	+	Silent	SNP	G	G	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr17:39743003G>A	ENST00000167586.6	-	1	170	c.84C>T	c.(82-84)tcC>tcT	p.S28S		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	28	Head.				aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				AGATGCGGCTGGAgccgcccc	0.711																																					p.S28S													.	.			0			c.C84T												4.0	7.0	6.0					17																	39743003		2043	4010	6053	SO:0001819	synonymous_variant	3861	exon1			GCGGCTGGAGCCG	BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.84C>T	17.37:g.39743003G>A			Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_000526	2	0.00	0	Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Silent	SNP	ENST00000167586.6	37	CCDS11400.1																																																																																					0.711	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257289.1		NM_000526	
JUP	3728	mdanderson.org	37	17	39921060	39921060	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr17:39921060G>A	ENST00000393931.3	-	7	1181	c.1063C>T	c.(1063-1065)Cag>Tag	p.Q355*	JUP_ENST00000310706.5_Nonsense_Mutation_p.Q355*|JUP_ENST00000393930.1_Nonsense_Mutation_p.Q355*|JUP_ENST00000540235.1_Intron	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	355					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CCCAGGGCCTGCATCCCACCT	0.672																																					p.Q355X	Colon(16;42 520 6044 17852 28530)												.	.			0			c.C1063T												63.0	60.0	61.0					17																	39921060		2203	4300	6503	SO:0001587	stop_gained	3728	exon7			GGGCCTGCATCCC	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.1063C>T	17.37:g.39921060G>A	ENSP00000377508:p.Gln355*		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_021991	101	0.00	0	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Nonsense_Mutation	SNP	ENST00000393931.3	37	CCDS11407.1	.	.	.	.	.	.	.	.	.	.	G	39	7.765030	0.98477	.	.	ENSG00000173801	ENST00000393930;ENST00000310706;ENST00000393931	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-29.996	18.8398	0.92177	0.0:0.0:1.0:0.0	.	.	.	.	X	355	.	ENSP00000311113:Q355X	Q	-	1	0	JUP	37174586	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.856000	0.86956	2.793000	0.96121	0.655000	0.94253	CAG			0.672	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257406.1			
ANKRD20A5P	440482	mdanderson.org	37	18	14179583	14179583	+	RNA	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr18:14179583G>T	ENST00000581935.1	+	0	488							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGACGCCCTGGACAAGCAGCA	0.687																																					.													.	.			0			.												13.0	12.0	12.0					18																	14179583		2159	4140	6299			440482	.			GCCCTGGACAAGC	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14179583G>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	.	0		0	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																						0.687	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000442833.1			
CD97	976	mdanderson.org	37	19	14515207	14515207	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr19:14515207G>T	ENST00000242786.5	+	13	1542	c.1462G>T	c.(1462-1464)Ggg>Tgg	p.G488W	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.G439W|CD97_ENST00000358600.3_Missense_Mutation_p.G395W	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	488					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CGTGATGCCTGGGCCACGGCA	0.632																																					p.G488W													.	.			0			c.G1462T												90.0	96.0	94.0					19																	14515207		2202	4298	6500	SO:0001583	missense	976	exon13			ATGCCTGGGCCAC		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1462G>T	19.37:g.14515207G>T	ENSP00000242786:p.Gly488Trp		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_078481	42	0.00	0	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.403503	0.42613	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.72167	-0.63;-0.55;-0.16	5.22	-0.906	0.10524	.	.	.	.	.	T	0.61974	0.2390	N	0.08118	0	0.09310	N	1	D;D;D	0.71674	0.998;0.998;0.988	D;D;P	0.66979	0.948;0.948;0.796	T	0.52719	-0.8538	9	0.56958	D	0.05	.	4.6116	0.12406	0.436:0.0:0.4196:0.1444	.	395;439;488	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	W	488;439;395;438	ENSP00000242786:G488W;ENSP00000349918:G439W;ENSP00000351413:G395W	ENSP00000242786:G488W	G	+	1	0	CD97	14376207	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.053000	0.03500	-0.166000	0.10890	-0.345000	0.07892	GGG			0.632	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459821.2		NM_078481	
MYO9B	4650	mdanderson.org	37	19	17309075	17309075	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr19:17309075T>C	ENST00000594824.1	+	24	4343	c.4196T>C	c.(4195-4197)cTc>cCc	p.L1399P	MYO9B_ENST00000397274.2_Missense_Mutation_p.L1399P|MYO9B_ENST00000595618.1_Missense_Mutation_p.L1399P			Q13459	MYO9B_HUMAN	myosin IXB	1399	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GCATCCTCCCTCCCAGACGCA	0.617																																					p.L1399P													.	.			0			c.T4196C												63.0	77.0	72.0					19																	17309075		2012	4166	6178	SO:0001583	missense	4650	exon24			CCTCCCTCCCAGA		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4196T>C	19.37:g.17309075T>C	ENSP00000471367:p.Leu1399Pro		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	60	0.05	3	NM_004145	13	0.00	0	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	T	9.457	1.092150	0.20471	.	.	ENSG00000099331	ENST00000397274	D	0.84589	-1.87	4.74	-3.79	0.04320	.	1.034310	0.07682	N	0.937321	T	0.62454	0.2429	N	0.08118	0	0.09310	N	1	B;B;B	0.29508	0.13;0.13;0.246	B;B;B	0.25291	0.059;0.059;0.055	T	0.52193	-0.8608	10	0.25106	T	0.35	.	2.5054	0.04644	0.1404:0.1269:0.2021:0.5306	.	1399;1399;1405	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	P	1399	ENSP00000380444:L1399P	ENSP00000380444:L1399P	L	+	2	0	MYO9B	17170075	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.017000	0.12590	-0.414000	0.07495	-0.677000	0.03784	CTC			0.617	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000463236.1			
EMILIN1	11117	mdanderson.org	37	2	27305716	27305716	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr2:27305716A>G	ENST00000380320.4	+	4	1776	c.1277A>G	c.(1276-1278)gAg>gGg	p.E426G		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	426					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGCAGGAGGAGAGCTGGCCT	0.711																																					p.E426G													.	.			0			c.A1277G												5.0	7.0	6.0					2																	27305716		2034	4135	6169	SO:0001583	missense	11117	exon4			AGGAGGAGAGCTG	AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.1277A>G	2.37:g.27305716A>G	ENSP00000369677:p.Glu426Gly		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_007046	351	0.00	0	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	ENST00000380320.4	37	CCDS1733.1	.	.	.	.	.	.	.	.	.	.	A	3.769	-0.048042	0.07407	.	.	ENSG00000138080	ENST00000380320	T	0.63255	-0.03	5.36	-0.16	0.13375	.	0.784816	0.11721	N	0.535849	T	0.34337	0.0894	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.14531	-1.0469	10	0.33940	T	0.23	-5.5392	3.7225	0.08462	0.5614:0.0:0.2834:0.1551	.	426	Q9Y6C2	EMIL1_HUMAN	G	426	ENSP00000369677:E426G	ENSP00000369677:E426G	E	+	2	0	EMILIN1	27159220	0.315000	0.24571	0.021000	0.16686	0.033000	0.12548	0.878000	0.28126	0.055000	0.16094	-0.473000	0.04963	GAG			0.711	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214185.1		NM_007046	
AMMECR1L	83607	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128628896	128628896	+	Silent	SNP	G	G	T	rs371126249		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr2:128628896G>T	ENST00000272647.5	-	4	705	c.445C>A	c.(445-447)Cgg>Agg	p.R149R	AMMECR1L_ENST00000393001.1_Silent_p.R149R	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like	149	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		CCACGAAGCCGCTTGTCCCGC	0.453																																					p.R149R													.	AMMECR1L	22		0			c.C445A							G	,	0,4406		0,0,2203	51.0	52.0	52.0		445,445	5.4	1.0	2		52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	AMMECR1L	NM_001199140.1,NM_031445.2	,	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	,	149/311,149/311	128628896	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	83607	exon4			GAAGCCGCTTGTC		CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535	ENST00000272647.5:c.445C>A	2.37:g.128628896G>T			Somatic	88	0.0113636364	1		WXS	Illumina HiSeq	Phase_I	98	0.28	27	NM_031445	0		0	B4E276	Silent	SNP	ENST00000272647.5	37	CCDS2152.1																																																																																					0.453	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254392.1		NM_031445	
LRP1B	53353	broad.mit.edu	37	2	141751584	141751585	+	In_Frame_Ins	INS	-	-	CGCTTC			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr2:141751584_141751585insCGCTTC	ENST00000389484.3	-	16	3594_3595	c.2623_2624insGAAGCG	c.(2623-2625)gat>gGAAGCGat	p.874_875insGS	Y_RNA_ENST00000365022.1_RNA	NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	874	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGAATCCTCATCGCTTCCGTCT	0.431										TSP Lung(27;0.18)																											p.D875delinsGSD	Colon(99;50 2074 2507 20106)												.	LRP1B	1315		0			c.2624_2625insGAAGCG																																									SO:0001652	inframe_insertion	53353	exon16			TCCTCATCGCTTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2618_2623dupGAAGCG	2.37:g.141751585_141751590dupCGCTTC	ENSP00000374135:p.Gly873_Ser874dup		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	86	0.09	8	NM_018557	0		0	Q8WY29|Q8WY30|Q8WY31	In_Frame_Ins	INS	ENST00000389484.3	37	CCDS2182.1																																																																																					0.431	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254736.2		NM_018557	
UBR3	130507	mdanderson.org	37	2	170684527	170684527	+	Silent	SNP	C	C	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr2:170684527C>T	ENST00000272793.5	+	1	560	c.510C>T	c.(508-510)tgC>tgT	p.C170C	UBR3_ENST00000418381.1_Silent_p.C170C			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	170					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GGGGCGCCTGCGACTGCGGGG	0.721																																					p.C170C													.	.			0			c.C510T												6.0	6.0	6.0					2																	170684527		667	1545	2212	SO:0001819	synonymous_variant	130507	exon1			CGCCTGCGACTGC	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.510C>T	2.37:g.170684527C>T			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	17	0.18	3	NM_172070	0		0	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Silent	SNP	ENST00000272793.5	37																																																																																						0.721	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000255290.2		NM_172070	
BAGE2	85319	broad.mit.edu	37	21	11087766	11087766	+	RNA	DEL	T	T	-	rs56721211		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr21:11087766delT	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAGACTGTATTTTTTATGGA	0.368																																					.													.	.			0			.																																											85319	.			ACTGTATTTTTTA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11087766delT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	10	0.40	4	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.368	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
ZNF74	7625	broad.mit.edu	37	22	20759905	20759905	+	Silent	SNP	G	G	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr22:20759905G>A	ENST00000400451.2	+	5	1096	c.582G>A	c.(580-582)ggG>ggA	p.G194G	ZNF74_ENST00000356671.5_Silent_p.G194G|ZNF74_ENST00000405993.1_Silent_p.G162G|ZNF74_ENST00000403682.3_Missense_Mutation_p.G166R|ZNF74_ENST00000357502.5_Missense_Mutation_p.G200R	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	194					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TTCCCGAGGGGGGACCCTTGC	0.667																																					p.G166R													.	ZNF74	54		0			c.G496A												28.0	34.0	32.0					22																	20759905		1960	4149	6109	SO:0001819	synonymous_variant	7625	exon4			CGAGGGGGGACCC	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.582G>A	22.37:g.20759905G>A			Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	114	0.04	4	NM_001256523	2	0.00	0	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	CCDS42982.1	.	.	.	.	.	.	.	.	.	.	G	8.852	0.944721	0.18356	.	.	ENSG00000185252	ENST00000403682;ENST00000357502	.	.	.	3.55	-5.74	0.02391	.	1.995260	0.02820	N	0.125498	T	0.48169	0.1485	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.57447	-0.7810	6	0.87932	D	0	-0.9424	11.6169	0.51094	0.1818:0.1328:0.6854:0.0	.	.	.	.	R	166;200	.	ENSP00000350101:G200R	G	+	1	0	ZNF74	19089905	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.369000	0.07533	-1.425000	0.01997	-0.302000	0.09304	GGG			0.667	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319648.2		NM_003426	
SUSD2	56241	mdanderson.org	37	22	24580118	24580118	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr22:24580118G>T	ENST00000358321.3	+	4	715	c.454G>T	c.(454-456)Gtg>Ttg	p.V152L		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	152					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CCCCAACAAAGTGTCAATGAT	0.617																																					p.V152L													.	.			0			c.G454T												130.0	97.0	108.0					22																	24580118		2203	4300	6503	SO:0001583	missense	56241	exon4			AACAAAGTGTCAA	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.454G>T	22.37:g.24580118G>T	ENSP00000351075:p.Val152Leu		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	60	0.05	3	NM_019601	1	0.00	0	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	37	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410551	0.25465	.	.	ENSG00000099994	ENST00000358321	T	0.09163	3.01	3.6	3.6	0.41247	.	0.160267	0.42682	D	0.000677	T	0.09291	0.0229	L	0.52011	1.625	0.32220	N	0.57538	P	0.38473	0.633	B	0.29353	0.101	T	0.13522	-1.0506	10	0.25751	T	0.34	-27.542	13.2851	0.60239	0.0:0.0:1.0:0.0	.	152	Q9UGT4	SUSD2_HUMAN	L	152	ENSP00000351075:V152L	ENSP00000351075:V152L	V	+	1	0	SUSD2	22910118	1.000000	0.71417	0.997000	0.53966	0.464000	0.32679	2.358000	0.44134	2.062000	0.61559	0.444000	0.29173	GTG			0.617	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320088.1		NM_019601	
ATP2B2	491	mdanderson.org	37	3	10413495	10413495	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr3:10413495G>T	ENST00000352432.4	-	11	1726	c.1657C>A	c.(1657-1659)Ctg>Atg	p.L553M	ATP2B2_ENST00000397077.1_Missense_Mutation_p.L508M|ATP2B2_ENST00000343816.4_Missense_Mutation_p.L539M|ATP2B2_ENST00000360273.2_Missense_Mutation_p.L553M|ATP2B2_ENST00000383800.4_Missense_Mutation_p.L508M			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	553					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ACACTTACCAGAATCTTGGTG	0.517																																					p.L553M	Ovarian(125;1619 1709 15675 19819 38835)												.	.			0			c.C1657A												127.0	108.0	114.0					3																	10413495		2203	4300	6503	SO:0001583	missense	491	exon12			TTACCAGAATCTT	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1657C>A	3.37:g.10413495G>T	ENSP00000324172:p.Leu553Met		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	123	0.04	5	NM_001001331	0		0	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151763	0.57151	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.95949	-3.86;-3.86;-3.86;-3.86;-3.86;-3.86	4.43	2.64	0.31445	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.083179	0.50627	D	0.000106	D	0.91737	0.7387	L	0.37800	1.135	0.58432	D	0.999997	B;B;B	0.31383	0.321;0.12;0.023	B;B;B	0.38458	0.274;0.063;0.039	D	0.86122	0.1569	10	0.34782	T	0.22	-7.0384	7.9602	0.30066	0.2514:0.0:0.7486:0.0	.	488;520;553	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	M	553;508;508;553;539;488;45;409;553	ENSP00000324172:L553M;ENSP00000373311:L508M;ENSP00000380267:L508M;ENSP00000353414:L553M;ENSP00000344677:L539M;ENSP00000414854:L409M	ENSP00000342954:L553M	L	-	1	2	ATP2B2	10388495	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	5.541000	0.67212	0.498000	0.27948	0.655000	0.94253	CTG			0.517	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000250576.2		NM_001683	
QTRTD1	79691	mdanderson.org	37	3	113798888	113798888	+	Silent	SNP	G	G	T	rs370420090		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr3:113798888G>T	ENST00000493014.1	+	4	632	c.564G>T	c.(562-564)ccG>ccT	p.P188P	QTRTD1_ENST00000479882.1_Silent_p.P171P|QTRTD1_ENST00000485050.1_Silent_p.P306P|QTRTD1_ENST00000281273.4_Silent_p.P294P	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						ATTACCAGCCGAATCCTGAAG	0.383																																					p.P306P													.	.			0			c.G918T												164.0	164.0	164.0					3																	113798888		2203	4300	6503	SO:0001819	synonymous_variant	79691	exon7			CCAGCCGAATCCT	AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.564G>T	3.37:g.113798888G>T			Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	90	0.04	4	NM_001256835	1	0.00	0		Silent	SNP	ENST00000493014.1	37	CCDS58845.1																																																																																					0.383	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000354711.1		NM_024638	
RHO	6010	broad.mit.edu	37	3	129252455	129252455	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr3:129252455G>T	ENST00000296271.3	+	5	1035	c.941G>T	c.(940-942)cGg>cTg	p.R314L		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	314					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)			breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	TTCCAGTTCCGGAACTGCATG	0.622																																					p.R314L	Esophageal Squamous(118;214 1623 30842 43234 46940)												.	RHO	57		0			c.G941T												153.0	134.0	140.0					3																	129252455		2203	4300	6503	SO:0001583	missense	6010	exon5			AGTTCCGGAACTG	AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.941G>T	3.37:g.129252455G>T	ENSP00000296271:p.Arg314Leu		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	75	0.04	3	NM_000539	0		0	Q16414|Q2M249	Missense_Mutation	SNP	ENST00000296271.3	37	CCDS3063.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151973	0.94645	.	.	ENSG00000163914	ENST00000296271	T	0.57595	0.39	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.77805	0.4185	M	0.88241	2.94	0.80722	D	1	D	0.71674	0.998	D	0.74674	0.984	T	0.82707	-0.0324	10	0.87932	D	0	.	18.7559	0.91832	0.0:0.0:1.0:0.0	.	314	P08100	OPSD_HUMAN	L	314	ENSP00000296271:R314L	ENSP00000296271:R314L	R	+	2	0	RHO	130735145	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.383000	0.97214	2.428000	0.82296	0.655000	0.94253	CGG			0.622	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356101.1		NM_000539	
MUC4	4585	hgsc.bcm.edu	37	3	195509484	195509484	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr3:195509484G>C	ENST00000463781.3	-	2	9426	c.8967C>G	c.(8965-8967)caC>caG	p.H2989Q	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H2989Q	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAAGGGTGGCGTGACCTGTGG	0.577																																					p.H2989Q													MUC4_ENST00000463781,NS,carcinoma,-2,1	MUC4_ENST00000463781	-2	1	0			c.C8967G												17.0	11.0	13.0					3																	195509484		654	1557	2211	SO:0001583	missense	4585	exon2			GGTGGCGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8967C>G	3.37:g.195509484G>C	ENSP00000417498:p.His2989Gln		Somatic	48	0.0208333333	1		WXS	Illumina HiSeq	.	52	0.06	3	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.781	-0.045574	0.07452	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.51;1.55	.	.	.	.	.	.	.	.	T	0.19446	0.0467	N	0.19112	0.55	0.09310	N	1	P	0.39748	0.686	B	0.41299	0.353	T	0.15178	-1.0446	7	.	.	.	.	7.5518	0.27802	0.0:0.0:1.0:0.0	.	2861	E7ESK3	.	Q	2989	ENSP00000417498:H2989Q;ENSP00000420243:H2989Q	.	H	-	3	2	MUC4	196994263	.	.	0.002000	0.10522	0.000000	0.00434	.	.	0.482000	0.27582	0.000000	0.15137	CAC			0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
ZNF518B	85460	bcgsc.ca;mdanderson.org	37	4	10445650	10445650	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr4:10445650G>A	ENST00000326756.3	-	3	2741	c.2303C>T	c.(2302-2304)aCg>aTg	p.T768M		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	768					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TAACACTGGCGTGGCAACATG	0.463																																					p.T768M													.	ZNF518B	116		0			c.C2303T												87.0	87.0	87.0					4																	10445650		2203	4300	6503	SO:0001583	missense	85460	exon3			ACTGGCGTGGCAA	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2303C>T	4.37:g.10445650G>A	ENSP00000317614:p.Thr768Met		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_1	180	0.03	6	NM_053042	4	0.00	0	Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165700	0.57476	.	.	ENSG00000178163	ENST00000326756	T	0.01745	4.66	6.02	5.01	0.66863	.	0.548806	0.17130	N	0.185852	T	0.03959	0.0111	L	0.43152	1.355	0.09310	N	0.999999	D	0.69078	0.997	P	0.50231	0.635	T	0.34725	-0.9817	10	0.87932	D	0	-17.503	13.4264	0.61028	0.0843:0.0:0.9157:0.0	.	768	Q9C0D4	Z518B_HUMAN	M	768	ENSP00000317614:T768M	ENSP00000317614:T768M	T	-	2	0	ZNF518B	10054748	0.901000	0.30685	0.581000	0.28614	0.716000	0.41182	3.521000	0.53472	2.865000	0.98341	0.655000	0.94253	ACG			0.463	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359040.1		NM_053042	
TECRL	253017	broad.mit.edu	37	4	65240937	65240937	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr4:65240937G>T	ENST00000381210.3	-	2	349	c.239C>A	c.(238-240)aCa>aAa	p.T80K	TECRL_ENST00000507440.1_Missense_Mutation_p.T80K	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	80					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						AGATGATTGTGTCACCTGAAA	0.204																																					p.T80K													.	TECRL	106		0			c.C239A												9.0	10.0	10.0					4																	65240937		2072	4134	6206	SO:0001583	missense	253017	exon2			GATTGTGTCACCT	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.239C>A	4.37:g.65240937G>T	ENSP00000370607:p.Thr80Lys		Somatic	412	0	0		WXS	Illumina HiSeq	Phase_I	468	0.02	8	NM_001010874	0		0		Missense_Mutation	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	G	7.862	0.726356	0.15439	.	.	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.41758	0.99;0.99;0.99	5.59	2.78	0.32641	.	0.551148	0.20396	N	0.093156	T	0.34135	0.0887	L	0.50333	1.59	0.25923	N	0.983098	B;B	0.26195	0.144;0.089	B;B	0.28232	0.087;0.025	T	0.21690	-1.0238	10	0.30078	T	0.28	-5.4517	7.4597	0.27287	0.268:0.0:0.732:0.0	.	80;80	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	K	80	ENSP00000426043:T80K;ENSP00000370607:T80K;ENSP00000422497:T80K	ENSP00000370607:T80K	T	-	2	0	TECRL	64923532	0.269000	0.24143	0.950000	0.38849	0.985000	0.73830	1.197000	0.32211	0.248000	0.21435	0.585000	0.79938	ACA			0.204	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361705.4		NM_001010874	
MAPK10	5602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	87022243	87022243	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr4:87022243G>T	ENST00000359221.3	-	8	1218	c.692C>A	c.(691-693)gCc>gAc	p.A231D	MAPK10_ENST00000395157.3_Missense_Mutation_p.A86D|MAPK10_ENST00000395160.3_Missense_Mutation_p.A86D|MAPK10_ENST00000395166.1_Missense_Mutation_p.A193D|MAPK10_ENST00000361569.2_Missense_Mutation_p.A231D|MAPK10_ENST00000395161.2_Missense_Mutation_p.A231D|MAPK10_ENST00000513839.1_5'Flank|MAPK10_ENST00000449047.2_Missense_Mutation_p.A86D|MAPK10_ENST00000395169.3_Missense_Mutation_p.A193D			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	231	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.A231V(1)|p.A86V(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GACCTCAGGGGCTCTGTAATA	0.498																																					p.A231D													MAPK10_ENST00000449047,NS,carcinoma,0,3	MAPK10_ENST00000449047	0	3	2	Substitution - Missense(2)	prostate(2)	c.C692A												132.0	114.0	120.0					4																	87022243		2203	4300	6503	SO:0001583	missense	5602	exon8			TCAGGGGCTCTGT	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.692C>A	4.37:g.87022243G>T	ENSP00000352157:p.Ala231Asp		Somatic	130	0	0		WXS	Illumina HiSeq	.	155	0.21	33	NM_002753	5	0.40	2	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.425782|5.425782	0.96131|0.96131	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161|ENST00000515400	D;D;D;D;D;D;D;D|.	0.92048|.	-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96|.	6.03|6.03	6.03|6.03	0.97812|0.97812	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88358|0.88358	0.6415|0.6415	H|H	0.95079|0.95079	3.62|3.62	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.67145|.	0.982;0.982;0.987;0.996;0.994|.	D;D;D;D;D|.	0.85130|.	0.957;0.942;0.989;0.993;0.997|.	D|D	0.90560|0.90560	0.4515|0.4515	10|5	0.87932|.	D|.	0|.	-15.6172|-15.6172	20.5752|20.5752	0.99366|0.99366	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	117;86;193;231;231|.	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779|.	.;.;.;.;MK10_HUMAN|.	D|R	193;231;86;231;193;86;86;231|143	ENSP00000378598:A193D;ENSP00000352157:A231D;ENSP00000378586:A86D;ENSP00000355297:A231D;ENSP00000378595:A193D;ENSP00000378589:A86D;ENSP00000414469:A86D;ENSP00000378590:A231D|.	ENSP00000352157:A231D|.	A|S	-|-	2|3	0|2	MAPK10|MAPK10	87241267|87241267	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.891000|0.891000	0.51852|0.51852	9.869000|9.869000	0.99810|0.99810	2.868000|2.868000	0.98415|0.98415	0.557000|0.557000	0.71058|0.71058	GCC|AGC			0.498	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000361363.2			
ICE1	23379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	5462346	5462346	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr5:5462346C>T	ENST00000296564.7	+	13	3121	c.2899C>T	c.(2899-2901)Caa>Taa	p.Q967*		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		967					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TATCCTCATCCAAAACCAAGA	0.443																																					p.Q967X													.	.			0			c.C2899T												24.0	25.0	24.0					5																	5462346		1960	4176	6136	SO:0001587	stop_gained	23379	exon13			CTCATCCAAAACC																												ENST00000296564.7:c.2899C>T	5.37:g.5462346C>T	ENSP00000296564:p.Gln967*		Somatic	132	0	0		WXS	Illumina HiSeq	.	124	0.41	51	NM_015325	0		0	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Nonsense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	c	40	8.273777	0.98737	.	.	ENSG00000164151	ENST00000296564	.	.	.	4.73	3.86	0.44501	.	0.913316	0.09404	N	0.806808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	0.2195	9.1927	0.37209	0.0:0.8967:0.0:0.1033	.	.	.	.	X	967	.	ENSP00000296564:Q967X	Q	+	1	0	KIAA0947	5515346	0.000000	0.05858	0.001000	0.08648	0.140000	0.21249	0.262000	0.18460	1.108000	0.41662	0.461000	0.40582	CAA			0.443	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365575.1			
ZSWIM6	57688	mdanderson.org	37	5	60628398	60628398	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr5:60628398G>A	ENST00000252744.5	+	1	299	c.299G>A	c.(298-300)cGc>cAc	p.R100H		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	100	Gly-rich.				neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						CGCTTTGAGCGCATCCCGGAG	0.697																																					p.R100H													.	.			0			c.G299A												7.0	12.0	10.0					5																	60628398		683	1580	2263	SO:0001583	missense	57688	exon1			TTGAGCGCATCCC	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.299G>A	5.37:g.60628398G>A	ENSP00000252744:p.Arg100His		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_020928	0		0		Missense_Mutation	SNP	ENST00000252744.5	37	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995466	0.35226	.	.	ENSG00000130449	ENST00000252744	T	0.34072	1.38	1.79	1.79	0.24919	.	.	.	.	.	T	0.55305	0.1912	M	0.70595	2.14	0.34923	D	0.748643	D	0.71674	0.998	D	0.78314	0.991	T	0.67138	-0.5746	9	0.66056	D	0.02	.	11.0937	0.48132	0.0:0.0:1.0:0.0	.	100	Q9HCJ5	ZSWM6_HUMAN	H	100	ENSP00000252744:R100H	ENSP00000252744:R100H	R	+	2	0	ZSWIM6	60664155	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	6.573000	0.74009	0.802000	0.34089	0.186000	0.17326	CGC			0.697	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368710.1		NM_020928	
CAMK4	814	mdanderson.org	37	5	110819954	110819954	+	Silent	SNP	A	A	G			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr5:110819954A>G	ENST00000282356.4	+	11	1610	c.1212A>G	c.(1210-1212)aaA>aaG	p.K404K	CAMK4_ENST00000512453.1_Silent_p.K404K|CAMK4_ENST00000512890.1_3'UTR	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	404					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AGAAAGTTAAAGGTGCAGATA	0.527																																					p.K404K													.	.			0			c.A1212G												57.0	61.0	59.0					5																	110819954		2202	4300	6502	SO:0001819	synonymous_variant	814	exon11			AGTTAAAGGTGCA	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.1212A>G	5.37:g.110819954A>G			Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001744	6	0.00	0	D3DSZ7	Silent	SNP	ENST00000282356.4	37	CCDS4103.1																																																																																					0.527	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250719.2		NM_001744	
TCERG1	10915	hgsc.bcm.edu;broad.mit.edu	37	5	145838663	145838664	+	In_Frame_Ins	INS	-	-	CCCAGG			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr5:145838663_145838664insCCCAGG	ENST00000296702.5	+	4	693_694	c.655_656insCCCAGG	c.(655-657)gcc>gCCCAGGcc	p.219_219A>AQA	TCERG1_ENST00000394421.2_In_Frame_Ins_p.219_219A>AQA	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	219	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ccaggcccaggcccaggcccaa	0.723																																					p.A219delinsAQA													.	TCERG1	148		0			c.655_656insCCCAGG																																									SO:0001652	inframe_insertion	10915	exon4			GCCCAGGCCCAGG	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.656_661dupCCCAGG	5.37:g.145838664_145838669dupCCCAGG	ENSP00000296702:p.GlnAla241dup		Somatic	128	0	0		WXS	Illumina HiSeq	.	135	0.31	42	NM_006706	2	0.00	0	Q2NKN2|Q59EA1	In_Frame_Ins	INS	ENST00000296702.5	37	CCDS4282.1																																																																																					0.723	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251886.1		NM_001040006	
HIST1H2AA	221613	broad.mit.edu;mdanderson.org	37	6	25726743	25726743	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr6:25726743C>T	ENST00000297012.3	-	1	47	c.13G>A	c.(13-15)Ggg>Agg	p.G5R	HIST1H2BA_ENST00000274764.2_5'Flank	NM_170745.3	NP_734466.1	Q96QV6	H2A1A_HUMAN	histone cluster 1, H2aa	5						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)	13						CCCTGCTTCCCTCGTCCAGAC	0.527																																					p.G5R													HIST1H2AA,NS,malignant_melanoma,+2,2	HIST1H2AA	34	2	0			c.G13A												473.0	365.0	401.0					6																	25726743		2203	4300	6503	SO:0001583	missense	221613	exon1			GCTTCCCTCGTCC	AY131982	CCDS4562.1	6p22.2	2011-01-27	2006-10-11		ENSG00000164508	ENSG00000164508		"""Histones / Replication-dependent"""	18729	protein-coding gene	gene with protein product		613499	"""H2A histone family, member R"", ""histone 1, H2aa"""			12408966	Standard	NM_170745		Approved	bA317E16.2, H2AFR	uc003nfc.3	Q96QV6	OTTHUMG00000014407	ENST00000297012.3:c.13G>A	6.37:g.25726743C>T	ENSP00000297012:p.Gly5Arg		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	63	0.05	3	NM_170745	0		0		Missense_Mutation	SNP	ENST00000297012.3	37	CCDS4562.1	.	.	.	.	.	.	.	.	.	.	C	9.769	1.172224	0.21704	.	.	ENSG00000164508	ENST00000297012	T	0.43688	0.94	3.34	-2.07	0.07276	Histone-fold (2);Histone H2A (1);	0.272209	0.23710	N	0.045340	T	0.26593	0.0650	M	0.94101	3.495	0.09310	N	0.999996	B	0.12630	0.006	B	0.04013	0.001	T	0.36792	-0.9733	10	0.62326	D	0.03	.	4.582	0.12264	0.1472:0.4759:0.0:0.377	.	5	Q96QV6	H2A1A_HUMAN	R	5	ENSP00000297012:G5R	ENSP00000297012:G5R	G	-	1	0	HIST1H2AA	25834722	0.001000	0.12720	0.000000	0.03702	0.044000	0.14063	1.471000	0.35365	-0.493000	0.06678	0.555000	0.69702	GGG			0.527	HIST1H2AA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040065.1		NM_170745	
HLA-DRB6	3128	broad.mit.edu	37	6	32521876	32521891	+	RNA	DEL	GGGAAAAAATTTATTT	GGGAAAAAATTTATTT	-	rs371496233|rs374359326|rs199520858		TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	GGGAAAAAATTTATTT	GGGAAAAAATTTATTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr6:32521876_32521891delGGGAAAAAATTTATTT	ENST00000411500.1	-	0	740					NR_001298.1				major histocompatibility complex, class II, DR beta 6 (pseudogene)																		ATTTTTTCTGGGGAAAAAATTTATTTTTTCTGGGGG	0.347																																					.													.	.			0			.																																											0	.			TTTCTGGGGAAAA	L76566		6p21.3	2011-07-08			ENSG00000229391	ENSG00000229391		"""Histocompatibility complex"""	4954	pseudogene	pseudogene						1529427, 10436177	Standard	NR_001298		Approved		uc003obn.1		OTTHUMG00000031028		6.37:g.32521876_32521891delGGGAAAAAATTTATTT			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	16	0.31	5	.	0		0		RNA	DEL	ENST00000411500.1	37																																																																																						0.347	HLA-DRB6-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000272900.1		NR_001298	
SP8	221833	mdanderson.org	37	7	20824970	20824970	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr7:20824970C>T	ENST00000361443.4	-	3	649	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	SP8_ENST00000418710.2_Missense_Mutation_p.G156S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	138					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						ccgccgccgccgctgcccccg	0.761																																					p.G156S													.	.			0			c.G466A																																									SO:0001583	missense	221833	exon2			CGCCGCCGCTGCC		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.412G>A	7.37:g.20824970C>T	ENSP00000354482:p.Gly138Ser		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_182700	0		0	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	6.365	0.435495	0.12045	.	.	ENSG00000164651	ENST00000418710;ENST00000361443	D;D	0.81821	-1.54;-1.54	3.09	2.16	0.27623	.	0.366549	0.17990	U	0.155235	T	0.58308	0.2113	N	0.08118	0	0.31008	N	0.719562	D;D	0.55605	0.972;0.972	B;B	0.41860	0.368;0.368	T	0.60005	-0.7347	10	0.08837	T	0.75	.	10.7467	0.46185	0.1919:0.8081:0.0:0.0	.	138;138	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	156;138	ENSP00000408792:G156S;ENSP00000354482:G138S	ENSP00000354482:G138S	G	-	1	0	SP8	20791495	.	.	0.969000	0.41365	0.291000	0.27294	.	.	0.455000	0.26910	0.306000	0.20318	GGC			0.761	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000326904.2			
GS1-124K5.2	0	broad.mit.edu	37	7	65949693	65949694	+	RNA	INS	-	-	A	rs566579750|rs560564041|rs191607615	byFrequency	TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr7:65949693_65949694insA	ENST00000442578.1	-	0	101																											GGTACCATTTTAAAAAAAAACA	0.282																																					.													.	.			0			.																																											0	.			CCATTTTAAAAAA																													7.37:g.65949702_65949702dupA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000442578.1	37																																																																																						0.282	GS1-124K5.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	pseudogene		OTTHUMT00000344730.1			
BAZ1B	9031	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	72892059	72892060	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr7:72892059_72892060delTC	ENST00000339594.4	-	7	2069_2070	c.1731_1732delGA	c.(1729-1734)cagaagfs	p.K578fs	BAZ1B_ENST00000404251.1_Frame_Shift_Del_p.K578fs	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	578	Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TCATACCGCTTCTGTTTTTCTA	0.436																																					p.578_578del	Esophageal Squamous(112;1167 1561 21085 43672 48228)												.	BAZ1B	147		0			c.1732_1733del																																									SO:0001589	frameshift_variant	9031	exon7			ACCGCTTCTGTTT	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.1731_1732delGA	7.37:g.72892059_72892060delTC	ENSP00000342434:p.Lys578fs		Somatic	173	0	0		WXS	Illumina HiSeq	.	200	0.15	30	NM_032408	4	0.00	0	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Frame_Shift_Del	DEL	ENST00000339594.4	37	CCDS5549.1																																																																																					0.436	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252123.4		NM_032408	
ZNF777	27153	mdanderson.org	37	7	149128883	149128883	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr7:149128883G>T	ENST00000247930.4	-	6	2803	c.2480C>A	c.(2479-2481)aCc>aAc	p.T827N		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	743					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GCCCGTGTGGGTCCGCAGGTG	0.771																																					p.T827N													.	.			0			c.C2480A												11.0	13.0	13.0					7																	149128883		2169	4268	6437	SO:0001583	missense	27153	exon6			GTGTGGGTCCGCA	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.2480C>A	7.37:g.149128883G>T	ENSP00000247930:p.Thr827Asn		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	11	0.27	3	NM_015694	7	0.00	0	Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	37	CCDS43675.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688613	0.48097	.	.	ENSG00000196453	ENST00000247930	T	0.07800	3.16	4.51	3.63	0.41609	.	.	.	.	.	T	0.18045	0.0433	.	.	.	0.29442	N	0.859062	P	0.52463	0.953	P	0.55260	0.772	T	0.02526	-1.1146	8	0.59425	D	0.04	-16.0071	10.206	0.43114	0.0993:0.0:0.9006:0.0	.	827	Q9ULD5-2	.	N	827	ENSP00000247930:T827N	ENSP00000247930:T827N	T	-	2	0	ZNF777	148759816	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.636000	0.46545	0.887000	0.36136	-0.339000	0.08088	ACC			0.771	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352708.1		NM_015694	
UBXN8	7993	broad.mit.edu	37	8	30614674	30614675	+	RNA	INS	-	-	A			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr8:30614674_30614675insA	ENST00000519246.1	+	0	727							O00124	UBXN8_HUMAN	UBX domain protein 8						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|single fertilization (GO:0007338)	integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(1)|lung(2)	3						catctctatttaaaaaaaaaaa	0.386																																					.	Colon(169;855 1943 17895 39459 47884)												.	UBXN8	13		0			.																																											7993	.			TCTATTTAAAAAA	D83767	CCDS75723.1, CCDS75724.1, CCDS75725.1	8p12-p11.2	2012-07-06	2008-07-25	2008-07-25		ENSG00000104691		"""UBX domain containing"""	30307	protein-coding gene	gene with protein product		602155	"""UBX domain containing 6"""	UBXD6		9027507, 21949850	Standard	NM_005671		Approved	D8S2298E, REP8	uc003xii.3	O00124			8.37:g.30614685_30614685dupA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	Q7Z6F2	RNA	INS	ENST00000519246.1	37																																																																																						0.386	UBXN8-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000375957.1		NM_005671	
RP11-369K17.1	0	broad.mit.edu	37	8	122125472	122125472	+	lincRNA	DEL	T	T	-	rs542537201	byFrequency	TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr8:122125472delT	ENST00000517739.1	+	0	258																											TATTGCCGTGTTTTTTTTTTT	0.328																																					.													.	.			0			.																																											0	.			GCCGTGTTTTTTT																													8.37:g.122125472delT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	0		0		RNA	DEL	ENST00000517739.1	37																																																																																						0.328	RP11-369K17.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000381541.1			
PLEC	5339	mdanderson.org	37	8	145001861	145001861	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr8:145001861T>C	ENST00000322810.4	-	27	4053	c.3884A>G	c.(3883-3885)gAg>gGg	p.E1295G	PLEC_ENST00000354958.2_Missense_Mutation_p.E1136G|PLEC_ENST00000356346.3_Missense_Mutation_p.E1144G|PLEC_ENST00000527096.1_Missense_Mutation_p.E1181G|PLEC_ENST00000354589.3_Missense_Mutation_p.E1158G|PLEC_ENST00000398774.2_Missense_Mutation_p.E1126G|PLEC_ENST00000345136.3_Missense_Mutation_p.E1158G|PLEC_ENST00000436759.2_Missense_Mutation_p.E1185G|PLEC_ENST00000357649.2_Missense_Mutation_p.E1162G	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1295	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTCCCCCACCTCCTGTGCCCC	0.721																																					p.E1295G													.	.			0			c.A3884G												5.0	6.0	6.0					8																	145001861		1998	4051	6049	SO:0001583	missense	5339	exon27			CCCACCTCCTGTG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3884A>G	8.37:g.145001861T>C	ENSP00000323856:p.Glu1295Gly		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_201380	0		0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	T	12.07	1.826359	0.32329	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2;1.2;1.2;1.2	5.44	4.25	0.50352	.	0.092481	0.40469	U	0.001089	T	0.34890	0.0913	L	0.46157	1.445	0.38215	D	0.940584	P;P;P;P;P;P;P;P	0.38078	0.617;0.617;0.617;0.483;0.617;0.617;0.617;0.617	B;B;B;B;B;B;B;B	0.39660	0.306;0.306;0.306;0.162;0.306;0.306;0.306;0.306	T	0.31971	-0.9924	10	0.66056	D	0.02	.	12.1384	0.53984	0.0:0.0:0.1436:0.8564	.	1185;1144;1136;1295;1126;1158;1162;1158	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	G	1158;1162;1158;1126;1295;1136;1144;1185;1181	ENSP00000344848:E1158G;ENSP00000350277:E1162G;ENSP00000346602:E1158G;ENSP00000381756:E1126G;ENSP00000323856:E1295G;ENSP00000347044:E1136G;ENSP00000348702:E1144G;ENSP00000388180:E1185G;ENSP00000434583:E1181G	ENSP00000323856:E1295G	E	-	2	0	PLEC	145073849	0.416000	0.25424	1.000000	0.80357	0.658000	0.38924	0.748000	0.26305	0.851000	0.35264	0.519000	0.50382	GAG			0.721	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
FGD3	89846	mdanderson.org	37	9	95797716	95797716	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr9:95797716C>T	ENST00000375482.3	+	18	2519	c.2023C>T	c.(2023-2025)Cag>Tag	p.Q675*	FGD3_ENST00000337352.6_Nonsense_Mutation_p.Q675*|FGD3_ENST00000538555.1_Nonsense_Mutation_p.Q278*|FGD3_ENST00000416701.2_Nonsense_Mutation_p.Q674*	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	675	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						GTGGAAGCTGCAGTGGGCCAA	0.667																																					p.Q675X													.	.			0			c.C2023T												32.0	41.0	38.0					9																	95797716		2168	4270	6438	SO:0001587	stop_gained	89846	exon18			AAGCTGCAGTGGG	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.2023C>T	9.37:g.95797716C>T	ENSP00000364631:p.Gln675*		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	67	0.06	4	NM_001083536	18	0.00	0	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Nonsense_Mutation	SNP	ENST00000375482.3	37	CCDS43849.1	.	.	.	.	.	.	.	.	.	.	C	41	9.019181	0.99038	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352;ENST00000538555	.	.	.	4.52	3.61	0.41365	.	0.434101	0.17260	N	0.180816	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	7.527	0.27660	0.0:0.8866:0.0:0.1134	.	.	.	.	X	675;674;675;278	.	ENSP00000336914:Q675X	Q	+	1	0	FGD3	94837537	0.065000	0.20965	0.550000	0.28217	0.586000	0.36452	1.597000	0.36729	2.468000	0.83385	0.561000	0.74099	CAG			0.667	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000055493.1		NM_033086	
NAIF1	203245	mdanderson.org	37	9	130829051	130829051	+	Silent	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr9:130829051G>T	ENST00000373078.4	-	1	549	c.330C>A	c.(328-330)ggC>ggA	p.G110G	SLC25A25_ENST00000373069.5_5'Flank|NAIF1_ENST00000488519.1_5'Flank|SLC25A25_ENST00000373068.2_5'Flank	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	110	Gly-rich.				negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G110G(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CACTGCCACCGCCTGTCCCAG	0.706																																					p.G110G													NAIF1,NS,carcinoma,0,1	NAIF1	0	1	1	Substitution - coding silent(1)	endometrium(1)	c.C330A												33.0	34.0	34.0					9																	130829051		2195	4289	6484	SO:0001819	synonymous_variant	203245	exon1			GCCACCGCCTGTC	AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.330C>A	9.37:g.130829051G>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	42	0.10	4	NM_197956	2	0.00	0	B3KV81|Q8WU12	Silent	SNP	ENST00000373078.4	37	CCDS6889.1																																																																																					0.706	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054330.1		NM_197956	
CDR1	1038	broad.mit.edu	37	X	139866495	139866495	+	Missense_Mutation	SNP	C	C	T	rs147745826	byFrequency	TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chrX:139866495C>T	ENST00000370532.2	-	1	228	c.37G>A	c.(37-39)Gta>Ata	p.V13I		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	13	23 X 6 AA approximate repeats.									breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				AACAAAGGTACGTCTTCCAGA	0.418																																					p.V13I													.	CDR1	58		0			c.G37A							C	ILE/VAL	0,3835		0,0,0,1632,571	164.0	156.0	159.0		37	-1.7	0.0	X	dbSNP_134	159	2,6726		0,1,1,2427,1871	no	missense	CDR1	NM_004065.2	29	0,1,1,4059,2442	TT,TC,T,CC,C		0.0297,0.0,0.0189	benign	13/263	139866495	2,10561	2203	4300	6503	SO:0001583	missense	1038	exon1			AAGGTACGTCTTC		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.37G>A	X.37:g.139866495C>T	ENSP00000359563:p.Val13Ile		Somatic	380	0.0078947368	3		WXS	Illumina HiSeq	Phase_I	699	0.01	7	NM_004065	0		0	Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359634	0.24598	0.0	2.97E-4	ENSG00000184258	ENST00000370532	T	0.33438	1.41	3.33	-1.7	0.08159	.	.	.	.	.	T	0.13329	0.0323	N	0.24115	0.695	0.09310	N	1	P	0.43826	0.818	B	0.29524	0.103	T	0.17440	-1.0369	8	.	.	.	.	7.585	0.27987	0.0:0.2992:0.0:0.7008	.	13	P51861	CDR1_HUMAN	I	13	ENSP00000359563:V13I	.	V	-	1	0	CDR1	139694161	0.000000	0.05858	0.003000	0.11579	0.008000	0.06430	-4.204000	0.00274	-0.516000	0.06470	0.544000	0.68410	GTA			0.418	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058583.1		NM_004065	
LTBP4	8425	hgsc.bcm.edu;mdanderson.org	37	19	41128449	41128449	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALT-01A-11D-A42Y-10	TCGA-2G-AALT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7931e069-fecb-4dd0-aac4-0eb70729e93c	2e330225-3768-4881-a499-65117453697e	g.chr19:41128449G>T	ENST00000308370.7	+	27	3559	c.3559G>T	c.(3559-3561)Gcg>Tcg	p.A1187S	LTBP4_ENST00000396819.3_Missense_Mutation_p.A1120S|LTBP4_ENST00000545697.1_Missense_Mutation_p.A555S|LTBP4_ENST00000204005.9_Missense_Mutation_p.A1150S|LTBP4_ENST00000243562.9_3'UTR|LTBP4_ENST00000602240.1_3'UTR	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1188	TB 3.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTTTGACACAGCGGCCCCGGA	0.682																																					.													.	.			0			.												35.0	39.0	38.0					19																	41128449		2036	4187	6223	SO:0001583	missense	8425	.			GACACAGCGGCCC	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3559G>T	19.37:g.41128449G>T	ENSP00000311905:p.Ala1187Ser		Somatic	64	0	0		WXS	Illumina HiSeq	.	63	0.06	4	.	180	0.00	0	O00508|O75412|O75413	Missense_Mutation	SNP	ENST00000308370.7	37		.	.	.	.	.	.	.	.	.	.	G	5.465	0.270930	0.10349	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819	D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03	3.89	2.84	0.33178	Matrix fibril-associated (2);TGF-beta binding (1);	0.225320	0.22602	N	0.057948	D	0.84902	0.5575	.	.	.	0.22066	N	0.999389	B;P;P;P;P	0.44006	0.058;0.646;0.824;0.688;0.688	B;B;B;B;B	0.38803	0.025;0.132;0.282;0.185;0.185	T	0.74777	-0.3550	9	0.21540	T	0.41	.	10.7116	0.45986	0.099:0.0:0.901:0.0	.	200;408;1120;1188;1150	Q8N2S1-4;B3KXY6;E7EUU1;Q8N2S1;E7ENG9	.;.;.;LTBP4_HUMAN;.	S	1150;555;1187;1120	ENSP00000204005:A1150S;ENSP00000441054:A555S;ENSP00000311905:A1187S;ENSP00000380031:A1120S	ENSP00000204005:A1150S	A	+	1	0	LTBP4	45820289	0.001000	0.12720	0.138000	0.22173	0.921000	0.55340	1.085000	0.30840	0.972000	0.38314	0.462000	0.41574	GCG			0.682	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_003573	
