#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PHC2	1912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	33832793	33832793	+	Silent	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr1:33832793C>T	ENST00000257118.5	-	6	953	c.900G>A	c.(898-900)gtG>gtA	p.V300V	PHC2_ENST00000431992.1_Silent_p.V271V|PHC2_ENST00000419414.2_Silent_p.V300V|PHC2_ENST00000373416.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	300					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGCTCCCTGGCACACTGCTGT	0.592																																					p.V300V													.	.			0			c.G900A												76.0	74.0	75.0					1																	33832793		2203	4300	6503	SO:0001819	synonymous_variant	1912	exon6			CCCTGGCACACTG	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.900G>A	1.37:g.33832793C>T			Somatic	126	0	0		WXS	Illumina HiSeq	.	82	0.28	23	NM_198040	2	0.50	1	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Silent	SNP	ENST00000257118.5	37	CCDS378.1																																																																																					0.592	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000011895.1		NM_198040	
CYP4Z2P	163720	broad.mit.edu	37	1	47325212	47325212	+	RNA	SNP	G	G	A	rs111656248	byFrequency	TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr1:47325212G>A	ENST00000505841.1	-	0	1204					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										AATAAGAATGGCCCTAGGTTC	0.393																																					.													.	.			0			.																																											0	.			AGAATGGCCCTAG	AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47325212G>A			Somatic	111	0.009009009	1		WXS	Illumina HiSeq	Phase_I	90	0.04	4	.	0		0	Q66ZJ5	RNA	SNP	ENST00000505841.1	37																																																																																						0.393	CYP4Z2P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000361094.1		NR_002788	
ARID4B	51742	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	235345258	235345258	+	Silent	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr1:235345258G>A	ENST00000264183.3	-	20	3473	c.2976C>T	c.(2974-2976)gtC>gtT	p.V992V	ARID4B_ENST00000349213.3_Silent_p.V906V|ARID4B_ENST00000366603.2_Silent_p.V992V|ARID4B_ENST00000494543.1_5'Flank	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	992					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			GTTTACTATCGACATTGACTG	0.463																																					p.V992V													.	.			0			c.C2976T												137.0	145.0	142.0					1																	235345258		2203	4300	6503	SO:0001819	synonymous_variant	51742	exon20			ACTATCGACATTG	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2976C>T	1.37:g.235345258G>A			Somatic	111	0	0		WXS	Illumina HiSeq	.	106	0.06	6	NM_016374	42	0.07	3	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Silent	SNP	ENST00000264183.3	37	CCDS31061.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.071024	0.00379	.	.	ENSG00000054267	ENST00000444620	.	.	.	5.1	-10.2	0.00374	.	.	.	.	.	T	0.35856	0.0946	.	.	.	0.53005	D	0.999967	.	.	.	.	.	.	T	0.45011	-0.9290	4	.	.	.	-1.0993	3.8309	0.08874	0.5658:0.1466:0.1036:0.184	.	.	.	.	L	392	.	.	S	-	2	0	ARID4B	233411881	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-1.323000	0.02692	-2.883000	0.00318	-0.482000	0.04802	TCG			0.463	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095566.3		NM_016374	
LGALS8	3964	broad.mit.edu	37	1	236706865	236706865	+	Silent	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr1:236706865G>A	ENST00000366584.4	+	8	1121	c.555G>A	c.(553-555)ctG>ctA	p.L185L	RP11-385F5.4_ENST00000433131.1_RNA|LGALS8_ENST00000525042.1_Silent_p.L168L|LGALS8_ENST00000526634.1_Silent_p.L185L|LGALS8_ENST00000416919.2_Silent_p.L168L|LGALS8_ENST00000352231.2_Silent_p.L227L|LGALS8_ENST00000527974.1_Silent_p.L227L|LGALS8_ENST00000323938.6_Silent_p.L158L|LGALS8_ENST00000450372.2_Silent_p.L227L|LGALS8_ENST00000526589.1_Silent_p.L227L|LGALS8_ENST00000341872.6_Silent_p.L185L	NM_201544.2	NP_963838.1	O00214	LEG8_HUMAN	lectin, galactoside-binding, soluble, 8	185					plasma cell differentiation (GO:0002317)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(5)	20	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTCAGAGGCTGCCATTCGCTG	0.512																																					p.L227L													.	LGALS8	42		0			c.G681A												69.0	62.0	65.0					1																	236706865		2203	4300	6503	SO:0001819	synonymous_variant	3964	exon10			GAGGCTGCCATTC	X91790	CCDS1611.1, CCDS1612.1	1q43	2011-08-04	2008-07-25		ENSG00000116977	ENSG00000116977		"""Lectins, galactoside-binding"""	6569	protein-coding gene	gene with protein product	"""galectin 8"""	606099				7852431, 8692978	Standard	NM_201545		Approved	PCTA-1	uc001hxy.2	O00214	OTTHUMG00000039953	ENST00000366584.4:c.555G>A	1.37:g.236706865G>A			Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	115	0.03	4	NM_006499	85	0.00	0	O15215|Q5T3P5|Q5T3Q4|Q8TEV1|Q96B92|Q9BXC8|Q9H584|Q9H585|Q9UEZ6|Q9UP32|Q9UP33|Q9UP34	Silent	SNP	ENST00000366584.4	37	CCDS1612.1																																																																																					0.512	LGALS8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000096365.2		NM_006499	
PARD3	56288	broad.mit.edu;mdanderson.org	37	10	34408663	34408663	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr10:34408663G>C	ENST00000374789.3	-	24	3880	c.3555C>G	c.(3553-3555)aaC>aaG	p.N1185K	PARD3_ENST00000374794.3_Missense_Mutation_p.N1073K|PARD3_ENST00000545260.1_Missense_Mutation_p.N1095K|PARD3_ENST00000350537.4_Missense_Mutation_p.N1139K|PARD3_ENST00000374788.3_Missense_Mutation_p.N1182K|PARD3_ENST00000374790.3_Missense_Mutation_p.N1125K|PARD3_ENST00000346874.4_Missense_Mutation_p.N1148K|PARD3_ENST00000545693.1_Missense_Mutation_p.N1169K	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1185					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CCGGCCGTGCGTTCGGCTGGA	0.567																																					p.N1185K													.	PARD3	131		0			c.C3555G												22.0	21.0	21.0					10																	34408663		2203	4299	6502	SO:0001583	missense	56288	exon24			CCGTGCGTTCGGC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3555C>G	10.37:g.34408663G>C	ENSP00000363921:p.Asn1185Lys		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_019619	80	0.06	5	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	G	9.943	1.218127	0.22373	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790	T;T;T;T;T;T;T;T	0.14516	2.62;2.59;2.68;2.68;2.54;2.5;2.59;2.62	5.4	3.53	0.40419	.	0.241836	0.47093	D	0.000242	T	0.12689	0.0308	L	0.47716	1.5	0.80722	D	1	B;P;B;B;B;B;B;B	0.35272	0.432;0.493;0.432;0.432;0.432;0.432;0.432;0.306	B;B;B;B;B;B;B;B	0.34536	0.185;0.095;0.185;0.185;0.185;0.185;0.185;0.09	T	0.05305	-1.0893	10	0.42905	T	0.14	.	9.9905	0.41868	0.2182:0.0:0.7818:0.0	.	1073;1095;1102;1139;1169;1148;1182;1185	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0	.;.;.;.;.;.;.;PARD3_HUMAN	K	1169;1095;1185;1182;1148;1073;1139;1125	ENSP00000443147:N1169K;ENSP00000440857:N1095K;ENSP00000363921:N1185K;ENSP00000363920:N1182K;ENSP00000340591:N1148K;ENSP00000363926:N1073K;ENSP00000311986:N1139K;ENSP00000363922:N1125K	ENSP00000340591:N1148K	N	-	3	2	PARD3	34448669	0.543000	0.26434	0.102000	0.21198	0.042000	0.13812	2.506000	0.45433	0.653000	0.30826	0.650000	0.86243	AAC			0.567	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047527.1		NM_019619	
TYSND1	219743	broad.mit.edu	37	10	71905245	71905245	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr10:71905245delA	ENST00000287078.6	-	1	1097	c.1098delT	c.(1096-1098)cttfs	p.L366fs	TYSND1_ENST00000335494.5_Frame_Shift_Del_p.L366fs|TYSND1_ENST00000494143.1_5'Flank	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	366	Serine protease.				protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						AGGTCACTACAAGGCGGGGTG	0.697																																					p.L366fs													.	TYSND1	20		0			c.1098delT												12.0	14.0	13.0					10																	71905245		2185	4279	6464	SO:0001589	frameshift_variant	219743	exon1			CACTACAAGGCGG	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.1098delT	10.37:g.71905245delA	ENSP00000287078:p.Leu366fs		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	19	0.47	9	NM_001040273	27	0.00	0	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Frame_Shift_Del	DEL	ENST00000287078.6	37	CCDS31213.1																																																																																					0.697	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048483.1		NM_173555	
CDHR1	92211	mdanderson.org	37	10	85965594	85965594	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr10:85965594G>T	ENST00000372117.3	+	10	977	c.874G>T	c.(874-876)Gcc>Tcc	p.A292S	CDHR1_ENST00000332904.3_Missense_Mutation_p.A292S|CDHR1_ENST00000440770.2_Missense_Mutation_p.A51S	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	292	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						GAACGATGGAGCCTTTGAAAT	0.567											OREG0020333	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A292S													.	.			0			c.G874T												77.0	73.0	74.0					10																	85965594		2203	4300	6503	SO:0001583	missense	92211	exon10			GATGGAGCCTTTG	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.874G>T	10.37:g.85965594G>T	ENSP00000361189:p.Ala292Ser		Somatic	54	0	0	1240	WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001171971	5	0.00	0	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	G	9.074	0.997701	0.19043	.	.	ENSG00000148600	ENST00000332904;ENST00000372117;ENST00000440770	T;T;T	0.50813	0.73;0.73;0.73	5.2	2.09	0.27110	Cadherin (4);Cadherin-like (1);	0.918383	0.09522	N	0.790838	T	0.24890	0.0604	N	0.16833	0.445	0.23959	N	0.996344	B;B;B	0.15141	0.006;0.012;0.005	B;B;B	0.19666	0.015;0.008;0.026	T	0.31223	-0.9951	10	0.07325	T	0.83	-9.6778	3.1836	0.06593	0.0902:0.1481:0.5004:0.2612	.	51;292;292	E7EN47;Q96JP9-2;Q96JP9	.;.;CDHR1_HUMAN	S	292;292;51	ENSP00000331063:A292S;ENSP00000361189:A292S;ENSP00000415980:A51S	ENSP00000331063:A292S	A	+	1	0	CDHR1	85955574	0.998000	0.40836	0.662000	0.29724	0.816000	0.46133	2.200000	0.42724	0.683000	0.31428	0.491000	0.48974	GCC			0.567	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049111.1		NM_033100	
TRPM5	29850	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	2436203	2436203	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:2436203C>T	ENST00000155858.6	-	10	1562	c.1554G>A	c.(1552-1554)tgG>tgA	p.W518*	TRPM5_ENST00000533060.1_Nonsense_Mutation_p.W518*|TRPM5_ENST00000452833.1_Nonsense_Mutation_p.W520*|TRPM5_ENST00000528453.1_Nonsense_Mutation_p.W518*	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		ACAGGTCCCGCCAGGGGTTCT	0.706																																					p.W518X	NSCLC(1;49 61 17205 18850 43201)												.	.			0			c.G1554A												23.0	29.0	27.0					11																	2436203		2180	4282	6462	SO:0001587	stop_gained	29850	exon10			GTCCCGCCAGGGG	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.1554G>A	11.37:g.2436203C>T	ENSP00000155858:p.Trp518*		Somatic	14	0	0		WXS	Illumina HiSeq	.	19	0.37	7	NM_014555	0		0		Nonsense_Mutation	SNP	ENST00000155858.6	37	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	C	37	6.621227	0.97714	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	.	.	.	3.68	2.71	0.32032	.	0.152115	0.47852	D	0.000204	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.9428	11.742	0.51799	0.0:0.8194:0.1806:0.0	.	.	.	.	X	512;518;520;518;518;518	.	ENSP00000155858:W518X	W	-	3	0	TRPM5	2392779	1.000000	0.71417	0.802000	0.32245	0.947000	0.59692	5.500000	0.66943	0.844000	0.35094	0.491000	0.48974	TGG			0.706	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000027378.1		NM_014555	
APBB1	322	broad.mit.edu;mdanderson.org	37	11	6415755	6415755	+	IGR	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:6415755G>T	ENST00000609360.1	-	0	2642				SMPD1_ENST00000527275.1_Missense_Mutation_p.S604I|SMPD1_ENST00000342245.4_Missense_Mutation_p.S605I|SMPD1_ENST00000356761.2_Missense_Mutation_p.S549I|APBB1_ENST00000526240.1_5'Flank|SMPD1_ENST00000299397.3_Missense_Mutation_p.S561I	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)						apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CGTGCTGACAGCCCTGCTCTG	0.642																																					p.S605I	GBM(147;1810 2556 5672 39622)												.	SMPD1	108		0			c.G1814T												55.0	58.0	57.0					11																	6415755		2201	4296	6497	SO:0001628	intergenic_variant	6609	exon6			CTGACAGCCCTGC	L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213			11.37:g.6415755G>T			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_000543	63	0.00	0	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	ENST00000609360.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.44|13.44	2.237756|2.237756	0.39598|0.39598	.|.	.|.	ENSG00000166311|ENSG00000166311	ENST00000526280|ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	.|D;D;D;D	.|0.89485	.|-2.52;-2.52;-2.52;-2.52	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.205916	.|0.42682	.|D	.|0.000662	D|D	0.85575|0.85575	0.5728|0.5728	M|M	0.66939|0.66939	2.045|2.045	0.28701|0.28701	N|N	0.904077|0.904077	.|P;B;B	.|0.48016	.|0.904;0.138;0.205	.|B;B;B	.|0.38264	.|0.269;0.037;0.035	D|D	0.83680|0.83680	0.0171|0.0171	5|10	.|0.46703	.|T	.|0.11	-11.2931|-11.2931	10.179|10.179	0.42957|0.42957	0.0905:0.0:0.9095:0.0|0.0905:0.0:0.9095:0.0	.|.	.|604;561;603	.|E9PKS3;G3XAB5;P17405	.|.;.;ASM_HUMAN	S|I	291|561;549;605;604	.|ENSP00000299397:S561I;ENSP00000349203:S549I;ENSP00000340409:S605I;ENSP00000435350:S604I	.|ENSP00000299397:S561I	A|S	+|+	1|2	0|0	SMPD1|SMPD1	6372331|6372331	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.839000|0.839000	0.47603|0.47603	3.873000|3.873000	0.56093|0.56093	2.537000|2.537000	0.85549|0.85549	0.462000|0.462000	0.41574|0.41574	GCC|AGC			0.642	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000471831.1		NM_001164	
ABCC8	6833	mdanderson.org	37	11	17452468	17452468	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:17452468G>T	ENST00000389817.3	-	12	1778	c.1710C>A	c.(1708-1710)gaC>gaA	p.D570E	ABCC8_ENST00000302539.4_Missense_Mutation_p.D570E|ABCC8_ENST00000528202.1_5'UTR			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	570	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	AGGGCGAGAAGTCGGCCTCTT	0.602																																					p.D570E													.	.			0			c.C1710A												105.0	92.0	96.0					11																	17452468		2200	4293	6493	SO:0001583	missense	6833	exon12			CGAGAAGTCGGCC	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1710C>A	11.37:g.17452468G>T	ENSP00000374467:p.Asp570Glu		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_000352	0		0	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	G	6.795	0.515693	0.12944	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.88818	-2.43;-2.43	5.46	4.55	0.56014	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.107640	0.64402	D	0.000009	T	0.79907	0.4527	N	0.24115	0.695	0.48762	D	0.999702	B;B	0.22851	0.076;0.076	B;B	0.29440	0.063;0.102	T	0.71310	-0.4631	10	0.02654	T	1	.	12.9169	0.58211	0.0797:0.0:0.9203:0.0	.	569;570	B7Z4N0;Q09428	.;ABCC8_HUMAN	E	570;570;584	ENSP00000374467:D570E;ENSP00000303960:D570E	ENSP00000303960:D570E	D	-	3	2	ABCC8	17409044	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	2.993000	0.49425	1.298000	0.44778	0.655000	0.94253	GAC			0.602	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000389093.1		NM_000352	
PTPMT1	114971	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	47587435	47587435	+	Intron	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:47587435G>T	ENST00000326674.9	+	2	196				PTPMT1_ENST00000426530.2_Silent_p.L87L|PTPMT1_ENST00000534775.1_Silent_p.L87L|PTPMT1_ENST00000326656.8_Intron|NDUFS3_ENST00000533507.1_Intron	NM_175732.2	NP_783859.1	Q8WUK0	PTPM1_HUMAN	protein tyrosine phosphatase, mitochondrial 1						cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|inositol phosphate dephosphorylation (GO:0046855)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylglycerophosphatase activity (GO:0008962)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	6						CGTCTTTGCTGAGCCACCTCT	0.682																																					p.L87L													.	.			0			c.G261T												22.0	24.0	23.0					11																	47587435		2042	4179	6221	SO:0001627	intron_variant	114971	exon1			TTTGCTGAGCCAC	BC014048	CCDS41643.1, CCDS44593.1	11p11.2	2011-06-09			ENSG00000110536	ENSG00000110536	3.1.3.36	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	26965	protein-coding gene	gene with protein product		609538				12477932	Standard	NM_175732		Approved	PLIP, DUSP23, MOSP	uc001nfs.4	Q8WUK0	OTTHUMG00000166892	ENST00000326674.9:c.175-23G>T	11.37:g.47587435G>T			Somatic	139	0	0		WXS	Illumina HiSeq	.	129	0.46	59	NM_001143984	22	0.32	7	E9PAT8|Q7Z557|Q96CR2|Q9BXV8	Silent	SNP	ENST00000326674.9	37	CCDS41643.1																																																																																					0.682	PTPMT1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391746.1		XM_374879	
FADS3	3995	mdanderson.org	37	11	61645045	61645045	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:61645045G>A	ENST00000278829.2	-	7	975	c.823C>T	c.(823-825)Ctc>Ttc	p.L275F	FADS3_ENST00000540820.1_Missense_Mutation_p.L275F|FADS3_ENST00000527697.1_Missense_Mutation_p.L151F|FADS3_ENST00000525588.1_Missense_Mutation_p.L247F	NM_021727.3	NP_068373.1	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	275					unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						ACCAGGGTGAGCAGCGGCGGG	0.627																																					p.L275F													.	.			0			c.C823T												77.0	70.0	72.0					11																	61645045		2202	4299	6501	SO:0001583	missense	3995	exon7			GGGTGAGCAGCGG		CCDS8013.1	11q12-q13.1	2013-01-25			ENSG00000221968	ENSG00000221968	1.14.19.3	"""Fatty acid desaturases"""	3576	protein-coding gene	gene with protein product	"""delta-9-desaturase"""	606150		LLCDL3			Standard	NM_021727		Approved	CYB5RP	uc001nsm.3	Q9Y5Q0	OTTHUMG00000167500	ENST00000278829.2:c.823C>T	11.37:g.61645045G>A	ENSP00000278829:p.Leu275Phe		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_021727	259	0.00	0	O60426	Missense_Mutation	SNP	ENST00000278829.2	37	CCDS8013.1	.	.	.	.	.	.	.	.	.	.	.	18.95	3.730913	0.69074	.	.	ENSG00000221968	ENST00000527697;ENST00000278829;ENST00000540820;ENST00000525588;ENST00000531956;ENST00000534223	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.65	4.73	0.59995	Fatty acid desaturase, type 1 (1);	.	.	.	.	D	0.83050	0.5170	L	0.59912	1.85	0.58432	D	0.999993	B;B	0.31989	0.35;0.163	P;B	0.50825	0.651;0.33	T	0.79752	-0.1671	9	0.28530	T	0.3	-16.2114	13.8075	0.63243	0.0:0.0:0.8454:0.1546	.	151;275	E9PKP8;Q9Y5Q0	.;FADS3_HUMAN	F	151;275;275;247;151;151	ENSP00000431533:L151F;ENSP00000278829:L275F;ENSP00000439308:L275F;ENSP00000432206:L247F;ENSP00000436890:L151F;ENSP00000434551:L151F	ENSP00000278829:L275F	L	-	1	0	FADS3	61401621	1.000000	0.71417	0.995000	0.50966	0.436000	0.31835	5.733000	0.68571	1.394000	0.46624	0.556000	0.70494	CTC			0.627	FADS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394836.1			
DPP3	10072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66276583	66276583	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:66276583delC	ENST00000360510.2	+	18	2140	c.2075delC	c.(2074-2076)tcafs	p.S692fs	DPP3_ENST00000532677.1_Frame_Shift_Del_p.S711fs|DPP3_ENST00000541961.1_Frame_Shift_Del_p.S692fs|DPP3_ENST00000531863.1_Frame_Shift_Del_p.S712fs|BBS1_ENST00000455748.2_5'Flank|BBS1_ENST00000393994.2_5'Flank|BBS1_ENST00000318312.7_5'Flank|CTD-3074O7.11_ENST00000419755.3_5'UTR|DPP3_ENST00000453114.1_Frame_Shift_Del_p.S692fs|BBS1_ENST00000537537.1_5'Flank|DPP3_ENST00000530165.1_Frame_Shift_Del_p.S662fs			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	692					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						TACGAGGCGTCAGCTGCTGGC	0.542																																					p.S692fs													.	DPP3	61		0			c.2074delT												80.0	78.0	79.0					11																	66276583		2200	4295	6495	SO:0001589	frameshift_variant	10072	exon18			AGGCGTCAGCTGC	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.2075delC	11.37:g.66276583delC	ENSP00000353701:p.Ser692fs		Somatic	59	0	0		WXS	Illumina HiSeq	.	53	0.38	20	NM_130443	168	0.00	0	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Frame_Shift_Del	DEL	ENST00000360510.2	37	CCDS8141.1																																																																																					0.542	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393424.2			
DPP3	10072	hgsc.bcm.edu	37	11	66276583	66276584	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:66276583_66276584delCA	ENST00000360510.2	+	18	2140_2141	c.2075_2076delCA	c.(2074-2076)tcafs	p.S692fs	DPP3_ENST00000532677.1_Frame_Shift_Del_p.S711fs|DPP3_ENST00000541961.1_Frame_Shift_Del_p.S692fs|DPP3_ENST00000531863.1_Frame_Shift_Del_p.S712fs|BBS1_ENST00000455748.2_5'Flank|BBS1_ENST00000393994.2_5'Flank|BBS1_ENST00000318312.7_5'Flank|CTD-3074O7.11_ENST00000419755.3_5'UTR|DPP3_ENST00000453114.1_Frame_Shift_Del_p.S692fs|BBS1_ENST00000537537.1_5'Flank|DPP3_ENST00000530165.1_Frame_Shift_Del_p.S662fs			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	692					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						TACGAGGCGTCAGCTGCTGGCC	0.54																																					p.692_692del													.	DPP3	61		0			c.2074_2075del																																									SO:0001589	frameshift_variant	10072	exon18			AGGCGTCAGCTGC	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.2075_2076delCA	11.37:g.66276583_66276584delCA	ENSP00000353701:p.Ser692fs		Somatic	59	0	0		WXS	Illumina HiSeq	.	53	0.00	0	NM_130443	168	0.00	0	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Frame_Shift_Del	DEL	ENST00000360510.2	37	CCDS8141.1																																																																																					0.540	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393424.2			
DPP3	10072	bcgsc.ca	37	11	66276584	66276584	+	Silent	SNP	A	A	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:66276584A>T	ENST00000360510.2	+	18	2141	c.2076A>T	c.(2074-2076)tcA>tcT	p.S692S	DPP3_ENST00000532677.1_Silent_p.S711S|DPP3_ENST00000541961.1_Silent_p.S692S|DPP3_ENST00000531863.1_Silent_p.S712S|BBS1_ENST00000455748.2_5'Flank|BBS1_ENST00000393994.2_5'Flank|BBS1_ENST00000318312.7_5'Flank|CTD-3074O7.11_ENST00000419755.3_5'UTR|DPP3_ENST00000453114.1_Silent_p.S692S|BBS1_ENST00000537537.1_5'Flank|DPP3_ENST00000530165.1_Silent_p.S662S			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	692					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						ACGAGGCGTCAGCTGCTGGCC	0.542																																					p.S692S													.	DPP3	61		0			c.A2076T												81.0	78.0	79.0					11																	66276584		2200	4295	6495	SO:0001819	synonymous_variant	10072	exon18			GGCGTCAGCTGCT	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.2076A>T	11.37:g.66276584A>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_1	53	0.40	21	NM_130443	173	0.03	6	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	37	CCDS8141.1																																																																																					0.542	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393424.2			
CPT1A	1374	mdanderson.org	37	11	68530187	68530187	+	Silent	SNP	G	G	T	rs576663980		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:68530187G>T	ENST00000265641.5	-	15	1937	c.1783C>A	c.(1783-1785)Cgg>Agg	p.R595R	CPT1A_ENST00000539743.1_Silent_p.R595R|CPT1A_ENST00000537756.2_5'UTR|CPT1A_ENST00000376618.2_Silent_p.R595R|CPT1A_ENST00000540367.1_Silent_p.R595R	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	595					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	CGGAAGAGCCGGGTCATGGAG	0.587																																					p.R595R													.	.			0			c.C1783A												69.0	61.0	64.0					11																	68530187		2200	4294	6494	SO:0001819	synonymous_variant	1374	exon15			AGAGCCGGGTCAT	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1783C>A	11.37:g.68530187G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001876	117	0.00	0	Q8TCU0|Q9BWK0	Silent	SNP	ENST00000265641.5	37	CCDS8185.1																																																																																					0.587	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397457.2		NM_001876	
ARHGAP32	9743	mdanderson.org	37	11	128910825	128910825	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:128910825G>T	ENST00000310343.9	-	10	1000	c.1001C>A	c.(1000-1002)cCa>cAa	p.P334Q	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.P260Q	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	334					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						GTACTCACCTGGTTTTGGCAC	0.393																																					p.P334Q													.	.			0			c.C1001A												83.0	73.0	76.0					11																	128910825		1566	3578	5144	SO:0001583	missense	9743	exon10			TCACCTGGTTTTG	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.1001C>A	11.37:g.128910825G>T	ENSP00000310561:p.Pro334Gln		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001142685	0		0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302271	0.81136	.	.	ENSG00000134909	ENST00000310343;ENST00000524655;ENST00000457677;ENST00000356092	T;T	0.32515	1.45;1.45	5.22	5.22	0.72569	Src homology-3 domain (1);	.	.	.	.	T	0.44808	0.1311	L	0.42245	1.32	0.80722	D	1	P;D;D	0.60575	0.941;0.969;0.988	P;P;P	0.60345	0.459;0.73;0.873	T	0.38178	-0.9673	9	0.72032	D	0.01	.	15.6837	0.77393	0.0:0.0:1.0:0.0	.	268;334;152	Q86T64;A7KAX9;Q86UT2	.;RHG32_HUMAN;.	Q	334;260;268;44	ENSP00000310561:P334Q;ENSP00000432468:P260Q	ENSP00000310561:P334Q	P	-	2	0	ARHGAP32	128416035	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.752000	0.85141	2.448000	0.82819	0.591000	0.81541	CCA			0.393	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386151.3		NM_014715	
ADAMTS8	11095	mdanderson.org	37	11	130286846	130286846	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr11:130286846G>A	ENST00000257359.6	-	3	1791	c.1085C>T	c.(1084-1086)gCc>gTc	p.A362V		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	362	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A391V(1)|p.A362V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TAGTTCATGGGCCAGGGTGTG	0.557																																					p.A362V													ADAMTS8_ENST00000414575,NS,carcinoma,0,3	ADAMTS8_ENST00000414575	0	3	2	Substitution - Missense(2)	lung(2)	c.C1085T												133.0	142.0	139.0					11																	130286846		2035	4181	6216	SO:0001583	missense	11095	exon3			TCATGGGCCAGGG	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1085C>T	11.37:g.130286846G>A	ENSP00000257359:p.Ala362Val		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_007037	7	0.00	0	Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	37	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	G	33	5.193946	0.94960	.	.	ENSG00000134917	ENST00000257359;ENST00000414575	D	0.92149	-2.98	4.66	4.66	0.58398	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.96519	0.8864	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	D	0.97454	1.0030	10	0.87932	D	0	.	17.91	0.88931	0.0:0.0:1.0:0.0	.	362	Q9UP79	ATS8_HUMAN	V	362;391	ENSP00000257359:A362V	ENSP00000257359:A362V	A	-	2	0	ADAMTS8	129792056	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.858000	0.99539	2.281000	0.76405	0.655000	0.94253	GCC			0.557	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385636.1		NM_007037	
FOXM1	2305	broad.mit.edu	37	12	2973635	2973635	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr12:2973635G>T	ENST00000359843.3	-	8	1185	c.1117C>A	c.(1117-1119)Cgg>Agg	p.R373R	FOXM1_ENST00000537018.1_5'Flank|FOXM1_ENST00000342628.2_Silent_p.R373R|FOXM1_ENST00000361953.3_Silent_p.R358R	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	373					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GAGCTGACCCGTGGTAGCAGT	0.592																																					p.R373R													.	FOXM1	62		0			c.C1117A												72.0	71.0	72.0					12																	2973635		2203	4300	6503	SO:0001819	synonymous_variant	2305	exon8			TGACCCGTGGTAG	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1117C>A	12.37:g.2973635G>T			Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	286	0.02	5	NM_021953	669	0.00	0	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	ENST00000359843.3	37	CCDS8515.1	.	.	.	.	.	.	.	.	.	.	G	9.411	1.080427	0.20309	.	.	ENSG00000111206	ENST00000535350	.	.	.	5.06	4.07	0.47477	.	.	.	.	.	T	0.68403	0.2997	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67417	-0.5676	4	.	.	.	.	13.6673	0.62403	0.0:0.0:0.7554:0.2446	.	.	.	.	K	98	.	.	T	-	2	0	FOXM1	2843896	1.000000	0.71417	0.970000	0.41538	0.824000	0.46624	3.930000	0.56522	2.342000	0.79632	0.561000	0.74099	ACG			0.592	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000398272.1		NM_021953	
PRH1	5554	broad.mit.edu	37	12	11035035	11035035	+	Silent	SNP	A	A	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr12:11035035A>G	ENST00000428168.2	-	4	337	c.300T>C	c.(298-300)caT>caC	p.H100H	PRR4_ENST00000536668.1_5'UTR	NM_006250.3	NP_006241.2	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 1	100						extracellular space (GO:0005615)				endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(232;0.245)		GAGGAGGGGGATGGCCTCCCT	0.637																																					p.H100H													.	PRH1	17		0			c.T300C												54.0	31.0	39.0					12																	11035035		2181	4176	6357	SO:0001819	synonymous_variant	5554	exon4			AGGGGGATGGCCT			12p13.2	2013-05-10			ENSG00000231887	ENSG00000231887			9366	protein-coding gene	gene with protein product		168730				3009472	Standard	NM_001291314		Approved	Pa	uc021qvf.1	P02810		ENST00000428168.2:c.300T>C	12.37:g.11035035A>G			Somatic	423	0.0047281324	2		WXS	Illumina HiSeq	Phase_I	1080	0.01	10	NM_006250	19	0.00	0	A2VCM0|A3KN66|A5D902|B2RMW2|Q4VBP2|Q53XA2|Q6P2F6	Silent	SNP	ENST00000428168.2	37																																																																																						0.637	PRH1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_006250	
PRB1	5542	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	11506146	11506146	+	Silent	SNP	A	A	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr12:11506146A>G	ENST00000500254.2	-	4	529	c.492T>C	c.(490-492)ccT>ccC	p.P164P	PRB1_ENST00000546254.1_Silent_p.P164P|PRB1_ENST00000545626.1_Silent_p.P144P	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1	0	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in allele S).|Missing (in clone CP-4).|Missing (in clone CP-5).			extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			CTCCTGCTGGAGGTGGGGGAC	0.637																																					p.P164P													.	PRB1	33		0			c.T492C												40.0	47.0	45.0					12																	11506146		2121	4242	6363	SO:0001819	synonymous_variant	5542	exon4			TGCTGGAGGTGGG		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.492T>C	12.37:g.11506146A>G			Somatic	683	0.0014641288	1		WXS	Illumina HiSeq	Phase_I	1753	0.04	67	NM_199353	0		0	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Silent	SNP	ENST00000500254.2	37	CCDS8642.1																																																																																					0.637	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000402312.1		NM_005039	
WBP11	51729	broad.mit.edu	37	12	14947586	14947586	+	Silent	SNP	A	A	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr12:14947586A>G	ENST00000261167.2	-	7	839	c.606T>C	c.(604-606)ccT>ccC	p.P202P		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	202	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GACCAGGGGGAGGGCCAGGAG	0.512																																					p.P202P													WBP11,right_lower_lobe,carcinoma,0,2	WBP11	66	2	0			c.T606C												100.0	107.0	105.0					12																	14947586		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon7			AGGGGGAGGGCCA	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.606T>C	12.37:g.14947586A>G			Somatic	198	0.0050505051	1		WXS	Illumina HiSeq	Phase_I	481	0.01	7	NM_016312	931	0.00	1	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																					0.512	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400850.1		NM_016312	
BRCA2	675	ucsc.edu;bcgsc.ca	37	13	32920964	32920964	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr13:32920964G>T	ENST00000380152.3	+	13	7171	c.6938G>T	c.(6937-6939)gGc>gTc	p.G2313V	BRCA2_ENST00000544455.1_Splice_Site_p.G2313V			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2313					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGTTTCCTAGGCACAATAAAA	0.279			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.G2313V	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812		0			c.G6938T												75.0	76.0	76.0					13																	32920964		2202	4292	6494	SO:0001630	splice_region_variant	675	exon13	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	TCCTAGGCACAAT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.6938-1G>T	13.37:g.32920964G>T			Somatic	65	0	0		WXS	Illumina HiSeq		35	0.11	4	NM_000059	3	0.00	0	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463893	0.63513	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.92048	-2.96;-2.96	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	D	0.95548	0.8553	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95315	0.8415	9	.	.	.	.	13.8597	0.63552	0.0:0.0:1.0:0.0	.	2313	P51587	BRCA2_HUMAN	V	2313	ENSP00000369497:G2313V;ENSP00000439902:G2313V	.	G	+	2	0	BRCA2	31818964	1.000000	0.71417	0.985000	0.45067	0.681000	0.39784	4.882000	0.63121	2.330000	0.79161	0.650000	0.86243	GGC			0.279	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046000.2		NM_000059	Missense_Mutation
ACIN1	22985	ucsc.edu	37	14	23548787	23548787	+	Missense_Mutation	SNP	C	C	T	rs55838227|rs34870944|rs61741619	byFrequency	TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr14:23548787C>T	ENST00000262710.1	-	6	2258	c.1931G>A	c.(1930-1932)cGt>cAt	p.R644H	ACIN1_ENST00000605057.1_Missense_Mutation_p.R586H|ACIN1_ENST00000457657.1_Missense_Mutation_p.R604H|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.R644H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	644	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S643_R644insHS(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TGAACGAGAACGTGAACGTGA	0.488																																					p.R644H													.	ACIN1	147		1	Insertion - In frame(1)	upper_aerodigestive_tract(1)	c.G1931A												255.0	224.0	235.0					14																	23548787		2203	4300	6503	SO:0001583	missense	22985	exon6			CGAGAACGTGAAC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1931G>A	14.37:g.23548787C>T	ENSP00000262710:p.Arg644His		Somatic	121	0	0		WXS	Illumina HiSeq		121	0.12	15	NM_001164814	77	0.13	10	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061864	0.76187	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.30448	2.29;1.53;2.29	5.46	5.46	0.80206	.	0.000000	0.41001	D	0.000979	T	0.42720	0.1215	L	0.27053	0.805	0.36352	D	0.86012	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.984;0.984	T	0.50808	-0.8784	10	0.59425	D	0.04	-1.7144	14.8141	0.70017	0.0:1.0:0.0:0.0	.	644;644;604	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	644;604;644	ENSP00000262710:R644H;ENSP00000405677:R604H;ENSP00000451328:R644H	ENSP00000262710:R644H	R	-	2	0	ACIN1	22618627	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	1.398000	0.34554	2.556000	0.86216	0.655000	0.94253	CGT			0.488	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000071707.3		NM_014977	
CD276	80381	mdanderson.org	37	15	74000799	74000799	+	Nonsense_Mutation	SNP	G	G	T	rs556281946		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr15:74000799G>T	ENST00000318443.5	+	7	1791	c.1489G>T	c.(1489-1491)Gag>Tag	p.E497*	CD276_ENST00000318424.5_Nonsense_Mutation_p.E279*|CD276_ENST00000561213.1_Nonsense_Mutation_p.E497*|CD276_ENST00000564751.1_Nonsense_Mutation_p.E279*|CD276_ENST00000537340.2_Nonsense_Mutation_p.E351*	NM_001024736.1	NP_001019907.1	Q5ZPR3	CD276_HUMAN	CD276 molecule	497					cell proliferation (GO:0008283)|immune response (GO:0006955)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of bone mineralization (GO:0030501)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			endometrium(3)|lung(5)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	13						ACAGAGCTGTGAGGAGGAGAA	0.537																																					p.E497X													.	.			0			c.G1489T												138.0	105.0	116.0					15																	74000799		2198	4297	6495	SO:0001587	stop_gained	80381	exon7			AGCTGTGAGGAGG	AF302102	CCDS10251.1, CCDS32288.1	15q23-q24	2013-01-11	2006-03-28		ENSG00000103855	ENSG00000103855		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19137	protein-coding gene	gene with protein product		605715	"""CD276 antigen"""			11224528, 12055244	Standard	XM_005254699		Approved	B7-H3, B7H3, B7RP-2	uc002avv.1	Q5ZPR3	OTTHUMG00000137585	ENST00000318443.5:c.1489G>T	15.37:g.74000799G>T	ENSP00000320084:p.Glu497*		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001024736	141	0.00	0	Q6P5Y4|Q6UXI2|Q8NBI8|Q8NC34|Q8NCB6|Q9BXR1	Nonsense_Mutation	SNP	ENST00000318443.5	37	CCDS32288.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.400484|4.400484	0.83120|0.83120	.|.	.|.	ENSG00000103855|ENSG00000103855	ENST00000318424;ENST00000318443;ENST00000537340|ENST00000543481	.|.	.|.	.|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.09338|.	T|.	0.73|.	-17.6058|-17.6058	12.4112|12.4112	0.55468|0.55468	0.082:0.0:0.918:0.0|0.082:0.0:0.918:0.0	.|.	.|.	.|.	.|.	X|L	279;497;351|141	.|.	ENSP00000320058:E279X|.	E|X	+|+	1|2	0|2	CD276|CD276	71787852|71787852	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	3.716000|3.716000	0.54904|0.54904	2.292000|2.292000	0.77174|0.77174	0.557000|0.557000	0.71058|0.71058	GAG|TGA			0.537	CD276-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268979.1		NM_025240	
C15orf40	123207	mdanderson.org	37	15	83677284	83677284	+	Intron	SNP	A	A	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr15:83677284A>G	ENST00000513601.2	-	3	374				RP11-382A20.5_ENST00000566841.1_RNA|C15orf40_ENST00000304177.5_Intron|C15orf40_ENST00000538348.2_Intron|C15orf40_ENST00000451195.3_Intron|C15orf40_ENST00000565712.1_Intron			Q8WUR7	CO040_HUMAN	chromosome 15 open reading frame 40											large_intestine(3)|lung(2)|skin(1)	6						aaaaaaaaaaaGAGAGCGAGA	0.483																																					p.F128L													.	.			0			c.T382C												46.0	44.0	45.0					15																	83677284		2203	4300	6503	SO:0001627	intron_variant	123207	exon3			AAAAAAAGAGAGC	BC019820	CCDS32312.1, CCDS32312.2, CCDS53968.1, CCDS53969.1	15q25.2	2012-05-30			ENSG00000169609	ENSG00000169609			28443	protein-coding gene	gene with protein product							Standard	NM_144597		Approved	MGC29937	uc010uoo.1	Q8WUR7	OTTHUMG00000160473	ENST00000513601.2:c.366+15T>C	15.37:g.83677284A>G			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001160113	1	0.00	0	A6NIC9|B2R5E7|F5GX92|F8WD31|G5EA00	Missense_Mutation	SNP	ENST00000513601.2	37	CCDS32312.2																																																																																					0.483	C15orf40-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000360737.2		NM_144597	
WASH4P	374677	ucsc.edu	37	16	67386	67386	+	Silent	SNP	T	T	C	rs62031401		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:67386T>C	ENST00000326592.9	-	4	1147	c.489A>G	c.(487-489)ccA>ccG	p.P163P	Z84812.4_ENST00000568710.1_RNA			A8MWX3	WASH4_HUMAN	WAS protein family homolog 4 pseudogene	163	WHD1.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CCTCGGGCTCTGGCTTGGTGC	0.567											OREG0003691	type=REGULATORY REGION|Gene=BC063682|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									.													.	.			0			.																																									SO:0001819	synonymous_variant	374677	.			GGGCTCTGGCTTG			16p13.3	2014-08-28	2008-01-16	2008-01-16	ENSG00000234769	ENSG00000234769		"""WAS protein homologs"""	14126	other	unknown			"""family with sequence similarity 39, member C pseudogene"""	FAM39CP		9054936, 11701968, 18159949	Standard	NG_003159		Approved	FLJ31670		A8MWX3	OTTHUMG00000059914	ENST00000326592.9:c.489A>G	16.37:g.67386T>C			Somatic	11	0.0909090909	1	585	WXS	Illumina HiSeq		26	0.46	12	.	0		0		Silent	SNP	ENST00000326592.9	37																																																																																						0.567	WASH4P-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000133175.2		NG_003159	
TMEM8A	58986	mdanderson.org	37	16	422655	422655	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:422655G>T	ENST00000431232.2	-	12	2135	c.1975C>A	c.(1975-1977)Ctg>Atg	p.L659M	MRPL28_ENST00000389675.2_5'Flank|MRPL28_ENST00000199706.8_5'Flank|TMEM8A_ENST00000250930.3_Missense_Mutation_p.L466M|MRPL28_ENST00000429738.1_5'Flank	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	659					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						CAGGGCCCCAGCATGTTCCAC	0.617																																					p.L659M													.	.			0			c.C1975A												114.0	100.0	105.0					16																	422655		2202	4300	6502	SO:0001583	missense	58986	exon12			GCCCCAGCATGTT	AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.1975C>A	16.37:g.422655G>T	ENSP00000401338:p.Leu659Met		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_021259	201	0.00	0	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Missense_Mutation	SNP	ENST00000431232.2	37	CCDS10407.1	.	.	.	.	.	.	.	.	.	.	G	9.756	1.168789	0.21621	.	.	ENSG00000129925	ENST00000431232;ENST00000250930;ENST00000448854	T;T;T	0.47869	0.83;0.83;0.83	3.97	0.143	0.14820	.	0.361485	0.25935	N	0.027348	T	0.29749	0.0743	L	0.28649	0.875	0.37095	D	0.89963	B	0.33919	0.432	B	0.33121	0.158	T	0.12372	-1.0550	10	0.23302	T	0.38	-4.7789	8.9161	0.35583	0.1289:0.0:0.5653:0.3058	.	659	Q9HCN3	TMM8A_HUMAN	M	659;466;207	ENSP00000401338:L659M;ENSP00000250930:L466M;ENSP00000401931:L207M	ENSP00000250930:L466M	L	-	1	2	TMEM8A	362656	0.579000	0.26725	0.221000	0.23827	0.942000	0.58702	-0.167000	0.09940	-0.170000	0.10816	-0.538000	0.04264	CTG			0.617	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000109257.2		NM_021259	
CCDC78	124093	mdanderson.org	37	16	776359	776359	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:776359G>T	ENST00000293889.6	-	1	114	c.9C>A	c.(7-9)caC>caA	p.H3Q	HAGHL_ENST00000564545.1_5'Flank|HAGHL_ENST00000341413.4_5'Flank|HAGHL_ENST00000561546.1_5'Flank|HAGHL_ENST00000389703.3_5'Flank|HAGHL_ENST00000564537.1_5'Flank|HAGHL_ENST00000549114.1_5'Flank	NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	3					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				TGGTGGCTGCGTGCTCCATAG	0.677																																					p.H3Q													.	.			0			c.C9A												12.0	10.0	10.0					16																	776359		1768	3274	5042	SO:0001583	missense	124093	exon1			GGCTGCGTGCTCC	BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.9C>A	16.37:g.776359G>T	ENSP00000293889:p.His3Gln		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_001031737	5	0.00	0	B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Missense_Mutation	SNP	ENST00000293889.6	37	CCDS32353.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.445644	0.25987	.	.	ENSG00000162004	ENST00000293889	T	0.42513	0.97	2.88	-5.75	0.02384	.	5.049580	0.00541	N	0.000232	T	0.27205	0.0667	L	0.44542	1.39	0.09310	N	1	P;P;P;P;P	0.43287	0.704;0.704;0.802;0.704;0.586	B;B;B;B;B	0.35073	0.195;0.195;0.195;0.195;0.092	T	0.32771	-0.9894	10	0.62326	D	0.03	18.2515	0.8347	0.01137	0.1962:0.1385:0.2188:0.4465	.	3;3;3;3;3	A2IDD5-4;A2IDD5-6;A2IDD5-3;A2IDD5-5;A2IDD5	.;.;.;.;CCD78_HUMAN	Q	3	ENSP00000293889:H3Q	ENSP00000293889:H3Q	H	-	3	2	CCDC78	716360	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-2.104000	0.01340	-1.955000	0.01023	-0.658000	0.03865	CAC			0.677	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241665.3		NM_173476	
CACNA1H	8912	mdanderson.org	37	16	1273502	1273502	+	IGR	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:1273502G>T	ENST00000348261.5	+	0	8084				TPSG1_ENST00000234798.4_Missense_Mutation_p.R56S	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit						aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CTCCGCAGGCGGAGGCTGGCC	0.726																																					p.R56S													TPSG1,colon,carcinoma,+1,1	TPSG1	1	1	0			c.C166A												6.0	7.0	7.0					16																	1273502		2031	4085	6116	SO:0001628	intergenic_variant	25823	exon3			GCAGGCGGAGGCT	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180			16.37:g.1273502G>T			Somatic	28	0.0357142857	1		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_012467	19	0.00	0	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	g	12.74	2.028603	0.35797	.	.	ENSG00000116176	ENST00000234798	D	0.87334	-2.24	2.76	-0.867	0.10655	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.77478	0.4136	L	0.43152	1.355	0.28931	N	0.891584	P	0.42203	0.773	B	0.37267	0.245	T	0.67745	-0.5591	9	0.40728	T	0.16	.	4.4904	0.11810	0.2059:0.0:0.6158:0.1784	.	56	Q9NRR2	TRYG1_HUMAN	S	56	ENSP00000234798:R56S	ENSP00000234798:R56S	R	-	1	0	TPSG1	1213503	0.001000	0.12720	0.246000	0.24233	0.700000	0.40528	1.083000	0.30815	-0.314000	0.08716	0.486000	0.48141	CGC			0.726	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000421601.1		NM_001005407	
TELO2	9894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1544544	1544544	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:1544544G>T	ENST00000262319.6	+	2	541	c.262G>T	c.(262-264)Gcc>Tcc	p.A88S		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	88					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GGAGCTGTGGGCCAGCTTCTT	0.677											OREG0023547	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A88S													.	.			0			c.G262T												35.0	38.0	37.0					16																	1544544		2199	4300	6499	SO:0001583	missense	9894	exon2			CTGTGGGCCAGCT	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.262G>T	16.37:g.1544544G>T	ENSP00000262319:p.Ala88Ser		Somatic	47	0	0	596	WXS	Illumina HiSeq	.	50	0.52	26	NM_016111	86	0.48	41	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343908	0.24339	.	.	ENSG00000100726	ENST00000262319	D	0.83914	-1.78	4.69	2.61	0.31194	.	0.449907	0.22047	N	0.065364	T	0.76428	0.3986	L	0.57536	1.79	0.23254	N	0.998037	B	0.31026	0.304	B	0.24269	0.052	T	0.59648	-0.7415	10	0.21014	T	0.42	-0.9163	12.4264	0.55548	0.0:0.3253:0.6747:0.0	.	88	Q9Y4R8	TELO2_HUMAN	S	88	ENSP00000262319:A88S	ENSP00000262319:A88S	A	+	1	0	TELO2	1484545	1.000000	0.71417	0.483000	0.27378	0.948000	0.59901	3.538000	0.53597	0.352000	0.24053	0.561000	0.74099	GCC			0.677	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103602.2		NM_016111	
ABCC6	368	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	16297454	16297454	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:16297454C>G	ENST00000205557.7	-	8	840	c.811G>C	c.(811-813)Gca>Cca	p.A271P	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	271					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CTTTTAAATGCTATTGCCTTG	0.562																																					p.A271P													.	.			0			c.G811C												47.0	46.0	47.0					16																	16297454		2197	4300	6497	SO:0001583	missense	368	exon8			TAAATGCTATTGC	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.811G>C	16.37:g.16297454C>G	ENSP00000205557:p.Ala271Pro		Somatic	207	0	0		WXS	Illumina HiSeq	.	141	0.40	57	NM_001171	0		0	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	.	4.997	0.185151	0.09495	.	.	ENSG00000091262	ENST00000205557;ENST00000456970;ENST00000546056	D;D	0.87256	-2.23;-2.23	2.54	1.56	0.23342	.	3.997670	0.01114	N	0.005646	T	0.80675	0.4668	L	0.29908	0.895	0.09310	N	0.999991	B;B	0.30281	0.002;0.275	B;B	0.28139	0.002;0.086	T	0.65582	-0.6133	10	0.35671	T	0.21	.	6.345	0.21345	0.0:0.8423:0.0:0.1577	.	283;271	F5GWQ0;O95255	.;MRP6_HUMAN	P	271;271;283	ENSP00000205557:A271P;ENSP00000405002:A271P	ENSP00000205557:A271P	A	-	1	0	ABCC6	16204955	0.001000	0.12720	0.000000	0.03702	0.036000	0.12997	0.378000	0.20569	0.175000	0.19841	-1.206000	0.01644	GCA			0.562	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252232.2			
IL21R	50615	broad.mit.edu;mdanderson.org	37	16	27456040	27456040	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:27456040G>T	ENST00000337929.3	+	6	1158	c.685G>T	c.(685-687)Gag>Tag	p.E229*	IL21R_ENST00000564089.1_Splice_Site_p.E229*|IL21R_ENST00000564583.1_3'UTR|IL21R_ENST00000395755.1_Splice_Site_p.E229*|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395754.4_Splice_Site_p.E229*	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	229					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CCAGTCAGAGGGTAGGTGTGA	0.577			T	BCL6	NHL																																p.E251X				Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	95		0			c.G751T												56.0	53.0	54.0					16																	27456040		2197	4300	6497	SO:0001630	splice_region_variant	50615	exon7			TCAGAGGGTAGGT	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.685+1G>T	16.37:g.27456040G>T			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	48	0.08	4	NM_181079	2	0.00	0	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Splice_Site	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370516	0.82573	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	.	.	.	4.3	4.3	0.51218	.	0.780759	0.11260	N	0.582668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-13.6871	12.2813	0.54765	0.0:0.0:1.0:0.0	.	.	.	.	X	229	.	ENSP00000338010:E229X	E	+	1	0	IL21R	27363541	1.000000	0.71417	0.424000	0.26647	0.644000	0.38419	3.591000	0.53986	1.936000	0.56123	0.561000	0.74099	GAG			0.577	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254578.2		NM_181078	Nonsense_Mutation
CHST6	4166	mdanderson.org	37	16	75513051	75513051	+	Silent	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr16:75513051G>A	ENST00000332272.4	-	3	855	c.676C>T	c.(676-678)Ctg>Ttg	p.L226L	RP11-77K12.4_ENST00000530512.3_RNA|CHST6_ENST00000390664.2_Silent_p.L226L	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	226					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TTGGTGCCCAGCACGATGCCG	0.711																																					p.L226L													.	.			0			c.C676T												20.0	22.0	21.0					16																	75513051		2193	4273	6466	SO:0001819	synonymous_variant	4166	exon3			TGCCCAGCACGAT	AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.676C>T	16.37:g.75513051G>A			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_021615	0		0	D3DUK3	Silent	SNP	ENST00000332272.4	37	CCDS10918.1																																																																																					0.711	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435478.1		NM_021615	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		Somatic	236	0.0677966102	16		RNA-Seq	Illumina HiSeq		276	0.08	21	NM_145301	21	0.43	9	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
NBR1	4077	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41345207	41345207	+	Silent	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr17:41345207C>T	ENST00000422280.1	+	11	1629	c.1170C>T	c.(1168-1170)acC>acT	p.T390T	NBR1_ENST00000341165.6_Silent_p.T390T|NBR1_ENST00000589872.1_Silent_p.T390T|NBR1_ENST00000542611.1_Silent_p.T369T|NBR1_ENST00000389312.4_Silent_p.T390T|NBR1_ENST00000590996.1_Silent_p.T390T	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	390					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		AGCCAGGAACCAAGTTTATCA	0.443																																					p.T390T													.	NBR1	55		0			c.C1170T												77.0	71.0	73.0					17																	41345207		1902	4126	6028	SO:0001819	synonymous_variant	4077	exon11			AGGAACCAAGTTT	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1170C>T	17.37:g.41345207C>T			Somatic	98	0.0102040816	1		WXS	Illumina HiSeq	Phase_I	122	0.27	33	NM_031862	54	0.26	14	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Silent	SNP	ENST00000422280.1	37	CCDS45694.1																																																																																					0.443	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000453461.1		NM_005899	
NPC1	4864	mdanderson.org	37	18	21136215	21136215	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr18:21136215G>T	ENST00000269228.5	-	8	1872	c.1318C>A	c.(1318-1320)Ctg>Atg	p.L440M	NPC1_ENST00000412552.2_Missense_Mutation_p.L190M|NPC1_ENST00000540608.1_5'UTR	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	440					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ACCTGGTGCAGTATCTGTATG	0.493																																					p.L440M													.	.			0			c.C1318A												117.0	109.0	112.0					18																	21136215		2203	4300	6503	SO:0001583	missense	4864	exon8			GGTGCAGTATCTG	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.1318C>A	18.37:g.21136215G>T	ENSP00000269228:p.Leu440Met		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_000271	32	0.00	0	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947459	0.53186	.	.	ENSG00000141458	ENST00000269228;ENST00000412552;ENST00000540608	D;D	0.94417	-3.42;-3.42	5.53	-3.92	0.04155	.	0.000000	0.85682	D	0.000000	D	0.96349	0.8809	M	0.83774	2.66	0.27264	N	0.958553	D;D	0.65815	0.978;0.995	P;D	0.66847	0.881;0.947	D	0.93580	0.6912	10	0.72032	D	0.01	-23.6309	15.768	0.78143	0.3537:0.0:0.6463:0.0	.	451;440	Q59GR1;O15118	.;NPC1_HUMAN	M	440;190;285	ENSP00000269228:L440M;ENSP00000408606:L190M	ENSP00000269228:L440M	L	-	1	2	NPC1	19390213	0.949000	0.32298	0.046000	0.18839	0.818000	0.46254	0.595000	0.24029	-0.623000	0.05618	-0.238000	0.12139	CTG			0.493	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254823.2		NM_000271	
C19orf26	255057	mdanderson.org	37	19	1236043	1236043	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr19:1236043G>T	ENST00000382477.2	-	2	313	c.39C>A	c.(37-39)gcC>gcA	p.A13A	AC004221.2_ENST00000592843.1_lincRNA|C19orf26_ENST00000215376.6_Silent_p.A13A|C19orf26_ENST00000590083.1_Silent_p.A19A			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26	13	Thr-rich.					integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCTACTgtggcagtggtgg	0.677										HNSCC(14;0.022)																											p.A19A													.	.			0			c.C57A												36.0	25.0	29.0					19																	1236043		2197	4293	6490	SO:0001819	synonymous_variant	255057	exon2			TACTGTGGCAGTG	BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.39C>A	19.37:g.1236043G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_152769	18	0.00	0	O43385	Silent	SNP	ENST00000382477.2	37																																																																																						0.677	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_152769	
SIRT6	51548	mdanderson.org	37	19	4174679	4174679	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr19:4174679G>A	ENST00000337491.2	-	8	1067	c.1003C>T	c.(1003-1005)Cgg>Tgg	p.R335W	SIRT6_ENST00000381935.3_Missense_Mutation_p.R263W|SIRT6_ENST00000601488.1_3'UTR|SIRT6_ENST00000594279.1_3'UTR|SIRT6_ENST00000305232.6_Missense_Mutation_p.R308W	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	335	Pro-rich.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGTGGGCCGCTCCCGTTTG	0.687																																					p.R335W													.	.			0			c.C1003T												3.0	4.0	4.0					19																	4174679		1994	3945	5939	SO:0001583	missense	51548	exon8			TGGGCCGCTCCCG	AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.1003C>T	19.37:g.4174679G>A	ENSP00000337332:p.Arg335Trp		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_016539	115	0.00	0	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Missense_Mutation	SNP	ENST00000337491.2	37	CCDS12122.1	.	.	.	.	.	.	.	.	.	.	G	9.471	1.095527	0.20471	.	.	ENSG00000077463	ENST00000337491;ENST00000305232;ENST00000381935	T;T;T	0.33438	1.84;1.83;1.41	3.75	-0.0758	0.13725	.	1.589830	0.03922	N	0.283739	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.26224	-1.0109	10	0.72032	D	0.01	-0.6034	0.3181	0.00298	0.261:0.1696:0.3268:0.2425	.	308;335	Q8N6T7-2;Q8N6T7	.;SIRT6_HUMAN	W	335;308;263	ENSP00000337332:R335W;ENSP00000305310:R308W;ENSP00000371360:R263W	ENSP00000305310:R308W	R	-	1	2	SIRT6	4125679	0.000000	0.05858	0.002000	0.10522	0.623000	0.37688	-0.194000	0.09559	-0.146000	0.11274	0.462000	0.41574	CGG			0.687	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457931.2			
CTC-260E6.6	0	broad.mit.edu	37	19	20242379	20242380	+	RNA	INS	-	-	T	rs112605508|rs78414131|rs373507394|rs76101235|rs71172568		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr19:20242379_20242380insT	ENST00000590606.1	-	0	315				CTC-260E6.6_ENST00000593655.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA																							TCAttttcttcttttttttttt	0.396																																					.													.	.			0			.																																											0	.			TTTCTTCTTTTTT																													19.37:g.20242390_20242390dupT			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	3	0.00	0		RNA	INS	ENST00000590606.1	37																																																																																						0.396	CTC-260E6.6-005	KNOWN	basic	antisense	antisense		OTTHUMT00000452859.1			
FCGBP	8857	mdanderson.org	37	19	40421236	40421236	+	Silent	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr19:40421236G>A	ENST00000221347.6	-	5	2692	c.2685C>T	c.(2683-2685)ggC>ggT	p.G895G		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	895	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTGCGTTCTGGCCGCATGAGC	0.687																																					p.G895G													.	.			0			c.C2685T												28.0	28.0	28.0					19																	40421236		2202	4298	6500	SO:0001819	synonymous_variant	8857	exon5			GTTCTGGCCGCAT	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2685C>T	19.37:g.40421236G>A			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_003890	0		0	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																					0.687	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462507.1		NM_003890	
RTN2	6253	mdanderson.org	37	19	45997951	45997951	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr19:45997951G>T	ENST00000245923.4	-	3	627	c.392C>A	c.(391-393)cCt>cAt	p.P131H	RTN2_ENST00000344680.4_Missense_Mutation_p.P131H|PPM1N_ENST00000456399.2_5'Flank|PPM1N_ENST00000396737.2_5'Flank|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000589384.1_5'UTR|RTN2_ENST00000430715.2_5'Flank|RTN2_ENST00000590526.1_5'UTR	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	131					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		CTCGGATGGAGGCGCGGTGTC	0.682																																					p.P131H													.	.			0			c.C392A												48.0	55.0	52.0					19																	45997951		2203	4300	6503	SO:0001583	missense	6253	exon3			GATGGAGGCGCGG	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.392C>A	19.37:g.45997951G>T	ENSP00000245923:p.Pro131His		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_206900	49	0.00	0	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	CCDS12665.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186883	0.38609	.	.	ENSG00000125744	ENST00000344680;ENST00000245923	T;T	0.56611	0.59;0.45	5.58	5.58	0.84498	.	0.413227	0.20865	N	0.084266	T	0.57784	0.2077	L	0.29908	0.895	0.42120	D	0.991421	D;D	0.76494	0.997;0.999	P;P	0.61328	0.789;0.887	T	0.53592	-0.8417	10	0.33141	T	0.24	-3.3425	15.0563	0.71915	0.0:0.0:1.0:0.0	.	131;131	O75298-2;O75298	.;RTN2_HUMAN	H	131	ENSP00000345127:P131H;ENSP00000245923:P131H	ENSP00000245923:P131H	P	-	2	0	RTN2	50689791	0.995000	0.38212	0.126000	0.21872	0.018000	0.09664	2.093000	0.41710	2.630000	0.89119	0.563000	0.77884	CCT			0.682	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000459574.1		NM_005619	
C2orf50	130813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	11273603	11273603	+	Missense_Mutation	SNP	C	C	A	rs529991308		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr2:11273603C>A	ENST00000381585.3	+	1	425	c.143C>A	c.(142-144)gCc>gAc	p.A48D	C2orf50_ENST00000405022.3_Missense_Mutation_p.A48D|AC062028.1_ENST00000396164.1_lincRNA			Q96LR7	CB050_HUMAN	chromosome 2 open reading frame 50	48										breast(1)|large_intestine(1)|upper_aerodigestive_tract(1)	3	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0997)|OV - Ovarian serous cystadenocarcinoma(76;0.134)		GGCTGCCAGGCCCCCCAGGCT	0.731													C|||	1	0.000199681	0.0	0.0	5008	,	,		14306	0.0		0.001	False		,,,				2504	0.0				p.A48D													.	.			0			c.C143A																																									SO:0001583	missense	130813	exon1			GCCAGGCCCCCCA	AK057872	CCDS1678.1	2p25.1	2012-08-02			ENSG00000150873	ENSG00000150873			26324	protein-coding gene	gene with protein product						12477932	Standard	NM_182500		Approved	FLJ25143	uc010yjj.1	Q96LR7	OTTHUMG00000119057	ENST00000381585.3:c.143C>A	2.37:g.11273603C>A	ENSP00000370997:p.Ala48Asp		Somatic	38	0	0		WXS	Illumina HiSeq	.	37	0.38	14	NM_182500	6	0.50	3	A8K9W3|D6W503	Missense_Mutation	SNP	ENST00000381585.3	37	CCDS1678.1	.	.	.	.	.	.	.	.	.	.	C	8.586	0.883399	0.17467	.	.	ENSG00000150873	ENST00000381585;ENST00000405022	.	.	.	3.41	-2.28	0.06826	.	1.520670	0.04096	N	0.312114	T	0.35128	0.0921	L	0.50333	1.59	0.09310	N	1	B	0.24317	0.101	B	0.22386	0.039	T	0.35475	-0.9787	9	0.48119	T	0.1	5.6444	5.297	0.15758	0.2919:0.4056:0.3024:0.0	.	48	Q96LR7	CB050_HUMAN	D	48	.	ENSP00000370997:A48D	A	+	2	0	C2orf50	11191054	0.000000	0.05858	0.002000	0.10522	0.112000	0.19704	0.008000	0.13197	-0.059000	0.13154	0.472000	0.43445	GCC			0.731	C2orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239268.1		NM_182500	
DNMT3A	1788	mdanderson.org	37	2	25523020	25523020	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr2:25523020G>T	ENST00000264709.3	-	3	502	c.165C>A	c.(163-165)cgC>cgA	p.R55R	DNMT3A_ENST00000321117.5_Silent_p.R55R|DNMT3A_ENST00000406659.3_Silent_p.R55R	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	55					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGGTGCTTGCGCTTCCTCC	0.652			"""Mis, F, N, S"""		AML																																p.R55R				Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	.			0			c.C165A												92.0	72.0	79.0					2																	25523020		2203	4300	6503	SO:0001819	synonymous_variant	1788	exon3			GTGCTTGCGCTTC		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.165C>A	2.37:g.25523020G>T			Somatic	27	0.037037037	1		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_175630	45	0.00	0	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	37	CCDS33157.1																																																																																					0.652	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000211587.1		NM_022552	
SLC8A1	6546	broad.mit.edu;mdanderson.org	37	2	40342735	40342735	+	Missense_Mutation	SNP	G	G	T	rs564442817		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr2:40342735G>T	ENST00000403092.1	-	11	2613	c.2580C>A	c.(2578-2580)gaC>gaA	p.D860E	SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1_ENST00000408028.2_Missense_Mutation_p.D852E|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.D855E|SLC8A1_ENST00000406785.2_Missense_Mutation_p.D824E|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1_ENST00000332839.4_Missense_Mutation_p.D860E|SLC8A1_ENST00000406391.2_Missense_Mutation_p.D824E|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1_ENST00000405269.1_Missense_Mutation_p.D824E|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000542024.1_Missense_Mutation_p.D824E|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.D855E|SLC8A1_ENST00000402441.1_Missense_Mutation_p.D824E			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	860					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CTGCATACTGGTCCTGGGTGG	0.532																																					p.D860E													.	SLC8A1	221		0			c.C2580A												73.0	73.0	73.0					2																	40342735		2203	4300	6503	SO:0001583	missense	6546	exon10			ATACTGGTCCTGG		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2580C>A	2.37:g.40342735G>T	ENSP00000384763:p.Asp860Glu		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	29	0.41	12	NM_021097	1	0.00	0	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429343	0.62844	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	6.07	5.19	0.71726	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.79399	0.4439	M	0.81497	2.545	0.58432	D	0.999999	D;D;D;D	0.89917	0.99;1.0;1.0;1.0	D;D;D;D	0.97110	0.978;0.998;0.989;1.0	T	0.82402	-0.0475	10	0.87932	D	0	.	13.3147	0.60401	0.0761:0.0:0.9239:0.0	.	824;847;855;860	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	E	824;860;855;860;855;824;824;860;852;847;824;824	ENSP00000383886:D824E;ENSP00000440727:D855E;ENSP00000384763:D860E;ENSP00000385678:D855E;ENSP00000385188:D824E;ENSP00000385535:D824E;ENSP00000332931:D860E;ENSP00000384908:D852E;ENSP00000385811:D824E;ENSP00000443515:D824E	ENSP00000332931:D860E	D	-	3	2	SLC8A1	40196239	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.059000	0.41384	1.577000	0.49804	0.655000	0.94253	GAC			0.532	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000326065.1		NM_021097	
NT5DC4	284958	broad.mit.edu;mdanderson.org	37	2	113479811	113479811	+	Silent	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr2:113479811C>T	ENST00000327581.4	+	4	306	c.255C>T	c.(253-255)caC>caT	p.H85H				Q86YG4	NT5D4_HUMAN	5'-nucleotidase domain containing 4	85							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)										TGGACGCCCACGGGAATGTGC	0.647																																					.													.	.			0			.																																									SO:0001819	synonymous_variant	284958	.			CGCCCACGGGAAT	BC041437		2q13	2012-04-20			ENSG00000144130	ENSG00000144130			27678	protein-coding gene	gene with protein product							Standard	XM_001716359		Approved		uc002tid.3	Q86YG4	OTTHUMG00000153308	ENST00000327581.4:c.255C>T	2.37:g.113479811C>T			Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	62	0.06	4	.	0		0		Silent	SNP	ENST00000327581.4	37																																																																																						0.647	NT5DC4-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000330647.1		XM_001716541	
THBD	7056	mdanderson.org	37	20	23028534	23028534	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr20:23028534G>T	ENST00000377103.2	-	1	1844	c.1608C>A	c.(1606-1608)ctC>ctA	p.L536L		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	536					blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	GCAGGTGGCAGAGGAGCGCCA	0.662																																					p.L536L													.	.			0			c.C1608A												21.0	23.0	23.0					20																	23028534		2198	4297	6495	SO:0001819	synonymous_variant	7056	exon1			GTGGCAGAGGAGC		CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1608C>A	20.37:g.23028534G>T			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_000361	1	0.00	0	Q8IV29|Q9UC32	Silent	SNP	ENST00000377103.2	37	CCDS13148.1																																																																																					0.662	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078307.2			
FRG1B	284802	bcgsc.ca	37	20	29628233	29628233	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr20:29628233A>G	ENST00000278882.3	+	6	615	c.235A>G	c.(235-237)Atg>Gtg	p.M79V	FRG1B_ENST00000439954.2_Missense_Mutation_p.M84V|FRG1B_ENST00000358464.4_Missense_Mutation_p.M79V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	79										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTAGGGGAAAATGGCTTTGTT	0.363																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	284802	.			GGGAAAATGGCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.235A>G	20.37:g.29628233A>G	ENSP00000278882:p.Met79Val		Somatic	463	0.0064794816	3		WXS	Illumina HiSeq	Phase_1	393	0.03	13	.	88	0.00	0	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	3.138	-0.176853	0.06380	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.41065	1.01	2.08	2.08	0.27032	Actin cross-linking (1);	0.040228	0.85682	D	0.000000	T	0.23370	0.0565	.	.	.	0.41063	D	0.985397	B;B	0.17852	0.002;0.024	B;B	0.25140	0.03;0.058	T	0.04593	-1.0940	9	0.11794	T	0.64	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	84;79	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	79;84;79	ENSP00000408863:M84V	ENSP00000278882:M79V	M	+	1	0	FRG1B	28241894	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	4.813000	0.62620	1.208000	0.43306	0.347000	0.21830	ATG			0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
ERGIC3	51614	mdanderson.org	37	20	34136278	34136278	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr20:34136278G>T	ENST00000348547.2	+	6	555	c.478G>T	c.(478-480)Gaa>Taa	p.E160*	ERGIC3_ENST00000447986.1_Nonsense_Mutation_p.E160*|ERGIC3_ENST00000279052.6_Nonsense_Mutation_p.E160*|ERGIC3_ENST00000482338.1_3'UTR|ERGIC3_ENST00000357394.4_Nonsense_Mutation_p.E160*	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	160					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TAACACCTGTGAAGATGTGCG	0.562																																					p.E160X													.	.			0			c.G478T												63.0	61.0	62.0					20																	34136278		2203	4300	6503	SO:0001587	stop_gained	51614	exon6			ACCTGTGAAGATG	AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.478G>T	20.37:g.34136278G>T	ENSP00000341358:p.Glu160*		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	85	0.06	5	NM_015966	731	0.00	0	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Nonsense_Mutation	SNP	ENST00000348547.2	37	CCDS13257.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	24.6|24.6	4.551403|4.551403	0.86127|0.86127	.|.	.|.	ENSG00000125991|ENSG00000125991	ENST00000348547;ENST00000357394;ENST00000447986;ENST00000279052;ENST00000355563|ENST00000413587	.|.	.|.	.|.	4.67|4.67	3.71|3.71	0.42584|0.42584	.|.	0.200385|.	0.50627|.	D|.	0.000106|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.51188|.	T|.	0.08|.	-2.7703|-2.7703	12.4911|12.4911	0.55901|0.55901	0.0821:0.0:0.9178:0.0|0.0821:0.0:0.9178:0.0	.|.	.|.	.|.	.|.	X|L	160;160;160;160;23|161	.|.	ENSP00000279052:E160X|.	E|X	+|+	1|2	0|2	ERGIC3|ERGIC3	33599692|33599692	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	9.738000|9.738000	0.98835|0.98835	0.942000|0.942000	0.37525|0.37525	0.298000|0.298000	0.19748|0.19748	GAA|TGA			0.562	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078880.2		NM_015966	
SGSM1	129049	mdanderson.org	37	22	25255730	25255730	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr22:25255730G>T	ENST00000400359.4	+	9	856	c.849G>T	c.(847-849)acG>acT	p.T283T	SGSM1_ENST00000400358.4_Silent_p.T283T	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	283						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						TGCACCAGACGGCTGACGTCA	0.592																																					p.T283T													.	.			0			c.G849T												98.0	100.0	99.0					22																	25255730		2074	4211	6285	SO:0001819	synonymous_variant	129049	exon9			CCAGACGGCTGAC	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.849G>T	22.37:g.25255730G>T			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001098497	7	0.00	0	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Silent	SNP	ENST00000400359.4	37	CCDS46674.1																																																																																					0.592	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000320282.1		XM_059318	
MN1	4330	broad.mit.edu	37	22	28195494	28195494	+	Silent	SNP	T	T	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr22:28195494T>G	ENST00000302326.4	-	1	1992	c.1038A>C	c.(1036-1038)ccA>ccC	p.P346P		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	346					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgagggggtggcggGGCCT	0.682			T	ETV6	"""AML, meningioma"""																																p.P346P				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	122		0			c.A1038C												1.0	2.0	2.0					22																	28195494		1109	2670	3779	SO:0001819	synonymous_variant	4330	exon1			AGGGGGTGGCGGG	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1038A>C	22.37:g.28195494T>G			Somatic	45	0.2222222222	10		WXS	Illumina HiSeq	Phase_I	63	0.33	21	NM_002430	10	0.00	0	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																					0.682	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
CHADL	150356	mdanderson.org	37	22	41634716	41634716	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr22:41634716G>T	ENST00000216241.9	-	3	412	c.360C>A	c.(358-360)aaC>aaA	p.N120K		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	120	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(1)|skin(1)	4						CACGCAGGTGGTTGGAGGCCA	0.721																																					p.N120K													.	.			0			c.C360A												9.0	15.0	13.0					22																	41634716		684	1586	2270	SO:0001583	missense	150356	exon3			CAGGTGGTTGGAG	BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.360C>A	22.37:g.41634716G>T	ENSP00000216241:p.Asn120Lys		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_138481	0		0	Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Missense_Mutation	SNP	ENST00000216241.9	37	CCDS46715.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.094469|4.094469	0.76870|0.76870	.|.	.|.	ENSG00000100399|ENSG00000100399	ENST00000216241|ENST00000417999	T|.	0.72835|.	-0.69|.	4.9|4.9	2.77|2.77	0.32553|0.32553	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87493|0.87493	0.6191|0.6191	H|H	0.98866|0.98866	4.355|4.355	0.40961|0.40961	D|D	0.98462|0.98462	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	D|D	0.89675|0.89675	0.3886|0.3886	10|5	0.72032|.	D|.	0.01|.	.|.	10.1049|10.1049	0.42528|0.42528	0.229:0.0:0.771:0.0|0.229:0.0:0.771:0.0	.|.	120;120|.	Q6NUI6-2;Q6NUI6|.	.;CHADL_HUMAN|.	K|N	120|118	ENSP00000216241:N120K|.	ENSP00000216241:N120K|.	N|T	-|-	3|2	2|0	CHADL|CHADL	39964662|39964662	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	3.102000|3.102000	0.50291|0.50291	1.069000|1.069000	0.40788|0.40788	0.462000|0.462000	0.41574|0.41574	AAC|ACC			0.721	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320597.1		NM_138481	
CSDC2	27254	mdanderson.org	37	22	41970829	41970829	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr22:41970829A>G	ENST00000306149.7	+	4	936	c.392A>G	c.(391-393)gAg>gGg	p.E131G		NM_014460.3	NP_055275.1	Q9Y534	CSDC2_HUMAN	cold shock domain containing C2, RNA binding	131	CSD.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			prostate(2)|upper_aerodigestive_tract(1)	3						CAGGCCGTGGAGGTGGTGCTC	0.657																																					p.E131G	NSCLC(181;294 2110 12667 14717 31090)												.	.			0			c.A392G												85.0	59.0	68.0					22																	41970829		2201	4300	6501	SO:0001583	missense	27254	exon4			CCGTGGAGGTGGT	AL834417	CCDS14019.1	22q13.2	2006-02-24			ENSG00000172346	ENSG00000172346			30359	protein-coding gene	gene with protein product						8573167, 12767259	Standard	NM_014460		Approved	PIPPin	uc003bak.1	Q9Y534	OTTHUMG00000150967	ENST00000306149.7:c.392A>G	22.37:g.41970829A>G	ENSP00000302485:p.Glu131Gly		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_014460	1	0.00	0	Q8ND37	Missense_Mutation	SNP	ENST00000306149.7	37	CCDS14019.1	.	.	.	.	.	.	.	.	.	.	a	31	5.060206	0.93846	.	.	ENSG00000172346	ENST00000306149	.	.	.	5.02	5.02	0.67125	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);Nucleic acid-binding, OB-fold (1);	0.055850	0.64402	D	0.000001	T	0.69178	0.3082	L	0.55103	1.725	0.80722	D	1	D	0.60575	0.988	P	0.62014	0.897	T	0.72421	-0.4299	9	0.66056	D	0.02	.	14.9178	0.70812	1.0:0.0:0.0:0.0	.	131	Q9Y534	CSDC2_HUMAN	G	131	.	ENSP00000302485:E131G	E	+	2	0	CSDC2	40300775	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.126000	0.94411	2.105000	0.64084	0.529000	0.55759	GAG			0.657	CSDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320689.1		NM_014460	
SRGAP3	9901	mdanderson.org	37	3	9036124	9036124	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr3:9036124G>T	ENST00000383836.3	-	19	2738	c.2311C>A	c.(2311-2313)Ctg>Atg	p.L771M	SRGAP3_ENST00000360413.3_Missense_Mutation_p.L747M	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	771	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TACAGGAGCAGCGAGGCCCCC	0.587			T	RAF1	pilocytic astrocytoma																																p.L771M				Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	.			0			c.C2311A												76.0	76.0	76.0					3																	9036124		2203	4300	6503	SO:0001583	missense	9901	exon19			GGAGCAGCGAGGC	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2311C>A	3.37:g.9036124G>T	ENSP00000373347:p.Leu771Met		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_014850	9	0.00	0	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965218	0.92855	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.57752	0.38;0.38	4.95	4.95	0.65309	Src homology-3 domain (4);	0.000000	0.64402	D	0.000001	T	0.78240	0.4252	M	0.89785	3.06	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.78314	0.986;0.991	D	0.83439	0.0042	10	0.72032	D	0.01	.	18.1343	0.89612	0.0:0.0:1.0:0.0	.	747;771	O43295-2;O43295	.;SRGP2_HUMAN	M	771;747	ENSP00000373347:L771M;ENSP00000353587:L747M	ENSP00000353587:L747M	L	-	1	2	SRGAP3	9011124	1.000000	0.71417	0.941000	0.38009	0.926000	0.56050	6.532000	0.73825	2.433000	0.82419	0.650000	0.86243	CTG			0.587	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207137.3			
ALS2CL	259173	mdanderson.org	37	3	46728533	46728533	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr3:46728533G>T	ENST00000318962.4	-	5	557	c.474C>A	c.(472-474)ctC>ctA	p.L158L	ALS2CL_ENST00000415953.1_Silent_p.L158L	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	158					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CGTGATGGGCGAGTGGCTGGT	0.682																																					p.L158L													.	.			0			c.C474A												46.0	45.0	45.0					3																	46728533		2203	4297	6500	SO:0001819	synonymous_variant	259173	exon5			ATGGGCGAGTGGC	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.474C>A	3.37:g.46728533G>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001190707	16	0.00	0	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Silent	SNP	ENST00000318962.4	37	CCDS2743.1																																																																																					0.682	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250567.3		NM_147129	
KIF9	64147	broad.mit.edu	37	3	47312777	47312777	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr3:47312777A>G	ENST00000265529.3	-	6	1221	c.541T>C	c.(541-543)Tca>Cca	p.S181P	KIF9_ENST00000335044.2_Missense_Mutation_p.S181P|KIF9_ENST00000452770.2_Missense_Mutation_p.S181P|KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000352910.4_Missense_Mutation_p.S88P|KIF9_ENST00000444589.2_Missense_Mutation_p.S181P			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	181	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		AGGTGAACTGACAAGCCCTTA	0.502																																					p.S181P	Colon(44;962 1147 15977 24541)												.	KIF9	59		0			c.T541C												80.0	72.0	74.0					3																	47312777		2203	4300	6503	SO:0001583	missense	64147	exon5			GAACTGACAAGCC	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.541T>C	3.37:g.47312777A>G	ENSP00000265529:p.Ser181Pro		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	89	0.03	3	NM_182902	2	0.00	0	Q86Z28|Q9H8A4	Missense_Mutation	SNP	ENST00000265529.3	37	CCDS2752.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.118714	0.77323	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01	5.33	5.33	0.75918	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.89015	0.6595	M	0.86864	2.845	0.42623	D	0.993353	D;D	0.76494	0.997;0.999	D;D	0.77557	0.976;0.99	D	0.91088	0.4904	10	0.87932	D	0	.	14.3028	0.66364	1.0:0.0:0.0:0.0	.	181;181	Q9HAQ2-2;Q9HAQ2	.;KIF9_HUMAN	P	181;181;181;181;88	ENSP00000333942:S181P;ENSP00000265529:S181P;ENSP00000414987:S181P;ENSP00000391100:S181P;ENSP00000292334:S88P	ENSP00000265529:S181P	S	-	1	0	KIF9	47287781	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.735000	0.55044	2.243000	0.73865	0.529000	0.55759	TCA			0.502	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257475.2			
IQCF3	401067	mdanderson.org	37	3	51864702	51864702	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr3:51864702G>T	ENST00000456080.1	+	8	1515	c.350G>T	c.(349-351)tGc>tTc	p.C117F	IQCF3_ENST00000437810.2_Missense_Mutation_p.C117F|IQCF3_ENST00000462079.1_3'UTR|IQCF3_ENST00000444293.1_Silent_p.L80L|IQCF3_ENST00000446775.1_Missense_Mutation_p.C117F|IQCF3_ENST00000440739.2_Missense_Mutation_p.C117F			P0C7M6	IQCF3_HUMAN	IQ motif containing F3	117	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.									endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AATGCTCTCTGCTTGTTCCAG	0.537																																					p.C117F													.	.			0			c.G350T												91.0	93.0	92.0					3																	51864702		2121	4238	6359	SO:0001583	missense	401067	exon7			CTCTCTGCTTGTT	AK057432	CCDS46837.1	3p21.31	2008-06-12			ENSG00000229972	ENSG00000229972			31816	protein-coding gene	gene with protein product							Standard	NM_001085479		Approved		uc021wyz.1	P0C7M6	OTTHUMG00000156910	ENST00000456080.1:c.350G>T	3.37:g.51864702G>T	ENSP00000415609:p.Cys117Phe		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	82	0.05	4	NM_001085479	0		0	B2RUV0	Missense_Mutation	SNP	ENST00000456080.1	37	CCDS46837.1	.	.	.	.	.	.	.	.	.	.	g	9.933	1.215351	0.22373	.	.	ENSG00000229972	ENST00000456080;ENST00000437810;ENST00000446775;ENST00000440739	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	4.72	2.88	0.33553	.	.	.	.	.	T	0.24044	0.0582	L	0.46157	1.445	0.09310	N	1	B	0.23249	0.082	B	0.29267	0.1	T	0.34601	-0.9822	9	0.10111	T	0.7	.	6.846	0.23988	0.0958:0.1759:0.7283:0.0	.	117	P0C7M6	IQCF3_HUMAN	F	117	ENSP00000415609:C117F;ENSP00000409373:C117F;ENSP00000401767:C117F;ENSP00000402012:C117F	ENSP00000409373:C117F	C	+	2	0	IQCF3	51839742	0.004000	0.15560	0.001000	0.08648	0.009000	0.06853	1.136000	0.31467	0.691000	0.31592	0.655000	0.94253	TGC			0.537	IQCF3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346579.2		NM_001085479	
CPN2	1370	mdanderson.org	37	3	194062273	194062273	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr3:194062273G>T	ENST00000323830.3	-	2	1248	c.1159C>A	c.(1159-1161)Ctg>Atg	p.L387M	CPN2_ENST00000429275.1_Missense_Mutation_p.L387M	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	387					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		AGGTTGAACAGGTTGTAGTTG	0.592																																					p.L387M													.	.			0			c.C1159A												95.0	102.0	100.0					3																	194062273		2203	4300	6503	SO:0001583	missense	1370	exon2			TGAACAGGTTGTA	J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.1159C>A	3.37:g.194062273G>T	ENSP00000319464:p.Leu387Met		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_001080513	0		0	B2RPE7|Q86SU4|Q8N5V4	Missense_Mutation	SNP	ENST00000323830.3	37	CCDS33920.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071125	0.55646	.	.	ENSG00000178772	ENST00000323830;ENST00000429275	T;T	0.48836	0.8;0.8	5.56	4.67	0.58626	.	0.000000	0.30890	N	0.008672	T	0.73377	0.3579	M	0.93197	3.39	0.33007	D	0.526952	D	0.89917	1.0	D	0.87578	0.998	T	0.82341	-0.0505	10	0.72032	D	0.01	.	9.8397	0.40991	0.0732:0.1407:0.7862:0.0	.	387	P22792	CPN2_HUMAN	M	387	ENSP00000319464:L387M;ENSP00000402232:L387M	ENSP00000319464:L387M	L	-	1	2	CPN2	195543968	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	4.559000	0.60796	2.782000	0.95742	0.655000	0.94253	CTG			0.592	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342856.2		NM_001080513	
FAM157A	728262	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	197894592	197894592	+	lincRNA	SNP	G	G	C			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr3:197894592G>C	ENST00000437428.2	+	0	753							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						CCGAGAAACTGTGAGCAAGAG	0.532											OREG0016022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V312L													.	FAM157A	4		0			c.G934C												12.0	11.0	11.0					3																	197894592		687	1552	2239			0	exon5			GAAACTGTGAGCA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197894592G>C			Somatic	295	0	0	2094	WXS	Illumina HiSeq	Phase_I	240	0.15	37	NM_001145248	0		0		RNA	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	2.230	-0.376352	0.05000	.	.	ENSG00000236438	ENST00000431569	.	.	.	0.467	0.467	0.16721	.	.	.	.	.	T	0.17408	0.0418	N	0.08118	0	0.09310	N	1	B	0.32829	0.386	B	0.35240	0.198	T	0.27020	-1.0086	6	.	.	.	.	.	.	.	.	312	C9JC47	F157A_HUMAN	L	312	.	.	V	+	1	0	FAM157A	199378989	0.083000	0.21467	0.001000	0.08648	0.019000	0.09904	0.293000	0.19029	0.539000	0.28788	0.388000	0.25769	GTG			0.532	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA		OTTHUMT00000340078.2		NM_001145248	
DSPP	1834	bcgsc.ca	37	4	88536953	88536953	+	Missense_Mutation	SNP	G	G	A	rs200486992		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr4:88536953G>A	ENST00000282478.7	+	4	3172	c.3139G>A	c.(3139-3141)Gat>Aat	p.D1047N	DSPP_ENST00000399271.1_Missense_Mutation_p.D1047N|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1047	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgatagcagtga	0.527																																					p.D1047N													.	DSPP	174		0			c.G3139A												46.0	57.0	53.0					4																	88536953		1537	2773	4310	SO:0001583	missense	1834	exon5			AGCAGCGATAGCA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3139G>A	4.37:g.88536953G>A	ENSP00000282478:p.Asp1047Asn		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_1	63	0.11	7	NM_014208	0		0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	g	3.566	-0.088574	0.07097	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88201	-2.35;-2.35	1.51	-1.84	0.07809	.	.	.	.	.	T	0.78355	0.4270	L	0.34521	1.04	0.09310	N	1	B	0.26708	0.157	B	0.08055	0.003	T	0.61637	-0.7022	9	0.38643	T	0.18	.	5.2365	0.15448	0.5606:0.0:0.4394:0.0	.	1047	Q9NZW4	DSPP_HUMAN	N	1047	ENSP00000382213:D1047N;ENSP00000282478:D1047N	ENSP00000282478:D1047N	D	+	1	0	DSPP	88755977	0.032000	0.19561	0.079000	0.20413	0.006000	0.05464	0.451000	0.21779	-0.607000	0.05738	-0.791000	0.03333	GAT			0.527	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
SPOCK3	50859	broad.mit.edu	37	4	167656103	167656103	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr4:167656103T>C	ENST00000357154.3	-	12	1417	c.1280A>G	c.(1279-1281)gAt>gGt	p.D427G	SPOCK3_ENST00000511269.1_Missense_Mutation_p.D424G|SPOCK3_ENST00000502330.1_Missense_Mutation_p.D427G|SPOCK3_ENST00000535728.1_Missense_Mutation_p.D295G|SPOCK3_ENST00000541354.1_Missense_Mutation_p.D307G|SPOCK3_ENST00000511531.1_Missense_Mutation_p.D427G|SPOCK3_ENST00000421836.2_Missense_Mutation_p.D376G|SPOCK3_ENST00000504953.1_Missense_Mutation_p.D424G|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Missense_Mutation_p.D424G|SPOCK3_ENST00000510741.1_Missense_Mutation_p.D384G|SPOCK3_ENST00000534949.1_Missense_Mutation_p.D331G|SPOCK3_ENST00000506886.1_Missense_Mutation_p.D427G|SPOCK3_ENST00000541637.1_Missense_Mutation_p.D329G|SPOCK3_ENST00000512681.1_Missense_Mutation_p.D329G	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	427	Asp-rich.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)	p.D424G(3)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		atcaccaccatcatcatcatc	0.303																																					p.D427G													SPOCK3,NS,carcinoma,0,4	SPOCK3	90	4	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.A1280G												171.0	161.0	164.0					4																	167656103		2203	4300	6503	SO:0001583	missense	50859	exon12			CCACCATCATCAT	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.1280A>G	4.37:g.167656103T>C	ENSP00000349677:p.Asp427Gly		Somatic	435	0	0		WXS	Illumina HiSeq	Phase_I	273	0.01	4	NM_016950	0		0	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	T	4.562	0.104449	0.08731	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000541637;ENST00000534949	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.78707	-1.2;1.38;1.38;-1.2;-1.2;-1.2;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	5.1	0.69264	.	0.263407	0.31392	N	0.007738	T	0.68577	0.3016	N	0.14661	0.345	0.52501	D	0.999956	P;P;P;P;P;P;P	0.37864	0.476;0.61;0.476;0.476;0.476;0.61;0.476	B;B;B;B;B;B;B	0.43575	0.161;0.424;0.243;0.243;0.243;0.424;0.243	T	0.70414	-0.4878	10	0.38643	T	0.18	-32.2602	14.9101	0.70749	0.0:0.0:0.0:1.0	.	329;331;376;436;384;424;427	B4DGK5;F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	G	427;424;424;427;427;427;384;307;329;424;295;376;329;331	ENSP00000349677:D427G;ENSP00000350153:D424G;ENSP00000425570:D424G;ENSP00000420920:D427G;ENSP00000423421:D427G;ENSP00000423606:D427G;ENSP00000426716:D384G;ENSP00000444789:D307G;ENSP00000426318:D329G;ENSP00000425502:D424G;ENSP00000441396:D295G;ENSP00000411344:D376G;ENSP00000445430:D329G;ENSP00000438142:D331G	ENSP00000349677:D427G	D	-	2	0	SPOCK3	167892678	0.991000	0.36638	0.968000	0.41197	0.019000	0.09904	1.364000	0.34171	2.060000	0.61445	0.514000	0.50259	GAT			0.303	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000364091.1			
ICE1	23379	mdanderson.org	37	5	5464352	5464352	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr5:5464352G>T	ENST00000296564.7	+	13	5127	c.4905G>T	c.(4903-4905)ctG>ctT	p.L1635L		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1635	Pro-rich.				positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TGCCGCCTCTGCTTGCTCCTC	0.512																																					p.L1635L													.	.			0			c.G4905T												114.0	120.0	118.0					5																	5464352		2014	4194	6208	SO:0001819	synonymous_variant	23379	exon13			GCCTCTGCTTGCT																												ENST00000296564.7:c.4905G>T	5.37:g.5464352G>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_015325	54	0.00	0	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	37	CCDS47187.1																																																																																					0.512	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365575.1			
AMACR	23600	mdanderson.org	37	5	34007933	34007933	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr5:34007933G>T	ENST00000335606.6	-	1	280	c.192C>A	c.(190-192)gcC>gcA	p.A64A	AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000382072.2_Silent_p.A64A|AMACR_ENST00000382068.3_Silent_p.A64A|AMACR_ENST00000502637.1_Silent_p.A64A|RP11-1084J3.4_ENST00000382079.3_Intron|AMACR_ENST00000441713.2_Silent_p.A64A|AMACR_ENST00000382085.3_Silent_p.A64A|AMACR_ENST00000426255.2_Silent_p.A64A|AMACR_ENST00000512079.1_Silent_p.A64A	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	64					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						GCCGCAGCACGGCGGCTCCCC	0.741																																					p.A64A													.	.			0			c.C192A												4.0	5.0	4.0					5																	34007933		1620	3520	5140	SO:0001819	synonymous_variant	23600	exon1			CAGCACGGCGGCT	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.192C>A	5.37:g.34007933G>T			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	12	0.25	3	NM_203382	14	0.00	0	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Silent	SNP	ENST00000335606.6	37	CCDS3902.1																																																																																					0.741	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207467.1		NM_014324	
TCOF1	6949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149754707	149754707	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr5:149754707C>T	ENST00000504761.2	+	10	1469	c.1469C>T	c.(1468-1470)gCa>gTa	p.A490V	TCOF1_ENST00000513346.1_Missense_Mutation_p.A490V|TCOF1_ENST00000377797.3_Missense_Mutation_p.A490V|TCOF1_ENST00000323668.7_Missense_Mutation_p.A413V|TCOF1_ENST00000394269.3_Missense_Mutation_p.A490V|TCOF1_ENST00000439160.2_Missense_Mutation_p.A490V|TCOF1_ENST00000445265.2_Missense_Mutation_p.A413V|TCOF1_ENST00000451292.1_Missense_Mutation_p.A490V			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	490					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGGCACTGGCAGCCATGAAT	0.592																																					p.A490V													.	.			0			c.C1469T												17.0	20.0	19.0					5																	149754707		2195	4298	6493	SO:0001583	missense	6949	exon10			CACTGGCAGCCAT		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.1469C>T	5.37:g.149754707C>T	ENSP00000421655:p.Ala490Val		Somatic	166	0	0		WXS	Illumina HiSeq	.	120	0.33	39	NM_001135243	142	0.37	53	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114333	0.37339	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	4.04	3.16	0.36331	Treacher Collins syndrome, treacle (1);	4.449660	0.00748	N	0.001047	T	0.54191	0.1843	L	0.51914	1.62	0.09310	N	1	B;B;B;B;B;P	0.36144	0.291;0.291;0.291;0.339;0.291;0.539	B;B;B;B;B;B	0.27076	0.046;0.046;0.046;0.076;0.046;0.046	T	0.39482	-0.9612	10	0.22706	T	0.39	-1.5504	7.9066	0.29765	0.0:0.8796:0.0:0.1204	.	490;413;490;490;413;490	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8;Q13428-5	.;.;.;TCOF_HUMAN;.;.	V	490;490;413;413;490;490;490;490;490	ENSP00000400939:A490V;ENSP00000367028:A490V;ENSP00000409944:A413V;ENSP00000325223:A413V;ENSP00000406888:A490V;ENSP00000377811:A490V;ENSP00000390717:A490V;ENSP00000421655:A490V;ENSP00000427484:A490V	ENSP00000325223:A413V	A	+	2	0	TCOF1	149734900	0.000000	0.05858	0.004000	0.12327	0.077000	0.17291	-0.563000	0.05943	0.806000	0.34183	0.462000	0.41574	GCA			0.592	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000380552.1		NM_001008656	
ADAM19	8728	mdanderson.org	37	5	156923970	156923970	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr5:156923970C>T	ENST00000517905.1	-	14	1570	c.1526G>A	c.(1525-1527)gGc>gAc	p.G509D	ADAM19_ENST00000257527.4_Missense_Mutation_p.G509D|ADAM19_ENST00000394020.1_Missense_Mutation_p.G511D|ADAM19_ENST00000430702.2_Missense_Mutation_p.G242D			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	509	Cys-rich.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTAGGCCTGGCCGCCCTCACA	0.642																																					p.G509D													.	.			0			c.G1526A												40.0	38.0	39.0					5																	156923970		2203	4300	6503	SO:0001583	missense	8728	exon14			GCCTGGCCGCCCT	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.1526G>A	5.37:g.156923970C>T	ENSP00000428654:p.Gly509Asp		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_033274	5	0.00	0	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.87|16.87	3.242305|3.242305	0.58995|0.58995	.|.	.|.	ENSG00000135074|ENSG00000135074	ENST00000517374|ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905	.|T;T;T;T	.|0.22134	.|1.97;1.97;1.97;1.97	5.49|5.49	4.61|4.61	0.57282|0.57282	.|ADAM, cysteine-rich (2);	.|0.094092	.|0.46758	.|D	.|0.000278	T|T	0.36552|0.36552	0.0971|0.0971	M|M	0.62266|0.62266	1.93|1.93	0.44424|0.44424	D|D	0.997346|0.997346	.|D;D;D	.|0.61697	.|0.987;0.99;0.99	.|P;P;P	.|0.61533	.|0.824;0.89;0.821	T|T	0.03068|0.03068	-1.1076|-1.1076	5|10	.|0.45353	.|T	.|0.12	.|.	9.994|9.994	0.41887|0.41887	0.0:0.8496:0.0:0.1504|0.0:0.8496:0.0:0.1504	.|.	.|509;509;242	.|Q9H013-2;Q9H013;E9PD32	.|.;ADA19_HUMAN;.	T|D	80|242;509;511;509	.|ENSP00000414088:G242D;ENSP00000257527:G509D;ENSP00000377588:G511D;ENSP00000428654:G509D	.|ENSP00000257527:G509D	A|G	-|-	1|2	0|0	ADAM19|ADAM19	156856548|156856548	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.675000|0.675000	0.39556|0.39556	1.692000|1.692000	0.37731|0.37731	2.572000|2.572000	0.86782|0.86782	0.557000|0.557000	0.71058|0.71058	GCC|GGC			0.642	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000373918.1		NM_033274	
SLU7	10569	mdanderson.org	37	5	159831548	159831548	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr5:159831548G>T	ENST00000297151.4	-	15	1867	c.1480C>A	c.(1480-1482)Ctg>Atg	p.L494M		NM_006425.4	NP_006416.3	O95391	SLU7_HUMAN	SLU7 splicing factor homolog (S. cerevisiae)	494					alternative mRNA splicing, via spliceosome (GO:0000380)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	pre-mRNA 3'-splice site binding (GO:0030628)|second spliceosomal transesterification activity (GO:0000386)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(4)|lung(6)|ovary(1)	20	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tcctcttTCAGTTTTTCTTGA	0.373																																					p.L494M													.	.			0			c.C1480A												100.0	94.0	96.0					5																	159831548		2203	4298	6501	SO:0001583	missense	10569	exon15			CTTTCAGTTTTTC	AF101074	CCDS4352.1	5q33.3	2010-04-13			ENSG00000164609	ENSG00000164609			16939	protein-coding gene	gene with protein product	zinc knuckle motif containing	605974				10197984, 15728250	Standard	NM_006425		Approved	9G8	uc003lyg.3	O95391	OTTHUMG00000130324	ENST00000297151.4:c.1480C>A	5.37:g.159831548G>T	ENSP00000297151:p.Leu494Met		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_006425	213	0.00	0	D3DQK2|Q3LUJ0|Q3LUJ1|Q6RXQ5|Q96FM9	Missense_Mutation	SNP	ENST00000297151.4	37	CCDS4352.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814844	0.32053	.	.	ENSG00000164609	ENST00000297151	T	0.30448	1.53	5.53	3.63	0.41609	.	0.756175	0.11899	N	0.518764	T	0.18800	0.0451	N	0.14661	0.345	0.38477	D	0.94762	B	0.10296	0.003	B	0.06405	0.002	T	0.04900	-1.0919	10	0.46703	T	0.11	-10.5975	8.594	0.33703	0.0837:0.0:0.7556:0.1607	.	494	O95391	SLU7_HUMAN	M	494	ENSP00000297151:L494M	ENSP00000297151:L494M	L	-	1	2	SLU7	159764126	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	1.187000	0.32090	0.702000	0.31825	0.591000	0.81541	CTG			0.373	SLU7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252673.1		NM_006425	
JARID2	3720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	15497278	15497278	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr6:15497278G>A	ENST00000341776.2	+	7	2066	c.1822G>A	c.(1822-1824)Gtc>Atc	p.V608I	JARID2_ENST00000541660.1_Missense_Mutation_p.V570I|JARID2_ENST00000397311.3_Missense_Mutation_p.V436I	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	608					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GATGCGGTTTGTCACGCAGAT	0.632																																					p.V608I													.	.			0			c.G1822A												38.0	32.0	34.0					6																	15497278		2202	4300	6502	SO:0001583	missense	3720	exon7			CGGTTTGTCACGC	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1822G>A	6.37:g.15497278G>A	ENSP00000341280:p.Val608Ile		Somatic	127	0	0		WXS	Illumina HiSeq	.	139	0.17	23	NM_004973	614	0.27	166	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826067	0.71143	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.43294	0.95;0.95;0.95	5.23	5.23	0.72850	ARID/BRIGHT DNA-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.46737	0.1408	L	0.36672	1.1	0.80722	D	1	B;D;P	0.69078	0.264;0.997;0.483	B;D;B	0.72338	0.052;0.977;0.057	T	0.32745	-0.9895	10	0.35671	T	0.21	-14.0708	18.7817	0.91934	0.0:0.0:1.0:0.0	.	570;472;608	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	I	472;608;436;570	ENSP00000341280:V608I;ENSP00000380478:V436I;ENSP00000444623:V570I	ENSP00000341280:V608I	V	+	1	0	JARID2	15605257	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	9.672000	0.98629	2.430000	0.82344	0.511000	0.50034	GTC			0.632	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000039926.1		NM_004973	
C6orf136	221545	mdanderson.org	37	6	30619174	30619174	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr6:30619174G>T	ENST00000376473.5	+	4	854	c.695G>T	c.(694-696)cGg>cTg	p.R232L	C6orf136_ENST00000528347.2_Missense_Mutation_p.R89L|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000293604.6_Missense_Mutation_p.R413L|C6orf136_ENST00000376471.4_Missense_Mutation_p.R98L	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	232						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GCCCGGTGGCGGCTTGTGGGG	0.537																																					p.R413L													C6orf136_ENST00000293604,caecum,carcinoma,0,2	C6orf136_ENST00000293604	0	2	0			c.G1238T												145.0	163.0	157.0					6																	30619174		2203	4300	6503	SO:0001583	missense	221545	exon4			GGTGGCGGCTTGT	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.695G>T	6.37:g.30619174G>T	ENSP00000365656:p.Arg232Leu		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_001161376	194	0.00	0	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	ENST00000376473.5	37	CCDS43443.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630321	0.67015	.	.	ENSG00000204564	ENST00000293604;ENST00000376473;ENST00000376471;ENST00000446773;ENST00000528347;ENST00000465699;ENST00000467801;ENST00000468785	.	.	.	5.2	4.31	0.51392	.	0.116858	0.56097	D	0.000024	T	0.70911	0.3278	M	0.76170	2.325	0.48762	D	0.999706	D;P;D	0.69078	0.984;0.537;0.997	P;B;D	0.69307	0.753;0.178;0.963	T	0.73588	-0.3935	9	0.72032	D	0.01	-22.9703	11.5306	0.50607	0.0866:0.0:0.9134:0.0	.	98;413;232	A9R9P9;F8VX15;Q5SQH8	.;.;CF136_HUMAN	L	413;232;98;350;89;54;45;5	.	ENSP00000293604:R413L	R	+	2	0	C6orf136	30727153	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	4.610000	0.61155	2.699000	0.92147	0.655000	0.94253	CGG			0.537	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076457.4		NM_145029	
PPP2R5D	5528	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42978951	42978951	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr6:42978951T>C	ENST00000485511.1	+	16	1915	c.1736T>C	c.(1735-1737)gTg>gCg	p.V579A	PPP2R5D_ENST00000461010.1_Missense_Mutation_p.V473A|PPP2R5D_ENST00000394110.3_Missense_Mutation_p.V547A|KLHDC3_ENST00000326974.4_5'Flank|PPP2R5D_ENST00000472118.1_Missense_Mutation_p.V571A	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	579					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CCCCAGGACGTGTACACCATC	0.572																																					p.V579A	Melanoma(63;587 1613 29742 31770)												.	PPP2R5D	47		0			c.T1736C												100.0	98.0	99.0					6																	42978951		2203	4300	6503	SO:0001583	missense	5528	exon16			AGGACGTGTACAC	L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.1736T>C	6.37:g.42978951T>C	ENSP00000417963:p.Val579Ala		Somatic	176	0.0056818182	1		WXS	Illumina HiSeq	Phase_I	206	0.22	45	NM_006245	186	0.34	64	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Missense_Mutation	SNP	ENST00000485511.1	37	CCDS4878.1	.	.	.	.	.	.	.	.	.	.	T	11.30	1.597772	0.28445	.	.	ENSG00000112640	ENST00000485511;ENST00000394110;ENST00000472118;ENST00000541610;ENST00000461010	T;T;T;T	0.42900	0.97;0.98;0.96;0.98	5.49	4.31	0.51392	.	0.125547	0.53938	D	0.000057	T	0.15089	0.0364	L	0.36672	1.1	0.47819	D	0.999525	B;B;B;B	0.09022	0.001;0.002;0.001;0.002	B;B;B;B	0.11329	0.002;0.006;0.001;0.006	T	0.06643	-1.0815	10	0.13853	T	0.58	-22.0579	12.3816	0.55309	0.0:0.0:0.1411:0.8589	.	473;561;579;547	Q14738-3;F5GYS1;Q14738;Q14738-2	.;.;2A5D_HUMAN;.	A	579;547;571;561;473	ENSP00000417963:V579A;ENSP00000377669:V547A;ENSP00000420550:V571A;ENSP00000420674:V473A	ENSP00000377669:V547A	V	+	2	0	PPP2R5D	43086929	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	7.988000	0.88194	0.905000	0.36596	0.533000	0.62120	GTG			0.572	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040573.3		NM_006245	
FAM46A	55603	mdanderson.org	37	6	82461790	82461790	+	Silent	SNP	T	T	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr6:82461790T>G	ENST00000320172.6	-	2	383	c.69A>C	c.(67-69)ctA>ctC	p.L23L	FAM46A_ENST00000369756.3_Silent_p.L104L|FAM46A_ENST00000369754.3_Silent_p.L42L	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	23					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		agtcgccgccTAGGGGGATGT	0.692																																					p.L23L													.	.			0			c.A69C												4.0	5.0	4.0					6																	82461790		1435	3404	4839	SO:0001819	synonymous_variant	55603	exon2			GCCGCCTAGGGGG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.69A>C	6.37:g.82461790T>G			Somatic	37	0.027027027	1		WXS	Illumina HiSeq	Phase_I	50	0.10	5	NM_017633	0		0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																					0.692	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000041331.1			
HBS1L	10767	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	135358728	135358728	+	Intron	SNP	T	T	C			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr6:135358728T>C	ENST00000367837.5	-	4	637				HBS1L_ENST00000367826.2_Intron|HBS1L_ENST00000314674.3_Intron|HBS1L_ENST00000367824.4_Intron|HBS1L_ENST00000415177.2_Intron|HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000367822.5_Missense_Mutation_p.I289M|HBS1L_ENST00000367820.2_Intron	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase						signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		TTGTGCCCTTTATGATTATGG	0.333																																					p.I289M													.	HBS1L	75		0			c.A867G												40.0	34.0	36.0					6																	135358728		692	1591	2283	SO:0001627	intron_variant	10767	exon5			GCCCTTTATGATT	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.430+1982A>G	6.37:g.135358728T>C			Somatic	72	0.0138888889	1		WXS	Illumina HiSeq	Phase_I	86	0.36	31	NM_001145207	24	0.29	7	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	37	CCDS5173.1	.	.	.	.	.	.	.	.	.	.	T	0.697	-0.792329	0.02884	.	.	ENSG00000112339	ENST00000367822	.	.	.	5.04	-0.415	0.12355	.	.	.	.	.	T	0.13457	0.0326	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.36601	-0.9741	7	0.49607	T	0.09	.	9.4837	0.38917	0.0:0.5683:0.0:0.4317	.	289	Q9Y450-2	.	M	289	.	ENSP00000356796:I289M	I	-	3	3	HBS1L	135400421	0.043000	0.20138	0.007000	0.13788	0.068000	0.16541	0.650000	0.24858	0.057000	0.16193	-0.256000	0.11100	ATA			0.333	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042339.2			
LMOD2	442721	broad.mit.edu	37	7	123302963	123302963	+	Silent	SNP	T	T	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr7:123302963T>A	ENST00000458573.2	+	2	1480	c.1323T>A	c.(1321-1323)ccT>ccA	p.P441P	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	441	Pro-rich.					cytoskeleton (GO:0005856)		p.P441P(1)									tgccaccacctcctcctcctc	0.572																																					p.P441P													LMOD2_ENST00000458573,NS,carcinoma,0,1	LMOD2	62	1	1	Substitution - coding silent(1)	endometrium(1)	c.T1323A												19.0	18.0	19.0					7																	123302963		1881	4064	5945	SO:0001819	synonymous_variant	442721	exon2			ACCACCTCCTCCT	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.1323T>A	7.37:g.123302963T>A			Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	101	0.04	4	NM_207163	0		0	A4D0W9|A4D0Y2|Q8WVJ8	Silent	SNP	ENST00000458573.2	37	CCDS47693.1																																																																																					0.572	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348525.1			
PRRT4	401399	mdanderson.org	37	7	127992356	127992356	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr7:127992356G>T	ENST00000446477.2	-	6	1567	c.1254C>A	c.(1252-1254)ttC>ttA	p.F418L	PRRT4_ENST00000535159.1_Missense_Mutation_p.F418L|PRRT4_ENST00000489835.2_Intron|PRRT4_ENST00000435512.1_Intron	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	418	Leu-rich.					integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						AGGCGTCGTAGAAGAGCGGGA	0.741																																					p.F418L													.	.			0			c.C1254A												7.0	13.0	11.0					7																	127992356		668	1555	2223	SO:0001583	missense	401399	exon6			GTCGTAGAAGAGC	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.1254C>A	7.37:g.127992356G>T	ENSP00000415026:p.Phe418Leu		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_001174164	1	0.00	0	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	37	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	G	8.640	0.895750	0.17686	.	.	ENSG00000224940	ENST00000446477;ENST00000535159;ENST00000489517	.	.	.	3.73	3.73	0.42828	.	.	.	.	.	T	0.27241	0.0668	N	0.04508	-0.205	0.80722	D	1	B	0.28178	0.202	B	0.30782	0.12	T	0.17228	-1.0376	8	0.02654	T	1	-26.8336	13.5682	0.61830	0.0:0.0:1.0:0.0	.	418	C9JH25	PRRT4_HUMAN	L	418	.	ENSP00000415026:F418L	F	-	3	2	PRRT4	127779592	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	0.732000	0.26072	2.140000	0.66376	0.536000	0.68110	TTC			0.741	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001114726	
SSPO	23145	mdanderson.org	37	7	149522448	149522448	+	RNA	SNP	G	G	A	rs376457361	byFrequency	TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr7:149522448G>A	ENST00000378016.2	+	0	14078							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTCTGGGACCGCGTTCAGTGT	0.637													G|||	2	0.000399361	0.0	0.0029	5008	,	,		18793	0.0		0.0	False		,,,				2504	0.0				p.R4692H													.	.			0			c.G14075A							G	HIS/ARG	1,4179		0,1,2089	72.0	79.0	77.0		14094	2.1	0.4	7		77	1,8423		0,1,4211	no	missense	SSPO	NM_198455.2	29	0,2,6300	AA,AG,GG		0.0119,0.0239,0.0159	probably-damaging	4692/5148	149522448	2,12602	2090	4212	6302			23145	exon99			GGGACCGCGTTCA	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149522448G>A			Somatic	43	0.023255814	1		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_198455	1	0.00	0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																						0.637	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
TSNARE1	203062	mdanderson.org	37	8	143399985	143399985	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr8:143399985G>T	ENST00000307180.3	-	7	1021	c.904C>A	c.(904-906)Cag>Aag	p.Q302K	TSNARE1_ENST00000518928.1_5'UTR|TSNARE1_ENST00000520166.1_Missense_Mutation_p.Q302K|TSNARE1_ENST00000519651.1_Missense_Mutation_p.Q83K|TSNARE1_ENST00000524325.1_Missense_Mutation_p.Q302K	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	302					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GTCTCCTGCTGTGCCGTGTGC	0.662																																					p.Q302K													.	.			0			c.C904A												78.0	72.0	74.0					8																	143399985		2203	4300	6503	SO:0001583	missense	203062	exon7			CCTGCTGTGCCGT			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.904C>A	8.37:g.143399985G>T	ENSP00000303437:p.Gln302Lys		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_145003	32	0.00	0	B7ZLB0|Q14D03	Missense_Mutation	SNP	ENST00000307180.3	37	CCDS6384.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813801	0.32053	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	4.0	4.0	0.46444	t-SNARE (1);	0.000000	0.31268	U	0.007944	T	0.49440	0.1557	M	0.79258	2.445	0.24373	N	0.994825	D;B;B;B	0.57899	0.981;0.355;0.259;0.259	D;B;B;B	0.65010	0.931;0.158;0.112;0.112	T	0.38457	-0.9660	10	0.51188	T	0.08	.	7.6632	0.28415	0.1184:0.0:0.8816:0.0	.	302;83;302;302	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	K	302;302;302;83	ENSP00000428763:Q302K;ENSP00000303437:Q302K;ENSP00000427770:Q302K;ENSP00000429679:Q83K	ENSP00000303437:Q302K	Q	-	1	0	TSNARE1	143397892	0.986000	0.35501	0.283000	0.24790	0.061000	0.15899	2.098000	0.41757	1.763000	0.52060	0.655000	0.94253	CAG			0.662	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_145003	
EPPK1	83481	mdanderson.org	37	8	144946691	144946691	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr8:144946691G>A	ENST00000525985.1	-	2	802	c.731C>T	c.(730-732)gCa>gTa	p.A244V				P58107	EPIPL_HUMAN	epiplakin 1	244						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGCTCAGCTGCACTCACCGC	0.682																																					p.A244V													.	.			0			c.C731T												13.0	16.0	15.0					8																	144946691		2164	4248	6412	SO:0001583	missense	83481	exon1			TCAGCTGCACTCA	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.731C>T	8.37:g.144946691G>A	ENSP00000436337:p.Ala244Val		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_031308	2	0.00	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	G	0.381	-0.928430	0.02359	.	.	ENSG00000227184	ENST00000525985	T	0.69175	-0.38	4.53	-1.3	0.09259	.	.	.	.	.	T	0.42988	0.1227	N	0.20445	0.575	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.21621	-1.0240	9	0.15066	T	0.55	.	5.8411	0.18635	0.3888:0.1531:0.4581:0.0	.	244	E9PPU0	.	V	244	ENSP00000436337:A244V	ENSP00000436337:A244V	A	-	2	0	EPPK1	145018679	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.125000	0.15749	-0.118000	0.11851	0.407000	0.27541	GCA			0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
CDKN2A	1029	mdanderson.org	37	9	21994303	21994303	+	Silent	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr9:21994303G>T	ENST00000579755.1	-	1	320	c.28C>A	c.(28-30)Cgg>Agg	p.R10R	CDKN2B-AS1_ENST00000584351.1_RNA|CDKN2B-AS1_ENST00000580467.1_RNA|CDKN2A_ENST00000361570.3_Silent_p.R51R|RP11-149I2.4_ENST00000578935.1_RNA|CDKN2A_ENST00000494262.1_Intron|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000584816.1_RNA|CDKN2B-AS1_ENST00000577551.1_RNA|CDKN2A_ENST00000498628.2_Intron|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B-AS1_ENST00000455933.2_RNA|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2A_ENST00000470819.2_Intron|CDKN2B-AS1_ENST00000582072.1_RNA|CDKN2B-AS1_ENST00000584637.1_RNA|CDKN2A_ENST00000530628.2_Silent_p.R10R|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000584020.1_RNA|CDKN2B-AS1_ENST00000580576.1_RNA|RP11-145E5.5_ENST00000404796.2_Intron			P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	0					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(198)|p.0(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGCCGAATCCGGAGGGTCACC	0.726		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.R10R													.	.			199	Whole gene deletion(199)	haematopoietic_and_lymphoid_tissue(34)|central_nervous_system(31)|lung(31)|skin(16)|kidney(14)|oesophagus(11)|bone(10)|pancreas(10)|urinary_tract(7)|breast(6)|soft_tissue(5)|thyroid(4)|pleura(4)|large_intestine(3)|stomach(3)|liver(3)|ovary(3)|upper_aerodigestive_tract(1)|vulva(1)|biliary_tract(1)|autonomic_ganglia(1)	c.C28A												11.0	12.0	12.0					9																	21994303		2174	4257	6431	SO:0001819	synonymous_variant	1029	exon1			GAATCCGGAGGGT	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000579755.1:c.28C>A	9.37:g.21994303G>T			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_058195	2	0.00	0	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Silent	SNP	ENST00000579755.1	37	CCDS6511.2																																																																																					0.726	CDKN2A-004	KNOWN	NMD_exception|upstream_ATG|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000051918.5		NM_000077	
DCAF12	25853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34089434	34089434	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr9:34089434T>G	ENST00000361264.4	-	8	1520	c.1179A>C	c.(1177-1179)aaA>aaC	p.K393N	RP11-537H15.3_ENST00000448245.1_RNA	NM_015397.3	NP_056212.1	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	393					protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						CAGTGGTTAGTTTCAGATTCT	0.507																																					p.K393N													.	.			0			c.A1179C												126.0	107.0	113.0					9																	34089434		2203	4300	6503	SO:0001583	missense	25853	exon8			GGTTAGTTTCAGA	AB067479	CCDS6549.1	9p11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000198876	ENSG00000198876		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	19911	protein-coding gene	gene with protein product	"""cancer/testis antigen 102"""		"""KIAA1892"", ""WD repeat domain 40A"""	KIAA1892, WDR40A		11572484, 9110174	Standard	NM_015397		Approved	DKFZP434O125, MGC1058, CT102, TCC52	uc003ztt.2	Q5T6F0	OTTHUMG00000019806	ENST00000361264.4:c.1179A>C	9.37:g.34089434T>G	ENSP00000355114:p.Lys393Asn		Somatic	69	0	0		WXS	Illumina HiSeq	.	68	0.25	17	NM_015397	89	0.19	17	A8KA70|D3DRL6|Q5T6E9|Q5T6F1|Q6P3V0|Q7L4F8|Q96PZ5|Q9NXA9|Q9UFJ1	Missense_Mutation	SNP	ENST00000361264.4	37	CCDS6549.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021282	0.75275	.	.	ENSG00000198876	ENST00000361264	T	0.63096	-0.02	5.21	2.79	0.32731	WD40 repeat-like-containing domain (1);	0.045142	0.85682	D	0.000000	T	0.58221	0.2107	L	0.55834	1.745	0.53005	D	0.999963	D	0.56746	0.977	P	0.52514	0.701	T	0.55636	-0.8110	10	0.15066	T	0.55	-16.4899	4.8656	0.13607	0.0:0.4777:0.0:0.5223	.	393	Q5T6F0	DCA12_HUMAN	N	393	ENSP00000355114:K393N	ENSP00000355114:K393N	K	-	3	2	DCAF12	34079434	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.102000	0.41796	0.792000	0.33850	0.533000	0.62120	AAA			0.507	DCAF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052133.2		NM_015397	
LOC100132077	100132077	broad.mit.edu	37	9	97109268	97109275	+	lincRNA	DEL	AAAAAAGA	AAAAAAGA	-	rs371617960		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	AAAAAAGA	AAAAAAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr9:97109268_97109275delAAAAAAGA	ENST00000454869.1	+	0	698					NR_033937.1																						caaaaaaaagaaaaaagaaaaaaagaaa	0.471																																					.													.	.			0			.																																											0	.			AAAAAGAAAAAAG																													9.37:g.97109276_97109283delAAAAAAGA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	10	0.30	3	.	0		0		RNA	DEL	ENST00000454869.1	37																																																																																						0.471	RP11-307E17.8-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000053177.1			
C9orf114	51490	mdanderson.org	37	9	131589464	131589464	+	Missense_Mutation	SNP	G	G	T	rs561363504		TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr9:131589464G>T	ENST00000361256.5	-	4	255	c.215C>A	c.(214-216)cCc>cAc	p.P72H		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	72							poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						CAGTGTGTAGGGCCGCCCTGA	0.632																																					p.P72H													.	.			0			c.C215A												39.0	36.0	37.0					9																	131589464		2203	4300	6503	SO:0001583	missense	51490	exon4			GTGTAGGGCCGCC		CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.215C>A	9.37:g.131589464G>T	ENSP00000354812:p.Pro72His		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_016390	89	0.00	0	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Missense_Mutation	SNP	ENST00000361256.5	37	CCDS6913.1	.	.	.	.	.	.	.	.	.	.	G	0.563	-0.844542	0.02671	.	.	ENSG00000198917	ENST00000361256;ENST00000372618	T	0.30448	1.53	5.37	2.45	0.29901	.	0.519631	0.22376	N	0.060863	T	0.14570	0.0352	N	0.20685	0.6	0.09310	N	0.999999	B;B	0.15141	0.012;0.003	B;B	0.09377	0.004;0.003	T	0.26883	-1.0090	10	0.14656	T	0.56	-0.012	4.1853	0.10395	0.0772:0.119:0.3926:0.4113	.	72;72	E7ESY7;Q5T280	.;CI114_HUMAN	H	72	ENSP00000354812:P72H	ENSP00000354812:P72H	P	-	2	0	C9orf114	130629285	0.106000	0.21978	0.951000	0.38953	0.257000	0.26127	0.697000	0.25556	0.230000	0.21059	0.555000	0.69702	CCC			0.632	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054500.1		NM_016390	
NELFB	25920	mdanderson.org	37	9	140157611	140157611	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chr9:140157611G>T	ENST00000343053.4	+	5	1057	c.720G>T	c.(718-720)gaG>gaT	p.E240D		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	240					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGCGGGCTGAGCTGCTCATGT	0.622																																					p.E240D													.	.			0			c.G720T												196.0	148.0	164.0					9																	140157611		2203	4300	6503	SO:0001583	missense	25920	exon5			GGCTGAGCTGCTC	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.720G>T	9.37:g.140157611G>T	ENSP00000339495:p.Glu240Asp		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_015456	236	0.00	1	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037748	0.93630	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.76912	0.4054	M	0.64260	1.97	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.79938	-0.1592	9	0.87932	D	0	-47.7876	16.6026	0.84820	0.0:0.0:1.0:0.0	.	240	Q8WX92	NELFB_HUMAN	D	240	.	ENSP00000339495:E240D	E	+	3	2	COBRA1	139277432	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	6.637000	0.74304	2.231000	0.72958	0.305000	0.20034	GAG			0.622	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254710.1		NM_015456	
MT-ATP6	4508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	9203	9203	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chrM:9203C>T	ENST00000361899.2	+	1	677	c.677C>T	c.(676-678)aCa>aTa	p.T226I	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	226					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						GCACGACAACACATAATGACC	0.483																																					p.T226M													.	.			0			c.C677T																																									SO:0001583	missense	0	exon1			ACAACACATAATG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.677C>T	M.37:g.9203C>T	ENSP00000354632:p.Thr226Ile		Somatic	31	0	0		WXS	Illumina HiSeq	.	32	0.91	29	ENST00000361899	0		0	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	37																																																																																						0.483	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024031	
FRMPD3	84443	broad.mit.edu	37	X	106846480	106846480	+	Silent	SNP	G	G	A			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chrX:106846480G>A	ENST00000276185.4	+	16	5310	c.5310G>A	c.(5308-5310)caG>caA	p.Q1770Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1770	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						aacaacaacagcagcagcagc	0.582																																					.													.	.			0			.												3.0	2.0	2.0					X																	106846480		690	1560	2250	SO:0001819	synonymous_variant	84443	.			ACAACAGCAGCAG	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5310G>A	X.37:g.106846480G>A			Somatic	115	0.0086956522	1		WXS	Illumina HiSeq	Phase_I	169	0.04	6	.	10	0.00	0	Q96JK8	Silent	SNP	ENST00000276185.4	37																																																																																						0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_042978	
ARHGAP36	158763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	130215791	130215791	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAM4-01A-11D-A435-10	TCGA-2G-AAM4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68fd725c-8226-46cb-bfd7-1e3bbded6197	4acd74c8-3572-47f4-972c-b9f81e248e33	g.chrX:130215791C>G	ENST00000276211.5	+	2	497	c.152C>G	c.(151-153)tCg>tGg	p.S51W	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.S39W|ARHGAP36_ENST00000370921.1_5'Flank	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	51					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						AAGATGGTATCGATACACAGC	0.527																																					p.S51W													.	.			0			c.C152G												143.0	118.0	127.0					X																	130215791		2203	4300	6503	SO:0001583	missense	158763	exon2			TGGTATCGATACA		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.152C>G	X.37:g.130215791C>G	ENSP00000276211:p.Ser51Trp		Somatic	66	0	0		WXS	Illumina HiSeq	.	98	0.42	41	NM_144967	4	0.50	2	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208787	0.58343	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.13538	2.58;2.59;2.61	4.16	4.16	0.48862	.	0.000000	0.39020	N	0.001499	T	0.21761	0.0524	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	T	0.01464	-1.1348	10	0.72032	D	0.01	.	10.8111	0.46547	0.0:1.0:0.0:0.0	.	20;39;51	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	W	51;39;3;20	ENSP00000276211:S51W;ENSP00000359960:S39W;ENSP00000408515:S20W	ENSP00000276211:S51W	S	+	2	0	ARHGAP36	130043472	0.998000	0.40836	0.995000	0.50966	0.697000	0.40408	4.534000	0.60622	2.315000	0.78130	0.544000	0.68410	TCG			0.527	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355073.1		NM_144967	
