#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CROCCP2	84809	broad.mit.edu	37	1	16945182	16945184	+	lincRNA	DEL	AAT	AAT	-	rs374889577|rs71803374	byFrequency	TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	AAT	AAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr1:16945182_16945184delAAT	ENST00000412962.1	-	0	2335_2337				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TACTGATGAAAATAATAACAGAT	0.325														915	0.182708	0.1906	0.2853	5008	,	,		89095	0.0278		0.2157	False		,,,				2504	0.2249				.													.	.			0			.																																											0	.			GATGAAAATAATA	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945185_16945187delAAT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	28	0.00	0	Q8NF65|Q96FR5|Q9BRE8	RNA	DEL	ENST00000412962.1	37																																																																																						0.325	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000092784.1		NR_026752.1	
USP48	84196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22028019	22028019	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr1:22028019T>C	ENST00000308271.9	-	22	3347	c.2699A>G	c.(2698-2700)gAt>gGt	p.D900G	USP48_ENST00000400301.1_Missense_Mutation_p.D900G|USP48_ENST00000374732.3_Missense_Mutation_p.D438G|USP48_ENST00000529637.1_Missense_Mutation_p.D912G	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	900					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TTTTTCTCCATCTGGTTTAGC	0.433																																					p.D900G													.	.			0			c.A2699G												167.0	165.0	166.0					1																	22028019		2203	4300	6503	SO:0001583	missense	84196	exon22			TCTCCATCTGGTT	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2699A>G	1.37:g.22028019T>C	ENSP00000309262:p.Asp900Gly		Somatic	79	0	0		WXS	Illumina HiSeq	.	77	0.19	15	NM_032236	131	0.31	41	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700165	0.48307	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T	0.05717	3.48;3.43;3.4	6.02	6.02	0.97574	.	0.141985	0.64402	D	0.000004	T	0.11410	0.0278	L	0.54323	1.7	0.53005	D	0.999966	P;B;P;P;B;P	0.42692	0.748;0.03;0.787;0.526;0.189;0.787	B;B;B;B;B;B	0.42771	0.301;0.018;0.397;0.393;0.112;0.397	T	0.00557	-1.1672	10	0.87932	D	0	.	15.7305	0.77800	0.0:0.0:0.0:1.0	.	912;900;25;900;900;438	B7ZKS7;B7ZKS3;Q86UV5-6;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;.;UBP48_HUMAN;.	G	900;900;438;912	ENSP00000383157:D900G;ENSP00000309262:D900G;ENSP00000431949:D912G	ENSP00000309262:D900G	D	-	2	0	USP48	21900606	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.592000	0.74095	2.299000	0.77371	0.528000	0.53228	GAT			0.433	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021372.1		NM_032236	
ATPAF1	64756	mdanderson.org	37	1	47101480	47101480	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr1:47101480G>T	ENST00000371937.4	-	9	1059	c.955C>A	c.(955-957)Ctg>Atg	p.L319M	ATPAF1_ENST00000329231.4_Missense_Mutation_p.L274M|ATPAF1_ENST00000532925.1_Missense_Mutation_p.L231M|ATPAF1_ENST00000576409.1_Missense_Mutation_p.L342M|ATPAF1_ENST00000574428.1_Missense_Mutation_p.L251M|ATPAF1_ENST00000542495.1_Missense_Mutation_p.L168M	NM_022745.4	NP_073582.3	Q5TC12	ATPF1_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 1	319					protein complex assembly (GO:0006461)	mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Acute lymphoblastic leukemia(166;0.155)					GCACATTTCAGTTCTGCTCCA	0.478																																					p.L342M	Melanoma(138;107 1777 21672 30337 52312)												.	.			0			c.C1024A												249.0	227.0	234.0					1																	47101480		2203	4300	6503	SO:0001583	missense	64756	exon9			ATTTCAGTTCTGC	AK026004	CCDS541.1, CCDS41327.1, CCDS541.2, CCDS41327.2, CCDS57997.1, CCDS57998.1	1p33-p32.3	2012-10-12			ENSG00000123472	ENSG00000123472		"""Mitochondrial respiratory chain complex assembly factors"""	18803	protein-coding gene	gene with protein product		608917				11410595	Standard	NM_022745		Approved	FLJ22351, Atp11p, ATP11	uc001cqh.4	Q5TC12	OTTHUMG00000007988	ENST00000371937.4:c.955C>A	1.37:g.47101480G>T	ENSP00000361005:p.Leu319Met		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_022745	50	0.00	0	B1AQW7|B7Z7D6|B7Z7I6|Q9H6E3	Missense_Mutation	SNP	ENST00000371937.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.96|18.96	3.734436|3.734436	0.69189|0.69189	.|.	.|.	ENSG00000123472|ENSG00000123472	ENST00000371937;ENST00000526821;ENST00000542495;ENST00000329231;ENST00000532925|ENST00000534216	T;T|.	0.56776|.	0.44;0.95|.	6.03|6.03	5.12|5.12	0.69794|0.69794	.|.	0.308584|.	0.31199|.	N|.	0.008062|.	T|T	0.56077|0.56077	0.1961|0.1961	L|L	0.54323|0.54323	1.7|1.7	0.34820|0.34820	D|D	0.738561|0.738561	D;D;D|.	0.89917|.	0.999;0.999;1.0|.	D;D;D|.	0.83275|.	0.933;0.996;0.963|.	T|T	0.66023|0.66023	-0.6026|-0.6026	10|5	0.72032|.	D|.	0.01|.	-9.7109|-9.7109	10.415|10.415	0.44316|0.44316	0.1467:0.0:0.8533:0.0|0.1467:0.0:0.8533:0.0	.|.	231;251;319|.	B7Z7I6;A8MRA7;Q5TC12|.	.;.;ATPF1_HUMAN|.	M|K	319;165;168;251;231|173	ENSP00000361005:L319M;ENSP00000330685:L251M|.	ENSP00000330685:L251M|.	L|N	-|-	1|3	2|2	ATPAF1|ATPAF1	46874067|46874067	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	3.379000|3.379000	0.52440|0.52440	1.552000|1.552000	0.49463|0.49463	0.655000|0.655000	0.94253|0.94253	CTG|AAC			0.478	ATPAF1-201	KNOWN	basic	protein_coding	protein_coding				NM_022745	
SEC22B	9554	broad.mit.edu	37	1	145109284	145109292	+	RNA	DEL	AAAAAAAAA	AAAAAAAAA	-	rs373765269		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	AAAAAAAAA	AAAAAAAAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr1:145109284_145109292delAAAAAAAAA	ENST00000453618.1	+	0	512							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											actccgtctcaaaaaaaaagaaaaaaaaa	0.435																																					.													.	.			0			.																																											9554	.			CGTCTCAAAAAAA	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109284_145109292delAAAAAAAAA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K1G0	RNA	DEL	ENST00000453618.1	37																																																																																						0.435	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
HRNR	388697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152191287	152191287	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr1:152191287G>C	ENST00000368801.2	-	3	2893	c.2818C>G	c.(2818-2820)Cag>Gag	p.Q940E	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	940					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGAGGACTGCCCTGAGCTA	0.577																																					p.Q940E													.	.			0			c.C2818G												252.0	254.0	253.0					1																	152191287		2203	4300	6503	SO:0001583	missense	388697	exon3			AGGACTGCCCTGA	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2818C>G	1.37:g.152191287G>C	ENSP00000357791:p.Gln940Glu		Somatic	67	0	0		WXS	Illumina HiSeq	.	59	0.36	21	NM_001009931	0		0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	4.575	0.106804	0.08780	.	.	ENSG00000197915	ENST00000368801	T	0.01767	4.65	3.28	-0.0525	0.13822	.	.	.	.	.	T	0.00440	0.0014	L	0.27053	0.805	0.09310	N	1	B	0.17852	0.024	B	0.12837	0.008	T	0.43589	-0.9382	9	0.02654	T	1	.	13.115	0.59295	0.0:0.3744:0.6256:0.0	.	940	Q86YZ3	HORN_HUMAN	E	940	ENSP00000357791:Q940E	ENSP00000357791:Q940E	Q	-	1	0	HRNR	150457911	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.617000	0.05584	-0.118000	0.11851	-0.321000	0.08615	CAG			0.577	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034016.1		XM_373868	
ADARB2	105	hgsc.bcm.edu	37	10	1578121	1578121	+	Intron	SNP	G	G	C			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr10:1578121G>C	ENST00000381312.1	-	2	426				ADARB2-AS1_ENST00000381301.3_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)						mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TCTCGTCCCAGTCTTTTCCTT	0.532																																					.													.	.			0			.																																									SO:0001627	intron_variant	642394	.			GTCCCAGTCTTTT	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.101-156766C>G	10.37:g.1578121G>C			Somatic	39	0	0		WXS	Illumina HiSeq	.	39	0.13	5	.	0		0	B2RPJ5|Q5VUT6|Q5VW42	RNA	SNP	ENST00000381312.1	37	CCDS7058.1																																																																																					0.532	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046426.1		NM_018702	
ITIH5	80760	mdanderson.org	37	10	7618459	7618459	+	Silent	SNP	G	G	T	rs376071464		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr10:7618459G>T	ENST00000256861.6	-	10	2013	c.1935C>A	c.(1933-1935)ccC>ccA	p.P645P	ITIH5_ENST00000446830.2_Silent_p.P427P|ITIH5_ENST00000298441.6_Silent_p.P431P|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397145.2_Silent_p.P645P|ITIH5_ENST00000397146.2_Silent_p.P645P	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	645					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CCACCGGTTCGGGTCCCATGG	0.677																																					p.P645P													.	.			0			c.C1935A												20.0	21.0	21.0					10																	7618459		2200	4295	6495	SO:0001819	synonymous_variant	80760	exon10			CGGTTCGGGTCCC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1935C>A	10.37:g.7618459G>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_001001851	13	0.00	0	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37																																																																																						0.677	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000046688.1		NM_030569	
EIF3A	8661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	120820788	120820788	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr10:120820788T>C	ENST00000369144.3	-	8	1302	c.1175A>G	c.(1174-1176)aAt>aGt	p.N392S	SNORA19_ENST00000410656.1_RNA|SNORA19_ENST00000384737.1_RNA|EIF3A_ENST00000541549.1_Missense_Mutation_p.N358S	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TTCAAGCCAATTGTAAAGGTC	0.368																																					p.N392S													.	.			0			c.A1175G												75.0	71.0	72.0					10																	120820788		2202	4300	6502	SO:0001583	missense	8661	exon8			AGCCAATTGTAAA	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.1175A>G	10.37:g.120820788T>C	ENSP00000358140:p.Asn392Ser		Somatic	150	0	0		WXS	Illumina HiSeq	.	100	0.31	31	NM_003750	53	0.51	27	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	T	13.75	2.329330	0.41197	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.23950	1.89;1.88	6.08	6.08	0.98989	Proteasome component (PCI) domain (1);	0.000000	0.41712	D	0.000838	T	0.43722	0.1260	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.10636	-1.0621	10	0.21014	T	0.42	-34.1009	16.6512	0.85203	0.0:0.0:0.0:1.0	.	392	Q14152	EIF3A_HUMAN	S	392;358	ENSP00000358140:N392S;ENSP00000438178:N358S	ENSP00000358140:N392S	N	-	2	0	EIF3A	120810778	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	6.175000	0.71949	2.333000	0.79357	0.482000	0.46254	AAT			0.368	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050634.1		NM_003750	
MUC2	4583	mdanderson.org	37	11	1093434	1093434	+	Silent	SNP	C	C	T	rs12786901		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr11:1093434C>T	ENST00000441003.2	+	30	5280	c.5253C>T	c.(5251-5253)acC>acT	p.T1751T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.T1718T|MUC2_ENST00000333592.6_Silent_p.T39T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccaccacggtgaccc	0.642																																					p.T1751T													.	.			0			c.C5253T							T		10,4082		0,10,2036	196.0	223.0	214.0		5250	-3.5	0.0	11	dbSNP_121	214	15,8043		0,15,4014	no	coding-synonymous	MUC2	NM_002457.2		0,25,6050	TT,TC,CC		0.1862,0.2444,0.2058		1750/2813	1093434	25,12125	2046	4029	6075	SO:0001819	synonymous_variant	4583	exon30			CACCACCACGGTG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5253C>T	11.37:g.1093434C>T			Somatic	30	0.0333333333	1		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_002457	0		0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																						0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
BSCL2	26580	mdanderson.org	37	11	62473086	62473086	+	5'UTR	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr11:62473086G>T	ENST00000403550.1	-	0	322				HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR|GNG3_ENST00000294117.5_5'Flank|BSCL2_ENST00000421906.1_5'UTR|BSCL2_ENST00000433053.1_Missense_Mutation_p.P31T|BSCL2_ENST00000278893.7_5'UTR|BSCL2_ENST00000407022.3_5'UTR|BSCL2_ENST00000360796.5_Missense_Mutation_p.P31T|BSCL2_ENST00000405837.1_Missense_Mutation_p.P31T|BSCL2_ENST00000537604.1_5'UTR			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)						cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						GCAGCTGGTGGTTCCTGGAAA	0.602																																					p.P31T													.	.			0			c.C91A												10.0	13.0	12.0					11																	62473086		692	1590	2282	SO:0001623	5_prime_UTR_variant	26580	exon2			CTGGTGGTTCCTG		CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.-102C>A	11.37:g.62473086G>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001122955	69	0.00	0	G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Missense_Mutation	SNP	ENST00000403550.1	37	CCDS8031.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924376	0.34002	.	.	ENSG00000168000	ENST00000405837;ENST00000433053;ENST00000360796;ENST00000524862;ENST00000532818;ENST00000464544	D;D;D;D	0.89270	-2.49;-2.49;-2.49;-1.71	5.08	3.15	0.36227	.	.	.	.	.	D	0.82536	0.5058	L	0.32530	0.975	0.34942	D	0.750391	B	0.25563	0.129	B	0.23419	0.046	T	0.82161	-0.0594	9	0.87932	D	0	.	10.1979	0.43065	0.0:0.0:0.6372:0.3628	.	31	G3XAE4	.	T	31	ENSP00000385332:P31T;ENSP00000414002:P31T;ENSP00000354032:P31T;ENSP00000433888:P31T	ENSP00000301781:P31T	P	-	1	0	BSCL2	62229662	1.000000	0.71417	0.967000	0.41034	0.088000	0.18126	5.463000	0.66712	0.691000	0.31592	-0.311000	0.09066	CCA			0.602	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000319185.1		NM_032667	
ANO1	55107	mdanderson.org	37	11	69972215	69972215	+	Silent	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr11:69972215G>T	ENST00000355303.5	+	10	1316	c.1011G>T	c.(1009-1011)gtG>gtT	p.V337V	ANO1_ENST00000538023.1_Silent_p.V337V|ANO1_ENST00000530676.1_Silent_p.V221V|ANO1_ENST00000398543.2_Silent_p.V221V|ANO1_ENST00000316296.5_Silent_p.V309V|ANO1_ENST00000531349.1_Silent_p.V72V	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	337					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	GGCTGGGCGTGTACACCCAGA	0.557																																					p.V337V													.	.			0			c.G1011T												115.0	121.0	119.0					11																	69972215		2076	4211	6287	SO:0001819	synonymous_variant	55107	exon10			GGGCGTGTACACC	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1011G>T	11.37:g.69972215G>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_018043	4	0.00	0	A8KAM3|Q8IYY8|Q8N7V3	Silent	SNP	ENST00000355303.5	37	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.354621	0.24512	.	.	ENSG00000131620	ENST00000530480	.	.	.	5.04	-4.77	0.03219	.	.	.	.	.	T	0.47619	0.1455	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48175	-0.9058	4	.	.	.	.	6.1277	0.20187	0.1445:0.5059:0.2416:0.108	.	.	.	.	F	202	.	.	C	+	2	0	ANO1	69649863	0.011000	0.17503	0.891000	0.34965	0.996000	0.88848	-1.630000	0.02028	-0.493000	0.06678	0.462000	0.41574	TGT			0.557	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000393685.1		NM_018043	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103093789	103093789	+	Silent	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr11:103093789G>A	ENST00000375735.2	+	59	9471	c.9327G>A	c.(9325-9327)ttG>ttA	p.L3109L	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Silent_p.L3109L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3109	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTCATCCTTTGGAAACTGAAC	0.363																																					p.L3109L													.	.			0			c.G9327A												63.0	57.0	59.0					11																	103093789		1839	4094	5933	SO:0001819	synonymous_variant	79659	exon59			TCCTTTGGAAACT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9327G>A	11.37:g.103093789G>A			Somatic	57	0	0		WXS	Illumina HiSeq	.	26	0.65	17	NM_001377	1	1.00	1	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																					0.363	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387196.1		XM_370652	
LOC643733	643733	broad.mit.edu	37	11	104774061	104774061	+	RNA	DEL	A	A	-			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr11:104774061delA	ENST00000532510.1	-	0	3419																											CTACATCAACAAAGTACACTA	0.358																																					.													.	.			0			.																																											0	.			ATCAACAAAGTAC																													11.37:g.104774061delA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000532510.1	37																																																																																						0.358	RP11-693N9.2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000387738.1			
TAS2R14	50840	hgsc.bcm.edu	37	12	11117118	11117118	+	Intron	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr12:11117118G>A	ENST00000381852.4	-	4	492				PRR4_ENST00000536668.1_Intron			Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						AAATTAGGATGAATGAATGAA	0.378																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			TAGGATGAATGAA	AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000381852.4:c.1170+9135C>T	12.37:g.11117118G>A			Somatic	12	0	0		WXS	Illumina HiSeq	.	22	0.45	10	.	1	0.00	0	Q645X3	RNA	SNP	ENST00000381852.4	37																																																																																						0.378	TAS2R14-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000402305.1		NM_023922	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K													TUBA1C,colon,carcinoma,0,1	TUBA1C	32	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A												56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A			Somatic	199	0.0804020101	16		RNA-Seq	Illumina HiSeq		204	0.07	14	NM_032704	1488	0.46	686		Missense_Mutation	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																					0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404424.1		NM_032704	
PDE1B	5153	mdanderson.org	37	12	54960850	54960850	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr12:54960850C>T	ENST00000243052.3	+	3	642	c.206C>T	c.(205-207)gCc>gTc	p.A69V	PDE1B_ENST00000550620.1_Missense_Mutation_p.A49V|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Missense_Mutation_p.A28V	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	69					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTGCTGGAAGCCGTCTACATA	0.483																																					p.A69V													.	.			0			c.C206T												86.0	84.0	85.0					12																	54960850		2203	4300	6503	SO:0001583	missense	5153	exon3			TGGAAGCCGTCTA	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.206C>T	12.37:g.54960850C>T	ENSP00000243052:p.Ala69Val		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_000924	1	0.00	0	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215917	0.79352	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.70516	-0.49;-0.46;-0.47	4.08	4.08	0.47627	.	0.134805	0.47455	D	0.000223	T	0.75635	0.3876	L	0.52905	1.665	0.46631	D	0.999138	D;P	0.54964	0.969;0.948	P;P	0.54544	0.755;0.627	T	0.78838	-0.2046	10	0.72032	D	0.01	.	14.5926	0.68378	0.0:1.0:0.0:0.0	.	49;69	Q01064-2;Q01064	.;PDE1B_HUMAN	V	69;28;49	ENSP00000243052:A69V;ENSP00000442559:A28V;ENSP00000448519:A49V	ENSP00000243052:A69V	A	+	2	0	PDE1B	53247117	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	5.639000	0.67868	2.560000	0.86352	0.561000	0.74099	GCC			0.483	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406203.1			
LHX5	64211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	113906210	113906210	+	Splice_Site	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr12:113906210C>T	ENST00000261731.3	-	3	971		c.e3-1			NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5						cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						CAGGATGACACTGCGGGCGGA	0.672																																					.													.	.			0			c.398-1G>A												66.0	53.0	57.0					12																	113906210		2202	4300	6502	SO:0001630	splice_region_variant	64211	exon4			ATGACACTGCGGG	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.398-1G>A	12.37:g.113906210C>T			Somatic	76	0	0		WXS	Illumina HiSeq	.	75	0.41	31	NM_022363	0		0	Q32MA4	Splice_Site	SNP	ENST00000261731.3	37	CCDS9171.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445769	0.84101	.	.	ENSG00000089116	ENST00000261731	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9696	0.89110	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LHX5	112390593	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.782000	0.85680	2.213000	0.71641	0.491000	0.48974	.			0.672	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404788.3		NM_022363	Intron
AACS	65985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	125626747	125626747	+	Missense_Mutation	SNP	G	G	A	rs146784734		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr12:125626747G>A	ENST00000316519.6	+	18	2197	c.1991G>A	c.(1990-1992)cGg>cAg	p.R664Q	AACS_ENST00000261686.6_Silent_p.P596P|AACS_ENST00000316543.10_Missense_Mutation_p.R262Q|AACS_ENST00000543665.1_Missense_Mutation_p.R96Q|AACS_ENST00000545511.1_Missense_Mutation_p.R176Q	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	664					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		GATCTGTACCGGGACATCCCT	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19835	0.0		0.0	False		,,,				2504	0.0				p.R664Q													.	.			0			c.G1991A							G	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	91.0	80.0	84.0		1991	1.2	0.8	12	dbSNP_134	84	0,8600		0,0,4300	no	missense	AACS	NM_023928.3	43	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	664/673	125626747	2,13004	2203	4300	6503	SO:0001583	missense	65985	exon18			TGTACCGGGACAT	AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1991G>A	12.37:g.125626747G>A	ENSP00000324842:p.Arg664Gln		Somatic	95	0	0		WXS	Illumina HiSeq	.	101	0.22	22	NM_023928	104	0.32	33	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	ENST00000316519.6	37	CCDS9263.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	17.34	3.365384	0.61513	4.54E-4	0.0	ENSG00000081760	ENST00000316519;ENST00000316543;ENST00000545511;ENST00000543665	T;T	0.30981	3.91;1.51	4.65	1.23	0.21249	.	0.375179	0.30227	N	0.010113	T	0.20129	0.0484	L	0.28556	0.865	0.80722	D	1	B	0.15473	0.013	B	0.04013	0.001	T	0.06285	-1.0835	10	0.35671	T	0.21	.	10.4319	0.44413	0.343:0.0:0.657:0.0	.	664	Q86V21	AACS_HUMAN	Q	664;262;176;96	ENSP00000324842:R664Q;ENSP00000324929:R262Q	ENSP00000324842:R664Q	R	+	2	0	AACS	124192700	0.963000	0.33076	0.792000	0.32020	0.720000	0.41350	0.711000	0.25764	0.504000	0.28082	-0.258000	0.10820	CGG	0		0.542	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400202.1		NM_023928	
DDX51	317781	mdanderson.org	37	12	132626108	132626108	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr12:132626108G>T	ENST00000397333.3	-	7	1077	c.1039C>A	c.(1039-1041)Ccc>Acc	p.P347T	NOC4L_ENST00000330579.1_5'Flank	NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	347	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		AGGCGGCCGGGGGTGGCTACC	0.632																																					p.P347T													DDX51,NS,carcinoma,0,1	DDX51	0	1	0			c.C1039A												39.0	51.0	47.0					12																	132626108		2052	4198	6250	SO:0001583	missense	317781	exon7			GGCCGGGGGTGGC	BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1039C>A	12.37:g.132626108G>T	ENSP00000380495:p.Pro347Thr		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_175066	56	0.00	0	A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	ENST00000397333.3	37	CCDS41865.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683346	0.88542	.	.	ENSG00000185163	ENST00000397333	T	0.07021	3.23	4.97	4.97	0.65823	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04140	-1.0974	10	0.87932	D	0	-10.4177	15.7485	0.77965	0.0:0.0:1.0:0.0	.	347	Q8N8A6	DDX51_HUMAN	T	347	ENSP00000380495:P347T	ENSP00000380495:P347T	P	-	1	0	DDX51	131192061	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	8.916000	0.92745	2.312000	0.78011	0.591000	0.81541	CCC			0.632	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398978.1		NM_175066	
CTAGE3P	220112	bcgsc.ca	37	13	52482429	52482429	+	IGR	SNP	T	T	C	rs6561654	byFrequency	TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr13:52482429T>C								CCDC70 (42063 upstream) : ATP7B (24379 downstream)																							ACTCACTCTATCTTCAGAATG	0.493													t|||	1324	0.264377	0.2322	0.3156	5008	,	,		11394	0.4534		0.172	False		,,,				2504	0.1718				.													.	.			0			.																																									SO:0001628	intergenic_variant	220112	.			ACTCTATCTTCAG																													13.37:g.52482429T>C			Somatic	24	0.0416666667	1		WXS	Illumina HiSeq	Phase_1	14	0.36	5	.	0		0		RNA	SNP		37																																																																																					0	0.493										
LMO7	4008	mdanderson.org	37	13	76427264	76427264	+	Silent	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr13:76427264C>T	ENST00000321797.8	+	26	4423	c.3702C>T	c.(3700-3702)tcC>tcT	p.S1234S	LMO7_ENST00000377534.3_Silent_p.S1519S|LMO7_ENST00000526202.1_Silent_p.S1111S|LMO7_ENST00000341547.4_Silent_p.S1185S|LMO7_ENST00000465261.2_Silent_p.S1234S|LMO7_ENST00000357063.3_Silent_p.S1519S			Q8WWI1	LMO7_HUMAN	LIM domain 7	1519					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CCCCCCGATCCAATTCTTGGA	0.443																																					p.S1234S													.	.			0			c.C3702T												87.0	87.0	87.0					13																	76427264		2203	4300	6503	SO:0001819	synonymous_variant	4008	exon25			CCGATCCAATTCT	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.3702C>T	13.37:g.76427264C>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_015842	32	0.00	0	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Silent	SNP	ENST00000321797.8	37																																																																																						0.443	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000045301.3		NM_005358	
IPO5	3843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	98667828	98667828	+	Silent	SNP	T	T	C			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr13:98667828T>C	ENST00000490680.1	+	20	2435	c.2370T>C	c.(2368-2370)ttT>ttC	p.F790F	IPO5_ENST00000539640.1_Silent_p.F665F|IPO5_ENST00000261574.5_Silent_p.F808F			O00410	IPO5_HUMAN	importin 5	790					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						ATGAACACTTTGAAGAACTGG	0.343																																					p.F808F													.	.			0			c.T2424C												106.0	105.0	105.0					13																	98667828		2203	4300	6503	SO:0001819	synonymous_variant	3843	exon23			ACACTTTGAAGAA	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2370T>C	13.37:g.98667828T>C			Somatic	85	0	0		WXS	Illumina HiSeq	.	48	0.23	11	NM_002271	136	0.46	63	B4DZA0|O15257|Q5T578|Q86XC7	Silent	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	T	9.901	1.206788	0.22205	.	.	ENSG00000065150	ENST00000469360	.	.	.	5.72	3.25	0.37280	.	.	.	.	.	T	0.60958	0.2309	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55224	-0.8174	4	.	.	.	-13.3205	10.5036	0.44821	0.0:0.1198:0.0:0.8802	.	.	.	.	S	792	.	.	L	+	2	0	IPO5	97465829	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.534000	0.36051	0.421000	0.25980	0.533000	0.62120	TTG			0.343	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000354655.1		NM_002271	
CHAMP1	283489	mdanderson.org	37	13	115091687	115091687	+	Silent	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr13:115091687G>T	ENST00000361283.1	+	3	2679	c.2370G>T	c.(2368-2370)cgG>cgT	p.R790R		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	790	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										GTCAAAGCCGGCATAATGAAG	0.378																																					p.R790R													.	.			0			c.G2370T												43.0	42.0	43.0					13																	115091687		2203	4300	6503	SO:0001819	synonymous_variant	283489	exon3			AAGCCGGCATAAT	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.2370G>T	13.37:g.115091687G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	45	0.11	5	NM_032436	32	0.00	0	B3KU06|Q6P181|Q8NC88|Q9BST0	Silent	SNP	ENST00000361283.1	37	CCDS9545.1																																																																																					0.378	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045977.2		NM_032436	
METTL3	56339	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	21967677	21967677	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr14:21967677G>A	ENST00000298717.4	-	8	1562	c.1411C>T	c.(1411-1413)Cgt>Tgt	p.R471C		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	471					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		TGACCTGTACGGCCTGTCCGA	0.448																																					p.R471C													METTL3,NS,malignant_melanoma,+1,2	METTL3	48	2	0			c.C1411T												167.0	158.0	161.0					14																	21967677		2203	4300	6503	SO:0001583	missense	56339	exon8			CTGTACGGCCTGT	AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1411C>T	14.37:g.21967677G>A	ENSP00000298717:p.Arg471Cys		Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	204	0.03	7	NM_019852	112	0.00	0	O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	ENST00000298717.4	37	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756435	0.69648	.	.	ENSG00000165819	ENST00000298717	T	0.43688	0.94	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.75162	0.3812	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83496	0.0072	10	0.87932	D	0	-9.3172	17.016	0.86419	0.0:0.0:1.0:0.0	.	471	Q86U44	MTA70_HUMAN	C	471	ENSP00000298717:R471C	ENSP00000298717:R471C	R	-	1	0	METTL3	21037517	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.201000	0.65163	2.559000	0.86315	0.460000	0.39030	CGT			0.448	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401227.1		NM_019852	
FUT8	2530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	66209100	66209100	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr14:66209100A>G	ENST00000360689.5	+	11	3427	c.1700A>G	c.(1699-1701)tAc>tGc	p.Y567C	FUT8_ENST00000557164.1_Missense_Mutation_p.Y404C|FUT8_ENST00000358307.2_Missense_Mutation_p.Y438C|FUT8_ENST00000417683.1_Missense_Mutation_p.Y161C|FUT8_ENST00000394585.1_Missense_Mutation_p.Y567C|FUT8_ENST00000394586.2_Missense_Mutation_p.Y567C	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	567					cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		ACGGTCAAGTACCCCACATAT	0.438																																					p.Y567C													.	.			0			c.A1700G												35.0	36.0	35.0					14																	66209100		2202	4299	6501	SO:0001583	missense	2530	exon11			TCAAGTACCCCAC	AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.1700A>G	14.37:g.66209100A>G	ENSP00000353910:p.Tyr567Cys		Somatic	78	0	0		WXS	Illumina HiSeq	.	72	0.29	21	NM_178155	74	0.28	21	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Missense_Mutation	SNP	ENST00000360689.5	37	CCDS9775.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.130902	0.77549	.	.	ENSG00000033170	ENST00000360689;ENST00000394586;ENST00000557164;ENST00000394585;ENST00000358307;ENST00000417683	T;T;T;T;T;T	0.59906	1.98;1.98;1.98;1.98;1.98;0.23	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.70885	0.3275	L	0.52573	1.65	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.91635	0.901;0.955;0.999	T	0.73257	-0.4040	10	0.72032	D	0.01	-9.8411	14.1792	0.65562	1.0:0.0:0.0:0.0	.	161;438;567	Q8IUA5;G3XAD2;Q9BYC5	.;.;FUT8_HUMAN	C	567;567;404;567;438;161	ENSP00000353910:Y567C;ENSP00000378087:Y567C;ENSP00000452433:Y404C;ENSP00000378086:Y567C;ENSP00000351057:Y438C;ENSP00000396770:Y161C	ENSP00000351057:Y438C	Y	+	2	0	FUT8	65278853	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.339000	0.96797	2.234000	0.73211	0.460000	0.39030	TAC			0.438	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286406.1		NM_004480	
PTGR2	145482	mdanderson.org	37	14	74350831	74350831	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr14:74350831G>T	ENST00000555661.1	+	10	1152	c.1007G>T	c.(1006-1008)gGt>gTt	p.G336V	PTGR2_ENST00000267568.4_Missense_Mutation_p.G336V|ZNF410_ENST00000442160.3_5'Flank|PTGR2_ENST00000555228.1_Missense_Mutation_p.G336V|RP5-1021I20.4_ENST00000556551.2_Splice_Site|PTGR2_ENST00000553813.1_Missense_Mutation_p.G202V|ZNF410_ENST00000555044.1_5'Flank|ZNF410_ENST00000324593.6_5'Flank|ZNF410_ENST00000540593.1_5'Flank			Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2	336					prostaglandin metabolic process (GO:0006693)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)			NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(2)	9					Indomethacin(DB00328)	ATGACAGGAGGTAACATTGGA	0.343																																					p.G336V	Esophageal Squamous(98;1155 1417 16452 47043 47872)												.	.			0			c.G1007T												125.0	109.0	115.0					14																	74350831		2203	4298	6501	SO:0001583	missense	145482	exon10			CAGGAGGTAACAT	AK096410	CCDS9820.1	14q24.1-q24.2	2008-06-04	2008-06-02	2008-06-03		ENSG00000140043			20149	protein-coding gene	gene with protein product		608642	"""zinc binding alcohol dehydrogenase domain containing 1"""	ZADH1		17449869	Standard	NM_152444		Approved	FLJ39091	uc001xow.3	Q8N8N7		ENST00000555661.1:c.1007G>T	14.37:g.74350831G>T	ENSP00000452280:p.Gly336Val		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_152444	11	0.00	0	Q3L8A4|Q6MZH8	Missense_Mutation	SNP	ENST00000555661.1	37	CCDS9820.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005213	0.93287	.	.	ENSG00000140043;ENSG00000140043;ENSG00000140043;ENSG00000258653	ENST00000555228;ENST00000555661;ENST00000267568;ENST00000553813	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	5.7	5.7	0.88788	GroES-like (1);	0.096992	0.64402	D	0.000001	D	0.86130	0.5859	M	0.78801	2.425	0.80722	D	1	D	0.76494	0.999	D	0.63703	0.917	D	0.86114	0.1564	10	0.52906	T	0.07	-8.3741	19.8405	0.96681	0.0:0.0:1.0:0.0	.	336	Q8N8N7	PTGR2_HUMAN	V	336;336;336;202	ENSP00000450975:G336V;ENSP00000452280:G336V;ENSP00000267568:G336V;ENSP00000450824:G202V	ENSP00000267568:G336V	G	+	2	0	RP5-1021I20.4;PTGR2	73420584	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.083000	0.94067	2.692000	0.91855	0.655000	0.94253	GGT			0.343	PTGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412575.1			
SLC25A29	123096	mdanderson.org	37	14	100758759	100758759	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr14:100758759G>T	ENST00000359232.3	-	4	1073	c.773C>A	c.(772-774)gCc>gAc	p.A258D	SLC25A29_ENST00000555927.1_Missense_Mutation_p.A192D|RP11-638I2.6_ENST00000556458.1_lincRNA|SLC25A29_ENST00000556505.1_Missense_Mutation_p.A192D|SLC25A29_ENST00000554912.1_Missense_Mutation_p.A192D|SLC25A29_ENST00000392908.3_3'UTR|AL157871.2_ENST00000553954.1_RNA|SLC25A29_ENST00000539621.1_Missense_Mutation_p.A192D	NM_001039355.1	NP_001034444.1	Q8N8R3	MCATL_HUMAN	solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29	258						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	acyl carnitine transmembrane transporter activity (GO:0015227)			NS(1)|endometrium(1)|ovary(1)	3		Melanoma(154;0.152)			L-Carnitine(DB00583)	GACGGGGAAGGCGCGCAGCAG	0.756																																					p.A258D													.	.			0			c.C773A												8.0	11.0	10.0					14																	100758759		2127	4175	6302	SO:0001583	missense	123096	exon4			GGGAAGGCGCGCA	AK095532	CCDS32156.1	14q32.2	2013-05-22	2012-03-29	2004-01-21	ENSG00000197119	ENSG00000197119		"""Solute carriers"""	20116	protein-coding gene	gene with protein product		615064	"""chromosome 14 open reading frame 69"", ""solute carrier family 25, member 29"""	C14orf69			Standard	XM_005267343		Approved	FLJ38975	uc010twx.2	Q8N8R3	OTTHUMG00000171569	ENST00000359232.3:c.773C>A	14.37:g.100758759G>T	ENSP00000352167:p.Ala258Asp		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_001039355	32	0.00	0	A3KMR5|Q541V0	Missense_Mutation	SNP	ENST00000359232.3	37	CCDS32156.1	.	.	.	.	.	.	.	.	.	.	G	34	5.343404	0.95783	.	.	ENSG00000197119	ENST00000359232;ENST00000554912;ENST00000539621;ENST00000556505;ENST00000555927	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	5.62	5.62	0.85841	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.89726	0.6798	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90191	0.4250	10	0.87932	D	0	-41.3651	19.6706	0.95910	0.0:0.0:1.0:0.0	.	258	Q8N8R3	MCATL_HUMAN	D	258;192;192;192;192	ENSP00000352167:A258D;ENSP00000450913:A192D;ENSP00000442985:A192D;ENSP00000452446:A192D;ENSP00000452078:A192D	ENSP00000352167:A258D	A	-	2	0	SLC25A29	99828512	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	9.385000	0.97223	2.645000	0.89757	0.655000	0.94253	GCC			0.756	SLC25A29-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000072449.3			
PDCD7	10081	mdanderson.org	37	15	65426076	65426076	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr15:65426076G>A	ENST00000204549.4	-	1	98	c.44C>T	c.(43-45)cCg>cTg	p.P15L		NM_005707.1	NP_005698.1	Q8N8D1	PDCD7_HUMAN	programmed cell death 7	15	Pro-rich.				apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of T cell apoptotic process (GO:0070234)|response to glucocorticoid (GO:0051384)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)				endometrium(4)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7						CTGCGGGGGCGGTGGGCCTGG	0.682																																					p.P15L													.	.			0			c.C44T												4.0	5.0	5.0					15																	65426076		1913	3966	5879	SO:0001583	missense	10081	exon1			GGGGGCGGTGGGC	AF083930	CCDS10201.1	15q22.2	2012-06-07			ENSG00000090470	ENSG00000090470			8767	protein-coding gene	gene with protein product	"""U11/U12 snRNP 59K"""	608138				10037816	Standard	NM_005707		Approved	HES18, ES18	uc002aol.3	Q8N8D1	OTTHUMG00000133117	ENST00000204549.4:c.44C>T	15.37:g.65426076G>A	ENSP00000204549:p.Pro15Leu		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_005707	7	0.00	0	Q96AK8|Q9Y6D7	Missense_Mutation	SNP	ENST00000204549.4	37	CCDS10201.1	.	.	.	.	.	.	.	.	.	.	G	4.842	0.156514	0.09236	.	.	ENSG00000090470	ENST00000204549	.	.	.	4.39	3.47	0.39725	.	0.080109	0.49305	D	0.000152	T	0.29684	0.0741	N	0.08118	0	0.44030	D	0.996755	B	0.06786	0.001	B	0.06405	0.002	T	0.09952	-1.0651	9	0.87932	D	0	-5.817	7.3315	0.26586	0.2053:0.0:0.7947:0.0	.	15	Q8N8D1	PDCD7_HUMAN	L	15	.	ENSP00000204549:P15L	P	-	2	0	PDCD7	63213129	0.992000	0.36948	1.000000	0.80357	0.836000	0.47400	2.067000	0.41461	0.962000	0.38057	-0.424000	0.05967	CCG			0.682	PDCD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256784.2		NM_005707	
WASH4P	374677	broad.mit.edu	37	16	67415	67415	+	Missense_Mutation	SNP	C	C	A	rs140898393		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr16:67415C>A	ENST00000326592.9	-	4	1118	c.460G>T	c.(460-462)Gac>Tac	p.D154Y	Z84812.4_ENST00000568710.1_RNA			A8MWX3	WASH4_HUMAN	WAS protein family homolog 4 pseudogene	154	WHD1.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ACAGGAAAGTCCTTCAGCTTC	0.592											OREG0003691	type=REGULATORY REGION|Gene=BC063682|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									.													.	.			0			.																																									SO:0001583	missense	0	.			GAAAGTCCTTCAG			16p13.3	2014-08-28	2008-01-16	2008-01-16	ENSG00000234769	ENSG00000234769		"""WAS protein homologs"""	14126	other	unknown			"""family with sequence similarity 39, member C pseudogene"""	FAM39CP		9054936, 11701968, 18159949	Standard	NG_003159		Approved	FLJ31670		A8MWX3	OTTHUMG00000059914	ENST00000326592.9:c.460G>T	16.37:g.67415C>A	ENSP00000317542:p.Asp154Tyr		Somatic	34	0	0	585	WXS	Illumina HiSeq	Phase_I	27	0.22	6	.	2	0.50	1		Missense_Mutation	SNP	ENST00000326592.9	37		.	.	.	.	.	.	.	.	.	.	c	0.003	-2.520231	0.00149	.	.	ENSG00000234769	ENST00000326592;ENST00000538848	.	.	.	0.379	0.379	0.16213	.	0.141721	0.49305	N	0.000158	T	0.11153	0.0272	.	.	.	0.18873	N	0.999982	.	.	.	.	.	.	T	0.32295	-0.9912	6	0.02654	T	1	-0.0023	4.4152	0.11452	0.6598:0.3402:0.0:0.0	.	.	.	.	Y	154;127	.	ENSP00000317542:D154Y	D	-	1	0	WASH4P	7415	1.000000	0.71417	0.310000	0.25168	0.169000	0.22640	2.686000	0.46968	-0.894000	0.03925	-1.447000	0.01057	GAC			0.592	WASH4P-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000133175.2		NG_003159	
TMEM8A	58986	broad.mit.edu;mdanderson.org	37	16	426323	426323	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr16:426323C>T	ENST00000431232.2	-	6	1197	c.1037G>A	c.(1036-1038)cGc>cAc	p.R346H	TMEM8A_ENST00000476735.1_5'Flank|TMEM8A_ENST00000250930.3_Missense_Mutation_p.R153H	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	346					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						GAAGGGGCTGCGGTCCACCCT	0.637																																					p.R346H													.	TMEM8A	49		0			c.G1037A												63.0	50.0	55.0					16																	426323		2201	4299	6500	SO:0001583	missense	58986	exon6			GGGCTGCGGTCCA	AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.1037G>A	16.37:g.426323C>T	ENSP00000401338:p.Arg346His		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_021259	94	0.00	0	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Missense_Mutation	SNP	ENST00000431232.2	37	CCDS10407.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663987	0.29604	.	.	ENSG00000129925	ENST00000431232;ENST00000250930	T;T	0.30714	1.94;1.52	4.45	3.5	0.40072	.	1.734660	0.02779	N	0.120632	T	0.19287	0.0463	N	0.14661	0.345	0.09310	N	1	B	0.34161	0.439	B	0.22880	0.042	T	0.19582	-1.0301	10	0.42905	T	0.14	0.1324	8.2246	0.31562	0.0:0.7954:0.0:0.2046	.	346	Q9HCN3	TMM8A_HUMAN	H	346;153	ENSP00000401338:R346H;ENSP00000250930:R153H	ENSP00000250930:R153H	R	-	2	0	TMEM8A	366324	0.000000	0.05858	0.022000	0.16811	0.015000	0.08874	-0.274000	0.08537	1.095000	0.41419	0.655000	0.94253	CGC			0.637	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000109257.2		NM_021259	
ZNF423	23090	mdanderson.org	37	16	49670885	49670885	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr16:49670885C>A	ENST00000561648.1	-	4	2231	c.2178G>T	c.(2176-2178)caG>caT	p.Q726H	ZNF423_ENST00000562520.1_Missense_Mutation_p.Q666H|ZNF423_ENST00000567169.1_Missense_Mutation_p.Q609H|ZNF423_ENST00000562871.1_Missense_Mutation_p.Q666H|ZNF423_ENST00000535559.1_Missense_Mutation_p.Q609H|ZNF423_ENST00000262383.2_Missense_Mutation_p.Q726H|ZNF423_ENST00000563137.2_Missense_Mutation_p.Q666H	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	726					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CGAAGACCTCCTGACACAGGG	0.562																																					p.Q726H													.	.			0			c.G2178T												102.0	96.0	98.0					16																	49670885		2198	4300	6498	SO:0001583	missense	23090	exon4			GACCTCCTGACAC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2178G>T	16.37:g.49670885C>A	ENSP00000455426:p.Gln726His		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_015069	22	0.00	0	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259288	0.39995	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.28255	1.62;1.62	5.05	3.88	0.44766	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.29882	0.0747	N	0.12663	0.25	0.42048	D	0.991102	D	0.76494	0.999	D	0.91635	0.999	T	0.06552	-1.0820	9	.	.	.	-30.2326	5.8709	0.18802	0.0:0.705:0.0:0.295	.	726	Q2M1K9	ZN423_HUMAN	H	726;609	ENSP00000262383:Q726H;ENSP00000442321:Q609H	.	Q	-	3	2	ZNF423	48228386	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.625000	0.46452	2.352000	0.79861	0.561000	0.74099	CAG			0.562	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000423258.1		NM_015069	
ZFHX3	463	mdanderson.org	37	16	72993363	72993363	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr16:72993363G>T	ENST00000268489.5	-	2	1354	c.682C>A	c.(682-684)Ctg>Atg	p.L228M	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	228					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AAGCTGTGCAGGACGGGGCTG	0.552																																					p.L228M													.	.			0			c.C682A												114.0	108.0	110.0					16																	72993363		2198	4300	6498	SO:0001583	missense	463	exon2			TGTGCAGGACGGG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.682C>A	16.37:g.72993363G>T	ENSP00000268489:p.Leu228Met		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	94	0.05	5	NM_006885	0		0	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	8.695	0.908405	0.17833	.	.	ENSG00000140836	ENST00000268489	T	0.77358	-1.09	4.7	4.7	0.59300	.	0.000000	0.39341	N	0.001396	T	0.80529	0.4640	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77619	-0.2520	10	0.29301	T	0.29	.	12.4741	0.55803	0.081:0.0:0.919:0.0	.	228	Q15911	ZFHX3_HUMAN	M	228	ENSP00000268489:L228M	ENSP00000268489:L228M	L	-	1	2	ZFHX3	71550864	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	5.629000	0.67798	2.331000	0.79229	0.561000	0.74099	CTG			0.552	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269008.1		NM_006885	
PIEZO1	9780	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	88783025	88783025	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr16:88783025G>A	ENST00000301015.9	-	47	7114	c.6868C>T	c.(6868-6870)Cgg>Tgg	p.R2290W	PIEZO1_ENST00000327397.7_Missense_Mutation_p.R158W|RP5-1142A6.9_ENST00000564984.1_RNA|MIR4722_ENST00000578292.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	2290					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						TAGAGCTCCCGCTTCATCTGG	0.652																																					p.R2290W													.	PIEZO1	79		0			c.C6868T												38.0	40.0	39.0					16																	88783025		692	1590	2282	SO:0001583	missense	9780	exon47			GCTCCCGCTTCAT	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.6868C>T	16.37:g.88783025G>A	ENSP00000301015:p.Arg2290Trp		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	32	0.13	4	NM_001142864	60	0.00	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.62|12.62	1.992162|1.992162	0.35131|0.35131	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015;ENST00000327397	.|T;T	.|0.72615	.|-0.67;-0.67	4.67|4.67	1.06|1.06	0.20224|0.20224	.|.	.|0.304107	.|0.28940	.|N	.|0.013652	T|T	0.68815|0.68815	0.3042|0.3042	N|N	0.22421|0.22421	0.69|0.69	0.22880|0.22880	N|N	0.998613|0.998613	.|D;D;D	.|0.89917	.|0.981;1.0;1.0	.|P;D;D	.|0.69654	.|0.849;0.965;0.965	T|T	0.59467|0.59467	-0.7449|-0.7449	5|10	.|0.72032	.|D	.|0.01	-25.9922|-25.9922	8.1766|8.1766	0.31285|0.31285	0.0855:0.0:0.5531:0.3614|0.0855:0.0:0.5531:0.3614	.|.	.|2290;158;158	.|Q92508;E7EUT2;Q96HU3	.|PIEZ1_HUMAN;.;.	V|W	2235|2290;158	.|ENSP00000301015:R2290W;ENSP00000333704:R158W	.|ENSP00000301015:R2290W	A|R	-|-	2|1	0|2	FAM38A|FAM38A	87310526|87310526	0.002000|0.002000	0.14202|0.14202	0.469000|0.469000	0.27204|0.27204	0.094000|0.094000	0.18550|0.18550	1.097000|1.097000	0.30988|0.30988	0.382000|0.382000	0.24878|0.24878	0.563000|0.563000	0.77884|0.77884	GCG|CGG			0.652	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000345699.4		NM_014745	
FLII	2314	mdanderson.org	37	17	18154278	18154278	+	Silent	SNP	G	G	A	rs144125005	byFrequency	TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr17:18154278G>A	ENST00000327031.4	-	14	1875	c.1650C>T	c.(1648-1650)ggC>ggT	p.G550G	FLII_ENST00000545457.2_Silent_p.G495G|FLII_ENST00000379450.4_Silent_p.G464G|FLII_ENST00000579294.1_Silent_p.G539G|FLII_ENST00000584444.1_5'Flank|FLII_ENST00000578558.1_Silent_p.G549G	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	550	Interaction with ACTL6A.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					TGGCCTCCCCGCCAATCCAGT	0.587													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15373	0.0		0.0	False		,,,				2504	0.0				p.G550G													.	.			0			c.C1650T							G		4,4402	8.1+/-20.4	0,4,2199	73.0	73.0	73.0		1650	-5.8	0.8	17	dbSNP_134	73	0,8600		0,0,4300	no	coding-synonymous	FLII	NM_002018.2		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		550/1270	18154278	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	2314	exon14			CTCCCCGCCAATC	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.1650C>T	17.37:g.18154278G>A			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_002018	78	0.00	0	B4DIL0|F5H407|J3QLG3	Silent	SNP	ENST00000327031.4	37	CCDS11192.1																																																																																			0		0.587	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132032.2		NM_002018	
CCL5	6352	bcgsc.ca;mdanderson.org	37	17	34207264	34207264	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr17:34207264C>T	ENST00000293272.3	-	1	248	c.46G>A	c.(46-48)Gcc>Acc	p.A16T	AC015849.2_ENST00000413928.1_RNA|CCL5_ENST00000366113.3_Missense_Mutation_p.A16T	NM_002985.2	NP_002976.2	P13501	CCL5_HUMAN	chemokine (C-C motif) ligand 5	16					activation of phospholipase D activity (GO:0031584)|calcium ion transport (GO:0006816)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular protein complex assembly (GO:0043623)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|eosinophil chemotaxis (GO:0048245)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage chemotaxis (GO:0048246)|MAPK cascade (GO:0000165)|monocyte chemotaxis (GO:0002548)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of T cell apoptotic process (GO:0070233)|negative regulation of viral genome replication (GO:0045071)|neutrophil activation (GO:0042119)|positive chemotaxis (GO:0050918)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of innate immune response (GO:0045089)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell apoptotic process (GO:0070234)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell migration (GO:2000406)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of translational initiation (GO:0045948)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|positive regulation of viral genome replication (GO:0045070)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein tetramerization (GO:0051262)|regulation of chronic inflammatory response (GO:0002676)|regulation of insulin secretion (GO:0050796)|regulation of neuron death (GO:1901214)|regulation of T cell activation (GO:0050863)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|CCR4 chemokine receptor binding (GO:0031729)|CCR5 chemokine receptor binding (GO:0031730)|chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|chemokine receptor antagonist activity (GO:0046817)|chemokine receptor binding (GO:0042379)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase activator activity (GO:0016004)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|receptor signaling protein tyrosine kinase activator activity (GO:0030298)			breast(1)|kidney(1)|lung(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0183)		GCGCAGAGGGCAGTAGCAATG	0.597																																					p.A16T													.	CCL5	6		0			c.G46A												136.0	103.0	114.0					17																	34207264		2203	4300	6503	SO:0001583	missense	6352	exon1			AGAGGGCAGTAGC	AF043341	CCDS11300.1	17q11.2-q12	2014-04-17	2002-08-22	2002-08-23	ENSG00000161570	ENSG00000271503		"""Chemokine ligands"", ""Endogenous ligands"""	10632	protein-coding gene	gene with protein product	"""T-cell specific protein p288"", ""T-cell specific RANTES protein"", ""SIS-delta"", ""regulated upon activation, normally T-expressed, and presumably secreted"", ""beta-chemokine RANTES"", ""small inducible cytokine subfamily A (Cys-Cys), member 5"""	187011	"""small inducible cytokine A5 (RANTES)"""	D17S136E, SCYA5		1691736	Standard	NM_002985		Approved	RANTES, SISd, TCP228, MGC17164	uc002hkf.3	P13501	OTTHUMG00000188396	ENST00000293272.3:c.46G>A	17.37:g.34207264C>T	ENSP00000293272:p.Ala16Thr		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_1	64	0.08	5	NM_002985	86	0.00	0	O43646|Q0QVW8|Q4ZGJ1|Q9NYA2|Q9UBG2|Q9UC99	Missense_Mutation	SNP	ENST00000293272.3	37	CCDS11300.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.007271	0.35415	.	.	ENSG00000161570	ENST00000293272;ENST00000366113	T;T	0.02631	4.22;4.22	4.93	-2.01	0.07410	.	0.625195	0.15570	N	0.255472	T	0.02304	0.0071	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39941	-0.9589	9	0.49607	T	0.09	.	8.537	0.33368	0.0:0.4149:0.0:0.5851	.	16	P13501	CCL5_HUMAN	T	16	ENSP00000293272:A16T;ENSP00000375216:A16T	ENSP00000293272:A16T	A	-	1	0	CCL5	31231377	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.823000	0.04443	-0.168000	0.10853	-0.254000	0.11334	GCC			0.597	CCL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256486.3		NM_002985	
HEXIM1	10614	broad.mit.edu	37	17	43229644	43229645	+	IGR	INS	-	-	T	rs71136074|rs13341389	byFrequency	TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr17:43229644_43229645insT	ENST00000332499.2	+	0	4785				AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						Ctttttctttattttttttttt	0.455																																					.													.	HEXIM1	25		0			.																																									SO:0001628	intergenic_variant	0	.			TTCTTTATTTTTT	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992			17.37:g.43229655_43229655dupT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	11	0.45	5	.	0		0	B2R8Y5	RNA	INS	ENST00000332499.2	37	CCDS11495.1																																																																																					0.455	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449821.2		NM_006460	
C17orf80	55028	mdanderson.org	37	17	71233050	71233050	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr17:71233050G>T	ENST00000535032.2	+	2	1542	c.1429G>T	c.(1429-1431)Gtg>Ttg	p.V477L	FAM104A_ENST00000583178.1_5'Flank|C17orf80_ENST00000577615.1_Missense_Mutation_p.V477L|C17orf80_ENST00000255557.4_Missense_Mutation_p.V477L|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000268942.8_Missense_Mutation_p.V477L|C17orf80_ENST00000426147.2_Missense_Mutation_p.V477L|C17orf80_ENST00000359042.2_Missense_Mutation_p.V477L			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	477						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			TGGACTAGGGGTGTTGCCAGG	0.522																																					p.V477L													.	.			0			c.G1429T												43.0	47.0	46.0					17																	71233050		2203	4300	6503	SO:0001583	missense	55028	exon3			CTAGGGGTGTTGC	AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.1429G>T	17.37:g.71233050G>T	ENSP00000440551:p.Val477Leu		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001100622	24	0.00	0	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Missense_Mutation	SNP	ENST00000535032.2	37	CCDS11694.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520970	0.44866	.	.	ENSG00000141219	ENST00000255557;ENST00000359042;ENST00000268942;ENST00000426147;ENST00000535032	T;T;T;T;T	0.15487	2.42;2.42;2.42;2.42;2.42	5.29	1.58	0.23477	.	0.141729	0.32328	N	0.006245	T	0.15565	0.0375	L	0.56769	1.78	0.09310	N	1	B;B;B;B	0.23806	0.073;0.073;0.073;0.091	B;B;B;B	0.30495	0.065;0.078;0.104;0.116	T	0.13308	-1.0514	10	0.36615	T	0.2	-7.7139	4.6918	0.12785	0.2852:0.1602:0.5546:0.0	.	477;477;477;477	B7Z7E5;Q9BSJ5;Q9BSJ5-2;Q9BSJ5-3	.;CQ080_HUMAN;.;.	L	477	ENSP00000255557:V477L;ENSP00000351937:V477L;ENSP00000268942:V477L;ENSP00000396970:V477L;ENSP00000440551:V477L	ENSP00000255557:V477L	V	+	1	0	C17orf80	68744645	0.017000	0.18338	0.782000	0.31804	0.954000	0.61252	0.205000	0.17356	1.065000	0.40693	0.655000	0.94253	GTG			0.522	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000441893.1		NM_017941	
RBFOX3	146713	mdanderson.org	37	17	77102854	77102854	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr17:77102854G>A	ENST00000453134.2	-	6	751	c.239C>T	c.(238-240)gCa>gTa	p.A80V	RBFOX3_ENST00000415831.1_Missense_Mutation_p.A80V|RBFOX3_ENST00000582043.1_Missense_Mutation_p.A80V|RBFOX3_ENST00000584778.1_Missense_Mutation_p.A80V|RBFOX3_ENST00000583458.1_Missense_Mutation_p.A79V|RBFOX3_ENST00000580155.1_Missense_Mutation_p.A80V			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3	80					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)	2						GTCCGTCTGTGCCGCCTCGTC	0.647																																					p.G80V													.	.			0			c.G239T												75.0	84.0	81.0					17																	77102854		692	1591	2283	SO:0001583	missense	146713	exon6			GTCTGTGCCGCCT		CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.239C>T	17.37:g.77102854G>A	ENSP00000393262:p.Ala80Val		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001082575	17	0.00	0	B4DEG6|B4DF29	Missense_Mutation	SNP	ENST00000453134.2	37	CCDS45805.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.100114	0.37048	.	.	ENSG00000167281	ENST00000338834;ENST00000415831;ENST00000453134	T;T	0.24908	1.83;1.83	4.04	4.04	0.47022	Nucleotide-binding, alpha-beta plait (1);	0.308545	0.30940	N	0.008566	T	0.22589	0.0545	L	0.34521	1.04	0.33975	D	0.647241	B;B	0.10296	0.0;0.003	B;B	0.12837	0.008;0.002	T	0.27938	-1.0059	10	0.56958	D	0.05	-9.141	16.3548	0.83232	0.0:0.0:1.0:0.0	.	80;80	B4DF29;A6NFN3	.;RFOX3_HUMAN	V	79;80;80	ENSP00000408395:A80V;ENSP00000393262:A80V	ENSP00000344726:A79V	A	-	2	0	RBFOX3	74614449	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.701000	0.68325	2.250000	0.74265	0.462000	0.41574	GCA			0.647	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437658.1		NM_001082575	
LOC644669	644669	broad.mit.edu	37	18	15317007	15317007	+	RNA	DEL	C	C	-	rs374063525		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr18:15317007delC	ENST00000455308.2	-	0	659					NR_027417.1																						atgaaattctcctacctcagc	0.493																																					.													.	.			0			.																																											0	.			AATTCTCCTACCT																													18.37:g.15317007delC			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	DEL	ENST00000455308.2	37																																																																																						0.493	AP005901.1-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000373635.1			
C18orf8	29919	mdanderson.org	37	18	21109168	21109168	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr18:21109168G>A	ENST00000269221.3	+	15	1432	c.1322G>A	c.(1321-1323)aGc>aAc	p.S441N	C18orf8_ENST00000590868.1_Missense_Mutation_p.S393N	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	441						lysosomal membrane (GO:0005765)				endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CAGAGCCGAAGCAGCCCGCTC	0.552																																					p.S441N													.	.			0			c.G1322A												70.0	74.0	73.0					18																	21109168		2203	4300	6503	SO:0001583	missense	29919	exon15			GCCGAAGCAGCCC	AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.1322G>A	18.37:g.21109168G>A	ENSP00000269221:p.Ser441Asn		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_013326	18	0.00	0	Q9BU17|Q9Y5M0	Missense_Mutation	SNP	ENST00000269221.3	37	CCDS32803.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604085	0.46423	.	.	ENSG00000141452	ENST00000269221;ENST00000544799;ENST00000540942;ENST00000542734	.	.	.	5.71	4.84	0.62591	.	0.192488	0.56097	N	0.000031	T	0.46405	0.1391	L	0.41236	1.265	0.80722	D	1	B;B	0.32302	0.363;0.361	B;B	0.29176	0.099;0.068	T	0.35375	-0.9791	9	0.16896	T	0.51	-9.5182	14.5477	0.68044	0.07:0.0:0.93:0.0	.	284;441	B7Z2Y1;Q96DM3	.;MIC1_HUMAN	N	441;284;393;284	.	ENSP00000269221:S441N	S	+	2	0	C18orf8	19363166	1.000000	0.71417	0.864000	0.33941	0.796000	0.44982	4.361000	0.59461	1.425000	0.47237	0.561000	0.74099	AGC			0.552	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445386.1		NM_013326	
ZNF396	252884	hgsc.bcm.edu	37	18	32949292	32949292	+	Silent	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr18:32949292G>T	ENST00000589332.1	-	4	1026	c.895C>A	c.(895-897)Cga>Aga	p.R299R	ZNF396_ENST00000306346.1_Silent_p.R299R			Q96N95	ZN396_HUMAN	zinc finger protein 396	299					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	7						GTATGGGTTCGTCGATGCTGA	0.428																																					p.R299R													ZNF396,NS,carcinoma,+1,1	ZNF396	1	1	0			c.C895A												82.0	80.0	81.0					18																	32949292		2203	4300	6503	SO:0001819	synonymous_variant	252884	exon4			GGGTTCGTCGATG	AK055775	CCDS11913.1	18p12	2013-01-09			ENSG00000186496	ENSG00000186496		"""-"", ""Zinc fingers, C2H2-type"""	18824	protein-coding gene	gene with protein product		609600					Standard	NM_145756		Approved	ZSCAN14, FLJ31213	uc010xcf.1	Q96N95	OTTHUMG00000132562	ENST00000589332.1:c.895C>A	18.37:g.32949292G>T			Somatic	126	0	0		WXS	Illumina HiSeq	.	70	0.04	3	NM_145756	0		0	A1L3V0|Q8NF98|Q8TD80	Silent	SNP	ENST00000589332.1	37																																																																																						0.428	ZNF396-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000255766.1		NM_145756	
ST8SIA5	29906	mdanderson.org	37	18	44260338	44260338	+	Silent	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr18:44260338G>A	ENST00000315087.7	-	7	1458	c.798C>T	c.(796-798)gaC>gaT	p.D266D	ST8SIA5_ENST00000536490.1_Silent_p.D235D|ST8SIA5_ENST00000538168.1_Silent_p.D302D|ST8SIA5_ENST00000590497.1_5'UTR	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	266					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						ATTCGAAGTCGTCCAGCACGT	0.612																																					p.D266D													.	.			0			c.C798T												120.0	70.0	87.0					18																	44260338		2203	4300	6503	SO:0001819	synonymous_variant	29906	exon7			GAAGTCGTCCAGC	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.798C>T	18.37:g.44260338G>A			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_013305	6	0.00	0	B7Z1K9|Q6IAW7	Silent	SNP	ENST00000315087.7	37	CCDS11930.1																																																																																					0.612	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255892.1		NM_013305	
MEX3C	51320	mdanderson.org	37	18	48723021	48723021	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr18:48723021G>T	ENST00000592416.1	-	1	108	c.109C>A	c.(109-111)Ctg>Atg	p.L37M	MEX3C_ENST00000591040.1_Intron			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C	224					chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CTCCGGAGCAGGGCCGCCTGC	0.731																																					p.L224M													.	.			0			c.C670A												13.0	9.0	10.0					18																	48723021		2151	4223	6374	SO:0001583	missense	51320	exon1			GGAGCAGGGCCGC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000592416.1:c.109C>A	18.37:g.48723021G>T	ENSP00000468078:p.Leu37Met		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_016626	8	0.00	0	A1L022|Q9NZE3	Missense_Mutation	SNP	ENST00000592416.1	37		.	.	.	.	.	.	.	.	.	.	G	11.09	1.536960	0.27475	.	.	ENSG00000176624	ENST00000406189	T	0.35236	1.32	3.08	1.22	0.21188	.	0.333537	0.20024	U	0.100841	T	0.28962	0.0719	N	0.14661	0.345	0.24748	N	0.992998	D	0.65815	0.995	P	0.56278	0.795	T	0.09314	-1.0680	10	0.37606	T	0.19	-3.2236	5.7595	0.18192	0.2681:0.0:0.7319:0.0	.	224	Q5U5Q3	MEX3C_HUMAN	M	224	ENSP00000385610:L224M	ENSP00000385610:L224M	L	-	1	2	MEX3C	46977019	0.933000	0.31639	0.997000	0.53966	0.901000	0.52897	1.438000	0.35002	0.147000	0.19030	-0.680000	0.03767	CTG			0.731	MEX3C-002	PUTATIVE	mRNA_start_NF|cds_start_NF|basic	protein_coding	protein_coding		OTTHUMT00000449560.1		NM_016626	
DCC	1630	mdanderson.org	37	18	51053066	51053066	+	Silent	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr18:51053066G>T	ENST00000442544.2	+	28	4807	c.4191G>T	c.(4189-4191)gtG>gtT	p.V1397V	DCC_ENST00000581580.1_Silent_p.V1030V|RP11-671P2.1_ENST00000582064.1_RNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1397					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGCTTCCTGTGTCTGTGCCAA	0.483																																					p.V1397V													.	.			0			c.G4191T												109.0	99.0	102.0					18																	51053066		2203	4300	6503	SO:0001819	synonymous_variant	1630	exon28			TCCTGTGTCTGTG	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.4191G>T	18.37:g.51053066G>T			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_005215	2	0.00	0		Silent	SNP	ENST00000442544.2	37	CCDS11952.1																																																																																					0.483	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255996.3		NM_005215	
MALT1	10892	mdanderson.org	37	18	56402546	56402546	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr18:56402546G>T	ENST00000348428.3	+	13	1846	c.1588G>T	c.(1588-1590)Gat>Tat	p.D530Y	RP11-126O1.4_ENST00000588835.1_RNA|MALT1_ENST00000345724.3_Missense_Mutation_p.D519Y	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	530	Caspase-like.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						TGTGTTACTGGATGAAGTTGC	0.353			T	BIRC3	MALT																																p.D530Y				Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	.	.			0			c.G1588T												32.0	38.0	36.0					18																	56402546		2179	4284	6463	SO:0001583	missense	10892	exon13			TTACTGGATGAAG		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.1588G>T	18.37:g.56402546G>T	ENSP00000319279:p.Asp530Tyr		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_006785	8	0.00	0	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	ENST00000348428.3	37	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190606	0.78789	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.42900	0.96;0.96	5.69	5.69	0.88448	.	0.097095	0.64402	D	0.000001	T	0.63402	0.2508	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64360	-0.6426	10	0.87932	D	0	.	18.5844	0.91183	0.0:0.0:1.0:0.0	.	519;530	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	Y	530;519	ENSP00000319279:D530Y;ENSP00000304161:D519Y	ENSP00000304161:D519Y	D	+	1	0	MALT1	54553526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.281000	0.95811	2.683000	0.91414	0.591000	0.81541	GAT			0.353	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256132.2			
SUGP1	57794	mdanderson.org	37	19	19416859	19416859	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr19:19416859G>T	ENST00000247001.5	-	4	684	c.337C>A	c.(337-339)Cct>Act	p.P113T	SUGP1_ENST00000585763.1_5'UTR|SUGP1_ENST00000334782.5_Missense_Mutation_p.P113T	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	113					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						GTGCTGGGAGGGGCGCTGGGC	0.672																																					p.P113T													.	.			0			c.C337A												8.0	10.0	9.0					19																	19416859		2086	4060	6146	SO:0001583	missense	57794	exon4			TGGGAGGGGCGCT	AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.337C>A	19.37:g.19416859G>T	ENSP00000247001:p.Pro113Thr		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_172231	54	0.00	0	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	ENST00000247001.5	37	CCDS12399.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574561	0.28092	.	.	ENSG00000105705	ENST00000247001;ENST00000535070;ENST00000334782	T	0.23348	1.91	4.57	2.43	0.29744	.	0.526405	0.20439	N	0.092307	T	0.18045	0.0433	L	0.54323	1.7	0.26211	N	0.979306	B	0.28713	0.22	B	0.22386	0.039	T	0.16630	-1.0396	10	0.13853	T	0.58	.	5.8394	0.18625	0.2989:0.0:0.7011:0.0	.	113	Q8IWZ8	SUGP1_HUMAN	T	113	ENSP00000247001:P113T	ENSP00000247001:P113T	P	-	1	0	SUGP1	19277859	0.513000	0.26194	0.321000	0.25320	0.291000	0.27294	0.361000	0.20267	0.936000	0.37367	-0.123000	0.14984	CCT			0.672	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460128.4		NM_021164	
CAPNS1	826	broad.mit.edu;bcgsc.ca	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	CAPNS1_ENST00000588780.1_Silent_p.G47G|CAPNS1_ENST00000588815.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000587718.1_Silent_p.G47G|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000590874.1_Silent_p.G47G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					p.G47G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	CAPNS1	19		0			c.C141T																																									SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGTGGT	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			Somatic	106	0.0094339623	1		WXS	Illumina HiSeq	Phase_I	88	0.10	9	NM_001749	5	0.20	1	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																					0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
ALDH16A1	126133	mdanderson.org	37	19	49972188	49972188	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr19:49972188G>A	ENST00000293350.4	+	16	2355	c.2192G>A	c.(2191-2193)cGc>cAc	p.R731H	ALDH16A1_ENST00000433981.2_Missense_Mutation_p.R566H|ALDH16A1_ENST00000540132.1_Missense_Mutation_p.R568H|CTD-3148I10.9_ENST00000599536.1_Intron|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.R680H	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	731						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.R731H(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CATCTGACCCGCTGCCTGGCC	0.567																																					p.R731H													.	.			1	Substitution - Missense(1)	urinary_tract(1)	c.G2192A												148.0	131.0	137.0					19																	49972188		2203	4300	6503	SO:0001583	missense	126133	exon16			TGACCCGCTGCCT	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.2192G>A	19.37:g.49972188G>A	ENSP00000293350:p.Arg731His		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	15	0.20	3	NM_153329	242	0.00	0	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	37	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584541	0.86748	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	4.8	4.8	0.61643	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.647297	0.15847	N	0.241706	T	0.49795	0.1578	L	0.52364	1.645	0.39250	D	0.964028	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.933;0.998;0.96	T	0.50516	-0.8819	10	0.62326	D	0.03	-21.9857	13.7622	0.62973	0.0:0.0:1.0:0.0	.	568;680;731	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	H	731;680;568;566	ENSP00000293350:R731H;ENSP00000410142:R680H;ENSP00000445088:R568H;ENSP00000398675:R566H	ENSP00000293350:R731H	R	+	2	0	ALDH16A1	54664000	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.573000	0.67417	2.393000	0.81446	0.456000	0.33151	CGC			0.567	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465358.1		NM_153329	
MEMO1	51072	mdanderson.org	37	2	32168448	32168448	+	Silent	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr2:32168448C>T	ENST00000295065.5	-	2	375	c.66G>A	c.(64-66)ccG>ccA	p.P22P	MEMO1_ENST00000490459.1_5'UTR|MEMO1_ENST00000407893.3_Silent_p.P22P|MEMO1_ENST00000379383.3_Silent_p.P25P|MEMO1_ENST00000404530.1_Silent_p.P22P|DPY30_ENST00000446765.1_5'UTR|MEMO1_ENST00000426310.2_Silent_p.P22P	NM_015955.2	NP_057039.1	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1	22					regulation of microtubule-based process (GO:0032886)	cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|breast(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	17	Acute lymphoblastic leukemia(172;0.155)					CATTCAGCTGCGGTCCTATAA	0.393																																					p.P22P													.	.			0			c.G66A												113.0	112.0	112.0					2																	32168448		2203	4300	6503	SO:0001819	synonymous_variant	51072	exon2			CAGCTGCGGTCCT	AF132961	CCDS1776.1, CCDS46255.1	2p22-p21	2010-05-24	2007-02-12	2007-02-12	ENSG00000162959	ENSG00000162959			14014	protein-coding gene	gene with protein product		611786	"""chromosome 2 open reading frame 4"""	C2orf4		15156151	Standard	NM_015955		Approved	CGI-27, MEMO	uc002rnx.3	Q9Y316	OTTHUMG00000128453	ENST00000295065.5:c.66G>A	2.37:g.32168448C>T			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_015955	3	0.00	0	B4DLS0|D6W575|Q5R2V8|Q5R2V9|Q6NSL5	Silent	SNP	ENST00000295065.5	37	CCDS1776.1																																																																																					0.393	MEMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250251.2		NM_015955	
HOXD13	3239	mdanderson.org	37	2	176957928	176957928	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr2:176957928G>T	ENST00000392539.3	+	1	310	c.310G>T	c.(310-312)Gcc>Tcc	p.A104S		NM_000523.3	NP_000514.2	P35453	HXD13_HUMAN	homeobox D13	104					anterior/posterior pattern specification (GO:0009952)|branch elongation of an epithelium (GO:0060602)|embryonic digit morphogenesis (GO:0042733)|embryonic hindgut morphogenesis (GO:0048619)|male genitalia development (GO:0030539)|morphogenesis of an epithelial fold (GO:0060571)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)		GGCTCCCCCAGCCAAAGAGTG	0.701			T	NUP98	AML*																																p.A104S				Dom	yes		2	2q31-q32	3239	homeo box D13		L	.	.			0			c.G310T												10.0	12.0	12.0					2																	176957928		2052	4051	6103	SO:0001583	missense	3239	exon1			CCCCCAGCCAAAG	AF005219	CCDS2264.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128714	ENSG00000128714		"""Homeoboxes / ANTP class : HOXL subclass"""	5136	protein-coding gene	gene with protein product		142989	"""homeo box D13"""	HOX4I, SPD		2574852, 1973146	Standard	NM_000523		Approved		uc002ukf.1	P35453	OTTHUMG00000132431	ENST00000392539.3:c.310G>T	2.37:g.176957928G>T	ENSP00000376322:p.Ala104Ser		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_000523	3	0.00	0		Missense_Mutation	SNP	ENST00000392539.3	37	CCDS2264.2	.	.	.	.	.	.	.	.	.	.	G	7.550	0.662557	0.14645	.	.	ENSG00000128714	ENST00000392539	T	0.41400	1.0	3.66	0.476	0.16779	.	0.277746	0.23758	N	0.044846	T	0.16854	0.0405	N	0.11560	0.145	0.19300	N	0.999979	B	0.06786	0.001	B	0.12837	0.008	T	0.11036	-1.0604	10	0.20046	T	0.44	.	2.6409	0.04971	0.3927:0.0:0.3937:0.2136	.	104	P35453	HXD13_HUMAN	S	104	ENSP00000376322:A104S	ENSP00000376322:A104S	A	+	1	0	HOXD13	176666174	0.413000	0.25400	0.199000	0.23439	0.850000	0.48378	0.731000	0.26058	0.235000	0.21160	0.563000	0.77884	GCC			0.701	HOXD13-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000359256.1			
TTN	7273	broad.mit.edu	37	2	179595012	179595012	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr2:179595012C>T	ENST00000591111.1	-	60	17388	c.17164G>A	c.(17164-17166)Gca>Aca	p.A5722T	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A6039T|TTN_ENST00000342992.6_Missense_Mutation_p.A4795T			Q8WZ42	TITIN_HUMAN	titin	12528	Ig-like 38.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCATGGGTGCAGTGCCACCC	0.463																																					p.A6039T													.	TTN	18412		0			c.G18115A												36.0	35.0	35.0					2																	179595012		1884	4113	5997	SO:0001583	missense	7273	exon62			TGGGTGCAGTGCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17164G>A	2.37:g.179595012C>T	ENSP00000465570:p.Ala5722Thr		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_001267550	0		0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.02	1.812900	0.32053	.	.	ENSG00000155657	ENST00000342992	T	0.66995	-0.24	5.89	5.02	0.67125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51907	0.1702	L	0.35487	1.065	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.53136	-0.8481	9	0.87932	D	0	.	5.115	0.14829	0.0:0.6113:0.1576:0.2311	.	5722	Q8WZ42	TITIN_HUMAN	T	4795	ENSP00000343764:A4795T	ENSP00000343764:A4795T	A	-	1	0	TTN	179303257	0.995000	0.38212	0.841000	0.33234	0.995000	0.86356	2.152000	0.42272	1.504000	0.48704	0.655000	0.94253	GCA			0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
SPAG16	79582	mdanderson.org	37	2	214149283	214149283	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr2:214149283G>T	ENST00000331683.5	+	1	171	c.76G>T	c.(76-78)Gcc>Tcc	p.A26S	SPAG16_ENST00000447990.1_Missense_Mutation_p.A26S|SPAG16_ENST00000413312.1_5'UTR|SPAG16_ENST00000432529.2_Missense_Mutation_p.A26S|SPAG16_ENST00000272898.7_Missense_Mutation_p.A26S|AC079610.2_ENST00000360083.3_lincRNA	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	26					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TTTGACGGCAGCCGGGGACGC	0.726																																					p.A26S													.	.			0			c.G76T												15.0	17.0	16.0					2																	214149283		2185	4283	6468	SO:0001583	missense	79582	exon1			ACGGCAGCCGGGG	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.76G>T	2.37:g.214149283G>T	ENSP00000332592:p.Ala26Ser		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_024532	24	0.00	0	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723472	0.30593	.	.	ENSG00000144451	ENST00000331683;ENST00000432529;ENST00000272898;ENST00000447990	T	0.57107	0.42	3.67	0.65	0.17812	.	.	.	.	.	T	0.25827	0.0629	N	0.08118	0	0.09310	N	0.999993	B;B;B	0.16396	0.01;0.017;0.003	B;B;B	0.15484	0.003;0.013;0.004	T	0.15549	-1.0433	9	0.27785	T	0.31	.	2.928	0.05791	0.2523:0.0:0.5326:0.2151	.	26;26;26	Q8N0X2;E7EWV3;Q8N0X2-4	SPG16_HUMAN;.;.	S	26	ENSP00000332592:A26S	ENSP00000272898:A26S	A	+	1	0	SPAG16	213857528	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.636000	0.05465	0.014000	0.14944	-0.224000	0.12420	GCC			0.726	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256601.2		NM_024532	
ATP5J	522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	27102058	27102058	+	Silent	SNP	G	G	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr21:27102058G>A	ENST00000400093.3	-	2	739	c.48C>T	c.(46-48)gcC>gcT	p.A16A	ATP5J_ENST00000400099.1_Silent_p.A16A|ATP5J_ENST00000400094.1_Silent_p.A16A|ATP5J_ENST00000284971.3_Silent_p.A16A|ATP5J_ENST00000457143.2_Silent_p.A24A|ATP5J_ENST00000400087.3_Silent_p.A16A|ATP5J_ENST00000400090.3_Silent_p.A16A	NM_001003701.1|NM_001003703.1|NM_001685.4	NP_001003701.1|NP_001003703.1|NP_001676.2	P18859	ATP5J_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6	16					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|lung(1)|pancreas(1)	4						GGACTGAGACGGCTGACCGAA	0.398																																					p.A24A	Colon(101;404 1513 9184 32221 46005)												.	.			0			c.C72T												60.0	58.0	58.0					21																	27102058		2203	4300	6503	SO:0001819	synonymous_variant	522	exon2			TGAGACGGCTGAC	M37104	CCDS13574.1, CCDS46637.1	21q21.1	2012-10-12	2010-06-11		ENSG00000154723	ENSG00000154723		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	847	protein-coding gene	gene with protein product	"""coupling factor 6"""	603152	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6"""	ATP5A, ATP5, ATPM		1830479, 1825642	Standard	NM_001685		Approved	CF6	uc002ylt.3	P18859	OTTHUMG00000078442	ENST00000400093.3:c.48C>T	21.37:g.27102058G>A			Somatic	190	0	0		WXS	Illumina HiSeq	.	249	0.14	36	NM_001003701	1436	0.19	267	J3KQ83	Silent	SNP	ENST00000400093.3	37	CCDS13574.1																																																																																					0.398	ATP5J-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000171357.1		NM_001685	
PCNT	5116	broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	47810695	47810695	+	Silent	SNP	G	G	A	rs370541579	byFrequency	TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr21:47810695G>A	ENST00000359568.5	+	20	4058	c.3951G>A	c.(3949-3951)aaG>aaA	p.K1317K	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1317				K -> T (in Ref. 1; AAD10838). {ECO:0000305}.	brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGTGTTTGAAGGAGGAGAGCG	0.547													G|||	5	0.000998403	0.0	0.0	5008	,	,		19276	0.005		0.0	False		,,,				2504	0.0				p.K1317K													.	PCNT	283		0			c.G3951A												34.0	33.0	33.0					21																	47810695		2202	4300	6502	SO:0001819	synonymous_variant	5116	exon20			TTTGAAGGAGGAG	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.3951G>A	21.37:g.47810695G>A			Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	250	0.03	8	NM_006031	10	0.00	0	O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	CCDS33592.1																																																																																					0.547	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207336.1		NM_006031	
TRANK1	9881	broad.mit.edu	37	3	36873948	36873948	+	Missense_Mutation	SNP	T	T	C	rs201976066		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr3:36873948T>C	ENST00000429976.2	-	21	7241	c.6994A>G	c.(6994-6996)Aga>Gga	p.R2332G	TRANK1_ENST00000301807.6_Missense_Mutation_p.R1782G|TRANK1_ENST00000428977.2_Missense_Mutation_p.R1782G	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2332							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CTGCTGCCTCTCCCCCTGCCC	0.507																																					p.R2332G													.	TRANK1	398		0			c.A6994G												117.0	119.0	118.0					3																	36873948		1918	4122	6040	SO:0001583	missense	9881	exon21			TGCCTCTCCCCCT	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6994A>G	3.37:g.36873948T>C	ENSP00000416168:p.Arg2332Gly		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	183	0.04	7	NM_014831	7	0.00	0	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	T	3.576	-0.086656	0.07097	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.34072	1.38;1.78;1.38	5.16	-2.15	0.07102	.	0.178818	0.26696	N	0.022979	T	0.23171	0.0560	L	0.29908	0.895	0.09310	N	1	B	0.23937	0.094	B	0.21917	0.037	T	0.28964	-1.0027	10	0.54805	T	0.06	.	11.3034	0.49320	0.0:0.0721:0.5657:0.3622	.	2332	O15050	TRNK1_HUMAN	G	1782;2332;1782	ENSP00000416826:R1782G;ENSP00000416168:R2332G;ENSP00000301807:R1782G	ENSP00000301807:R1782G	R	-	1	2	TRANK1	36848952	0.000000	0.05858	0.000000	0.03702	0.293000	0.27360	0.313000	0.19415	0.021000	0.15133	0.459000	0.35465	AGA			0.507	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_014831	
ROBO2	6092	mdanderson.org	37	3	77666777	77666777	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr3:77666777G>T	ENST00000461745.1	+	22	4307	c.3407G>T	c.(3406-3408)gGc>gTc	p.G1136V	ROBO2_ENST00000332191.8_Missense_Mutation_p.G1136V|ROBO2_ENST00000469233.1_3'UTR|ROBO2_ENST00000487694.3_Missense_Mutation_p.G1152V	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1136					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCTGTTCGAGGCGTGGCTTCT	0.527																																					p.G1136V													ROBO2_ENST00000487694,colon,carcinoma,-1,4	ROBO2_ENST00000487694	-1	4	0			c.G3407T												109.0	105.0	106.0					3																	77666777		2039	4195	6234	SO:0001583	missense	6092	exon22			TTCGAGGCGTGGC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3407G>T	3.37:g.77666777G>T	ENSP00000417164:p.Gly1136Val		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_002942	3	0.00	0	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.185725|4.185725	0.78789|0.78789	.|.	.|.	ENSG00000185008|ENSG00000185008	ENST00000490991|ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191	.|T;T;T	.|0.71817	.|-0.6;-0.56;-0.33	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.000000	.|0.46442	.|D	.|0.000300	D|D	0.83880|0.83880	0.5350|0.5350	M|M	0.67397|0.67397	2.05|2.05	.|.	.|.	.|.	.|D;D;P	.|0.89917	.|1.0;0.981;0.915	.|D;P;B	.|0.87578	.|0.998;0.799;0.297	D|D	0.84776|0.84776	0.0770|0.0770	4|9	.|0.72032	.|D	.|0.01	.|.	19.5819|19.5819	0.95471|0.95471	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1152;1136;1136	.|Q19AB5;F8W703;Q9HCK4	.|.;.;ROBO2_HUMAN	S|V	293|1152;1152;1136;1136	.|ENSP00000417335:G1152V;ENSP00000417164:G1136V;ENSP00000327536:G1136V	.|ENSP00000327536:G1136V	A|G	+|+	1|2	0|0	ROBO2|ROBO2	77749467|77749467	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.614000|0.614000	0.37383|0.37383	9.476000|9.476000	0.97823|0.97823	2.624000|2.624000	0.88883|0.88883	0.655000|0.655000	0.94253|0.94253	GCG|GGC			0.527	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000352600.2		XM_031246	
ZBTB11	27107	mdanderson.org	37	3	101373562	101373562	+	Silent	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr3:101373562G>T	ENST00000312938.4	-	8	2875	c.2295C>A	c.(2293-2295)ggC>ggA	p.G765G		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	765					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TACAATGATAGCCTCGAACCT	0.353																																					p.G765G													.	.			0			c.C2295A												122.0	123.0	122.0					3																	101373562		2203	4300	6503	SO:0001819	synonymous_variant	27107	exon8			ATGATAGCCTCGA	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2295C>A	3.37:g.101373562G>T			Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	64	0.06	4	NM_014415	7	0.00	0	Q2NKP9	Silent	SNP	ENST00000312938.4	37	CCDS2943.1																																																																																					0.353	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353441.2		NM_014415	
MUC4	4585	bcgsc.ca	37	3	195508187	195508187	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr3:195508187C>T	ENST00000463781.3	-	2	10723	c.10264G>A	c.(10264-10266)Gcc>Acc	p.A3422T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3422T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGCGTGACCTGTG	0.582																																					p.A3422T													.	MUC4	1505		0			c.G10264A												27.0	21.0	23.0					3																	195508187		688	1579	2267	SO:0001583	missense	4585	exon2			GGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10264G>A	3.37:g.195508187C>T	ENSP00000417498:p.Ala3422Thr		Somatic	123	0.0243902439	3		WXS	Illumina HiSeq	Phase_1	151	0.05	8	NM_018406	3	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.361	-0.939430	0.02322	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.49;1.48	0.312	-0.624	0.11552	.	.	.	.	.	T	0.08891	0.0220	N	0.02539	-0.55	0.09310	N	1	B	0.19583	0.037	B	0.08055	0.003	T	0.27434	-1.0074	8	.	.	.	.	1.4254	0.02322	0.3411:0.3312:0.0:0.3277	.	3294	E7ESK3	.	T	3422	ENSP00000417498:A3422T;ENSP00000420243:A3422T	.	A	-	1	0	MUC4	196992966	0.000000	0.05858	0.004000	0.12327	0.012000	0.07955	-2.425000	0.01028	-0.890000	0.03945	0.089000	0.15464	GCC			0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MAN2B2	23324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	6599004	6599004	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr4:6599004C>T	ENST00000285599.3	+	8	1258	c.1222C>T	c.(1222-1224)Cag>Tag	p.Q408*	MAN2B2_ENST00000504248.1_Nonsense_Mutation_p.Q357*	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	408					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						GCAGCAGCTCCAGCAGCTTCG	0.647																																					p.Q408X													.	.			0			c.C1222T												36.0	41.0	39.0					4																	6599004		2203	4298	6501	SO:0001587	stop_gained	23324	exon8			CAGCTCCAGCAGC	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1222C>T	4.37:g.6599004C>T	ENSP00000285599:p.Gln408*		Somatic	84	0	0		WXS	Illumina HiSeq	.	79	0.27	21	NM_015274	8	0.00	0	Q66MP2|Q86T67	Nonsense_Mutation	SNP	ENST00000285599.3	37	CCDS33951.1	.	.	.	.	.	.	.	.	.	.	C	38	6.786590	0.97837	.	.	ENSG00000013288	ENST00000285599;ENST00000504248	.	.	.	5.27	5.27	0.74061	.	0.185812	0.45606	D	0.000343	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-22.9737	17.4272	0.87529	0.0:1.0:0.0:0.0	.	.	.	.	X	408;357	.	ENSP00000285599:Q408X	Q	+	1	0	MAN2B2	6649905	0.859000	0.29813	0.995000	0.50966	0.950000	0.60333	1.596000	0.36718	2.448000	0.82819	0.643000	0.83706	CAG			0.647	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359106.2		NM_015274	
ADH1C	126	broad.mit.edu	37	4	100265826	100265827	+	RNA	INS	-	-	AACTC	rs368136717|rs34551784|rs79306877	byFrequency	TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr4:100265826_100265827insAACTC	ENST00000510055.1	-	0	742				ADH1C_ENST00000515683.1_RNA			P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	TACATTTTCTTAACAAGTTTTT	0.297														1074	0.214457	0.0998	0.2709	5008	,	,		19444	0.0764		0.4046	False		,,,				2504	0.2761				.													.	.			0			.																																											126	.			TTTTCTTAACAAG	M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100265826_100265827insAACTC			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.67	4	.	0		0	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	RNA	INS	ENST00000510055.1	37																																																																																						0.297	ADH1C-004	KNOWN	mRNA_end_NF|basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000365189.2		NM_000669	
HLA-H	3136	hgsc.bcm.edu	37	6	29856882	29856882	+	IGR	SNP	C	C	G			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr6:29856882C>G								HLA-G (57980 upstream) : HLA-A (52154 downstream)																							CCCTCAGCCTCCACTCAGGTC	0.552																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	3136	.			CAGCCTCCACTCA																													6.37:g.29856882C>G			Somatic	45	0	0		WXS	Illumina HiSeq	.	53	0.09	5	.	4	0.25	1		RNA	SNP		37																																																																																					0	0.552										
NCOA7	135112	mdanderson.org	37	6	126176191	126176191	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr6:126176191C>G	ENST00000368357.3	+	4	428	c.76C>G	c.(76-78)Caa>Gaa	p.Q26E	NCOA7_ENST00000487635.1_3'UTR|NCOA7_ENST00000229634.9_Intron|NCOA7_ENST00000392477.2_Missense_Mutation_p.Q26E	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	26					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		ACAAGCCAAACAAAATGCAGA	0.373																																					p.Q26E													.	.			0			c.C76G												112.0	119.0	117.0					6																	126176191		2203	4300	6503	SO:0001583	missense	135112	exon3			GCCAAACAAAATG	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.76C>G	6.37:g.126176191C>G	ENSP00000357341:p.Gln26Glu		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_181782	1	0.00	0	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	37	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016198	0.75161	.	.	ENSG00000111912	ENST00000368357;ENST00000431092;ENST00000392477;ENST00000453302;ENST00000417494;ENST00000428318;ENST00000419660	T;T;T;T	0.56103	2.6;2.6;0.65;0.48	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000002	T	0.55081	0.1898	L	0.29908	0.895	0.80722	D	1	D;D;P;P	0.61697	0.99;0.974;0.954;0.956	D;D;D;D	0.73380	0.98;0.969;0.954;0.931	T	0.59648	-0.7415	10	0.72032	D	0.01	-38.874	17.0844	0.86606	0.0:1.0:0.0:0.0	.	26;26;26;26	Q8NI08-6;Q8NI08-2;Q8NI08-4;Q8NI08	.;.;.;NCOA7_HUMAN	E	26	ENSP00000357341:Q26E;ENSP00000376269:Q26E;ENSP00000406363:Q26E;ENSP00000408211:Q26E	ENSP00000357341:Q26E	Q	+	1	0	NCOA7	126217884	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.564000	0.60830	2.704000	0.92352	0.650000	0.86243	CAA			0.373	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000042083.4		XM_059748	
MED23	9439	mdanderson.org	37	6	131913587	131913587	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr6:131913587G>T	ENST00000368068.3	-	25	3591	c.3412C>A	c.(3412-3414)Cca>Aca	p.P1138T	MED23_ENST00000403834.3_Missense_Mutation_p.P1144T|MED23_ENST00000368060.3_Missense_Mutation_p.P1138T|MED23_ENST00000545957.1_Missense_Mutation_p.P779T|MED23_ENST00000479213.1_5'UTR|MED23_ENST00000368058.1_Missense_Mutation_p.P1144T|MED23_ENST00000354577.4_Missense_Mutation_p.P1144T	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	1138					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		TTCTCTCTTGGCACTAAAGGC	0.343																																					p.P1144T													.	.			0			c.C3430A												146.0	133.0	137.0					6																	131913587		2203	4300	6503	SO:0001583	missense	9439	exon26			CTCTTGGCACTAA	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.3412C>A	6.37:g.131913587G>T	ENSP00000357047:p.Pro1138Thr		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	61	0.07	4	NM_015979	18	0.00	0	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Missense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863501	0.91511	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000545957	D;D;D;D;D;D	0.91180	-2.8;-2.8;-2.8;-2.8;-2.8;-2.8	6.02	6.02	0.97574	.	0.046228	0.85682	D	0.000000	D	0.93687	0.7983	L	0.52011	1.625	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.983	D	0.93336	0.6705	10	0.72032	D	0.01	-12.564	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1138;1144	Q9ULK4;Q9ULK4-3	MED23_HUMAN;.	T	1144;1138;1144;1138;1144;779	ENSP00000346588:P1144T;ENSP00000357047:P1138T;ENSP00000384536:P1144T;ENSP00000357039:P1138T;ENSP00000357037:P1144T;ENSP00000439977:P779T	ENSP00000346588:P1144T	P	-	1	0	MED23	131955280	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.651000	0.98493	2.865000	0.98341	0.655000	0.94253	CCA			0.343	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000042215.1			
TAAR2	9287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	132938975	132938975	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr6:132938975G>T	ENST00000367931.1	-	2	369	c.370C>A	c.(370-372)Ctg>Atg	p.L124M	TAAR2_ENST00000275191.2_Missense_Mutation_p.L79M|TAAR2_ENST00000537809.1_Missense_Mutation_p.L79M			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	124					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		CTAAGCATCAGGTCAAAACTA	0.363																																					p.L124M													.	.			0			c.C370A												77.0	75.0	76.0					6																	132938975		2203	4300	6503	SO:0001583	missense	9287	exon2			GCATCAGGTCAAA	AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.370C>A	6.37:g.132938975G>T	ENSP00000356908:p.Leu124Met		Somatic	39	0	0		WXS	Illumina HiSeq	.	55	0.09	5	NM_001033080	0		0	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	ENST00000367931.1	37	CCDS34541.1	.	.	.	.	.	.	.	.	.	.	G	4.472	0.087433	0.08583	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.20069	2.1;2.1;2.1	6.0	-1.32	0.09201	GPCR, rhodopsin-like superfamily (1);	0.074563	0.48767	D	0.000179	T	0.02193	0.0068	N	0.02876	-0.465	0.24148	N	0.995709	P	0.40681	0.727	B	0.40702	0.338	T	0.44847	-0.9301	10	0.24483	T	0.36	-28.3376	6.2075	0.20610	0.46:0.0:0.3521:0.1879	.	124	Q9P1P5	TAAR2_HUMAN	M	79;124;79	ENSP00000275191:L79M;ENSP00000356908:L124M;ENSP00000441263:L79M	ENSP00000275191:L79M	L	-	1	2	TAAR2	132980668	0.000000	0.05858	0.976000	0.42696	0.639000	0.38242	-0.891000	0.04135	-0.131000	0.11578	-0.312000	0.09012	CTG			0.363	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000390735.1		NM_014626	
TBP	6908	hgsc.bcm.edu;mdanderson.org	37	6	170871016	170871016	+	Silent	SNP	G	G	A	rs542031948		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr6:170871016G>A	ENST00000392092.2	+	3	471	c.192G>A	c.(190-192)caG>caA	p.Q64Q	TBP_ENST00000540980.1_Silent_p.Q44Q|TBP_ENST00000230354.6_Silent_p.Q64Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacaacaacagcagcagcagc	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14897	0.0		0.0	False		,,,				2504	0.0				p.Q64Q													TBP,NS,carcinoma,0,2	TBP	0	2	0			c.G192A												31.0	35.0	33.0					6																	170871016		2202	4292	6494	SO:0001819	synonymous_variant	6908	exon3			ACAACAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.192G>A	6.37:g.170871016G>A			Somatic	59	0	0		WXS	Illumina HiSeq	.	64	0.09	6	NM_003194	35	0.00	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																					0.557	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000043271.2		NM_003194	
RAPGEF5	9771	ucsc.edu	37	7	22176601	22176601	+	Splice_Site	SNP	T	T	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr7:22176601T>A	ENST00000401957.2	-	12	1616	c.1369A>T	c.(1369-1371)Aaa>Taa	p.K457*	RAPGEF5_ENST00000344041.6_Splice_Site_p.K607*			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	457	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						CCAGGGATTTTCTAAAAAACA	0.348																																					p.K607X													.	RAPGEF5	96		0			c.A1819T												32.0	30.0	31.0					7																	22176601		1798	4057	5855	SO:0001630	splice_region_variant	9771	exon22			GGATTTTCTAAAA	D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000401957.2:c.1369-1A>T	7.37:g.22176601T>A			Somatic	31	0	0		WXS	Illumina HiSeq		33	0.12	4	NM_012294	0		0	A4D140|Q8IXU5	Nonsense_Mutation	SNP	ENST00000401957.2	37		.	.	.	.	.	.	.	.	.	.	T	44	10.677436	0.99448	.	.	ENSG00000136237	ENST00000344041;ENST00000425852;ENST00000258735;ENST00000401957	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	.	.	.	X	607;459;321;457	.	ENSP00000258735:K321X	K	-	1	0	RAPGEF5	22143126	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.028000	0.76470	2.371000	0.80710	0.533000	0.62120	AAA			0.348	RAPGEF5-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000326590.2		NM_012294	Nonsense_Mutation
NOD1	10392	hgsc.bcm.edu;mdanderson.org	37	7	30491538	30491538	+	Silent	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr7:30491538G>T	ENST00000222823.4	-	6	2020	c.1495C>A	c.(1495-1497)Cgg>Agg	p.R499R		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	499	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GGCAAAGCCCGCAGGAAGCCC	0.632																																					p.R499R													.	.			0			c.C1495A												29.0	36.0	33.0					7																	30491538		2203	4300	6503	SO:0001819	synonymous_variant	10392	exon6			AAGCCCGCAGGAA	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1495C>A	7.37:g.30491538G>T			Somatic	69	0	0		WXS	Illumina HiSeq	.	85	0.05	4	NM_006092	4	0.00	0	B4DTU3|Q549U4|Q8IWF5	Silent	SNP	ENST00000222823.4	37	CCDS5427.1																																																																																					0.632	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250443.2			
CALN1	83698	mdanderson.org	37	7	71252821	71252821	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr7:71252821G>T	ENST00000329008.5	-	6	897	c.599C>A	c.(598-600)gCc>gAc	p.A200D	CALN1_ENST00000431984.1_Missense_Mutation_p.A200D|CALN1_ENST00000405452.2_Missense_Mutation_p.A200D|CALN1_ENST00000412588.1_Missense_Mutation_p.A242D|CALN1_ENST00000395276.2_Missense_Mutation_p.A200D|CALN1_ENST00000395275.2_Missense_Mutation_p.A242D	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GATGATGAAGGCCATAGCAAA	0.577																																					p.A242D													.	.			0			c.C725A												132.0	102.0	112.0					7																	71252821		2203	4300	6503	SO:0001583	missense	83698	exon7			ATGAAGGCCATAG	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.599C>A	7.37:g.71252821G>T	ENSP00000332498:p.Ala200Asp		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_031468	4	0.00	0	J3KQA7	Missense_Mutation	SNP	ENST00000329008.5	37	CCDS5541.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811049	0.90707	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452	T;T;T;T;T;T	0.80480	-1.14;-1.38;-1.14;-1.14;-1.38;-1.14	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.84800	0.5552	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.86975	0.2100	10	0.87932	D	0	-24.2427	17.5493	0.87872	0.0:0.0:1.0:0.0	.	200;200	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	D	200;242;200;200;242;200	ENSP00000332498:A200D;ENSP00000378690:A242D;ENSP00000378691:A200D;ENSP00000410704:A200D;ENSP00000391882:A242D;ENSP00000384354:A200D	ENSP00000332498:A200D	A	-	2	0	CALN1	70890757	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.748000	0.98867	2.372000	0.80975	0.561000	0.74099	GCC			0.577	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320044.2		NM_031468	
CFTR	1080	broad.mit.edu	37	7	117175426	117175426	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr7:117175426T>C	ENST00000003084.6	+	6	836	c.704T>C	c.(703-705)cTt>cCt	p.L235P	CFTR_ENST00000454343.1_Missense_Mutation_p.L235P	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	235	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GTCCTTGCCCTTTTTCAGGCT	0.438									Cystic Fibrosis																												p.L235P													.	CFTR	171		0			c.T704C												128.0	119.0	122.0					7																	117175426		2203	4300	6503	SO:0001583	missense	1080	exon6	Familial Cancer Database	CF	TTGCCCTTTTTCA	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.704T>C	7.37:g.117175426T>C	ENSP00000003084:p.Leu235Pro		Somatic	157	0.0063694268	1		WXS	Illumina HiSeq	Phase_I	144	0.03	4	NM_000492	0		0	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.849389	0.32699	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.91351	-2.83;-2.83;-2.83	5.37	4.2	0.49525	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.563956	0.20074	N	0.099787	T	0.77025	0.4070	N	0.01438	-0.865	0.22982	N	0.998476	B	0.16166	0.016	B	0.25884	0.064	T	0.66180	-0.5988	10	0.34782	T	0.22	-0.328	12.4979	0.55940	0.0:0.0:0.1397:0.8603	.	235	P13569	CFTR_HUMAN	P	235;235;205	ENSP00000003084:L235P;ENSP00000403677:L235P;ENSP00000389119:L205P	ENSP00000003084:L235P	L	+	2	0	CFTR	116962662	0.900000	0.30661	0.016000	0.15963	0.989000	0.77384	4.475000	0.60210	0.864000	0.35578	0.528000	0.53228	CTT			0.438	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059397.3		NM_000492	
GPR124	25960	mdanderson.org	37	8	37699257	37699257	+	Missense_Mutation	SNP	G	G	A	rs376732365		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr8:37699257G>A	ENST00000412232.2	+	19	3414	c.3401G>A	c.(3400-3402)tGc>tAc	p.C1134Y	GPR124_ENST00000315215.7_Missense_Mutation_p.C917Y	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1134					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CTGGGCCCCTGCAAGCTCACC	0.751																																					p.C1134Y													.	.			0			c.G3401A												1.0	2.0	2.0					8																	37699257		1194	2705	3899	SO:0001583	missense	25960	exon19			GCCCCTGCAAGCT	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3401G>A	8.37:g.37699257G>A	ENSP00000406367:p.Cys1134Tyr		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_032777	38	0.00	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210166	0.79240	.	.	ENSG00000020181	ENST00000315215;ENST00000412232	T;T	0.70282	-0.47;-0.22	4.79	4.79	0.61399	.	0.055148	0.64402	D	0.000001	D	0.82719	0.5098	M	0.65975	2.015	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.70935	0.971;0.956	D	0.85275	0.1058	10	0.87932	D	0	-30.3323	17.8176	0.88639	0.0:0.0:1.0:0.0	.	917;1134	Q96PE1-2;Q96PE1	.;GP124_HUMAN	Y	917;1134	ENSP00000323508:C917Y;ENSP00000406367:C1134Y	ENSP00000323508:C917Y	C	+	2	0	GPR124	37818415	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	7.399000	0.79935	2.203000	0.70933	0.484000	0.47621	TGC			0.751	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343331.2			
Unknown	0	bcgsc.ca	37	9	45376198	45376198	+	IGR	SNP	G	G	A	rs146422224		TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr9:45376198G>A								RP11-449H15.2 (163697 upstream) : RP11-187C18.5 (17646 downstream)																							CATCCGGCTCGCGGACCAAAC	0.532																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	441420	.			CGGCTCGCGGACC																													9.37:g.45376198G>A			Somatic	31	0.0322580645	1		WXS	Illumina HiSeq	Phase_1	29	0.24	7	.	0		0		RNA	SNP		37																																																																																					0	0.532										
SLC2A8	29988	mdanderson.org	37	9	130160366	130160366	+	Silent	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr9:130160366C>T	ENST00000373371.3	+	3	491	c.402C>T	c.(400-402)tgC>tgT	p.C134C	SLC2A8_ENST00000373360.3_Silent_p.C134C|SLC2A8_ENST00000373352.1_Intron	NM_001271712.1|NM_014580.3	NP_001258641.1|NP_055395.2	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 8	134					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|male meiosis I (GO:0007141)|response to hypoxia (GO:0001666)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	glucose binding (GO:0005536)|glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	11						GCCTGGCCTGCGGTGTTGCCT	0.701																																					p.C134C													.	.			0			c.C402T												8.0	10.0	9.0					9																	130160366		2148	4231	6379	SO:0001819	synonymous_variant	29988	exon3			GGCCTGCGGTGTT	AJ245937	CCDS6870.1, CCDS65138.1, CCDS75903.1	9q33.3	2013-05-22	2008-09-02		ENSG00000136856	ENSG00000136856		"""Solute carriers"""	13812	protein-coding gene	gene with protein product		605245	"""solute carrier family 2 (facilitated glucose transporter) member 8"""			10671487, 10821868	Standard	NM_014580		Approved	GLUTX1, GLUT8	uc004bqu.4	Q9NY64	OTTHUMG00000020702	ENST00000373371.3:c.402C>T	9.37:g.130160366C>T			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	15	0.20	3	NM_014580	22	0.00	0	Q8WUZ9|Q9NSC4	Silent	SNP	ENST00000373371.3	37	CCDS6870.1																																																																																					0.701	SLC2A8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054177.1		NM_014580	
SAT1	6303	bcgsc.ca;mdanderson.org	37	X	23802158	23802158	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chrX:23802158T>A	ENST00000379253.3	+	3	539	c.360T>A	c.(358-360)aaT>aaA	p.N120K	SAT1_ENST00000379254.1_Intron|SAT1_ENST00000489394.1_Intron|SAT1_ENST00000379270.4_Intron|RP13-314C10.5_ENST00000366134.2_RNA|Y_RNA_ENST00000365402.1_RNA|SAT1_ENST00000379251.3_Missense_Mutation_p.N150K			Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						AAAAAAAAAATTAGATATGCT	0.403																																					.													.	SAT1	29		0			.																																									SO:0001583	missense	6303	.			AAAAAATTAGATA	M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379253.3:c.360T>A	X.37:g.23802158T>A	ENSP00000368555:p.Asn120Lys		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_1	89	0.06	5	.	19	0.00	0	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	ENST00000379253.3	37		.	.	.	.	.	.	.	.	.	.	T	2.719	-0.267069	0.05754	.	.	ENSG00000130066	ENST00000379253;ENST00000379251	.	.	.	3.4	-6.8	0.01709	.	.	.	.	.	T	0.13884	0.0336	.	.	.	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.23976	-1.0173	6	.	.	.	.	0.2282	0.00177	0.2554:0.1562:0.2552:0.3332	.	120	A6NM56	.	K	120;150	.	.	N	+	3	2	SAT1	23712079	0.000000	0.05858	0.000000	0.03702	0.124000	0.20399	-0.024000	0.12435	-1.566000	0.01673	0.242000	0.17961	AAT			0.403	SAT1-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000056058.1		NM_002970	
ARR3	407	mdanderson.org	37	X	69501571	69501571	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chrX:69501571G>T	ENST00000307959.8	+	17	1173	c.1122G>T	c.(1120-1122)gaG>gaT	p.E374D	RAB41_ENST00000374473.2_5'Flank|RAB41_ENST00000276066.4_5'Flank	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	374					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						AAGGCGAGGAGGAGAGCCAGA	0.562																																					p.E374D													.	.			0			c.G1122T												80.0	53.0	62.0					X																	69501571		2196	4292	6488	SO:0001583	missense	407	exon17			CGAGGAGGAGAGC		CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.1122G>T	X.37:g.69501571G>T	ENSP00000311538:p.Glu374Asp		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_004312	2	0.00	0	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Missense_Mutation	SNP	ENST00000307959.8	37	CCDS14399.1	.	.	.	.	.	.	.	.	.	.	G	7.784	0.710177	0.15239	.	.	ENSG00000120500	ENST00000374480;ENST00000307959	T	0.10005	2.92	3.75	-3.78	0.04333	Immunoglobulin E-set (1);Arrestin, C-terminal (1);	3.417810	0.01507	N	0.017763	T	0.05731	0.0150	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34104	-0.9842	10	0.44086	T	0.13	.	5.36	0.16083	0.4651:0.2628:0.272:0.0	.	374	P36575	ARRC_HUMAN	D	374	ENSP00000311538:E374D	ENSP00000311538:E374D	E	+	3	2	ARR3	69418296	0.087000	0.21565	0.000000	0.03702	0.004000	0.04260	0.074000	0.14662	-1.290000	0.02372	-1.028000	0.02416	GAG			0.562	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057055.2		NM_004312	
NOX1	27035	broad.mit.edu	37	X	100105256	100105256	+	Silent	SNP	A	A	G			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chrX:100105256A>G	ENST00000372966.3	-	9	1222	c.1017T>C	c.(1015-1017)ccT>ccC	p.P339P	NOX1_ENST00000372960.4_Silent_p.P302P|NOX1_ENST00000217885.5_Silent_p.P339P|NOX1_ENST00000372964.1_Intron	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	339	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						TCAAAGTAAAAGGATGCCATT	0.448																																					p.P339P													.	NOX1	79		0			c.T1017C												66.0	62.0	63.0					X																	100105256		2203	4300	6503	SO:0001819	synonymous_variant	27035	exon9			AGTAAAAGGATGC	AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.1017T>C	X.37:g.100105256A>G			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	117	0.03	4	NM_013955	2	0.00	0	A8K836|O95691|Q2PP02	Silent	SNP	ENST00000372966.3	37	CCDS14474.1	.	.	.	.	.	.	.	.	.	.	A	5.456	0.269283	0.10349	.	.	ENSG00000007952	ENST00000427768	.	.	.	3.87	1.8	0.24995	.	.	.	.	.	T	0.56156	0.1966	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49890	-0.8891	4	.	.	.	-5.2296	8.5096	0.33208	0.2544:0.0:0.7456:0.0	.	.	.	.	L	24	.	.	F	-	1	0	NOX1	99991912	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	0.722000	0.25925	0.628000	0.30357	-0.537000	0.04273	TTT			0.448	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057495.1		NM_007052	
HCFC1	3054	mdanderson.org	37	X	153215724	153215724	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chrX:153215724C>T	ENST00000310441.7	-	24	6940	c.5974G>A	c.(5974-5976)Ggc>Agc	p.G1992S	HCFC1_ENST00000354233.3_Missense_Mutation_p.G1923S|HCFC1_ENST00000369984.4_Missense_Mutation_p.G2037S	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1992	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTGGCCGGGCCATAGCCCTTC	0.632																																					p.G1992S													.	.			0			c.G5974A												52.0	53.0	53.0					X																	153215724		2099	4190	6289	SO:0001583	missense	3054	exon24			CCGGGCCATAGCC		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.5974G>A	X.37:g.153215724C>T	ENSP00000309555:p.Gly1992Ser		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_005334	121	0.00	0	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	CCDS44020.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.361470|5.361470	0.95877|0.95877	.|.	.|.	ENSG00000172534|ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233|ENST00000444191	T;T;T|.	0.59772|.	0.24;0.24;0.24|.	5.36|5.36	5.36|5.36	0.76844|0.76844	Fibronectin, type III (2);Immunoglobulin-like fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76779|.	0.4035|.	M|M	0.77616|0.77616	2.38|2.38	0.49687|0.49687	D|D	0.999815|0.999815	D|.	0.76494|.	0.999|.	D|.	0.91635|.	0.999|.	T|.	0.77814|.	-0.2448|.	10|.	0.87932|.	D|.	0|.	.|.	16.8817|16.8817	0.86065|0.86065	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1992|.	P51610|.	HCFC1_HUMAN|.	S|X	1992;2037;1923|567	ENSP00000309555:G1992S;ENSP00000359001:G2037S;ENSP00000346174:G1923S|.	ENSP00000309555:G1992S|.	G|W	-|-	1|2	0|0	HCFC1|HCFC1	152868918|152868918	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.940000|0.940000	0.58332|0.58332	7.813000|7.813000	0.86123|0.86123	2.247000|2.247000	0.74100|0.74100	0.525000|0.525000	0.51046|0.51046	GGC|TGG			0.632	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061099.4		NM_005334	
MAP3K14	9020	mdanderson.org	37	17	43351583	43351583	+	RNA	SNP	G	G	T			TCGA-2G-AALY-01A-11D-A42Y-10	TCGA-2G-AALY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1d72b00-762d-4b89-bd7e-f9010bfa451a	8bc7851f-087a-4d33-a4e0-20e48169eee0	g.chr17:43351583G>T	ENST00000344686.2	-	0	1564							Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase 14						cellular response to mechanical stimulus (GO:0071260)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|T cell costimulation (GO:0031295)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|NF-kappaB-inducing kinase activity (GO:0004704)|protein kinase activity (GO:0004672)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TCCTCTGGGAGACAGCCCTGC	0.627																																					.													.	.			0			.												27.0	29.0	29.0					17																	43351583		1918	4113	6031			9020	.			CTGGGAGACAGCC	Y10256	CCDS74079.1	17q21.31	2014-06-16			ENSG00000006062	ENSG00000006062	2.7.11.25	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6853	protein-coding gene	gene with protein product	"""serine/threonine protein-kinase"""	604655				9020361	Standard	NM_003954		Approved	NIK, HSNIK, FTDCR1B, HS	uc002iiw.1	Q99558	OTTHUMG00000180364		17.37:g.43351583G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	.	3	0.00	0	A8K2D8|D3DX67|Q8IYN1	Missense_Mutation	SNP	ENST00000344686.2	37		.	.	.	.	.	.	.	.	.	.	G	18.30	3.593276	0.66219	.	.	ENSG00000006062	ENST00000344686;ENST00000376926	.	.	.	6.04	6.04	0.98038	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.74207	0.3686	L	0.47190	1.495	0.30566	N	0.764035	D	0.56968	0.978	D	0.68765	0.96	T	0.73100	-0.4089	8	0.54805	T	0.06	.	17.7352	0.88390	0.0:0.0:1.0:0.0	.	487	Q99558	M3K14_HUMAN	I	486;270	.	ENSP00000342059:L486I	L	-	1	0	MAP3K14	40707366	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	4.591000	0.61019	2.873000	0.98535	0.561000	0.74099	CTC			0.627	MAP3K14-201	KNOWN	basic	processed_transcript	processed_transcript				NM_003954	
