#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	mdanderson.org	37	1	6194211	6194211	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:6194211G>T	ENST00000262450.3	-	20	3220	c.3121C>A	c.(3121-3123)Cac>Aac	p.H1041N	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AGCACACGGTGCCCCTCATCC	0.617																																					p.H1041N													.	.			0			c.C3121A												78.0	75.0	76.0					1																	6194211		2203	4300	6503	SO:0001583	missense	26038	exon20			CACGGTGCCCCTC	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3121C>A	1.37:g.6194211G>T	ENSP00000262450:p.His1041Asn		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_015557	0		0	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755006	0.89843	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	T	0.72282	-0.64	4.67	4.67	0.58626	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82697	0.5093	M	0.69523	2.12	0.80722	D	1	D	0.57899	0.981	D	0.67900	0.954	D	0.83680	0.0171	10	0.48119	T	0.1	-34.2877	17.9248	0.88980	0.0:0.0:1.0:0.0	.	1041	Q8TDI0	CHD5_HUMAN	N	1041;557;449;449	ENSP00000262450:H1041N	ENSP00000262450:H1041N	H	-	1	0	CHD5	6116798	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	9.710000	0.98732	2.301000	0.77427	0.561000	0.74099	CAC			0.617	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000002823.2		NM_015557	
SLC45A1	50651	mdanderson.org	37	1	8390578	8390578	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:8390578G>A	ENST00000471889.1	+	5	1410	c.1025G>A	c.(1024-1026)aGc>aAc	p.S342N	Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000481265.1_3'UTR|SLC45A1_ENST00000377479.2_Missense_Mutation_p.S376N|SLC45A1_ENST00000289877.8_Missense_Mutation_p.S342N			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	342					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TCGCCGCCCAGCCCCCTCACG	0.677																																					p.S342N													.	.			0			c.G1025A												34.0	33.0	33.0					1																	8390578		2203	4300	6503	SO:0001583	missense	50651	exon4			CGCCCAGCCCCCT	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1025G>A	1.37:g.8390578G>A	ENSP00000418096:p.Ser342Asn		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	75	0.05	4	NM_001080397	3	0.00	0	Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	37	CCDS30577.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123010	0.77436	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	T;T;T	0.31769	1.54;1.48;1.54	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.50684	0.1630	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.42749	-0.9433	10	0.16896	T	0.51	-40.4429	16.5386	0.84378	0.0:0.0:1.0:0.0	.	342	Q9Y2W3	S45A1_HUMAN	N	342;376;342	ENSP00000418096:S342N;ENSP00000366699:S376N;ENSP00000289877:S342N	ENSP00000289877:S342N	S	+	2	0	SLC45A1	8313165	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	9.356000	0.97091	2.121000	0.65114	0.561000	0.74099	AGC			0.677	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001245.5			
EFHD2	79180	mdanderson.org	37	1	15736569	15736569	+	Silent	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:15736569G>A	ENST00000375980.4	+	1	179	c.102G>A	c.(100-102)gcG>gcA	p.A34A	RP3-467K16.4_ENST00000427824.1_lincRNA	NM_024329.5	NP_077305.2	Q96C19	EFHD2_HUMAN	EF-hand domain family, member D2	34						membrane (GO:0016020)	calcium ion binding (GO:0005509)			large_intestine(1)|skin(1)	2		Renal(390;0.00145)|Breast(348;0.00173)|Colorectal(325;0.00215)|all_lung(284;0.00366)|Lung NSC(340;0.00395)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)|Hepatocellular(190;0.152)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.59e-07)|COAD - Colon adenocarcinoma(227;3.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000119)|KIRC - Kidney renal clear cell carcinoma(229;0.00251)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		ACGGGGCAGCGGCGGCGGCGG	0.776																																					p.A34A													.	.			0			c.G102A												1.0	1.0	1.0					1																	15736569		329	807	1136	SO:0001819	synonymous_variant	79180	exon1			GGCAGCGGCGGCG	BC014923	CCDS155.1	1p36	2014-07-01	2005-01-25		ENSG00000142634	ENSG00000142634		"""EF-hand domain containing"""	28670	protein-coding gene	gene with protein product	"""swiprosin-1"""		"""EF hand domain containing 2"""			21244694	Standard	NM_024329		Approved	MGC4342	uc001awh.2	Q96C19	OTTHUMG00000002254	ENST00000375980.4:c.102G>A	1.37:g.15736569G>A			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_024329	0		0	Q5JYW9	Silent	SNP	ENST00000375980.4	37	CCDS155.1																																																																																					0.776	EFHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006433.1		NM_024329	
EPHA2	1969	bcgsc.ca	37	1	16462158	16462158	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:16462158G>T	ENST00000358432.5	-	6	1574	c.1420C>A	c.(1420-1422)Cgc>Agc	p.R474S		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	474	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	ACCTTCTTGCGGTAAGTGACC	0.632																																					p.R474S													.	EPHA2	102		0			c.C1420A												61.0	58.0	59.0					1																	16462158		2203	4300	6503	SO:0001583	missense	1969	exon6			TCTTGCGGTAAGT	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.1420C>A	1.37:g.16462158G>T	ENSP00000351209:p.Arg474Ser		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_1	56	0.07	4	NM_004431	34	0.00	0	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	37	CCDS169.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.576454	0.45902	.	.	ENSG00000142627	ENST00000358432	T	0.57436	0.4	5.26	5.26	0.73747	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.124523	0.36932	N	0.002339	T	0.47967	0.1474	L	0.52823	1.66	0.38527	D	0.948877	B;B	0.25312	0.123;0.001	B;B	0.24541	0.054;0.001	T	0.53034	-0.8495	10	0.59425	D	0.04	.	11.4561	0.50183	0.0:0.0:0.8201:0.1799	.	474;474	B5A968;P29317	.;EPHA2_HUMAN	S	474	ENSP00000351209:R474S	ENSP00000351209:R474S	R	-	1	0	EPHA2	16334745	0.982000	0.34865	1.000000	0.80357	0.975000	0.68041	1.463000	0.35277	2.466000	0.83321	0.556000	0.70494	CGC			0.632	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026322.1		NM_004431	
SERINC2	347735	broad.mit.edu	37	1	31897662	31897662	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:31897662A>C	ENST00000373709.3	+	3	484	c.334A>C	c.(334-336)Acc>Ccc	p.T112P	SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000373710.1_Missense_Mutation_p.T121P|SERINC2_ENST00000536384.1_Missense_Mutation_p.T116P|SERINC2_ENST00000536859.1_Missense_Mutation_p.T116P	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	112					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CTTCTTTTTCACCCTGCTCAT	0.657																																					p.T121P													.	SERINC2	44		0			c.A361C												18.0	19.0	19.0					1																	31897662		2203	4299	6502	SO:0001583	missense	347735	exon4			TTTTTCACCCTGC	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.334A>C	1.37:g.31897662A>C	ENSP00000362813:p.Thr112Pro		Somatic	75	0.1066666667	8		WXS	Illumina HiSeq	Phase_I	72	0.17	12	NM_001199038	170	0.14	24	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	ENST00000373709.3	37	CCDS30662.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.027057	0.35797	.	.	ENSG00000168528	ENST00000373710;ENST00000536859;ENST00000373709;ENST00000536384	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	4.3	1.86	0.25419	.	0.398700	0.29355	N	0.012382	T	0.11879	0.0289	L	0.43152	1.355	0.28690	N	0.90465	B;B;B;P	0.35328	0.33;0.33;0.33;0.495	B;B;B;B	0.41412	0.356;0.356;0.356;0.356	T	0.12192	-1.0557	10	0.41790	T	0.15	-30.1886	2.2137	0.03955	0.3941:0.0:0.1942:0.4117	.	116;121;116;112	B4DJK5;E7EUZ9;B7Z567;Q96SA4	.;.;.;SERC2_HUMAN	P	121;116;112;116	ENSP00000362814:T121P;ENSP00000444307:T116P;ENSP00000362813:T112P;ENSP00000439048:T116P	ENSP00000362813:T112P	T	+	1	0	SERINC2	31670249	0.003000	0.15002	0.968000	0.41197	0.339000	0.28857	0.973000	0.29422	0.183000	0.20059	0.533000	0.62120	ACC			0.657	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010680.1		NM_018565	
SPOCD1	90853	mdanderson.org	37	1	32259490	32259490	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:32259490G>T	ENST00000360482.2	-	12	2521	c.2392C>A	c.(2392-2394)Ccc>Acc	p.P798T	SPOCD1_ENST00000373648.2_3'UTR|RP11-84A19.3_ENST00000527035.1_RNA|SPOCD1_ENST00000257100.3_Missense_Mutation_p.P291T|SPOCD1_ENST00000533231.1_Missense_Mutation_p.P798T	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	798					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TCATTCGAGGGCTCCCAGTCT	0.567																																					p.P798T													.	.			0			c.C2392A												79.0	85.0	83.0					1																	32259490		2203	4300	6503	SO:0001583	missense	90853	exon12			TCGAGGGCTCCCA	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2392C>A	1.37:g.32259490G>T	ENSP00000353670:p.Pro798Thr		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_144569	4	0.00	0	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.636|9.636	1.137738|1.137738	0.21123|0.21123	.|.	.|.	ENSG00000134668|ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000294514;ENST00000452755;ENST00000533231;ENST00000449266|ENST00000528579	T;T;T;T|.	0.52754|.	0.7;1.68;0.65;1.68|.	4.82|4.82	0.127|0.127	0.14727|0.14727	.|.	.|.	.|.	.|.	.|.	T|T	0.40791|0.40791	0.1131|0.1131	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	0.999998|0.999998	B;B;B|.	0.32573|.	0.031;0.376;0.1|.	B;B;B|.	0.30401|.	0.028;0.115;0.054|.	T|T	0.34700|0.34700	-0.9818|-0.9818	9|5	0.54805|.	T|.	0.06|.	-3.112|-3.112	5.7924|5.7924	0.18367|0.18367	0.3333:0.1405:0.5262:0.0|0.3333:0.1405:0.5262:0.0	.|.	798;234;798|.	Q6ZMY3-2;E9PPM7;Q6ZMY3|.	.;.;SPOC1_HUMAN|.	T|R	291;798;195;234;798;141|171	ENSP00000257100:P291T;ENSP00000353670:P798T;ENSP00000399778:P234T;ENSP00000435851:P798T|.	ENSP00000257100:P291T|.	P|S	-|-	1|3	0|2	SPOCD1|SPOCD1	32032077|32032077	0.056000|0.056000	0.20664|0.20664	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.050000|0.050000	0.14120|0.14120	-0.304000|-0.304000	0.08843|0.08843	-1.595000|-1.595000	0.00837|0.00837	CCC|AGC			0.567	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000381912.1		NM_144569	
S100PBP	64766	mdanderson.org	37	1	33295580	33295580	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:33295580G>T	ENST00000373475.5	+	5	1190	c.936G>T	c.(934-936)acG>acT	p.T312T	S100PBP_ENST00000373476.1_Silent_p.T312T|S100PBP_ENST00000356689.3_3'UTR|S100PBP_ENST00000398243.3_Silent_p.T311T	NM_022753.3	NP_073590.2			S100P binding protein											endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|stomach(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				ATGTTCCGACGTTTTCACAGT	0.393																																					p.T312T													.	.			0			c.G936T												94.0	88.0	90.0					1																	33295580		2203	4300	6503	SO:0001819	synonymous_variant	64766	exon5			TCCGACGTTTTCA	BX647916	CCDS30666.1	1p35.1	2008-02-05			ENSG00000116497	ENSG00000116497			25768	protein-coding gene	gene with protein product	"""S100P binding protein 1"""	611889				12477932	Standard	NM_022753		Approved	FLJ12903, S100PBPR	uc001bwc.4	Q96BU1	OTTHUMG00000003955	ENST00000373475.5:c.936G>T	1.37:g.33295580G>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_022753	36	0.00	0		Silent	SNP	ENST00000373475.5	37	CCDS30666.1																																																																																					0.393	S100PBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011266.1		NM_022753	
CLCC1	23155	broad.mit.edu	37	1	109492518	109492518	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:109492518T>C	ENST00000369971.2	-	3	284	c.155A>G	c.(154-156)aAg>aGg	p.K52R	CLCC1_ENST00000369970.3_Missense_Mutation_p.K52R|CLCC1_ENST00000415331.1_Missense_Mutation_p.K52R|CLCC1_ENST00000369969.2_Missense_Mutation_p.K52R|CLCC1_ENST00000356970.2_Missense_Mutation_p.K52R|CLCC1_ENST00000302500.4_Missense_Mutation_p.K52R|CLCC1_ENST00000369976.1_Missense_Mutation_p.K52R|CLCC1_ENST00000348264.2_Missense_Mutation_p.K52R|CLCC1_ENST00000369968.2_Missense_Mutation_p.K52R|AKNAD1_ENST00000357393.4_Intron	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	52						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		ACTGACATCCTTTTCCCCTGA	0.279																																					p.K52R													.	CLCC1	55		0			c.A155G												58.0	59.0	59.0					1																	109492518		2203	4290	6493	SO:0001583	missense	23155	exon3			ACATCCTTTTCCC	AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.155A>G	1.37:g.109492518T>C	ENSP00000358988:p.Lys52Arg		Somatic	418	0.0023923445	1		WXS	Illumina HiSeq	Phase_I	541	0.01	5	NM_001048210	40	0.00	0	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	37	CCDS41362.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.272517	0.80580	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369968;ENST00000369976;ENST00000369970;ENST00000348264;ENST00000302500	T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.41	5.41	0.78517	.	0.597033	0.18496	N	0.139493	T	0.42494	0.1205	M	0.62723	1.935	0.19775	N	0.999957	P;P;P;P	0.50819	0.827;0.827;0.804;0.939	P;B;P;P	0.51324	0.526;0.439;0.467;0.666	T	0.38564	-0.9655	10	0.51188	T	0.08	-5.3424	12.107	0.53818	0.0:0.0:0.0:1.0	.	52;52;52;52	Q96S66-4;Q96S66-3;Q96S66-2;Q96S66	.;.;.;CLCC1_HUMAN	R	52	ENSP00000349456:K52R;ENSP00000358988:K52R;ENSP00000411591:K52R;ENSP00000358986:K52R;ENSP00000358985:K52R;ENSP00000358993:K52R;ENSP00000358987:K52R;ENSP00000337243:K52R;ENSP00000306552:K52R	ENSP00000306552:K52R	K	-	2	0	CLCC1	109294041	0.008000	0.16893	0.271000	0.24616	0.493000	0.33554	1.671000	0.37513	2.166000	0.68216	0.460000	0.39030	AAG			0.279	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032405.1		NM_015127	
RGS4	5999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	163043412	163043412	+	Splice_Site	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:163043412G>A	ENST00000367909.6	+	4	718	c.378G>A	c.(376-378)gaG>gaA	p.E126E	RGS4_ENST00000531057.1_Intron|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367906.3_Splice_Site_p.E108E|RGS4_ENST00000527809.1_Splice_Site_p.E108E|RGS4_ENST00000421743.2_Splice_Site_p.E223E|RGS4_ENST00000367908.4_Intron	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	126	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						CAACCAAAGAGGTAGGttttt	0.338																																					p.E223E	Ovarian(76;1257 1738 3039 6086)												.	.			0			c.G669A												61.0	56.0	58.0					1																	163043412		2203	4299	6502	SO:0001630	splice_region_variant	5999	exon5			CAAAGAGGTAGGT	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.378+1G>A	1.37:g.163043412G>A			Somatic	114	0	0		WXS	Illumina HiSeq	.	133	0.23	31	NM_001102445	17	0.35	6	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Silent	SNP	ENST00000367909.6	37	CCDS1243.1																																																																																					0.338	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083197.2		NM_005613	Silent
ATP2B4	493	hgsc.bcm.edu;broad.mit.edu	37	1	203667380	203667380	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr1:203667380G>T	ENST00000357681.5	+	3	1412	c.289G>T	c.(289-291)Gtg>Ttg	p.V97L	ATP2B4_ENST00000391954.2_Missense_Mutation_p.V97L|ATP2B4_ENST00000341360.2_Missense_Mutation_p.V97L|ATP2B4_ENST00000367218.3_Missense_Mutation_p.V97L|ATP2B4_ENST00000367219.3_Missense_Mutation_p.V97L	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	97					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CTTAGAATTAGTGTGGGAAGC	0.493																																					p.V97L													.	.			0			c.G289T												126.0	113.0	117.0					1																	203667380		2203	4300	6503	SO:0001583	missense	493	exon3			GAATTAGTGTGGG	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.289G>T	1.37:g.203667380G>T	ENSP00000350310:p.Val97Leu		Somatic	93	0	0		WXS	Illumina HiSeq	.	98	0.05	5	NM_001001396	27	0.00	0	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.748672	0.89753	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	4.95	4.95	0.65309	ATPase, P-type cation-transporter, N-terminal (2);	0.000000	0.44097	D	0.000488	D	0.85323	0.5670	M	0.69523	2.12	0.80722	D	1	D;B;B	0.69078	0.997;0.097;0.302	D;B;P	0.79108	0.992;0.166;0.521	D	0.85061	0.0934	10	0.42905	T	0.14	-21.2251	18.1654	0.89723	0.0:0.0:1.0:0.0	.	97;97;97	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	L	97	ENSP00000350310:V97L;ENSP00000356187:V97L;ENSP00000356188:V97L;ENSP00000375816:V97L;ENSP00000340930:V97L	ENSP00000340930:V97L	V	+	1	0	ATP2B4	201934003	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.959000	0.87885	2.467000	0.83353	0.655000	0.94253	GTG			0.493	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087462.1		NM_001001396	
UNC5B	219699	mdanderson.org	37	10	73051501	73051501	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr10:73051501G>T	ENST00000335350.6	+	10	2023	c.1607G>T	c.(1606-1608)gGc>gTc	p.G536V	UNC5B_ENST00000373192.4_Missense_Mutation_p.G525V	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	536					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CAGCTCTTGGGCCTGCCCCGA	0.692																																					p.G536V													.	.			0			c.G1607T												30.0	31.0	31.0					10																	73051501		2203	4299	6502	SO:0001583	missense	219699	exon10			TCTTGGGCCTGCC	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1607G>T	10.37:g.73051501G>T	ENSP00000334329:p.Gly536Val		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_170744	48	0.00	0	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	g	13.01	2.110729	0.37242	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.48836	0.86;0.8	4.24	4.24	0.50183	.	0.318030	0.31797	N	0.007048	T	0.41305	0.1153	L	0.40543	1.245	0.53005	D	0.999964	P;P	0.44521	0.837;0.749	B;B	0.42593	0.392;0.219	T	0.39272	-0.9622	10	0.49607	T	0.09	-33.6702	12.5389	0.56158	0.0:0.3108:0.6892:0.0	.	525;536	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	V	536;525	ENSP00000334329:G536V;ENSP00000362288:G525V	ENSP00000334329:G536V	G	+	2	0	UNC5B	72721507	0.991000	0.36638	1.000000	0.80357	0.985000	0.73830	3.506000	0.53364	2.081000	0.62600	0.556000	0.70494	GGC			0.692	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048541.1		NM_170744	
SORBS1	10580	mdanderson.org	37	10	97082525	97082525	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr10:97082525G>T	ENST00000371245.3	-	25	2482	c.2456C>A	c.(2455-2457)aCa>aAa	p.T819K	SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000353505.5_Missense_Mutation_p.T819K|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000277982.5_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371247.2_Intron|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000361941.3_Intron|SORBS1_ENST00000371246.2_Intron|SORBS1_ENST00000371227.4_Missense_Mutation_p.T1180K|SORBS1_ENST00000306402.6_Intron	NM_001034956.1	NP_001030128			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTCAGATTCTGTGAGATCTGG	0.383																																					p.T819K													.	.			0			c.C2456A												123.0	110.0	115.0					10																	97082525		2203	4300	6503	SO:0001583	missense	10580	exon25			GATTCTGTGAGAT	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000371245.3:c.2456C>A	10.37:g.97082525G>T	ENSP00000360291:p.Thr819Lys		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001034956	0		0		Missense_Mutation	SNP	ENST00000371245.3	37	CCDS31256.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.168013	0.57476	.	.	ENSG00000095637	ENST00000371245;ENST00000371227;ENST00000353505	T;T;T	0.07908	3.5;3.15;3.5	5.37	5.37	0.77165	.	.	.	.	.	T	0.11922	0.0290	N	0.08118	0	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.567	D;D;B	0.83275	0.996;0.994;0.213	T	0.17992	-1.0351	9	0.05721	T	0.95	.	19.0994	0.93268	0.0:0.0:1.0:0.0	.	1180;819;462	Q9BX66-11;Q9BX66-3;Q6MZY5	.;.;.	K	819;1180;819	ENSP00000360291:T819K;ENSP00000360271:T1180K;ENSP00000343998:T819K	ENSP00000343998:T819K	T	-	2	0	SORBS1	97072515	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.124000	0.77185	2.512000	0.84698	0.655000	0.94253	ACA			0.383	SORBS1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000049519.1			
SEMA4G	57715	mdanderson.org	37	10	102743827	102743827	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr10:102743827G>A	ENST00000370250.4	+	14	2829	c.2456G>A	c.(2455-2457)cGc>cAc	p.R819H	MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000342071.1_Missense_Mutation_p.A157V|MRPL43_ENST00000370242.4_Missense_Mutation_p.A157V|SEMA4G_ENST00000517724.1_Intron|MRPL43_ENST00000318325.2_Intron|MRPL43_ENST00000370241.3_Intron|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000210633.3_Missense_Mutation_p.R824H|MRPL43_ENST00000299179.5_Intron	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	819					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		GAACTCAGCCGCATCCTGGAA	0.572																																					p.R824H													.	.			0			c.G2471A												75.0	76.0	76.0					10																	102743827		2203	4300	6503	SO:0001583	missense	57715	exon14			TCAGCCGCATCCT	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.2456G>A	10.37:g.102743827G>A	ENSP00000359270:p.Arg819His		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_017893	44	0.00	0	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	g|g|g	19.31|19.31|19.31	3.803175|3.803175|3.803175	0.70682|0.70682|0.70682	.|.|.	.|.|.	ENSG00000055950|ENSG00000095539|ENSG00000055950	ENST00000370242;ENST00000342071|ENST00000370250;ENST00000210633|ENST00000448244	.|T;T|.	.|0.23147|.	.|1.92;1.96|.	5.54|5.54|5.54	4.63|4.63|4.63	0.57726|0.57726|0.57726	.|.|.	.|0.219434|0.219434	.|0.32868|0.32868	.|U|U	.|0.005550|0.005550	T|T|T	0.42765|0.42765|0.42765	0.1217|0.1217|0.1217	L|L|L	0.29908|0.29908|0.29908	0.895|0.895|0.895	0.45676|0.45676|0.45676	D|D|D	0.998592|0.998592|0.998592	P;P|D|.	0.35226|0.89917|.	0.491;0.491|1.0|.	B;B|D|.	0.25405|0.70716|.	0.06;0.06|0.97|.	T|T|T	0.26018|0.26018|0.26018	-1.0115|-1.0115|-1.0115	8|10|6	0.72032|0.72032|.	D|D|.	0.01|0.01|.	-6.9246|-6.9246|-6.9246	6.0|6.0|6.0	0.19515|0.19515|0.19515	0.2415:0.0:0.7585:0.0|0.2415:0.0:0.7585:0.0|0.2415:0.0:0.7585:0.0	.|.|.	157;157|824|.	B1AL06;C9J5Q3|Q9NTN9-2|.	.;.|.|.	V|H|W	157|819;824|154	.|ENSP00000359270:R819H;ENSP00000210633:R824H|.	ENSP00000339844:A157V|ENSP00000210633:R824H|.	A|R|R	-|+|-	2|2|1	0|0|2	MRPL43|SEMA4G|MRPL43	102733817|102733817|102733817	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.979000|0.979000|0.979000	0.70002|0.70002|0.70002	5.711000|5.711000|5.711000	0.68400|0.68400|0.68400	2.616000|2.616000|2.616000	0.88540|0.88540|0.88540	0.550000|0.550000|0.550000	0.68814|0.68814|0.68814	GCG|CGC|CGG			0.572	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000049920.2			
TDRD1	56165	mdanderson.org	37	10	115971626	115971626	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr10:115971626G>T	ENST00000369280.1	+	14	2122	c.1662G>T	c.(1660-1662)gaG>gaT	p.E554D	TDRD1_ENST00000422662.1_Intron|TDRD1_ENST00000369282.1_Splice_Site_p.E554D|TDRD1_ENST00000369281.2_Intron|TDRD1_ENST00000251864.2_Splice_Site_p.E554D			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	554	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		CTTTTTCAGAGGATGATCAGT	0.363																																					p.E554D													.	.			0			c.G1662T												167.0	160.0	162.0					10																	115971626		2203	4300	6503	SO:0001630	splice_region_variant	56165	exon14			TTCAGAGGATGAT	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1661-1G>T	10.37:g.115971626G>T			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_198795	0		0	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	37		.	.	.	.	.	.	.	.	.	.	G	21.1	4.099542	0.76983	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369280	T;T;T	0.10668	2.85;2.85;2.85	5.8	5.8	0.92144	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.054746	0.64402	D	0.000001	T	0.27313	0.0670	M	0.65975	2.015	0.80722	D	1	P;D	0.89917	0.95;1.0	D;D	0.83275	0.941;0.996	T	0.00722	-1.1594	10	0.33940	T	0.23	.	9.0103	0.36137	0.1234:0.0:0.8766:0.0	.	554;554	Q9BXT4;Q9BXT4-3	TDRD1_HUMAN;.	D	554	ENSP00000358288:E554D;ENSP00000251864:E554D;ENSP00000358286:E554D	ENSP00000251864:E554D	E	+	3	2	TDRD1	115961616	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.755000	0.47540	2.730000	0.93505	0.563000	0.77884	GAG			0.363	TDRD1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000050457.2			Missense_Mutation
MUC2	4583	mdanderson.org	37	11	1093185	1093185	+	Silent	SNP	C	C	T	rs111164661		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr11:1093185C>T	ENST00000441003.2	+	30	5031	c.5004C>T	c.(5002-5004)acC>acT	p.T1668T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.T1635T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caacacccaccggcacacagt	0.627																																					p.T1668T													.	.			0			c.C5004T																																									SO:0001819	synonymous_variant	4583	exon30			ACCCACCGGCACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5004C>T	11.37:g.1093185C>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_002457	6	0.00	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																						0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
ZNF143	7702	hgsc.bcm.edu	37	11	9519221	9519221	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr11:9519221G>T	ENST00000396602.2	+	10	960		c.e10-1		ZNF143_ENST00000299606.2_Splice_Site|ZNF143_ENST00000396597.3_Splice_Site|ZNF143_ENST00000396604.1_Splice_Site|ZNF143_ENST00000530463.1_Splice_Site	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143						gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		TTTTCTTAAAGGTTATGGATT	0.303																																					.													.	.			0			c.842-1G>T												38.0	41.0	40.0					11																	9519221		2201	4293	6494	SO:0001630	splice_region_variant	7702	exon10			CTTAAAGGTTATG	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.842-1G>T	11.37:g.9519221G>T			Somatic	95	0	0		WXS	Illumina HiSeq	.	107	0.05	5	NM_003442	1	0.00	0	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Splice_Site	SNP	ENST00000396602.2	37	CCDS7799.2	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667632	0.88348	.	.	ENSG00000166478	ENST00000396604;ENST00000396602;ENST00000530463;ENST00000396597;ENST00000299606	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0081	0.92861	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF143	9475797	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.821000	0.99360	2.492000	0.84095	0.650000	0.86243	.			0.303	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000313921.2		NM_003442	Intron
EIF4G2	1982	broad.mit.edu	37	11	10820574	10820574	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr11:10820574G>T	ENST00000526148.1	-	21	3133	c.2623C>A	c.(2623-2625)Caa>Aaa	p.Q875K	EIF4G2_ENST00000396525.2_Missense_Mutation_p.Q837K|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000339995.5_Missense_Mutation_p.Q875K|EIF4G2_ENST00000525681.1_Missense_Mutation_p.Q875K|RP11-685M7.5_ENST00000532365.1_RNA	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GGAAACTCTTGGGTTATATCT	0.348																																					p.Q875K													.	EIF4G2	89		0			c.C2623A												94.0	105.0	101.0					11																	10820574		2201	4294	6495	SO:0001583	missense	1982	exon21			ACTCTTGGGTTAT	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.2623C>A	11.37:g.10820574G>T	ENSP00000433664:p.Gln875Lys		Somatic	222	0.0045045045	1		WXS	Illumina HiSeq	Phase_I	247	0.02	5	NM_001172705	2448	0.00	0		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924921	0.73213	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000528839	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34	6.07	6.07	0.98685	eIF4-gamma/eIF5/eIF2-epsilon (3);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.67720	0.2923	N	0.05177	-0.1	0.45621	D	0.998555	P;P	0.42993	0.797;0.797	B;B	0.39876	0.312;0.312	T	0.71751	-0.4498	9	0.38643	T	0.18	-7.2128	20.6593	0.99626	0.0:0.0:1.0:0.0	.	875;948	P78344;B4DZF2	IF4G2_HUMAN;.	K	875;875;875;837;948;223	ENSP00000433664:Q875K;ENSP00000433371:Q875K;ENSP00000340281:Q875K;ENSP00000379778:Q837K;ENSP00000434815:Q223K	ENSP00000340281:Q875K	Q	-	1	0	EIF4G2	10777150	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.576000	0.74023	2.885000	0.99019	0.655000	0.94253	CAA			0.348	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000386603.1		NM_001418	
OR4A16	81327	hgsc.bcm.edu	37	11	55110715	55110715	+	Silent	SNP	G	G	A	rs77981146	byFrequency	TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr11:55110715G>A	ENST00000314721.2	+	1	89	c.39G>A	c.(37-39)ctG>ctA	p.L13L		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L13L(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TTGTCCTCCTGGGCCTCACTC	0.388																																					p.L13L													OR4A16,NS,lymphoid_neoplasm,0,1	OR4A16	0	1	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.G39A												57.0	51.0	53.0					11																	55110715		2201	4296	6497	SO:0001819	synonymous_variant	81327	exon1			CCTCCTGGGCCTC	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.39G>A	11.37:g.55110715G>A			Somatic	28	0.0357142857	1		WXS	Illumina HiSeq	.	22	0.14	3	NM_001005274	0		0	Q6IFL3	Silent	SNP	ENST00000314721.2	37	CCDS31499.1																																																																																			0.006		0.388	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391160.1		NM_001005274	
PTGDR2	11251	mdanderson.org	37	11	60621184	60621184	+	Silent	SNP	G	G	A	rs145585912		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr11:60621184G>A	ENST00000332539.4	-	2	123	c.12C>T	c.(10-12)aaC>aaT	p.N4N	RP11-804A23.4_ENST00000538705.1_RNA	NM_004778.2	NP_004769.2	Q9Y5Y4	PD2R2_HUMAN	prostaglandin D2 receptor 2	4					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|calcium-mediated signaling (GO:0019722)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|prostaglandin D receptor activity (GO:0004956)|prostaglandin F receptor activity (GO:0004958)|prostaglandin J receptor activity (GO:0001785)									Indomethacin(DB00328)|Sulindac(DB00605)	TCAGTGTGGCGTTGGCCGACA	0.647																																					p.N4N													.	.			0			c.C12T							G		0,4364		0,0,2182	39.0	30.0	33.0		12	2.0	0.6	11	dbSNP_134	33	2,8500		0,2,4249	no	coding-synonymous	GPR44	NM_004778.2		0,2,6431	AA,AG,GG		0.0235,0.0,0.0155		4/396	60621184	2,12864	2182	4251	6433	SO:0001819	synonymous_variant	11251	exon2			TGTGGCGTTGGCC	AF118265	CCDS7994.1	11q12-q13.3	2012-08-08	2011-11-11	2011-11-11		ENSG00000183134		"""CD molecules"", ""GPCR / Class A : Prostanoid receptors"""	4502	protein-coding gene	gene with protein product	"""chemoattractant receptor homologous molecule expressed on T helper type 2 cells"""	604837	"""G protein-coupled receptor 44"""	GPR44		10036181	Standard	NM_004778		Approved	CRTH2, CD294, DP2	uc001nqc.2	Q9Y5Y4		ENST00000332539.4:c.12C>T	11.37:g.60621184G>A			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_004778	0		0	O94765|Q4QRI6	Silent	SNP	ENST00000332539.4	37	CCDS7994.1																																																																																			0		0.647	PTGDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396328.1		NM_004778	
C11orf53	341032	mdanderson.org	37	11	111156435	111156435	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr11:111156435G>T	ENST00000280325.4	+	4	514	c.367G>T	c.(367-369)Gcc>Tcc	p.A123S		NM_198498.1	NP_940900.1	Q8IXP5	CK053_HUMAN	chromosome 11 open reading frame 53	123										endometrium(1)|large_intestine(2)|lung(3)|skin(2)	8		all_cancers(61;2.05e-09)|Melanoma(852;4.04e-05)|all_epithelial(67;6.15e-05)|all_hematologic(158;0.000826)|Acute lymphoblastic leukemia(157;0.000966)|all_neural(223;0.0332)|Medulloblastoma(222;0.0425)|Breast(348;0.147)		Epithelial(105;1.7e-06)|BRCA - Breast invasive adenocarcinoma(274;3.16e-06)|all cancers(92;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0507)		CCCTGTGTCTGCCGATGCCCT	0.617																																					p.A123S													.	.			0			c.G367T												77.0	68.0	71.0					11																	111156435		2201	4297	6498	SO:0001583	missense	341032	exon4			GTGTCTGCCGATG	BC039669	CCDS31674.1	11q23.1	2012-05-31			ENSG00000150750	ENSG00000150750			30527	protein-coding gene	gene with protein product						12477932	Standard	NM_198498		Approved	MGC50104	uc001plc.3	Q8IXP5	OTTHUMG00000166656	ENST00000280325.4:c.367G>T	11.37:g.111156435G>T	ENSP00000280325:p.Ala123Ser		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_198498	0		0		Missense_Mutation	SNP	ENST00000280325.4	37	CCDS31674.1	.	.	.	.	.	.	.	.	.	.	G	4.546	0.101334	0.08731	.	.	ENSG00000150750	ENST00000280325	.	.	.	4.96	-4.62	0.03370	.	0.696787	0.14026	N	0.346459	T	0.20333	0.0489	L	0.42245	1.32	0.09310	N	1	B	0.13145	0.007	B	0.15870	0.014	T	0.38112	-0.9676	9	0.05833	T	0.94	-8.2594	1.5641	0.02601	0.4715:0.1067:0.1979:0.2239	.	123	Q8IXP5	CK053_HUMAN	S	123	.	ENSP00000280325:A123S	A	+	1	0	C11orf53	110661645	0.000000	0.05858	0.000000	0.03702	0.237000	0.25408	-1.004000	0.03678	-0.416000	0.07473	0.561000	0.74099	GCC			0.617	C11orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390989.1		NM_198498	
AC026369.1	0	hgsc.bcm.edu	37	12	148526	148526	+	IGR	SNP	G	G	A	rs200039062	byFrequency	TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr12:148526G>A	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							GAAAAGAGCTGTTTGTTTCAA	0.413																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	677784	.			AGAGCTGTTTGTT																													12.37:g.148526G>A			Somatic	21	0	0		WXS	Illumina HiSeq	.	64	0.33	21	.	0		0		RNA	SNP	ENST00000594563.1	37																																																																																						0.413	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding					
PDE3A	5139	broad.mit.edu	37	12	20522114	20522115	+	5'Flank	INS	-	-	GCGT	rs138187101|rs71039938	byFrequency	TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr12:20522114_20522115insGCGT	ENST00000359062.3	+	0	0				RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	AATTGGGAAGAgcgtgcgtgcg	0.594														639	0.127596	0.0212	0.1628	5008	,	,		12687	0.0337		0.2704	False		,,,				2504	0.1963				.													.	PDE3A	184		0			.																																									SO:0001631	upstream_gene_variant	0	.			GGGAAGAGCGTGC		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962		12.37:g.20522119_20522122dupGCGT	Exception_encountered		Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	25	0.68	17	.	13	0.00	0	O60865|Q13348|Q17RD1	RNA	INS	ENST00000359062.3	37	CCDS31754.1																																																																																					0.594	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401756.2			
LHX5	64211	mdanderson.org	37	12	113907120	113907120	+	Silent	SNP	C	C	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr12:113907120C>A	ENST00000261731.3	-	2	777	c.204G>T	c.(202-204)gcG>gcT	p.A68A	LHX5_ENST00000557836.1_5'Flank|RP11-82C23.2_ENST00000551357.2_RNA	NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	68	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						AGATGCCTTGCGCGCAGCCGG	0.612																																					p.A68A													.	.			0			c.G204T												75.0	69.0	71.0					12																	113907120		2203	4300	6503	SO:0001819	synonymous_variant	64211	exon2			GCCTTGCGCGCAG	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.204G>T	12.37:g.113907120C>A			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_022363	0		0	Q32MA4	Silent	SNP	ENST00000261731.3	37	CCDS9171.1																																																																																					0.612	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404788.3		NM_022363	
UBAC2	337867	mdanderson.org	37	13	99853189	99853189	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr13:99853189G>T	ENST00000403766.3	+	1	162	c.27G>T	c.(25-27)ggG>ggT	p.G9G	UBAC2_ENST00000376440.2_5'UTR|UBAC2-AS1_ENST00000426037.2_lincRNA	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2	9					protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCTCCAGTGGGCTCTGTGAGT	0.716																																					p.G9G													.	.			0			c.G27T												8.0	10.0	10.0					13																	99853189		1554	3564	5118	SO:0001819	synonymous_variant	337867	exon1			CAGTGGGCTCTGT	AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267	ENST00000403766.3:c.27G>T	13.37:g.99853189G>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001144072	77	0.00	0	B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	Silent	SNP	ENST00000403766.3	37	CCDS45064.1																																																																																					0.716	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045588.1		NM_177967	
MYH6	4624	mdanderson.org	37	14	23853812	23853812	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr14:23853812C>T	ENST00000356287.3	-	35	5433	c.5404G>A	c.(5404-5406)Gcc>Acc	p.A1802T	MYH6_ENST00000405093.3_Missense_Mutation_p.A1802T			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1802					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ATCTGCTCGGCCTCGTCCAGC	0.627																																					p.A1802T													.	.			0			c.G5404A												71.0	71.0	71.0					14																	23853812		2203	4300	6503	SO:0001583	missense	4624	exon36			GCTCGGCCTCGTC	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.5404G>A	14.37:g.23853812C>T	ENSP00000348634:p.Ala1802Thr		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_002471	4	0.00	0	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	c	32	5.170812	0.94807	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.80909	-1.43;-1.43	4.82	4.82	0.62117	Myosin tail (1);	.	.	.	.	D	0.92205	0.7528	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94045	0.7313	9	0.72032	D	0.01	.	18.2942	0.90139	0.0:1.0:0.0:0.0	.	1802	P13533	MYH6_HUMAN	T	1802	ENSP00000386041:A1802T;ENSP00000348634:A1802T	ENSP00000348634:A1802T	A	-	1	0	MYH6	22923652	1.000000	0.71417	0.997000	0.53966	0.850000	0.48378	7.785000	0.85724	2.395000	0.81488	0.561000	0.74099	GCC			0.627	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071796.3			
TRAF3	7187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	103355943	103355943	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr14:103355943G>A	ENST00000560371.1	+	7	915	c.698G>A	c.(697-699)aGt>aAt	p.S233N	TRAF3_ENST00000539721.1_Intron|TRAF3_ENST00000347662.4_Intron|TRAF3_ENST00000392745.2_Missense_Mutation_p.S233N|TRAF3_ENST00000351691.5_Intron	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	233				Missing (in Ref. 3; AAA68195). {ECO:0000305}.	apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		AGCACCTGTAGTTTTAAGCGC	0.443																																					p.S233N													.	.			0			c.G698A												248.0	198.0	215.0					14																	103355943		2203	4300	6503	SO:0001583	missense	7187	exon8			CCTGTAGTTTTAA	U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.698G>A	14.37:g.103355943G>A	ENSP00000454207:p.Ser233Asn		Somatic	72	0	0		WXS	Illumina HiSeq	.	65	0.17	11	NM_145725	16	0.44	7	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Missense_Mutation	SNP	ENST00000560371.1	37	CCDS9975.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486643	0.84854	.	.	ENSG00000131323	ENST00000392745;ENST00000351691	T	0.26223	1.75	5.72	5.72	0.89469	Zinc finger, TRAF-type (1);	0.226739	0.56097	D	0.000029	T	0.42539	0.1207	L	0.55743	1.74	0.80722	D	1	D	0.55172	0.97	P	0.57425	0.82	T	0.02766	-1.1113	10	0.21540	T	0.41	-20.8515	19.88	0.96892	0.0:0.0:1.0:0.0	.	233	Q13114	TRAF3_HUMAN	N	233	ENSP00000376500:S233N	ENSP00000332468:S233N	S	+	2	0	TRAF3	102425696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.473000	0.73572	2.708000	0.92522	0.561000	0.74099	AGT			0.443	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415735.1		NM_145725	
C15orf52	388115	mdanderson.org	37	15	40631802	40631802	+	Missense_Mutation	SNP	G	G	A	rs372352300		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr15:40631802G>A	ENST00000559313.1	-	3	289	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	C15orf52_ENST00000557973.1_5'UTR|C15orf52_ENST00000397536.2_5'Flank	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	92							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		TCTGCCTGCCGACGGTCCTCC	0.632																																					p.R92W													.	.			0			c.C274T							G	TRP/ARG	0,4208		0,0,2104	66.0	75.0	72.0		274	1.5	1.0	15		72	1,8443		0,1,4221	no	missense	C15orf52	NM_207380.2	101	0,1,6325	AA,AG,GG		0.0118,0.0,0.0079	probably-damaging	92/535	40631802	1,12651	2104	4222	6326	SO:0001583	missense	388115	exon3			CCTGCCGACGGTC	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.274C>T	15.37:g.40631802G>A	ENSP00000453969:p.Arg92Trp		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_207380	9	0.00	0	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Missense_Mutation	SNP	ENST00000559313.1	37	CCDS10055.2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421606	0.83559	0.0	1.18E-4	ENSG00000188549	ENST00000382688	.	.	.	5.04	1.5	0.22942	.	0.262623	0.26224	N	0.025603	T	0.59088	0.2168	M	0.63428	1.95	0.26454	N	0.975567	D	0.89917	1.0	P	0.62014	0.897	T	0.54180	-0.8332	9	0.87932	D	0	-16.6651	11.2837	0.49210	0.0:0.0:0.5231:0.4769	.	92	Q6ZUT6	CO052_HUMAN	W	92	.	ENSP00000372135:R92W	R	-	1	2	C15orf52	38419094	0.999000	0.42202	0.981000	0.43875	0.993000	0.82548	1.895000	0.39778	0.461000	0.27071	0.462000	0.41574	CGG			0.632	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319567.2		NM_207380	
DLL4	54567	mdanderson.org	37	15	41228737	41228737	+	Nonsense_Mutation	SNP	G	G	T	rs201981567		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr15:41228737G>T	ENST00000249749.5	+	9	1828	c.1552G>T	c.(1552-1554)Gag>Tag	p.E518*		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	518	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CAGCCGCTGCGAGTTCCCCGT	0.652																																					p.E518X													.	.			0			c.G1552T												27.0	29.0	28.0					15																	41228737		2118	4222	6340	SO:0001587	stop_gained	54567	exon9			CGCTGCGAGTTCC	AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.1552G>T	15.37:g.41228737G>T	ENSP00000249749:p.Glu518*		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_019074	25	0.00	0	Q3KP23|Q9NQT9	Nonsense_Mutation	SNP	ENST00000249749.5	37	CCDS45232.1	.	.	.	.	.	.	.	.	.	.	G	40	8.436196	0.98810	.	.	ENSG00000128917	ENST00000249749	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	.	.	.	X	518	.	ENSP00000249749:E518X	E	+	1	0	DLL4	39016029	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.827000	0.99397	2.879000	0.98667	0.650000	0.86243	GAG			0.652	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418859.1			
VPS39	23339	mdanderson.org	37	15	42491770	42491770	+	Intron	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr15:42491770G>T	ENST00000348544.4	-	2	139				VPS39_ENST00000568357.1_Intron|VPS39_ENST00000318006.5_Intron|MIR627_ENST00000384979.1_RNA			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ATGCCCATTAGTAGTATTTCT	0.358																																					.													.	.			0			.												46.0	35.0	38.0					15																	42491770		1127	2545	3672	SO:0001627	intron_variant	693212	.			CCATTAGTAGTAT	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.139+323C>A	15.37:g.42491770G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	.	0		0	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	RNA	SNP	ENST00000348544.4	37	CCDS10083.1																																																																																					0.358	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000420472.1		NM_015289	
FANCI	55215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89824446	89824446	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr15:89824446G>A	ENST00000310775.7	+	15	1513	c.1427G>A	c.(1426-1428)aGt>aAt	p.S476N	FANCI_ENST00000300027.8_Missense_Mutation_p.S476N	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	476					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					GTTCTTCAAAGTTGTTCTTCT	0.368								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.S476N													.	.			0			c.G1427A												198.0	186.0	190.0					15																	89824446		2200	4299	6499	SO:0001583	missense	55215	exon15	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TTCAAAGTTGTTC	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.1427G>A	15.37:g.89824446G>A	ENSP00000310842:p.Ser476Asn		Somatic	143	0	0		WXS	Illumina HiSeq	.	184	0.27	50	NM_001113378	42	0.33	14	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	G	1.727	-0.495009	0.04322	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.76186	-1.0;-1.0;-1.0	5.95	1.94	0.25998	.	0.232564	0.51477	N	0.000093	T	0.51584	0.1683	N	0.20685	0.6	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.002	B;B;B	0.09377	0.001;0.004;0.004	T	0.20840	-1.0263	10	0.11794	T	0.64	-2.2089	6.3247	0.21237	0.4361:0.1202:0.4437:0.0	.	476;476;476	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	N	476	ENSP00000300027:S476N;ENSP00000310842:S476N;ENSP00000413249:S476N	ENSP00000300027:S476N	S	+	2	0	FANCI	87625450	1.000000	0.71417	0.619000	0.29118	0.873000	0.50193	4.131000	0.57970	0.110000	0.17919	-0.122000	0.15005	AGT			0.368	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421140.1		NM_018193	
ZNF205	7755	mdanderson.org	37	16	3169647	3169647	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr16:3169647C>T	ENST00000382192.3	+	7	1191	c.986C>T	c.(985-987)aCg>aTg	p.T329M	RP11-473M20.14_ENST00000575139.1_RNA|ZNF205_ENST00000219091.4_Missense_Mutation_p.T329M|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	329					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						CACCGGCGCACGCACACGGGC	0.677																																					p.T329M													.	.			0			c.C986T												46.0	50.0	49.0					16																	3169647		2197	4299	6496	SO:0001583	missense	7755	exon7			GGCGCACGCACAC	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.986C>T	16.37:g.3169647C>T	ENSP00000371627:p.Thr329Met		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001042428	70	0.00	0	A8MZK0|D3DUB4|Q9BU95	Missense_Mutation	SNP	ENST00000382192.3	37	CCDS10494.2	.	.	.	.	.	.	.	.	.	.	C	16.98	3.271537	0.59649	.	.	ENSG00000122386	ENST00000382192;ENST00000219091	T;T	0.01025	5.43;5.43	5.15	2.82	0.32997	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.164453	0.29908	N	0.010887	T	0.03390	0.0098	M	0.69185	2.1	0.26870	N	0.967767	D	0.71674	0.998	D	0.63488	0.915	T	0.13495	-1.0507	10	0.56958	D	0.05	-9.1361	10.2442	0.43330	0.0:0.8059:0.0:0.1941	.	329	O95201	ZN205_HUMAN	M	329	ENSP00000371627:T329M;ENSP00000219091:T329M	ENSP00000219091:T329M	T	+	2	0	ZNF205	3109648	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-0.198000	0.09505	1.176000	0.42840	0.462000	0.41574	ACG			0.677	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309057.1		NM_003456	
LOC653786	653786	broad.mit.edu	37	16	22579567	22579568	+	RNA	INS	-	-	CCA	rs370421878|rs200819155		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr16:22579567_22579568insCCA	ENST00000550753.1	+	0	1976					NR_003676.2																						AATGGGTTAattcatccatcca	0.421																																					.													.	.			0			.																																											0	.			GGTTAATTCATCC																													16.37:g.22579567_22579568insCCA			Somatic	48	0.0416666667	2		WXS	Illumina HiSeq	Phase_I	45	0.16	7	.	0		0		RNA	INS	ENST00000550753.1	37																																																																																						0.421	RP11-368J21.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409041.1			
HIRIP3	8479	mdanderson.org	37	16	30005069	30005069	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr16:30005069G>A	ENST00000279392.3	-	5	2130	c.1300C>T	c.(1300-1302)Cgg>Tgg	p.R434W	INO80E_ENST00000304516.7_5'Flank|INO80E_ENST00000567254.1_5'Flank|INO80E_ENST00000563197.1_5'Flank|INO80E_ENST00000567705.1_5'Flank|HIRIP3_ENST00000566471.1_5'Flank|HIRIP3_ENST00000564026.1_Missense_Mutation_p.S121L	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	434					chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						CCACAGGCCCGAATGTAGCGC	0.607																																					p.R434W													.	.			0			c.C1300T												52.0	55.0	54.0					16																	30005069		2197	4300	6497	SO:0001583	missense	8479	exon5			AGGCCCGAATGTA	AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.1300C>T	16.37:g.30005069G>A	ENSP00000279392:p.Arg434Trp		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_003609	125	0.00	0	H3BSR3|O75707|O75708	Missense_Mutation	SNP	ENST00000279392.3	37	CCDS10664.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.481385	0.44147	.	.	ENSG00000149929	ENST00000279392;ENST00000352552	T	0.35236	1.32	5.55	4.58	0.56647	.	0.365401	0.25860	N	0.027830	T	0.21103	0.0508	L	0.33485	1.01	0.23156	N	0.998204	P	0.44659	0.84	B	0.30495	0.116	T	0.19192	-1.0313	10	0.52906	T	0.07	-7.4542	8.3071	0.32049	0.0842:0.1557:0.7601:0.0	.	434	Q9BW71	HIRP3_HUMAN	W	434;121	ENSP00000279392:R434W	ENSP00000279392:R434W	R	-	1	2	HIRIP3	29912570	0.322000	0.24634	1.000000	0.80357	0.995000	0.86356	1.259000	0.32956	1.316000	0.45131	0.655000	0.94253	CGG			0.607	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255160.2		NM_003609	
Unknown	0	bcgsc.ca	37	16	32403532	32403532	+	IGR	SNP	T	T	A	rs75037542		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr16:32403532T>A								RP11-17M15.2 (81656 upstream) : RP11-626K17.3 (62400 downstream)																							TTTTTTCTTATGAAAATATTC	0.299																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTCTTATGAAAAT																													16.37:g.32403532T>A			Somatic	50	0.04	2		WXS	Illumina HiSeq	Phase_1	44	0.27	12	.	0		0		RNA	SNP		37																																																																																					0	0.299										
PHKB	5257	mdanderson.org	37	16	47531349	47531349	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr16:47531349G>T	ENST00000323584.5	+	2	140	c.116G>T	c.(115-117)aGa>aTa	p.R39I	PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000455779.1_Missense_Mutation_p.R32I|PHKB_ENST00000299167.8_Missense_Mutation_p.R39I|PHKB_ENST00000566044.1_Missense_Mutation_p.R32I	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	39					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				AATCTTCCAAGACCTGATAAT	0.328																																					p.R39I													PHKB_ENST00000323584,NS,carcinoma,0,3	PHKB_ENST00000323584	0	3	0			c.G116T												76.0	77.0	77.0					16																	47531349		2201	4300	6501	SO:0001583	missense	5257	exon2			TTCCAAGACCTGA		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.116G>T	16.37:g.47531349G>T	ENSP00000313504:p.Arg39Ile		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_000293	22	0.00	0	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852314	0.51270	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.90676	-2.71;-2.7	5.9	3.96	0.45880	.	0.346288	0.33401	N	0.004959	T	0.81044	0.4741	N	0.08118	0	0.58432	D	0.999999	P;B;P	0.44578	0.838;0.002;0.731	P;B;P	0.45071	0.466;0.003;0.468	T	0.75941	-0.3140	10	0.16896	T	0.51	-14.7387	10.4189	0.44338	0.2234:0.0:0.7766:0.0	.	32;39;32	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	I	32;32;39	ENSP00000414345:R32I;ENSP00000313504:R39I	ENSP00000299167:R32I	R	+	2	0	PHKB	46088850	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	2.567000	0.45956	0.842000	0.35045	0.591000	0.81541	AGA			0.328	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000430413.1			
SPG7	6687	mdanderson.org	37	16	89598891	89598891	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr16:89598891C>T	ENST00000268704.2	+	9	1186	c.1171C>T	c.(1171-1173)Cgg>Tgg	p.R391W	SPG7_ENST00000341316.2_Missense_Mutation_p.R391W|RNU7-117P_ENST00000516770.1_RNA	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	391					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		TGCCCGTGTGCGGAGCCTCTT	0.587																																					p.R391W													SPG7_ENST00000341316,NS,carcinoma,0,8	SPG7_ENST00000341316	0	8	0			c.C1171T												35.0	40.0	38.0					16																	89598891		2188	4290	6478	SO:0001583	missense	6687	exon9			CGTGTGCGGAGCC	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1171C>T	16.37:g.89598891C>T	ENSP00000268704:p.Arg391Trp		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_003119	97	0.00	0	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	37	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878762	0.72294	.	.	ENSG00000197912	ENST00000268704;ENST00000341316	D;D	0.94417	-3.42;-3.42	5.63	4.66	0.58398	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	D	0.98626	0.9540	H	0.99555	4.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99425	1.0934	10	0.87932	D	0	-1.2096	15.8214	0.78648	0.137:0.863:0.0:0.0	.	391;391	Q9UQ90;Q9UQ90-2	SPG7_HUMAN;.	W	391	ENSP00000268704:R391W;ENSP00000341157:R391W	ENSP00000268704:R391W	R	+	1	2	SPG7	88126392	0.998000	0.40836	1.000000	0.80357	0.514000	0.34195	3.846000	0.55888	1.345000	0.45676	0.456000	0.33151	CGG			0.587	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269921.2		NM_003119	
DNAH2	146754	hgsc.bcm.edu	37	17	7637830	7637830	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr17:7637830G>T	ENST00000572933.1	+	7	2242	c.782G>T	c.(781-783)aGt>aTt	p.S261I	DNAH2_ENST00000082259.3_Missense_Mutation_p.S261I|DNAH2_ENST00000389173.2_Missense_Mutation_p.S261I|DNAH2_ENST00000570791.1_Missense_Mutation_p.S261I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	261	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GAGATGCTCAGTGCCCAGGAG	0.527																																					p.S261I													.	.			0			c.G782T												74.0	72.0	73.0					17																	7637830		2203	4300	6503	SO:0001583	missense	146754	exon6			TGCTCAGTGCCCA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.782G>T	17.37:g.7637830G>T	ENSP00000458355:p.Ser261Ile		Somatic	46	0	0		WXS	Illumina HiSeq	.	80	0.05	4	NM_020877	0		0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181246	0.78677	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.57107	0.42;0.42	5.63	5.63	0.86233	Dynein heavy chain, domain-1 (1);	1.180830	0.05800	N	0.611986	T	0.71871	0.3391	M	0.67953	2.075	0.45330	D	0.998323	P;D	0.53619	0.669;0.961	B;P	0.56865	0.265;0.808	T	0.60984	-0.7154	10	0.45353	T	0.12	.	18.4634	0.90747	0.0:0.0:1.0:0.0	.	261;261	Q9P225;Q9P225-3	DYH2_HUMAN;.	I	261	ENSP00000373825:S261I;ENSP00000082259:S261I	ENSP00000082259:S261I	S	+	2	0	DNAH2	7578555	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.328000	0.52052	2.671000	0.90904	0.455000	0.32223	AGT			0.527	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440241.1		NM_020877	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		Somatic	112	0.0446428571	5		RNA-Seq	Illumina HiSeq		200	0.06	11	NM_145301	40	0.33	13	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
RASL10B	91608	mdanderson.org	37	17	34062225	34062225	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr17:34062225G>T	ENST00000268864.3	+	2	399	c.22G>T	c.(22-24)Gcc>Tcc	p.A8S		NM_033315.3	NP_201572.1	Q96S79	RSLAB_HUMAN	RAS-like, family 10, member B	8	Small GTPase-like.				GTP catabolic process (GO:0006184)|positive regulation of peptide hormone secretion (GO:0090277)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(2)|endometrium(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTACCGGGTGGCCGTGCTGGG	0.701																																					p.A8S													.	.			0			c.G22T												57.0	57.0	57.0					17																	34062225		2203	4299	6502	SO:0001583	missense	91608	exon2			CGGGTGGCCGTGC	BC041133	CCDS11297.1	17q21.1	2014-05-09			ENSG00000141150	ENSG00000270885			30295	protein-coding gene	gene with protein product		612128				12477932	Standard	NM_033315		Approved	VTS58635, RRP17	uc002hju.3	Q96S79	OTTHUMG00000188385	ENST00000268864.3:c.22G>T	17.37:g.34062225G>T	ENSP00000268864:p.Ala8Ser		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_033315	18	0.00	0	B3KV31	Missense_Mutation	SNP	ENST00000268864.3	37	CCDS11297.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792340	0.90453	.	.	ENSG00000141150	ENST00000268864	T	0.77358	-1.09	3.87	3.87	0.44632	.	0.000000	0.46442	D	0.000295	D	0.87261	0.6133	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.89163	0.3531	10	0.66056	D	0.02	.	14.9734	0.71251	0.0:0.0:1.0:0.0	.	8	Q96S79	RSLAB_HUMAN	S	8	ENSP00000268864:A8S	ENSP00000268864:A8S	A	+	1	0	RASL10B	31086338	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.180000	0.94867	1.987000	0.57996	0.462000	0.41574	GCC			0.701	RASL10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256498.2		NM_033315	
IKZF3	22806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37922278	37922278	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr17:37922278G>A	ENST00000346872.3	-	8	1356	c.1295C>T	c.(1294-1296)cCc>cTc	p.P432L	IKZF3_ENST00000350532.3_Missense_Mutation_p.P393L|IKZF3_ENST00000346243.3_Missense_Mutation_p.P354L|IKZF3_ENST00000377958.2_Missense_Mutation_p.P345L|IKZF3_ENST00000535189.1_Missense_Mutation_p.P398L|IKZF3_ENST00000377944.3_Missense_Mutation_p.P289L|IKZF3_ENST00000583368.1_Missense_Mutation_p.P185L|IKZF3_ENST00000467757.1_Missense_Mutation_p.P376L|IKZF3_ENST00000377945.3_Missense_Mutation_p.P298L|IKZF3_ENST00000351680.3_Missense_Mutation_p.P393L|IKZF3_ENST00000394189.2_Missense_Mutation_p.P250L|IKZF3_ENST00000439167.2_Missense_Mutation_p.P359L|IKZF3_ENST00000377952.2_Missense_Mutation_p.P211L|IKZF3_ENST00000439016.2_Missense_Mutation_p.P337L|RP11-94L15.2_ENST00000488188.2_lincRNA	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	432					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGGGCAGATGGGCGGGGGCTT	0.557																																					p.P432L													IKZF3,NS,neuroblastoma,+1,1	IKZF3	1	1	0			c.C1295T												128.0	130.0	129.0					17																	37922278		2203	4300	6503	SO:0001583	missense	22806	exon8			CAGATGGGCGGGG	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.1295C>T	17.37:g.37922278G>A	ENSP00000344544:p.Pro432Leu		Somatic	79	0	0		WXS	Illumina HiSeq	.	119	0.31	37	NM_012481	1	0.00	0	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	ENST00000346872.3	37	CCDS11346.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.40|12.40	1.926123|1.926123	0.34002|0.34002	.|.	.|.	ENSG00000161405|ENSG00000161405	ENST00000488188;ENST00000346872;ENST00000377945;ENST00000394189;ENST00000377944;ENST00000377958;ENST00000377952;ENST00000535189;ENST00000351680;ENST00000346243;ENST00000350532;ENST00000467757|ENST00000439167;ENST00000439016	T;T;T;T;T;T;T;T;T;T|.	0.09163|.	3.47;3.46;3.22;3.01;3.71;3.28;3.31;3.38;3.28;4.28|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.106119|0.106119	0.42682|0.42682	D|D	0.000673|0.000673	T|T	0.49304|0.49304	0.1549|0.1549	L|L	0.29908|0.29908	0.895|0.895	0.53005|0.53005	D|D	0.999962|0.999962	P;B;B;B;P;B;B;B;B;B;B;P;P|.	0.37663|.	0.481;0.435;0.435;0.435;0.481;0.064;0.214;0.302;0.009;0.055;0.332;0.604;0.462|.	B;B;B;B;B;B;B;B;B;B;B;B;B|.	0.35813|.	0.117;0.167;0.124;0.167;0.164;0.059;0.167;0.124;0.008;0.062;0.167;0.167;0.211|.	T|T	0.36720|0.36720	-0.9736|-0.9736	10|7	0.42905|0.06625	T|T	0.14|0.88	-16.2107|-16.2107	15.3581|15.3581	0.74443|0.74443	0.0:0.1389:0.8611:0.0|0.0:0.1389:0.8611:0.0	.|.	345;211;250;298;289;398;354;337;393;376;393;359;432|.	Q9UKT9-9;Q9UKT9-12;Q9UKT9-11;Q9UKT9-13;Q9UKT9-10;Q9UKT9-7;Q9UKT9-6;Q9UKT9-5;Q9UKT9-4;Q9UKT9-2;Q9UKT9-3;Q9UKT9-8;Q9UKT9|.	.;.;.;.;.;.;.;.;.;.;.;.;IKZF3_HUMAN|.	L|S	432;337;298;250;289;345;211;398;393;354;393;376|347;386	ENSP00000367180:P298L;ENSP00000377741:P250L;ENSP00000367179:P289L;ENSP00000367194:P345L;ENSP00000367188:P211L;ENSP00000438972:P398L;ENSP00000345622:P393L;ENSP00000341977:P354L;ENSP00000344471:P393L;ENSP00000420463:P376L|.	ENSP00000341977:P354L|ENSP00000403027:P386S	P|P	-|-	2|1	0|0	IKZF3|IKZF3	35175804|35175804	0.998000|0.998000	0.40836|0.40836	0.990000|0.990000	0.47175|0.47175	0.299000|0.299000	0.27559|0.27559	5.173000|5.173000	0.65010|0.65010	2.702000|2.702000	0.92279|0.92279	0.655000|0.655000	0.94253|0.94253	CCC|CCA			0.557	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257004.2		NM_012481	
LPIN2	9663	mdanderson.org	37	18	2951054	2951054	+	Splice_Site	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr18:2951054G>A	ENST00000261596.4	-	4	827	c.589C>T	c.(589-591)Cga>Tga	p.R197*	RP11-737O24.2_ENST00000581488.1_RNA|RP11-737O24.2_ENST00000584431.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	197					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GAGTCCTACCGTGCTGCCTGG	0.542																																					p.R197X													.	.			0			c.C589T												128.0	111.0	116.0					18																	2951054		2203	4300	6503	SO:0001630	splice_region_variant	9663	exon4			CCTACCGTGCTGC	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.590+1C>T	18.37:g.2951054G>A			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_014646	14	0.00	0	A7MD25|D3DUH3	Nonsense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.094483	0.76870	.	.	ENSG00000101577	ENST00000261596;ENST00000455369	.	.	.	5.92	4.77	0.60923	.	0.141034	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	12.0838	0.53686	0.0:0.0:0.2864:0.7135	.	.	.	.	X	197	.	ENSP00000261596:R197X	R	-	1	2	LPIN2	2941054	1.000000	0.71417	0.984000	0.44739	0.053000	0.15095	3.229000	0.51278	1.075000	0.40932	-0.262000	0.10625	CGA			0.542	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254363.2		NM_014646	Nonsense_Mutation
MTCL1	23255	mdanderson.org	37	18	8784400	8784400	+	Silent	SNP	C	C	T	rs145456770		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr18:8784400C>T	ENST00000306329.11	+	5	2370	c.2370C>T	c.(2368-2370)agC>agT	p.S790S	SOGA2_ENST00000400050.3_Silent_p.S430S|SOGA2_ENST00000359865.3_Silent_p.S430S|SOGA2_ENST00000517570.1_Silent_p.S430S|SOGA2_ENST00000306285.7_5'UTR																							GCTTCGGGAGCGGGAAGCCAT	0.657																																					p.S430S													.	.			0			c.C1290T							C		0,4406		0,0,2203	54.0	68.0	63.0		1290	-4.2	0.0	18	dbSNP_134	63	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CCDC165	NM_015210.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		430/1587	8784400	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	23255	exon6			CGGGAGCGGGAAG																												ENST00000306329.11:c.2370C>T	18.37:g.8784400C>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_015210	7	0.00	0		Silent	SNP	ENST00000306329.11	37																																																																																				0		0.657	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000444141.1			
SMAD7	4092	mdanderson.org	37	18	46476633	46476633	+	Silent	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr18:46476633G>A	ENST00000262158.2	-	1	448	c.162C>T	c.(160-162)ggC>ggT	p.G54G	SMAD7_ENST00000589634.1_Silent_p.G54G|SMAD7_ENST00000591805.1_5'Flank	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	54	Poly-Gly.				adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					ccctgcccgggccgccgccac	0.781																																					p.G54G													.	.			0			c.C162T												2.0	2.0	2.0					18																	46476633		1471	2957	4428	SO:0001819	synonymous_variant	4092	exon1			GCCCGGGCCGCCG	AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.162C>T	18.37:g.46476633G>A			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_005904	2	0.00	0	B7Z773|K7EQ10|O14740|Q6DK23	Silent	SNP	ENST00000262158.2	37	CCDS11936.1																																																																																					0.781	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255906.1		NM_005904	
RPS28	6234	mdanderson.org	37	19	8387794	8387794	+	3'UTR	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr19:8387794G>T	ENST00000600659.2	+	0	896				NDUFA7_ENST00000301457.2_5'Flank|KANK3_ENST00000330915.3_Missense_Mutation_p.P799T|NDUFA7_ENST00000598884.1_5'Flank	NM_001031.4	NP_001022.1	P62857	RS28_HUMAN	ribosomal protein S28						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)										TGGGAGCCAGGGGGTGACTCG	0.592																																					p.P799T													.	.			0			c.C2395A												57.0	49.0	52.0					19																	8387794		2203	4300	6503	SO:0001624	3_prime_UTR_variant	256949	exon11			AGCCAGGGGGTGA	D14530	CCDS45953.1	19p13.2	2011-04-06				ENSG00000233927		"""S ribosomal proteins"""	10418	protein-coding gene	gene with protein product	"""40S ribosomal protein S28"""	603685				8415000, 9582194	Standard	NM_001031		Approved	S28	uc002mjn.3	P62857		ENST00000600659.2:c.*655G>T	19.37:g.8387794G>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_198471	48	0.00	0	P25112	Missense_Mutation	SNP	ENST00000600659.2	37	CCDS45953.1	.	.	.	.	.	.	.	.	.	.	G	5.798	0.331473	0.10956	.	.	ENSG00000186994	ENST00000330915	T	0.26660	1.72	3.46	1.31	0.21738	.	.	.	.	.	T	0.16300	0.0392	L	0.38175	1.15	0.09310	N	1	B	0.20988	0.05	B	0.23419	0.046	T	0.36407	-0.9749	9	0.10636	T	0.68	.	5.9221	0.19088	0.2442:0.0:0.7558:0.0	.	799	Q6NY19-2	.	T	799	ENSP00000328923:P799T	ENSP00000328923:P799T	P	-	1	0	KANK3	8293794	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.071000	0.14594	0.469000	0.27268	-0.258000	0.10820	CCT			0.592	RPS28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461377.3		NM_001031	
BRD4	23476	mdanderson.org	37	19	15367969	15367969	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr19:15367969G>A	ENST00000263377.2	-	8	1578	c.1357C>T	c.(1357-1359)Cgc>Tgc	p.R453C	BRD4_ENST00000360016.5_Missense_Mutation_p.R453C|BRD4_ENST00000602230.1_5'UTR|BRD4_ENST00000371835.4_Missense_Mutation_p.R453C	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	453					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			TTGGCAAAGCGCATTTCGAAC	0.657			T	C15orf55	lethal midline carcinoma of young people																																p.R453C				Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	BRD4_ENST00000263377,NS,carcinoma,0,2	BRD4_ENST00000263377	0	2	0			c.C1357T												29.0	27.0	28.0					19																	15367969		2203	4300	6503	SO:0001583	missense	23476	exon8			CAAAGCGCATTTC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1357C>T	19.37:g.15367969G>A	ENSP00000263377:p.Arg453Cys		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_058243	106	0.00	0	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	37	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.840985	0.91197	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.25579	1.79;2.13;2.13	5.36	5.36	0.76844	Bromodomain (3);	0.000000	0.64402	D	0.000007	T	0.52273	0.1724	M	0.72479	2.2	0.80722	D	1	D;D;D	0.89917	1.0;0.984;1.0	D;P;D	0.85130	0.997;0.598;0.994	T	0.52990	-0.8501	10	0.59425	D	0.04	-20.8744	17.898	0.88895	0.0:0.0:1.0:0.0	.	453;453;453	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	C	453	ENSP00000263377:R453C;ENSP00000360901:R453C;ENSP00000353112:R453C	ENSP00000263377:R453C	R	-	1	0	BRD4	15228969	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.010000	0.57117	2.523000	0.85059	0.655000	0.94253	CGC			0.657	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000465800.3		NM_058243	
GRAMD1A	57655	mdanderson.org	37	19	35502430	35502430	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr19:35502430G>A	ENST00000317991.5	+	7	770	c.578G>A	c.(577-579)cGc>cAc	p.R193H	GRAMD1A_ENST00000411896.2_Missense_Mutation_p.R186H|GRAMD1A_ENST00000504615.2_5'UTR|GRAMD1A_ENST00000599564.1_Missense_Mutation_p.R280H	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	193						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CTCATCTTCCGCCTCTGGCAG	0.617																																					p.R193H													.	.			0			c.G578A												79.0	84.0	83.0					19																	35502430		1932	4119	6051	SO:0001583	missense	57655	exon7			TCTTCCGCCTCTG	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.578G>A	19.37:g.35502430G>A	ENSP00000441032:p.Arg193His		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_020895	309	0.00	1	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	37	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072498	0.93950	.	.	ENSG00000089351	ENST00000453966;ENST00000317991;ENST00000411896	T;T	0.27557	1.66;1.67	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.53417	0.1795	M	0.65677	2.01	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.83275	0.996;0.994;0.996;0.945	T	0.57774	-0.7753	10	0.87932	D	0	.	14.7684	0.69657	0.0:0.0:1.0:0.0	.	193;193;186;280	Q96CP6-3;Q96CP6;Q96CP6-2;F5GZ02	.;GRM1A_HUMAN;.;.	H	280;193;186	ENSP00000441032:R193H;ENSP00000439267:R186H	ENSP00000441032:R193H	R	+	2	0	GRAMD1A	40194270	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.363000	0.97131	2.338000	0.79540	0.561000	0.74099	CGC			0.617	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000461557.1		NM_020895	
CAPNS1	826	broad.mit.edu	37	19	36631958	36631958	+	Silent	SNP	C	C	G	rs567500165		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr19:36631958C>G	ENST00000246533.3	+	2	643	c.45C>G	c.(43-45)ggC>ggG	p.G15G	CAPNS1_ENST00000590874.1_Silent_p.G15G|CAPNS1_ENST00000588815.1_Silent_p.G15G|CAPNS1_ENST00000587718.1_Silent_p.G15G|CAPNS1_ENST00000588780.1_Silent_p.G15G|CAPNS1_ENST00000589146.1_Silent_p.G15G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	15	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcgggggaggcg	0.736													C|||	1	0.000199681	0.0	0.0	5008	,	,		3971	0.001		0.0	False		,,,				2504	0.0				p.G15G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	CAPNS1	19		0			c.C45G												6.0	7.0	7.0					19																	36631958		1958	3947	5905	SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGGGGA	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.45C>G	19.37:g.36631958C>G			Somatic	83	0.0120481928	1		WXS	Illumina HiSeq	Phase_I	114	0.04	5	NM_001749	15	0.00	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																					0.736	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
HRC	3270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49657880	49657880	+	Silent	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr19:49657880G>A	ENST00000252825.4	-	1	801	c.615C>T	c.(613-615)gcC>gcT	p.A205A	HRC_ENST00000595625.1_Silent_p.A205A	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	205	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		ACTCAGTGGAGGcctcctctt	0.572																																					p.A205A	Melanoma(37;75 1097 24567 25669 30645)												.	.			0			c.C615T												121.0	90.0	101.0					19																	49657880		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			AGTGGAGGCCTCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.615C>T	19.37:g.49657880G>A			Somatic	54	0	0		WXS	Illumina HiSeq	.	60	0.27	16	NM_002152	5	0.60	3	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																					0.572	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465649.1		NM_002152	
TRAPPC12	51112	broad.mit.edu	37	2	3481509	3481509	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr2:3481509A>G	ENST00000324266.5	+	10	2015	c.1820A>G	c.(1819-1821)gAg>gGg	p.E607G	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.E607G	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	607					vesicle-mediated transport (GO:0016192)												CAAGACGTTGAGAAAGTAACA	0.289																																					p.E607G													.	.			0			c.A1820G												66.0	71.0	70.0					2																	3481509		2203	4299	6502	SO:0001583	missense	51112	exon10			ACGTTGAGAAAGT	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1820A>G	2.37:g.3481509A>G	ENSP00000324318:p.Glu607Gly		Somatic	256	0	0		WXS	Illumina HiSeq	Phase_I	336	0.02	7	NM_016030	170	0.04	6	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	ENST00000324266.5	37	CCDS1652.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.82|19.82	3.899009|3.899009	0.72754|0.72754	.|.	.|.	ENSG00000171853|ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266;ENST00000415624|ENST00000452495	T;T;T|.	0.75260|.	-0.92;-0.92;-0.92|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.74921|.	0.3780|.	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.71184|.	0.958;0.972|.	T|.	0.75158|.	-0.3416|.	10|.	0.56958|.	D|.	0.05|.	.|.	15.5474|15.5474	0.76118|0.76118	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	596;607|.	E7ENL7;Q8WVT3|.	.;TPC12_HUMAN|.	G|W	607;596;607;106|8	ENSP00000371544:E607G;ENSP00000324318:E607G;ENSP00000396592:E106G|.	ENSP00000303612:E596G|.	E|X	+|+	2|3	0|0	TTC15|TTC15	3460516|3460516	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.414000|0.414000	0.31173|0.31173	8.286000|8.286000	0.89916|0.89916	2.322000|2.322000	0.78497|0.78497	0.528000|0.528000	0.53228|0.53228	GAG|TGA			0.289	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206693.2		NM_016030	
SNX17	9784	mdanderson.org	37	2	27598736	27598736	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr2:27598736G>T	ENST00000233575.2	+	11	1224	c.1002G>T	c.(1000-1002)acG>acT	p.T334T	SNX17_ENST00000537606.1_Silent_p.T309T|ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000542478.1_Silent_p.T120T|SNX17_ENST00000543024.1_Silent_p.T120T	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	334	FERM-like.|PTB-like F3 module.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGGAAGCACGAGCAGCCCAG	0.617																																					p.T334T													.	.			0			c.G1002T												50.0	53.0	52.0					2																	27598736		2203	4300	6503	SO:0001819	synonymous_variant	9784	exon11			AAGCACGAGCAGC	D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.1002G>T	2.37:g.27598736G>T			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_014748	477	0.00	1	B4DQM7|Q53HN7|Q6IAS3	Silent	SNP	ENST00000233575.2	37	CCDS1750.1																																																																																					0.617	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215024.1		NM_014748	
STEAP3	55240	mdanderson.org	37	2	120005329	120005329	+	Silent	SNP	C	C	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr2:120005329C>T	ENST00000354888.5	+	4	1071	c.567C>T	c.(565-567)ccC>ccT	p.P189P	STEAP3_ENST00000425223.2_Silent_p.P189P|STEAP3_ENST00000393108.2_Silent_p.P189P|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000393110.2_Silent_p.P199P|STEAP3_ENST00000450943.2_Silent_p.P189P|STEAP3_ENST00000409811.1_Silent_p.P189P|STEAP3_ENST00000393106.2_Silent_p.P189P|STEAP3_ENST00000393107.2_Silent_p.P189P	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	189					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						GCTTCATGCCCGTGGACATGG	0.682																																					p.P199P													.	.			0			c.C597T												39.0	40.0	40.0					2																	120005329		2203	4300	6503	SO:0001819	synonymous_variant	55240	exon4			CATGCCCGTGGAC	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.567C>T	2.37:g.120005329C>T			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_182915	22	0.00	0	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	ENST00000354888.5	37	CCDS2125.1																																																																																					0.682	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254193.1		NM_018234	
SPEG	10290	mdanderson.org	37	2	220313115	220313115	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr2:220313115G>A	ENST00000312358.7	+	4	1367	c.1235G>A	c.(1234-1236)cGc>cAc	p.R412H	SPEG_ENST00000396695.2_5'UTR|SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396698.1_Missense_Mutation_p.R308H	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	412					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GAGCGACGGCGCAGCCTGGAG	0.746																																					p.R412H													.	.			0			c.G1235A												2.0	3.0	2.0					2																	220313115		1273	2922	4195	SO:0001583	missense	10290	exon4			GACGGCGCAGCCT	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.1235G>A	2.37:g.220313115G>A	ENSP00000311684:p.Arg412His		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_005876	9	0.00	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028977	0.75504	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000431523;ENST00000396698	T;T;T	0.66280	-0.2;0.45;0.05	4.85	4.85	0.62838	.	0.000000	0.40818	N	0.001009	T	0.62392	0.2424	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.64410	0.925	T	0.65113	-0.6247	10	0.62326	D	0.03	.	8.7066	0.34358	0.1715:0.0:0.8285:0.0	.	412	Q15772	SPEG_HUMAN	H	412;412;259;308	ENSP00000311684:R412H;ENSP00000410986:R259H;ENSP00000379926:R308H	ENSP00000265327:R412H	R	+	2	0	SPEG	220021359	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	2.149000	0.42244	2.237000	0.73441	0.462000	0.41574	CGC			0.746	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130252.2		NM_005876	
ALPPL2	251	mdanderson.org	37	2	233271628	233271628	+	Silent	SNP	C	C	G	rs61730279	byFrequency	TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr2:233271628C>G	ENST00000295453.3	+	1	76	c.24C>G	c.(22-24)ctC>ctG	p.L8L		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	8					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	GGGTGCTGCTCCTGCTGGGCC	0.637																																					p.L8L													.	.			0			c.C24G												74.0	79.0	77.0					2																	233271628		2203	4300	6503	SO:0001819	synonymous_variant	251	exon1			GCTGCTCCTGCTG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.24C>G	2.37:g.233271628C>G			Somatic	66	0.0151515152	1		WXS	Illumina HiSeq	Phase_I	43	0.09	4	NM_031313	0		0	A8KAF2|Q16727|Q53S81|Q96CM1	Silent	SNP	ENST00000295453.3	37	CCDS2491.1																																																																																					0.637	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257034.2		NM_031313	
SPATA25	128497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44515336	44515336	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr20:44515336G>T	ENST00000372519.3	-	2	548	c.504C>A	c.(502-504)ccC>ccA	p.P168P		NM_080608.3	NP_542175.1	Q9BR10	SPT25_HUMAN	spermatogenesis associated 25	168					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTCCTGGGACGGGCACGGTGG	0.647																																					p.P168P													.	.			0			c.C504A												64.0	65.0	65.0					20																	44515336		2203	4300	6503	SO:0001819	synonymous_variant	128497	exon2			TGGGACGGGCACG	AL008726	CCDS13383.1	20q13.12	2011-11-24	2011-11-24	2011-11-24	ENSG00000149634	ENSG00000149634			16158	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 165"""	C20orf165		19240080	Standard	NM_080608		Approved	dJ337O18.8, TSG23	uc002xqf.3	Q9BR10	OTTHUMG00000032628	ENST00000372519.3:c.504C>A	20.37:g.44515336G>T			Somatic	55	0	0		WXS	Illumina HiSeq	.	65	0.29	19	NM_080608	2	0.50	1		Silent	SNP	ENST00000372519.3	37	CCDS13383.1																																																																																					0.647	SPATA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079541.1			
SAMD10	140700	mdanderson.org	37	20	62607102	62607102	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr20:62607102G>T	ENST00000369886.3	-	4	703	c.529C>A	c.(529-531)Cag>Aag	p.Q177K	ZNF512B_ENST00000450537.1_Intron|ZNF512B_ENST00000217130.3_Intron|SAMD10_ENST00000498830.1_5'UTR	NM_080621.4	NP_542188.1	Q9BYL1	SAM10_HUMAN	sterile alpha motif domain containing 10	177	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	7	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CGGAGCACCTGCTGCAGCACC	0.682																																					p.Q177K													.	.			0			c.C529A												31.0	36.0	35.0					20																	62607102		2203	4298	6501	SO:0001583	missense	140700	exon4			GCACCTGCTGCAG		CCDS13549.1	20q13.33	2013-01-10	2004-07-15	2004-07-16	ENSG00000130590	ENSG00000130590		"""Sterile alpha motif (SAM) domain containing"""	16129	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 136"""	C20orf136			Standard	NM_080621		Approved		uc002yhm.2	Q9BYL1	OTTHUMG00000033011	ENST00000369886.3:c.529C>A	20.37:g.62607102G>T	ENSP00000358902:p.Gln177Lys		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_080621	9	0.00	0		Missense_Mutation	SNP	ENST00000369886.3	37	CCDS13549.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888761	0.91814	.	.	ENSG00000130590	ENST00000369886	D	0.83163	-1.69	3.99	3.99	0.46301	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.355996	0.27460	U	0.019264	D	0.85652	0.5746	L	0.31664	0.95	0.58432	D	0.999999	D	0.53885	0.963	D	0.71414	0.973	D	0.86463	0.1780	10	0.46703	T	0.11	-5.896	16.0943	0.81110	0.0:0.0:1.0:0.0	.	177	Q9BYL1	SAM10_HUMAN	K	177	ENSP00000358902:Q177K	ENSP00000358902:Q177K	Q	-	1	0	SAMD10	62077546	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.302000	0.96175	1.792000	0.52537	0.491000	0.48974	CAG			0.682	SAMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080255.1		NM_080621	
SCAF4	57466	broad.mit.edu	37	21	33074607	33074607	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr21:33074607G>A	ENST00000286835.7	-	5	789	c.407C>T	c.(406-408)gCg>gTg	p.A136V	SCAF4_ENST00000399804.1_Missense_Mutation_p.A136V|SCAF4_ENST00000434667.3_Missense_Mutation_p.A121V	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	136	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						ACTGGTTCCCGCTGCCATGTC	0.398																																					p.A136V													SCAF4,NS,carcinoma,+1,1	SCAF4	142	1	0			c.C407T												155.0	132.0	140.0					21																	33074607		2203	4300	6503	SO:0001583	missense	57466	exon5			GTTCCCGCTGCCA	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.407C>T	21.37:g.33074607G>A	ENSP00000286835:p.Ala136Val		Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	254	0.03	7	NM_020706	39	0.00	0	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	ENST00000286835.7	37	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399846	0.83120	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.42513	0.97;0.97;0.97	5.69	5.69	0.88448	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);	0.122954	0.53938	D	0.000045	T	0.57651	0.2068	L	0.41236	1.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.982;0.982;0.992;0.982	T	0.49925	-0.8887	10	0.33940	T	0.23	-18.3783	19.8097	0.96542	0.0:0.0:1.0:0.0	.	121;136;136;136	C9JLZ0;Q0P607;O95104-2;O95104	.;.;.;SFR15_HUMAN	V	121;136;136	ENSP00000402377:A121V;ENSP00000286835:A136V;ENSP00000382703:A136V	ENSP00000286835:A136V	A	-	2	0	SCAF4	31996478	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.723000	0.98772	2.685000	0.91497	0.484000	0.47621	GCG			0.398	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000192659.1		XM_047889	
DRICH1	51233	broad.mit.edu	37	22	23974156	23974156	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr22:23974156T>C	ENST00000317749.5	-	1	352	c.55A>G	c.(55-57)Aag>Gag	p.K19E	KB-1572G7.3_ENST00000390329.3_RNA	NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		19										endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						GGTGCGTCCTTCCCCCTGGGC	0.532																																					p.K19E													.	C22orf43	18		0			c.A55G												93.0	95.0	95.0					22																	23974156		1965	4139	6104	SO:0001583	missense	51233	exon1			CGTCCTTCCCCCT																												ENST00000317749.5:c.55A>G	22.37:g.23974156T>C	ENSP00000316137:p.Lys19Glu		Somatic	122	0.0081967213	1		WXS	Illumina HiSeq	Phase_I	151	0.04	6	NM_016449	3	0.00	0	Q6ICJ8|Q6P4I3|Q9NU31	Missense_Mutation	SNP	ENST00000317749.5	37	CCDS42985.1	.	.	.	.	.	.	.	.	.	.	t	6.700	0.497794	0.12762	.	.	ENSG00000189269	ENST00000317749	T	0.32515	1.45	0.14	-0.28	0.12886	.	.	.	.	.	T	0.30324	0.0761	L	0.34521	1.04	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.20306	-1.0279	8	0.51188	T	0.08	.	.	.	.	.	19	Q6PGQ1	CV043_HUMAN	E	19	ENSP00000316137:K19E	ENSP00000316137:K19E	K	-	1	0	C22orf43	22304156	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.944000	0.03913	-1.393000	0.02079	-1.425000	0.01104	AAG			0.532	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319708.2			
MKL1	57591	mdanderson.org	37	22	40807620	40807620	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr22:40807620G>T	ENST00000355630.3	-	15	3160	c.2570C>A	c.(2569-2571)cCc>cAc	p.P857H	MKL1_ENST00000396617.3_3'UTR|MKL1_ENST00000407029.1_Missense_Mutation_p.P857H|MKL1_ENST00000402042.1_Missense_Mutation_p.P807H	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	857					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GGGTGACGGGGGGTGGTCCAG	0.627			T	RBM15	acute megakaryocytic leukemia																																p.P857H				Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	.			0			c.C2570A												82.0	65.0	71.0					22																	40807620		2203	4300	6503	SO:0001583	missense	57591	exon15			GACGGGGGGTGGT	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.2570C>A	22.37:g.40807620G>T	ENSP00000347847:p.Pro857His		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_020831	117	0.00	0	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657652	0.88154	.	.	ENSG00000196588	ENST00000355630;ENST00000402042;ENST00000407029;ENST00000499213	T;T;T	0.61627	0.1;0.09;0.1	4.65	4.65	0.58169	.	0.167755	0.52532	D	0.000064	T	0.73713	0.3622	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.73550	-0.3947	10	0.44086	T	0.13	-23.8263	18.1028	0.89510	0.0:0.0:1.0:0.0	.	807;857	B0QY83;Q969V6	.;MKL1_HUMAN	H	857;807;857;11	ENSP00000347847:P857H;ENSP00000385584:P807H;ENSP00000385835:P857H	ENSP00000347847:P857H	P	-	2	0	MKL1	39137566	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.248000	0.95456	2.586000	0.87340	0.561000	0.74099	CCC			0.627	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321522.1		NM_020831	
TNFRSF13C	115650	mdanderson.org	37	22	42322228	42322228	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr22:42322228G>T	ENST00000291232.3	-	2	288	c.244C>A	c.(244-246)Ccc>Acc	p.P82T	MIR378I_ENST00000582688.1_RNA	NM_052945.3	NP_443177.1	Q96RJ3	TR13C_HUMAN	tumor necrosis factor receptor superfamily, member 13C	82					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of germinal center formation (GO:0002636)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				lung(2)|urinary_tract(1)	3						agcAGCGCGGGGGCGCCAAAG	0.781																																					p.P82T													.	.			0			c.C244A												5.0	6.0	6.0					22																	42322228		1886	3777	5663	SO:0001583	missense	115650	exon2			GCGCGGGGGCGCC	AF373846	CCDS14024.1	22q13.1-q13.3	2014-09-17			ENSG00000159958	ENSG00000159958		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	17755	protein-coding gene	gene with protein product		606269				11509692	Standard	NM_052945		Approved	BAFFR, CD268	uc003bbl.2	Q96RJ3	OTTHUMG00000151271	ENST00000291232.3:c.244C>A	22.37:g.42322228G>T	ENSP00000291232:p.Pro82Thr		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_052945	2	0.00	0		Missense_Mutation	SNP	ENST00000291232.3	37	CCDS14024.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020765	0.54576	.	.	ENSG00000159958	ENST00000291232	T	0.70282	-0.47	3.16	3.16	0.36331	.	0.000000	0.53938	D	0.000055	T	0.73458	0.3589	L	0.32530	0.975	0.35175	D	0.771936	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.79339	-0.1844	10	0.59425	D	0.04	-9.9864	10.0698	0.42325	0.0:0.0:1.0:0.0	.	82;82	Q5H8V1;Q96RJ3	.;TR13C_HUMAN	T	82	ENSP00000291232:P82T	ENSP00000291232:P82T	P	-	1	0	TNFRSF13C	40652174	1.000000	0.71417	0.998000	0.56505	0.420000	0.31355	2.103000	0.41806	2.063000	0.61619	0.313000	0.20887	CCC			0.781	TNFRSF13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322046.1			
CPT1B	1375	mdanderson.org	37	22	51016324	51016324	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr22:51016324G>T	ENST00000360719.2	-	2	158	c.21C>A	c.(19-21)gcC>gcA	p.A7A	CHKB_ENST00000463053.1_5'Flank|CPT1B_ENST00000440709.1_Silent_p.A7A|CPT1B_ENST00000405237.3_Silent_p.A7A|CPT1B_ENST00000395650.2_Silent_p.A7A|CPT1B_ENST00000434492.2_5'UTR|CPT1B_ENST00000312108.7_Silent_p.A7A|CHKB-CPT1B_ENST00000452668.1_5'UTR|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000457250.1_Silent_p.A7A	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	7					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		GGAAGGCCACGGCCTGGTGAG	0.692																																					p.A7A	Esophageal Squamous(170;988 1933 25577 30295 48163)												.	.			0			c.C21A												51.0	47.0	49.0					22																	51016324		2203	4300	6503	SO:0001819	synonymous_variant	1375	exon2			GGCCACGGCCTGG	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.21C>A	22.37:g.51016324G>T			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001145135	38	0.00	0	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Silent	SNP	ENST00000360719.2	37	CCDS14098.1																																																																																					0.692	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317264.5		NM_152246	
SCN11A	11280	mdanderson.org	37	3	38986945	38986945	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:38986945C>A	ENST00000302328.3	-	3	643	c.445G>T	c.(445-447)Ggg>Tgg	p.G149W	SCN11A_ENST00000456224.3_Missense_Mutation_p.G149W|SCN11A_ENST00000450244.1_Missense_Mutation_p.G149W|SCN11A_ENST00000444237.2_Missense_Mutation_p.G149W	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	149					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ttagcaggccctgtagccatg	0.413																																					p.G149W													.	.			0			c.G445T												155.0	139.0	145.0					3																	38986945		2203	4300	6503	SO:0001583	missense	11280	exon3			CAGGCCCTGTAGC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.445G>T	3.37:g.38986945C>A	ENSP00000307599:p.Gly149Trp		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_014139	0		0	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984439	0.35036	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	3.89	-1.27	0.09347	.	1.665100	0.02782	N	0.121008	D	0.95472	0.8529	L	0.40543	1.245	0.09310	N	1	P	0.50369	0.934	P	0.46850	0.529	D	0.89247	0.3588	10	0.87932	D	0	.	8.7661	0.34704	0.0:0.3656:0.0:0.6344	.	149	Q9UI33	SCNBA_HUMAN	W	149	ENSP00000307599:G149W;ENSP00000400945:G149W;ENSP00000416757:G149W;ENSP00000408028:G149W	ENSP00000307599:G149W	G	-	1	0	SCN11A	38961949	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.511000	0.22739	-0.249000	0.09569	-0.367000	0.07326	GGG			0.413	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109746.4		NM_014139	
CCR9	10803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45943034	45943034	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:45943034G>A	ENST00000357632.2	+	3	934	c.754G>A	c.(754-756)Gcc>Acc	p.A252T	CCR9_ENST00000422395.1_3'UTR|LZTFL1_ENST00000536047.1_Intron|Y_RNA_ENST00000364765.1_RNA|CCR9_ENST00000395963.2_Missense_Mutation_p.A240T|LZTFL1_ENST00000539217.1_Intron|CCR9_ENST00000355983.2_Missense_Mutation_p.A240T	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	252					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		CAAGCACAAAGCCCTAAAAGT	0.478																																					p.A252T													.	.			0			c.G754A												221.0	183.0	196.0					3																	45943034		2203	4300	6503	SO:0001583	missense	10803	exon3			CACAAAGCCCTAA	AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.754G>A	3.37:g.45943034G>A	ENSP00000350256:p.Ala252Thr		Somatic	92	0	0		WXS	Illumina HiSeq	.	83	0.29	24	NM_031200	0		0	Q4VBM3|Q549E0|Q9UQQ6	Missense_Mutation	SNP	ENST00000357632.2	37	CCDS2732.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132608	0.77662	.	.	ENSG00000173585	ENST00000357632;ENST00000395963;ENST00000355983	T;T;T	0.38077	1.16;1.16;1.16	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.204777	0.41194	D	0.000925	T	0.59307	0.2184	M	0.80028	2.48	0.51767	D	0.999937	D	0.76494	0.999	D	0.77557	0.99	T	0.64136	-0.6478	10	0.87932	D	0	.	10.3905	0.44166	0.0:0.1343:0.709:0.1567	.	252	P51686	CCR9_HUMAN	T	252;240;240	ENSP00000350256:A252T;ENSP00000379292:A240T;ENSP00000348260:A240T	ENSP00000348260:A240T	A	+	1	0	CCR9	45918038	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.468000	0.66743	2.289000	0.77006	0.563000	0.77884	GCC			0.478	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257323.2			
PLXNB1	5364	mdanderson.org	37	3	48454325	48454325	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:48454325G>T	ENST00000358536.4	-	25	4949	c.4680C>A	c.(4678-4680)ggC>ggA	p.G1560G	PLXNB1_ENST00000448774.2_Silent_p.G171G|PLXNB1_ENST00000296440.6_Silent_p.G1560G|PLXNB1_ENST00000465117.1_5'Flank|PLXNB1_ENST00000456774.1_Silent_p.G1377G|PLXNB1_ENST00000358459.4_Silent_p.G1377G	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1560					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGATGCCGCTGCCCAGGAGGT	0.582																																					p.G1560G													.	.			0			c.C4680A												76.0	71.0	73.0					3																	48454325		2203	4300	6503	SO:0001819	synonymous_variant	5364	exon25			GCCGCTGCCCAGG	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.4680C>A	3.37:g.48454325G>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001130082	59	0.00	0	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	ENST00000358536.4	37	CCDS2765.1																																																																																					0.582	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344454.1		NM_002673	
CNTN3	5067	mdanderson.org	37	3	74548917	74548917	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:74548917G>T	ENST00000263665.6	-	2	102	c.75C>A	c.(73-75)ggC>ggA	p.G25G		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	25					cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TAAATACAGGGCCTTGTAAGA	0.368																																					p.G25G													.	.			0			c.C75A												89.0	94.0	92.0					3																	74548917		2203	4300	6503	SO:0001819	synonymous_variant	5067	exon2			TACAGGGCCTTGT	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.75C>A	3.37:g.74548917G>T			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_020872	5	0.00	0	B9EK50|Q9H039	Silent	SNP	ENST00000263665.6	37	CCDS33790.1																																																																																					0.368	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352306.1		NM_020872	
ROBO1	6091	mdanderson.org	37	3	78706359	78706359	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:78706359A>G	ENST00000464233.1	-	18	2616	c.2503T>C	c.(2503-2505)Ttt>Ctt	p.F835L	ROBO1_ENST00000436010.2_Missense_Mutation_p.F796L|ROBO1_ENST00000495273.1_Missense_Mutation_p.F799L|ROBO1_ENST00000467549.1_Missense_Mutation_p.F799L	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	835	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.			F -> L (in Ref. 4; AAI15023). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ACCACGGAAAAGGTGGAACCA	0.478																																					p.F835L													.	.			0			c.T2503C												79.0	79.0	79.0					3																	78706359		1966	4172	6138	SO:0001583	missense	6091	exon18			CGGAAAAGGTGGA	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2503T>C	3.37:g.78706359A>G	ENSP00000420321:p.Phe835Leu		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	45	0.09	4	NM_002941	55	0.00	0	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	A	4.900	0.167264	0.09339	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	6.04	4.88	0.63580	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.391844	0.31648	N	0.007297	T	0.17577	0.0422	N	0.00392	-1.555	0.23831	N	0.996728	B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0	B;B;B;B;B	0.12156	0.001;0.006;0.007;0.002;0.002	T	0.20840	-1.0263	9	.	.	.	.	9.4278	0.38590	0.8637:0.0:0.1363:0.0	.	799;835;799;799;796	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	L	796;799;835;799;799;839	ENSP00000406043:F796L;ENSP00000420321:F835L;ENSP00000420637:F799L;ENSP00000417992:F799L	.	F	-	1	0	ROBO1	78789049	0.975000	0.34042	0.918000	0.36340	0.384000	0.30261	2.277000	0.43417	1.104000	0.41587	0.529000	0.55759	TTT			0.478	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352610.1		NM_002941	
H1FOO	132243	broad.mit.edu	37	3	129268107	129268108	+	Frame_Shift_Ins	INS	-	-	A	rs150160917		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:129268107_129268108insA	ENST00000324382.2	+	3	647_648	c.642_643insA	c.(643-645)aggfs	p.R215fs	H1FOO_ENST00000503977.1_Frame_Shift_Ins_p.R76fs	NM_153833.1	NP_722575.1	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific	215					meiotic nuclear division (GO:0007126)|negative regulation of stem cell differentiation (GO:2000737)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of DNA methylation (GO:0044030)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|female germ cell nucleus (GO:0001674)|nucleosome (GO:0000786)|nucleus (GO:0005634)	nucleosomal DNA binding (GO:0031492)			endometrium(1)|lung(4)|skin(1)	6						CGGGAGAGGCTAGGAAGGTGCC	0.653																																					p.A214fs													.	H1FOO	20		0			c.642_643insA																																									SO:0001589	frameshift_variant	132243	exon3			AGAGGCTAGGAAG	AY158091	CCDS3064.1	3q21.3	2011-01-27			ENSG00000178804	ENSG00000178804		"""Histones / Replication-independent"""	18463	protein-coding gene	gene with protein product						12408966	Standard	NM_153833		Approved		uc003emu.3	Q8IZA3	OTTHUMG00000159541	ENST00000324382.2:c.643dupA	3.37:g.129268108_129268108dupA	ENSP00000319799:p.Arg215fs		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	80	0.09	7	NM_153833	0		0	Q86WT7	Frame_Shift_Ins	INS	ENST00000324382.2	37	CCDS3064.1																																																																																					0.653	H1FOO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356100.3		NM_153833	
CLDN18	51208	mdanderson.org	37	3	137742658	137742658	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:137742658G>T	ENST00000183605.5	+	2	605	c.379G>T	c.(379-381)Gtc>Ttc	p.V127F	CLDN18_ENST00000343735.4_Missense_Mutation_p.V127F	NM_016369.3	NP_057453.1	P56856	CLD18_HUMAN	claudin 18	127					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						CATGTTCATTGTCTCAGGTAA	0.488																																					p.V127F													.	.			0			c.G379T												77.0	67.0	70.0					3																	137742658		2203	4300	6503	SO:0001583	missense	51208	exon2			TTCATTGTCTCAG	AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000183605.5:c.379G>T	3.37:g.137742658G>T	ENSP00000183605:p.Val127Phe		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_016369	4	0.00	0	A5PL21|Q96PH4	Missense_Mutation	SNP	ENST00000183605.5	37	CCDS3095.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436414	0.25813	.	.	ENSG00000066405	ENST00000343735;ENST00000183605;ENST00000536138	D;D	0.90133	-2.62;-2.62	5.49	-1.62	0.08372	.	0.621880	0.16273	N	0.221713	D	0.85191	0.5640	L	0.45581	1.43	0.09310	N	0.999993	B;B	0.28900	0.144;0.227	B;B	0.33196	0.159;0.134	T	0.76019	-0.3112	10	0.51188	T	0.08	.	8.0595	0.30625	0.3852:0.1279:0.4869:0.0	.	127;127	P56856;P56856-2	CLD18_HUMAN;.	F	127;127;116	ENSP00000340939:V127F;ENSP00000183605:V127F	ENSP00000183605:V127F	V	+	1	0	CLDN18	139225348	0.008000	0.16893	0.780000	0.31762	0.590000	0.36582	-0.079000	0.11357	-0.147000	0.11254	-1.223000	0.01593	GTC			0.488	CLDN18-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000357199.2		NM_001002026	
MUC4	4585	mdanderson.org	37	3	195509308	195509308	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr3:195509308G>A	ENST00000463781.3	-	2	9602	c.9143C>T	c.(9142-9144)tCa>tTa	p.S3048L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3048L|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	989					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCTGAGGAAGTGTC	0.607																																					p.S3048L													.	.			0			c.C9143T																																									SO:0001583	missense	4585	exon2			GATGCTGAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9143C>T	3.37:g.195509308G>A	ENSP00000417498:p.Ser3048Leu		Somatic	33	0.0303030303	1		WXS	Illumina HiSeq	Phase_I	115	0.04	5	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	8.283	0.816093	0.16607	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.44;1.43	.	.	.	.	.	.	.	.	T	0.15869	0.0382	N	0.19112	0.55	0.20975	N	0.999814	B	0.22480	0.07	B	0.14023	0.01	T	0.26360	-1.0105	7	.	.	.	.	5.4195	0.16392	0.0:0.0:1.0:0.0	.	2920	E7ESK3	.	L	3048	ENSP00000417498:S3048L;ENSP00000420243:S3048L	.	S	-	2	0	MUC4	196994087	0.286000	0.24305	0.013000	0.15412	0.000000	0.00434	2.555000	0.45854	0.497000	0.27926	0.000000	0.15137	TCA			0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
KIAA1109	84162	mdanderson.org	37	4	123283210	123283210	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr4:123283210G>T	ENST00000264501.4	+	86	15199	c.14826G>T	c.(14824-14826)aaG>aaT	p.K4942N	KIAA1109_ENST00000388738.3_Missense_Mutation_p.K4942N			Q2LD37	K1109_HUMAN	KIAA1109	4942					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTGGAAGAAAGATTGATCCAG	0.343																																					p.K4942N													.	.			0			c.G14826T												97.0	96.0	96.0					4																	123283210		1813	4074	5887	SO:0001583	missense	84162	exon84			AAGAAAGATTGAT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14826G>T	4.37:g.123283210G>T	ENSP00000264501:p.Lys4942Asn		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_015312	95	0.00	0	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.76|12.76	2.035270|2.035270	0.35893|0.35893	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755|ENST00000306802	T;T;T|.	0.47177|.	0.85;0.85;0.85|.	5.21|5.21	3.13|3.13	0.36017|0.36017	Fragile site-associated protein, C-terminal (1);|.	0.047126|.	0.85682|.	D|.	0.000000|.	T|T	0.44993|0.44993	0.1320|0.1320	L|L	0.38531|0.38531	1.155|1.155	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.85130|.	0.991;0.997|.	T|T	0.26573|0.26573	-1.0099|-1.0099	10|5	0.54805|.	T|.	0.06|.	.|.	6.2224|6.2224	0.20689|0.20689	0.3991:0.0:0.6009:0.0|0.3991:0.0:0.6009:0.0	.|.	4941;4942|.	Q2LD37-4;Q2LD37|.	.;K1109_HUMAN|.	N|I	4942;4942;1611;543|1318	ENSP00000264501:K4942N;ENSP00000373390:K4942N;ENSP00000410874:K1611N|.	ENSP00000264501:K4942N|.	K|R	+|+	3|2	2|0	KIAA1109|KIAA1109	123502660|123502660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.938000|1.938000	0.40203|0.40203	1.207000|1.207000	0.43291|0.43291	0.655000|0.655000	0.94253|0.94253	AAG|AGA			0.343	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316415.1		NM_020797	
LRBA	987	bcgsc.ca	37	4	151236743	151236743	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr4:151236743G>T	ENST00000357115.3	-	52	7939	c.7696C>A	c.(7696-7698)Cag>Aag	p.Q2566K	LRBA_ENST00000510413.1_Missense_Mutation_p.Q2555K|LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000507224.1_Missense_Mutation_p.Q2555K|LRBA_ENST00000535741.1_Missense_Mutation_p.Q2555K	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2566						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					ACTGGCAGCTGGTATGGCTGG	0.388																																					p.Q2566K													.	LRBA	253		0			c.C7696A												109.0	99.0	103.0					4																	151236743		2203	4300	6503	SO:0001583	missense	987	exon52			GCAGCTGGTATGG	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7696C>A	4.37:g.151236743G>T	ENSP00000349629:p.Gln2566Lys		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_1	51	0.08	4	NM_006726	35	0.00	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340038	0.24339	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.71579	-0.58;-0.58;-0.58;0.5	5.6	5.6	0.85130	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.62853	0.2462	N	0.24115	0.695	0.80722	D	1	P;B;B;P	0.49447	0.924;0.176;0.031;0.552	P;B;B;B	0.47044	0.535;0.176;0.159;0.194	T	0.58662	-0.7597	10	0.07482	T	0.82	.	19.6104	0.95604	0.0:0.0:1.0:0.0	.	2566;2555;2555;461	P50851;F5H1X8;P50851-2;Q68D03	LRBA_HUMAN;.;.;.	K	2555;2555;2566;2555	ENSP00000446299:Q2555K;ENSP00000421552:Q2555K;ENSP00000349629:Q2566K;ENSP00000422180:Q2555K	ENSP00000349629:Q2566K	Q	-	1	0	LRBA	151456193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.434000	0.97515	2.636000	0.89361	0.557000	0.71058	CAG			0.388	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000364939.1			
PCDHB10	56126	mdanderson.org	37	5	140573922	140573922	+	Silent	SNP	C	C	T	rs376773467		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr5:140573922C>T	ENST00000239446.4	+	1	1981	c.1797C>T	c.(1795-1797)aaC>aaT	p.N599N		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGCCAGAACGCCTGGCTGT	0.721																																					p.N599N													.	.			0			c.C1797T												4.0	6.0	5.0					5																	140573922		1101	2431	3532	SO:0001819	synonymous_variant	56126	exon1			CCAGAACGCCTGG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1797C>T	5.37:g.140573922C>T			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_018930	0		0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																					0.721	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251821.1		NM_018930	
DBN1	1627	hgsc.bcm.edu	37	5	176884449	176884449	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr5:176884449G>T	ENST00000309007.5	-	14	2154	c.1935C>A	c.(1933-1935)ttC>ttA	p.F645L	DBN1_ENST00000393563.4_Missense_Mutation_p.F377L|DBN1_ENST00000292385.5_Missense_Mutation_p.F647L|DBN1_ENST00000393565.1_Missense_Mutation_p.F691L|DBN1_ENST00000512501.1_3'UTR	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	645					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACCACCCTCGAAGCCCTCCT	0.627											OREG0016462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F647L													.	.			0			c.C1941A												137.0	121.0	126.0					5																	176884449		2203	4300	6503	SO:0001583	missense	1627	exon15			ACCCTCGAAGCCC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1935C>A	5.37:g.176884449G>T	ENSP00000308532:p.Phe645Leu		Somatic	80	0	0	1934	WXS	Illumina HiSeq	.	84	0.05	4	NM_080881	411	0.00	2	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330177	0.41297	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000393563	T;T;T;T	0.35236	1.34;1.32;1.34;1.4	4.75	1.76	0.24704	.	0.408692	0.22332	N	0.061444	T	0.19765	0.0475	N	0.19112	0.55	0.26130	N	0.980422	P;B;P	0.42785	0.79;0.433;0.568	B;B;B	0.40009	0.316;0.07;0.147	T	0.11251	-1.0595	10	0.87932	D	0	-16.6398	3.5144	0.07719	0.3778:0.1927:0.4295:0.0	.	595;645;647	B3KSQ7;Q16643;Q16643-2	.;DREB_HUMAN;.	L	645;647;691;377	ENSP00000308532:F645L;ENSP00000292385:F647L;ENSP00000377195:F691L;ENSP00000377193:F377L	ENSP00000292385:F647L	F	-	3	2	DBN1	176817055	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	0.701000	0.25616	0.616000	0.30141	-0.291000	0.09656	TTC			0.627	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000253429.2		NM_080881	
GRM4	2914	mdanderson.org	37	6	34026771	34026771	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr6:34026771G>T	ENST00000538487.2	-	5	1450	c.1007C>A	c.(1006-1008)cCc>cAc	p.P336H	GRM4_ENST00000535756.1_Missense_Mutation_p.P203H|GRM4_ENST00000544773.2_Missense_Mutation_p.P167H|GRM4_ENST00000455714.2_Missense_Mutation_p.P196H|GRM4_ENST00000374181.4_Missense_Mutation_p.P336H|GRM4_ENST00000374177.3_Missense_Mutation_p.P267H|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000609222.1_Missense_Mutation_p.P203H	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	336					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CATCCTCTTGGGGAGGATCGT	0.622																																					p.P336H													GRM4_ENST00000374181,NS,malignant_melanoma,-1,6	GRM4_ENST00000374181	-1	6	0			c.C1007A												100.0	59.0	73.0					6																	34026771		2203	4300	6503	SO:0001583	missense	2914	exon5			CTCTTGGGGAGGA	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1007C>A	6.37:g.34026771G>T	ENSP00000440556:p.Pro336His		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001256811	1	0.00	0	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.811350	0.50527	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69;-1.69;-1.69	3.34	3.34	0.38264	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	D	0.88455	0.6441	M	0.84948	2.725	0.80722	D	1	P;D;D;D;D	0.89917	0.939;0.967;1.0;1.0;0.994	P;P;D;D;D	0.97110	0.71;0.87;1.0;0.989;0.968	D	0.86986	0.2107	10	0.20519	T	0.43	.	15.1984	0.73116	0.0:0.0:1.0:0.0	.	336;167;196;336;203	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	H	336;267;28;203;167;336;196	ENSP00000363296:P336H;ENSP00000363292:P267H;ENSP00000445533:P28H;ENSP00000437925:P203H;ENSP00000437730:P167H;ENSP00000440556:P336H;ENSP00000398456:P196H	ENSP00000363292:P267H	P	-	2	0	GRM4	34134749	1.000000	0.71417	1.000000	0.80357	0.279000	0.26890	9.599000	0.98280	1.877000	0.54381	0.185000	0.17295	CCC			0.622	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040213.2			
ETV7	51513	mdanderson.org	37	6	36339272	36339272	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr6:36339272G>T	ENST00000340181.4	-	5	740	c.499C>A	c.(499-501)Ctt>Att	p.L167I	ETV7_ENST00000538992.1_Missense_Mutation_p.L16I|ETV7_ENST00000339796.5_Missense_Mutation_p.L167I|ETV7_ENST00000373738.1_Missense_Mutation_p.L112I|ETV7_ENST00000373737.4_Intron	NM_001207037.1|NM_001207040.1|NM_016135.3	NP_001193966.1|NP_001193969.1|NP_057219.1	Q9Y603	ETV7_HUMAN	ets variant 7	167					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(4)	10						TTGCTGGTAAGCCCTGGGTCT	0.622																																					p.L167I													.	.			0			c.C499A												53.0	47.0	49.0					6																	36339272		2203	4300	6503	SO:0001583	missense	51513	exon5			TGGTAAGCCCTGG	AF116508	CCDS4819.1, CCDS56422.1, CCDS56423.1, CCDS56424.1, CCDS56425.1, CCDS75440.1, CCDS75441.1	6p21	2008-09-12	2008-09-12		ENSG00000010030	ENSG00000010030			18160	protein-coding gene	gene with protein product	"""TEL2 oncogene"""	605255	"""ets variant gene 7 (TEL2 oncogene)"""			10828014, 11108721	Standard	NM_016135		Approved	TEL2, TEL-2	uc003omb.3	Q9Y603	OTTHUMG00000014594	ENST00000340181.4:c.499C>A	6.37:g.36339272G>T	ENSP00000341843:p.Leu167Ile		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_016135	11	0.00	0	B3KVC2|B4DVB6|B4E1G4|Q5R3L3|Q5R3L4|Q9NZ65|Q9NZ66|Q9NZ68|Q9NZR8|Q9UNJ7|Q9Y5K4|Q9Y604	Missense_Mutation	SNP	ENST00000340181.4	37	CCDS4819.1	.	.	.	.	.	.	.	.	.	.	G	9.502	1.103355	0.20632	.	.	ENSG00000010030	ENST00000339796;ENST00000340181;ENST00000373738;ENST00000538992	T;T;T;T	0.15139	2.99;3.0;2.66;2.45	3.49	-1.42	0.08913	.	2.987830	0.01985	U	0.045116	T	0.03739	0.0106	L	0.29908	0.895	0.09310	N	1	P;B;B;B;P	0.40398	0.716;0.356;0.267;0.356;0.617	B;B;B;B;B	0.39068	0.289;0.071;0.016;0.104;0.11	T	0.19844	-1.0293	10	0.22109	T	0.4	.	4.5927	0.12315	0.3882:0.1657:0.4461:0.0	.	108;112;167;112;167	Q9Y603-2;Q9Y603-4;Q9Y603;Q9Y603-6;Q9Y603-5	.;.;ETV7_HUMAN;.;.	I	167;167;112;16	ENSP00000342260:L167I;ENSP00000341843:L167I;ENSP00000362843:L112I;ENSP00000440592:L16I	ENSP00000342260:L167I	L	-	1	0	ETV7	36447250	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.234000	0.09028	-0.148000	0.11234	-0.219000	0.12488	CTT			0.622	ETV7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040341.1		NM_016135	
FOXP4	116113	mdanderson.org	37	6	41556457	41556457	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr6:41556457G>T	ENST00000307972.4	+	8	1065	c.1053G>T	c.(1051-1053)caG>caT	p.Q351H	FOXP4_ENST00000409208.1_Missense_Mutation_p.Q351H|FOXP4_ENST00000373057.3_Missense_Mutation_p.Q349H|FOXP4_ENST00000373060.1_Missense_Mutation_p.Q351H|FOXP4_ENST00000373063.3_Missense_Mutation_p.Q350H			Q8IVH2	FOXP4_HUMAN	forkhead box P4	351	Leucine-zipper.				embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					TGGTGCAGCAGCTGGAGATCC	0.627																																					p.Q351H													.	.			0			c.G1053T												122.0	105.0	111.0					6																	41556457		2203	4300	6503	SO:0001583	missense	116113	exon9			GCAGCAGCTGGAG	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.1053G>T	6.37:g.41556457G>T	ENSP00000309823:p.Gln351His		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	46	0.09	4	NM_001012426	194	0.00	0	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	37	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.803016	0.50315	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.28896	0.0717	M	0.84326	2.69	0.80722	D	1	B;B;P	0.47350	0.011;0.038;0.894	B;B;P	0.47162	0.027;0.027;0.54	T	0.27468	-1.0073	10	0.66056	D	0.02	.	17.7185	0.88344	0.0:0.0:1.0:0.0	.	350;349;351	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	H	351;350;351;349;351	ENSP00000362151:Q351H;ENSP00000362154:Q350H;ENSP00000386958:Q351H;ENSP00000362148:Q349H;ENSP00000309823:Q351H	ENSP00000309823:Q351H	Q	+	3	2	FOXP4	41664435	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.452000	0.60054	2.283000	0.76528	0.561000	0.74099	CAG			0.627	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000106767.1		NM_138457	
ECT2L	345930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	139223666	139223666	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr6:139223666C>T	ENST00000423192.1	+	21	2778	c.2617C>T	c.(2617-2619)Cca>Tca	p.P873S	ECT2L_ENST00000367682.2_Missense_Mutation_p.P873S|ECT2L_ENST00000541398.1_Missense_Mutation_p.P727S			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	873							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						TCTTCAGGGTCCAAAATATAA	0.323			"""N, Splice, Mis"""		ETP ALL																																p.P873S				Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	.			0			c.C2617T												91.0	89.0	89.0					6																	139223666		1820	4080	5900	SO:0001583	missense	345930	exon21			CAGGGTCCAAAAT		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.2617C>T	6.37:g.139223666C>T	ENSP00000387388:p.Pro873Ser		Somatic	47	0	0		WXS	Illumina HiSeq	.	45	0.31	14	NM_001195037	0		0	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.551831	0.45487	.	.	ENSG00000203734	ENST00000423192;ENST00000367682;ENST00000541398	T;T;T	0.76709	-1.04;-1.04;-1.04	5.85	4.97	0.65823	Pleckstrin homology-type (1);	0.139599	0.25783	N	0.028329	T	0.50599	0.1625	L	0.36672	1.1	0.24455	N	0.994465	B;B	0.22909	0.077;0.046	B;B	0.23419	0.046;0.021	T	0.38090	-0.9677	10	0.28530	T	0.3	-8.0E-4	11.2525	0.49034	0.0:0.9134:0.0:0.0866	.	727;873	F5H7S9;Q008S8	.;ECT2L_HUMAN	S	873;873;727	ENSP00000387388:P873S;ENSP00000356655:P873S;ENSP00000442307:P727S	ENSP00000356655:P873S	P	+	1	0	ECT2L	139265359	0.997000	0.39634	0.992000	0.48379	0.894000	0.52154	2.266000	0.43320	1.457000	0.47850	0.655000	0.94253	CCA			0.323	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042441.3		NM_001077706	
KIF25	3834	mdanderson.org	37	6	168443364	168443364	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr6:168443364G>T	ENST00000443060.2	+	9	1344	c.953G>T	c.(952-954)aGc>aTc	p.S318I	KIF25_ENST00000351261.3_Intron|KIF25_ENST00000354419.2_Missense_Mutation_p.S318I			Q9UIL4	KIF25_HUMAN	kinesin family member 25	318	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TACCGGAACAGCAGGCTCACC	0.642																																					p.S318I													.	.			0			c.G953T												114.0	109.0	110.0					6																	168443364		2203	4300	6503	SO:0001583	missense	3834	exon8			GGAACAGCAGGCT	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.953G>T	6.37:g.168443364G>T	ENSP00000388878:p.Ser318Ile		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_030615	1	0.00	0	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344479	0.61073	.	.	ENSG00000125337	ENST00000443060;ENST00000354419	D;D	0.86297	-2.1;-2.1	4.13	3.21	0.36854	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.94407	0.8201	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94822	0.7988	10	0.87932	D	0	-29.3518	11.0021	0.47611	0.0:0.1905:0.8095:0.0	.	318	Q9UIL4	KIF25_HUMAN	I	318	ENSP00000388878:S318I;ENSP00000346401:S318I	ENSP00000346401:S318I	S	+	2	0	KIF25	168186213	1.000000	0.71417	0.998000	0.56505	0.640000	0.38277	5.310000	0.65780	0.792000	0.33850	0.543000	0.68304	AGC			0.642	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362509.1			
PMS2P3	5387	broad.mit.edu	37	7	75142330	75142330	+	RNA	DEL	T	T	-	rs587638101	byFrequency	TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr7:75142330delT	ENST00000418756.1	-	0	991				Y_RNA_ENST00000364004.1_RNA	NR_028059.1		Q13401	PM2P3_HUMAN	postmeiotic segregation increased 2 pseudogene 3						mismatch repair (GO:0006298)|regulation of transcription, DNA-templated (GO:0006355)	mismatch repair complex (GO:0032300)	nucleic acid binding (GO:0003676)			lung(1)	1						ttctttcctcttttttttttt	0.313																																					.	NSCLC(70;602 1339 5301 18528 38453)												.	PMS2P3	7		0			.																																											0	.			TTCCTCTTTTTTT	D38437		7q11.23	2010-10-26	2010-10-26	2010-10-26	ENSG00000127957	ENSG00000127957			9128	pseudogene	pseudogene			"""postmeiotic segregation increased 2-like 3"", ""postmeiotic segregation increased 2-like 3, pseudogene"""	PMS2L9, PMS2L3		8586419	Standard	NR_028059		Approved	PMS5, PMSR3	uc022agi.1	Q13401	OTTHUMG00000156049		7.37:g.75142330delT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	2	0.00	0	A6NG70|Q3MJ29	RNA	DEL	ENST00000418756.1	37																																																																																						0.313	PMS2P3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000342862.2		NR_028059	
LAPTM4B	55353	mdanderson.org	37	8	98788291	98788291	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr8:98788291C>A	ENST00000521545.2	+	1	288	c.54C>A	c.(52-54)tgC>tgA	p.C18*	LAPTM4B_ENST00000445593.2_Nonsense_Mutation_p.C109*|RNU7-177P_ENST00000517101.1_RNA			Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta	162					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			GCTGCTTGTGCTGCCATGTCC	0.697																																					p.C109X													.	.			0			c.C327A												18.0	20.0	19.0					8																	98788291		2158	4244	6402	SO:0001587	stop_gained	55353	exon1			CTTGTGCTGCCAT	AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000521545.2:c.54C>A	8.37:g.98788291C>A	ENSP00000428409:p.Cys18*		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_018407	170	0.00	0	Q3ZCV5|Q7L909|Q86VH8|Q9H060	Nonsense_Mutation	SNP	ENST00000521545.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	45|45	11.423764|11.423764	0.99559|0.99559	.|.	.|.	ENSG00000104341|ENSG00000104341	ENST00000517924|ENST00000445593;ENST00000378722;ENST00000521545	.|.	.|.	.|.	4.29|4.29	2.43|2.43	0.29744|0.29744	.|.	.|0.056594	.|0.64402	.|D	.|0.000001	T|.	0.21761|.	0.0524|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34054|.	-0.9844|.	3|.	.|0.02654	.|T	.|1	-15.4307|-15.4307	8.9933|8.9933	0.36037|0.36037	0.0:0.8173:0.0:0.1827|0.0:0.8173:0.0:0.1827	.|.	.|.	.|.	.|.	D|X	72|109;155;18	.|.	.|ENSP00000367995:C155X	A|C	+|+	2|3	0|2	LAPTM4B|LAPTM4B	98857467|98857467	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.819000|0.819000	0.46315|0.46315	0.972000|0.972000	0.29409|0.29409	1.015000|1.015000	0.39444|0.39444	0.643000|0.643000	0.83706|0.83706	GCT|TGC			0.697	LAPTM4B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000380016.2			
BAI1	575	mdanderson.org	37	8	143614695	143614695	+	Silent	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr8:143614695G>T	ENST00000517894.1	+	25	4332	c.3438G>T	c.(3436-3438)ctG>ctT	p.L1146L	BAI1_ENST00000323289.5_Silent_p.L1146L			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1146					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGCCGCTGCTGGCGCTGACCT	0.706																																					p.L1146L													.	.			0			c.G3438T												16.0	22.0	20.0					8																	143614695		2199	4287	6486	SO:0001819	synonymous_variant	575	exon24			GCTGCTGGCGCTG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3438G>T	8.37:g.143614695G>T			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001702	8	0.00	0		Silent	SNP	ENST00000517894.1	37																																																																																						0.706	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000379963.3		NM_001702	
JAK2	3717	mdanderson.org	37	9	5064922	5064922	+	Missense_Mutation	SNP	G	G	T	rs375678155		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr9:5064922G>T	ENST00000381652.3	+	9	1590	c.1096G>T	c.(1096-1098)Gtg>Ttg	p.V366L	JAK2_ENST00000544510.1_Missense_Mutation_p.V217L|JAK2_ENST00000539801.1_Missense_Mutation_p.V366L	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	366	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TTTGTCTTTCGTGTCATTAAT	0.343		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.V366L				Dom	yes		9	9p24	3717	Janus kinase 2		L	.	.			0			c.G1096T												102.0	100.0	101.0					9																	5064922		2203	4300	6503	SO:0001583	missense	3717	exon9	Familial Cancer Database		TCTTTCGTGTCAT		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1096G>T	9.37:g.5064922G>T	ENSP00000371067:p.Val366Leu		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_004972	7	0.00	0	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865012	0.71949	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.67171	-0.25;-0.25;-0.25	5.15	5.15	0.70609	FERM domain (1);	0.059270	0.64402	D	0.000002	T	0.69133	0.3077	M	0.81942	2.565	0.58432	D	0.999999	P	0.36483	0.555	B	0.31614	0.133	T	0.75836	-0.3177	10	0.87932	D	0	-10.4265	18.6185	0.91313	0.0:0.0:1.0:0.0	.	366	O60674	JAK2_HUMAN	L	366;366;217	ENSP00000440387:V366L;ENSP00000371067:V366L;ENSP00000443103:V217L	ENSP00000371067:V366L	V	+	1	0	JAK2	5054922	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	9.459000	0.97638	2.412000	0.81896	0.313000	0.20887	GTG			0.343	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051609.1			
ACO1	48	mdanderson.org	37	9	32431768	32431768	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr9:32431768G>T	ENST00000309951.6	+	15	1916	c.1778G>T	c.(1777-1779)aGa>aTa	p.R593I	ACO1_ENST00000541043.1_Missense_Mutation_p.R494I|ACO1_ENST00000379923.1_Missense_Mutation_p.R593I	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	593					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TGGCCGACTAGAGACGAGATC	0.448											OREG0019130	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R593I													.	.			0			c.G1778T												117.0	108.0	111.0					9																	32431768		2203	4300	6503	SO:0001583	missense	48	exon15			CGACTAGAGACGA	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.1778G>T	9.37:g.32431768G>T	ENSP00000309477:p.Arg593Ile		Somatic	57	0	0	832	WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_002197	34	0.00	0	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	37	CCDS6525.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573349	0.86542	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000541043	T;T;T	0.17854	2.25;2.25;2.25	5.49	5.49	0.81192	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	M	0.73962	2.25	0.80722	D	1	D;B	0.89917	1.0;0.049	D;B	0.72338	0.977;0.022	T	0.20739	-1.0266	10	0.51188	T	0.08	-17.2239	18.505	0.90894	0.0:0.0:1.0:0.0	.	629;593	Q59FI0;P21399	.;ACOC_HUMAN	I	629;593;593;494	ENSP00000309477:R593I;ENSP00000369255:R593I;ENSP00000438733:R494I	ENSP00000309477:R593I	R	+	2	0	ACO1	32421768	1.000000	0.71417	0.987000	0.45799	0.915000	0.54546	9.813000	0.99286	2.746000	0.94184	0.655000	0.94253	AGA			0.448	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051998.3		NM_002197	
LAMC3	10319	mdanderson.org	37	9	133936554	133936554	+	Missense_Mutation	SNP	C	C	T	rs138199679		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chr9:133936554C>T	ENST00000361069.4	+	13	2424	c.2291C>T	c.(2290-2292)aCg>aTg	p.T764M	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	764	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TCGGCCTGTACGACCATCCCA	0.667																																					p.T764M													.	.			0			c.C2291T							C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	48.0	44.0	45.0		2291	1.9	0.1	9	dbSNP_134	45	0,8598		0,0,4299	no	missense	LAMC3	NM_006059.3	81	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	764/1576	133936554	1,13003	2203	4299	6502	SO:0001583	missense	10319	exon13			CCTGTACGACCAT	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.2291C>T	9.37:g.133936554C>T	ENSP00000354360:p.Thr764Met		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_006059	68	0.00	0	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.624973	0.28889	2.27E-4	0.0	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.63417	-0.04	4.79	1.92	0.25849	EGF-like, laminin (3);	0.301676	0.36444	N	0.002584	T	0.44746	0.1308	L	0.27053	0.805	0.24112	N	0.995835	B	0.26483	0.15	B	0.26202	0.067	T	0.30679	-0.9970	10	0.36615	T	0.2	.	8.8357	0.35111	0.0:0.7456:0.0:0.2544	.	764	Q9Y6N6	LAMC3_HUMAN	M	764	ENSP00000354360:T764M	ENSP00000347156:T764M	T	+	2	0	LAMC3	132926375	0.003000	0.15002	0.139000	0.22197	0.500000	0.33767	0.868000	0.27982	0.452000	0.26830	0.557000	0.71058	ACG	0		0.667	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054717.3		NM_006059	
VCX	26609	bcgsc.ca	37	X	7811810	7811810	+	Missense_Mutation	SNP	G	G	C	rs149395826		TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chrX:7811810G>C	ENST00000381059.3	+	3	593	c.374G>C	c.(373-375)aGt>aCt	p.S125T	VCX_ENST00000341408.4_Intron	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	125	10 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|Glu-rich.				chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GAACCACTGAGTCAGGAGAGC	0.617																																					p.S125T													.	VCX	28		0			c.G374C												35.0	45.0	42.0					X																	7811810		1509	3129	4638	SO:0001583	missense	26609	exon3			CACTGAGTCAGGA	AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.374G>C	X.37:g.7811810G>C	ENSP00000370447:p.Ser125Thr		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_1	176	0.07	12	NM_013452	6	0.00	0	A0JNS5|Q4V774|Q9P0H3	Missense_Mutation	SNP	ENST00000381059.3	37	CCDS14128.1	.	.	.	.	.	.	.	.	.	.	-	5.303	0.241346	0.10077	.	.	ENSG00000182583	ENST00000381059	T	0.28255	1.62	.	.	.	.	.	.	.	.	T	0.24509	0.0594	L	0.43923	1.385	0.80722	D	1	B	0.28667	0.219	B	0.39217	0.294	T	0.05784	-1.0864	8	0.11485	T	0.65	.	5.8617	0.18752	9.0E-4:0.0:0.9991:0.0	.	125	Q9H320	VCX1_HUMAN	T	125	ENSP00000370447:S125T	ENSP00000370447:S125T	S	+	2	0	VCX	7771810	0.010000	0.17322	0.074000	0.20217	0.075000	0.17131	0.831000	0.27476	0.068000	0.16574	0.068000	0.15388	AGT			0.617	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000071474.1		NM_013452	
TSC22D3	1831	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	106957876	106957876	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chrX:106957876T>C	ENST00000372397.2	-	3	601	c.278A>G	c.(277-279)gAg>gGg	p.E93G	TSC22D3_ENST00000315660.4_Missense_Mutation_p.E159G|TSC22D3_ENST00000372382.4_Missense_Mutation_p.E69G|TSC22D3_ENST00000372390.4_Missense_Mutation_p.E36G|TSC22D3_ENST00000372384.2_Missense_Mutation_p.E159G|TSC22D3_ENST00000372383.4_Missense_Mutation_p.E159G|TSC22D3_ENST00000506081.1_Missense_Mutation_p.E159G|TSC22D3_ENST00000514426.1_Missense_Mutation_p.E91G	NM_004089.3	NP_004080.2	Q99576	T22D3_HUMAN	TSC22 domain family, member 3	93	Leucine-zipper.				body fluid secretion (GO:0007589)|ion transmembrane transport (GO:0034220)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)|lung(3)	6						CAGGGTGTTCTCACGCTCTAG	0.562																																					p.E159G													.	.			0			c.A476G												166.0	151.0	156.0					X																	106957876		2203	4300	6503	SO:0001583	missense	1831	exon3			GTGTTCTCACGCT	Z50781	CCDS14530.1, CCDS14531.1, CCDS35365.1	Xq22.3	2008-02-15	2005-03-01	2005-03-03	ENSG00000157514	ENSG00000157514			3051	protein-coding gene	gene with protein product	"""glucocorticoid-induced leucine zipper"""	300506	"""delta sleep inducing peptide, immunoreactor"""	DSIPI		8982256	Standard	XM_005262098		Approved	DIP, GILZ, TSC-22R, hDIP	uc004enh.3	Q99576	OTTHUMG00000022168	ENST00000372397.2:c.278A>G	X.37:g.106957876T>C	ENSP00000361474:p.Glu93Gly		Somatic	62	0	0		WXS	Illumina HiSeq	.	122	0.04	5	NM_198057	406	0.00	1	Q5H9S3|Q5JRI9|Q6FIH6|Q8NAI1|Q8WVB9|Q9UBN5|Q9UG13	Missense_Mutation	SNP	ENST00000372397.2	37	CCDS14531.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.190473	0.78789	.	.	ENSG00000157514	ENST00000372390;ENST00000372397;ENST00000315660;ENST00000372383;ENST00000372384;ENST00000394928;ENST00000372382;ENST00000506081;ENST00000514426	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.80949	0.4722	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	D	0.84334	0.0523	9	0.87932	D	0	-13.2289	12.659	0.56803	0.0:0.0:0.0:1.0	.	159;93	Q99576-3;Q99576	.;T22D3_HUMAN	G	36;93;159;159;159;138;69;159;91	.	ENSP00000314655:E159G	E	-	2	0	TSC22D3	106844532	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.020000	0.88740	1.965000	0.57142	0.486000	0.48141	GAG			0.562	TSC22D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057843.2		NM_198057	
BRCC3	79184	mdanderson.org	37	X	154305544	154305544	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALX-01A-11D-A42Y-10	TCGA-2G-AALX-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf2e58a-b110-4629-ad4d-c9d3e9ae9fd1	6f7b63d6-eada-4f34-bd4c-3740da653338	g.chrX:154305544G>A	ENST00000369462.1	+	4	320	c.295G>A	c.(295-297)Gca>Aca	p.A99T	BRCC3_ENST00000330045.7_Missense_Mutation_p.A99T|BRCC3_ENST00000340647.4_Missense_Mutation_p.A100T|MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000369459.2_Missense_Mutation_p.A99T|BRCC3_ENST00000399042.1_Missense_Mutation_p.A99T	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	99	MPN.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCAGCTGTCTGCAGCTTCAAC	0.478																																					p.A100T													.	.			0			c.G298A												98.0	88.0	91.0					X																	154305544		1896	4107	6003	SO:0001583	missense	79184	exon4			CTGTCTGCAGCTT	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.295G>A	X.37:g.154305544G>A	ENSP00000358474:p.Ala99Thr		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001242640	35	0.00	0	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Missense_Mutation	SNP	ENST00000369462.1	37	CCDS56611.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654155	0.88056	.	.	ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000411985;ENST00000399042;ENST00000457026;ENST00000399026	T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.63343	0.2503	M	0.77486	2.375	0.58432	D	0.999997	P;P;P	0.49358	0.617;0.617;0.923	B;B;P	0.51550	0.242;0.242;0.673	T	0.62058	-0.6934	10	0.20519	T	0.43	-13.5119	15.2839	0.73814	0.0:0.0:1.0:0.0	.	100;99;99	P46736-3;P46736-2;P46736	.;.;BRCC3_HUMAN	T	100;99;99;99;75;99;99;41	ENSP00000344103:A100T;ENSP00000328641:A99T;ENSP00000358471:A99T;ENSP00000358474:A99T;ENSP00000413170:A75T;ENSP00000381998:A99T;ENSP00000381988:A41T	ENSP00000328641:A99T	A	+	1	0	BRCC3	153958738	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	9.025000	0.93694	2.287000	0.76781	0.523000	0.50628	GCA			0.478	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000058788.4		NM_024332	
