#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	mdanderson.org	37	1	1269228	1269228	+	Missense_Mutation	SNP	T	T	C			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:1269228T>C	ENST00000339381.5	+	6	1975	c.1943T>C	c.(1942-1944)cTg>cCg	p.L648P		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	648					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		ACGGGCTGCCTGAGCACACTC	0.701																																					p.L648P													.	.			0			c.T1943C												21.0	23.0	22.0					1																	1269228		2193	4293	6486	SO:0001583	missense	83756	exon6			GCTGCCTGAGCAC	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1943T>C	1.37:g.1269228T>C	ENSP00000344411:p.Leu648Pro		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_152228	2	0.00	0	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	37	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	T	11.51	1.659166	0.29515	.	.	ENSG00000169962	ENST00000339381	D	0.89617	-2.54	4.2	3.05	0.35203	GPCR, family 3, C-terminal (2);	0.080149	0.52532	D	0.000072	D	0.93387	0.7891	M	0.81341	2.54	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.92659	0.6140	10	0.87932	D	0	.	9.7203	0.40300	0.0:0.0:0.1743:0.8257	.	648	Q7RTX0	TS1R3_HUMAN	P	648	ENSP00000344411:L648P	ENSP00000344411:L648P	L	+	2	0	TAS1R3	1259091	1.000000	0.71417	1.000000	0.80357	0.399000	0.30720	3.292000	0.51772	0.668000	0.31126	0.329000	0.21502	CTG			0.701	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008493.1			
MMP23B	8510	mdanderson.org	37	1	1569981	1569981	+	Nonsense_Mutation	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:1569981C>T	ENST00000356026.5	+	8	1277	c.1153C>T	c.(1153-1155)Cga>Tga	p.R385*	MMP23B_ENST00000378675.3_3'UTR			O75900	MMP23_HUMAN	matrix metallopeptidase 23B	385					proteolysis (GO:0006508)|reproduction (GO:0000003)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			large_intestine(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Marimastat(DB00786)	CTACTCCTGGCGAGTCCGTGT	0.657																																					p.R385X													.	.			0			c.C1153T												8.0	13.0	12.0					1																	1569981		1466	3641	5107	SO:0001587	stop_gained	8510	exon8			TCCTGGCGAGTCC		CCDS30559.1	1p36.3	2013-01-11	2005-08-08		ENSG00000189409	ENSG00000189409		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7171	protein-coding gene	gene with protein product	"""matrix metalloproteinase 22"", ""femalysin"", ""matrix metalloproteinase in the female reproductive tract"""	603321	"""matrix metalloproteinase 23B"""	MMP22		9740677, 9750192	Standard	XM_005244810		Approved	MIFR, MIFR-1	uc001agp.3	O75900	OTTHUMG00000074713	ENST00000356026.5:c.1153C>T	1.37:g.1569981C>T	ENSP00000348308:p.Arg385*		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	68	0.04	3	NM_006983	3	0.00	0	A2AGN0|A2AGN1|O75894|O75895|Q5QPQ8|Q76P96|Q7LDM6|Q7LDM7|Q9UBR9|Q9UJK8	Nonsense_Mutation	SNP	ENST00000356026.5	37	CCDS30559.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819314	0.50633	.	.	ENSG00000189409	ENST00000356026;ENST00000412415	.	.	.	3.62	2.65	0.31530	.	0.120869	0.49916	U	0.000123	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.7498	9.3351	0.38045	0.5764:0.4236:0.0:0.0	.	.	.	.	X	385;425	.	ENSP00000348308:R385X	R	+	1	2	MMP23B	1559844	1.000000	0.71417	0.950000	0.38849	0.376000	0.30014	2.816000	0.48026	0.627000	0.30340	0.462000	0.41574	CGA			0.657	MMP23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000158492.2		NM_006983	
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921136	12921136	+	Silent	SNP	C	C	T	rs368491327	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:12921136C>T	ENST00000240189.2	+	4	1014	c.927C>T	c.(925-927)gaC>gaT	p.D309D		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	309					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.D309D(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGAAGAGGACTTGAAGTGTC	0.498													.|||	12	0.00239617	0.0038	0.0058	5008	,	,		21997	0.001		0.001	False		,,,				2504	0.001				p.D309D													PRAMEF2,pharynx,carcinoma,0,1	PRAMEF2	0	1	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C927T												131.0	134.0	133.0					1																	12921136		2202	4297	6499	SO:0001819	synonymous_variant	65122	exon4			AGAGGACTTGAAG		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.927C>T	1.37:g.12921136C>T			Somatic	103	0.0097087379	1		WXS	Illumina HiSeq	.	81	0.07	6	NM_023014	0		0		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																					0.498	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005517.1		NM_023014	
PRAMEF4	400735	ucsc.edu	37	1	12939904	12939904	+	Missense_Mutation	SNP	A	A	C	rs3895133		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:12939904A>C	ENST00000235349.5	-	4	968	c.898T>G	c.(898-900)Ttc>Gtc	p.F300V		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	300					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGTGAGGAACTTTAACGAG	0.483																																					p.F300V													.	PRAMEF4	62		0			c.T898G												50.0	69.0	62.0					1																	12939904		1404	2644	4048	SO:0001583	missense	400735	exon4			TGAGGAACTTTAA		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.898T>G	1.37:g.12939904A>C	ENSP00000235349:p.Phe300Val		Somatic	25	0.2	5		WXS	Illumina HiSeq		17	0.35	6	NM_001009611	0		0	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	t	1.416	-0.574302	0.03882	.	.	ENSG00000243073	ENST00000235349	T	0.38887	1.11	1.48	-2.96	0.05547	.	1.221790	0.05721	N	0.597800	T	0.18759	0.0450	N	0.04132	-0.27	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09207	-1.0685	10	0.37606	T	0.19	.	3.305	0.06997	0.5711:0.149:0.0:0.2799	.	300	O60810	PRAM4_HUMAN	V	300	ENSP00000235349:F300V	ENSP00000235349:F300V	F	-	1	0	PRAMEF4	12862491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.518000	0.02246	-3.281000	0.00197	-4.216000	0.00009	TTC			0.483	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005518.1		NM_001009611	
ASB17	127247	mdanderson.org	37	1	76388026	76388026	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:76388026G>T	ENST00000284142.6	-	2	559	c.420C>A	c.(418-420)taC>taA	p.Y140*		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	140					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						GGCTTGGACAGTATACTGGTG	0.333																																					p.Y140X													.	.			0			c.C420A												58.0	55.0	56.0					1																	76388026		2203	4300	6503	SO:0001587	stop_gained	127247	exon2			TGGACAGTATACT	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.420C>A	1.37:g.76388026G>T	ENSP00000284142:p.Tyr140*		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_080868	0		0	B1APB8|Q8N0X5	Nonsense_Mutation	SNP	ENST00000284142.6	37	CCDS671.1	.	.	.	.	.	.	.	.	.	.	G	31	5.088125	0.94100	.	.	ENSG00000154007	ENST00000284142	.	.	.	4.96	4.02	0.46733	.	0.304532	0.23736	N	0.045063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9239	0.41481	0.1012:0.0:0.8988:0.0	.	.	.	.	X	140	.	ENSP00000284142:Y140X	Y	-	3	2	ASB17	76160614	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.858000	0.39408	2.480000	0.83734	0.460000	0.39030	TAC			0.333	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026982.1		NM_080868	
DNASE2B	58511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	84880280	84880280	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:84880280G>C	ENST00000370665.3	+	6	848	c.815G>C	c.(814-816)aGa>aCa	p.R272T	DNASE2B_ENST00000370662.3_Missense_Mutation_p.R64T	NM_021233.2	NP_067056.2	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta	272					apoptotic DNA fragmentation (GO:0006309)	extracellular region (GO:0005576)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)			endometrium(1)|lung(4)|skin(1)	6				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		CAGCGAAAAAGACAAGAGCTT	0.408																																					p.R272T	Pancreas(54;788 1175 11852 16034 30034)												.	.			0			c.G815C												99.0	100.0	100.0					1																	84880280		2203	4300	6503	SO:0001583	missense	58511	exon6			GAAAAAGACAAGA	AF274571	CCDS694.1, CCDS44167.1	1p22.3	2008-02-05			ENSG00000137976	ENSG00000137976			28875	protein-coding gene	gene with protein product		608057				12594037, 11376952	Standard	NM_021233		Approved	DLAD	uc001djt.1	Q8WZ79	OTTHUMG00000009860	ENST00000370665.3:c.815G>C	1.37:g.84880280G>C	ENSP00000359699:p.Arg272Thr		Somatic	160	0	0		WXS	Illumina HiSeq	.	159	0.12	19	NM_021233	6	0.00	0	Q5VXD0|Q5VXD1|Q8WZ80|Q9NQW3	Missense_Mutation	SNP	ENST00000370665.3	37	CCDS44167.1	.	.	.	.	.	.	.	.	.	.	G	8.122	0.781114	0.16120	.	.	ENSG00000137976	ENST00000370665;ENST00000370662	T;T	0.12984	2.63;2.63	4.42	0.729	0.18266	.	0.503327	0.23400	N	0.048584	T	0.01976	0.0062	N	0.24115	0.695	0.09310	N	1	B	0.30973	0.302	B	0.27262	0.078	T	0.47586	-0.9106	10	0.13470	T	0.59	-9.9588	8.1025	0.30865	0.1036:0.2755:0.6209:0.0	.	272	Q8WZ79	DNS2B_HUMAN	T	272;64	ENSP00000359699:R272T;ENSP00000359696:R64T	ENSP00000359696:R64T	R	+	2	0	DNASE2B	84652868	0.009000	0.17119	0.840000	0.33206	0.922000	0.55478	0.782000	0.26788	0.158000	0.19367	0.655000	0.94253	AGA			0.408	DNASE2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000027248.1		NM_021233	
AKNAD1	254268	mdanderson.org	37	1	109391643	109391643	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:109391643G>A	ENST00000370001.3	-	4	1341	c.1073C>T	c.(1072-1074)aCc>aTc	p.T358I	AKNAD1_ENST00000357393.4_Missense_Mutation_p.T65I|AKNAD1_ENST00000369994.1_Missense_Mutation_p.T358I|AKNAD1_ENST00000369995.3_Missense_Mutation_p.T358I	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	358						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TTTCTGAGAGGTTGGTGACAA	0.378																																					p.T358I													.	.			0			c.C1073T												94.0	97.0	96.0					1																	109391643		2203	4300	6503	SO:0001583	missense	254268	exon4			TGAGAGGTTGGTG	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.1073C>T	1.37:g.109391643G>A	ENSP00000359018:p.Thr358Ile		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_152763	0		0	B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	ENST00000370001.3	37	CCDS791.2	.	.	.	.	.	.	.	.	.	.	G	10.64	1.405711	0.25378	.	.	ENSG00000162641	ENST00000370001;ENST00000357393;ENST00000369994;ENST00000369995	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	5.31	4.39	0.52855	.	0.503710	0.21360	N	0.075804	T	0.22244	0.0536	L	0.34521	1.04	0.09310	N	1	P;P	0.40931	0.733;0.576	P;B	0.46758	0.526;0.244	T	0.06862	-1.0803	10	0.54805	T	0.06	-1.7909	14.1718	0.65514	0.0:0.1502:0.8498:0.0	.	65;358	B4DET8;Q5T1N1	.;AKND1_HUMAN	I	358;65;358;358	ENSP00000359018:T358I;ENSP00000349968:T65I;ENSP00000359011:T358I;ENSP00000359012:T358I	ENSP00000349968:T65I	T	-	2	0	AKNAD1	109193166	0.022000	0.18835	0.003000	0.11579	0.010000	0.07245	2.190000	0.42630	1.342000	0.45619	0.561000	0.74099	ACC			0.378	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030923.2		NM_152763	
DENND4B	9909	mdanderson.org	37	1	153914440	153914440	+	Silent	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:153914440C>T	ENST00000361217.4	-	6	1378	c.960G>A	c.(958-960)gtG>gtA	p.V320V		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	320	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGCGGGACAGCACAGCGATGG	0.692																																					p.V320V													DENND4B_ENST00000361217,NS,carcinoma,-1,2	DENND4B_ENST00000361217	-1	2	0			c.G960A												31.0	38.0	36.0					1																	153914440		2167	4257	6424	SO:0001819	synonymous_variant	9909	exon6			GGACAGCACAGCG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.960G>A	1.37:g.153914440C>T			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_014856	35	0.00	0	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359960	0.24598	.	.	ENSG00000198837	ENST00000472932	.	.	.	4.39	1.36	0.22044	.	.	.	.	.	T	0.46541	0.1398	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51092	-0.8749	5	0.87932	D	0	-17.3499	5.0801	0.14651	0.0:0.4917:0.2401:0.2682	.	.	.	.	Y	169	.	ENSP00000435709:C169Y	C	-	2	0	DENND4B	152181064	0.316000	0.24580	0.999000	0.59377	0.894000	0.52154	-0.380000	0.07427	0.483000	0.27608	-0.448000	0.05591	TGC			0.692	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090278.2		XM_375806	
SOX13	9580	mdanderson.org	37	1	204092289	204092289	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr1:204092289G>A	ENST00000367204.1	+	11	1293	c.1184G>A	c.(1183-1185)gGc>gAc	p.G395D		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	395					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CTGGAGGACGGCTGTGTGCAC	0.622																																					p.G395D													.	.			0			c.G1184A												76.0	86.0	83.0					1																	204092289		2143	4259	6402	SO:0001583	missense	9580	exon11			AGGACGGCTGTGT		CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1184G>A	1.37:g.204092289G>A	ENSP00000356172:p.Gly395Asp		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	115	0.04	5	NM_005686	142	0.00	0	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139861	0.37728	.	.	ENSG00000143842	ENST00000367204	D	0.97752	-4.52	4.96	0.85	0.18980	.	0.747816	0.13749	N	0.365427	D	0.92312	0.7561	N	0.19112	0.55	0.24171	N	0.995624	B;B;B	0.17038	0.006;0.006;0.02	B;B;B	0.14023	0.01;0.005;0.01	D	0.84137	0.0415	10	0.25106	T	0.35	.	6.2573	0.20881	0.2502:0.411:0.3387:0.0	.	262;262;395	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	D	395	ENSP00000356172:G395D	ENSP00000356172:G395D	G	+	2	0	SOX13	202358912	0.057000	0.20700	0.986000	0.45419	0.664000	0.39144	0.028000	0.13644	0.120000	0.18254	0.563000	0.77884	GGC			0.622	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087881.2		NM_005686	
FAM21A	387680	broad.mit.edu	37	10	51826259	51826259	+	5'Flank	DEL	A	A	-	rs368712005		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr10:51826259delA	ENST00000282633.5	+	0	0				FAM21A_ENST00000351071.6_5'Flank|FAM21A_ENST00000314664.7_5'Flank|RP11-324H6.5_ENST00000456967.1_RNA	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A						retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						TAACAAAAGCAAAAAAAAAAA	0.333																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			AAAAGCAAAAAAA	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225		10.37:g.51826259delA	Exception_encountered		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	1	0.00	0	A2A3S2|A2A3U6|Q6DHY0	RNA	DEL	ENST00000282633.5	37	CCDS41527.1																																																																																					0.333	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276917.2		NM_001005751	
DDIT4	54541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	74034751	74034751	+	Silent	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr10:74034751C>T	ENST00000307365.3	+	3	705	c.504C>T	c.(502-504)agC>agT	p.S168S	RP11-442H21.2_ENST00000491934.2_RNA	NM_019058.2	NP_061931.1	Q9NX09	DDIT4_HUMAN	DNA-damage-inducible transcript 4	168					brain development (GO:0007420)|cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of glycolytic process (GO:0045820)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of TOR signaling (GO:0032007)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron death (GO:1901216)|protein complex disassembly (GO:0043241)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|lung(5)|pancreas(1)|prostate(2)|urinary_tract(1)	12						TCGACCCCAGCCTGGTGCCCA	0.687											OREG0020262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S168S													.	.			0			c.C504T												27.0	28.0	28.0					10																	74034751		2202	4300	6502	SO:0001819	synonymous_variant	54541	exon3			CCCCAGCCTGGTG	AK000507	CCDS7315.1	10q22.1	2008-05-14			ENSG00000168209	ENSG00000168209			24944	protein-coding gene	gene with protein product	"""HIF-1 responsive RTP801"""	607729				11884613	Standard	NM_019058		Approved	RTP801, FLJ20500, REDD-1, REDD1, Dig2	uc001jsx.1	Q9NX09	OTTHUMG00000018435	ENST00000307365.3:c.504C>T	10.37:g.74034751C>T			Somatic	72	0	0	1149	WXS	Illumina HiSeq	.	66	0.11	7	NM_019058	401	0.19	78	Q9H0S3	Silent	SNP	ENST00000307365.3	37	CCDS7315.1																																																																																					0.687	DDIT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048577.1		NM_019058	
AP2A2	161	mdanderson.org	37	11	988573	988573	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr11:988573C>T	ENST00000448903.2	+	10	1294	c.1153C>T	c.(1153-1155)Cgg>Tgg	p.R385W	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Missense_Mutation_p.R386W	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	385					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CGTGAGCGTGCGGCAGCGGGC	0.642																																					p.R386W													.	.			0			c.C1156T												116.0	128.0	124.0					11																	988573		2184	4278	6462	SO:0001583	missense	161	exon10			AGCGTGCGGCAGC	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1153C>T	11.37:g.988573C>T	ENSP00000413234:p.Arg385Trp		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001242837	61	0.00	0	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	ENST00000448903.2	37	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339255	0.81911	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	T;T	0.56444	0.46;0.46	3.93	2.99	0.34606	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78780	0.4337	H	0.95114	3.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.84036	0.0362	10	0.87932	D	0	-4.9461	12.333	0.55049	0.3042:0.6958:0.0:0.0	.	386;385	O94973-2;O94973	.;AP2A2_HUMAN	W	385;386;386;122;125	ENSP00000413234:R385W;ENSP00000327694:R386W	ENSP00000327694:R386W	R	+	1	2	AP2A2	978573	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.367000	0.44213	0.924000	0.37069	0.555000	0.69702	CGG			0.642	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000385431.2		NM_012305	
MTL5	9633	mdanderson.org	37	11	68483337	68483337	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr11:68483337G>T	ENST00000255087.5	-	7	1171	c.988C>A	c.(988-990)Cat>Aat	p.H330N		NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	330	CRC. {ECO:0000255|PROSITE- ProRule:PRU00971}.				cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			ATATCATGATGCAAGTTGTTG	0.363																																					p.H330N													.	.			0			c.C988A												100.0	85.0	90.0					11																	68483337		2200	4294	6494	SO:0001583	missense	9633	exon7			CATGATGCAAGTT	U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.988C>A	11.37:g.68483337G>T	ENSP00000255087:p.His330Asn		Somatic	65	0.0153846154	1		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_004923	2	0.00	0	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	37	CCDS8184.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894236	0.33442	.	.	ENSG00000132749	ENST00000255087	T	0.28255	1.62	5.34	4.37	0.52481	Tesmin/TSO1-like, CXC (1);	0.592830	0.17259	N	0.180857	T	0.14570	0.0352	N	0.03154	-0.405	0.46654	D	0.999147	B	0.20459	0.045	B	0.26693	0.072	T	0.10636	-1.0621	10	0.30078	T	0.28	-10.1075	9.6801	0.40065	0.0:0.1521:0.691:0.1569	.	330	Q9Y4I5	MTL5_HUMAN	N	330	ENSP00000255087:H330N	ENSP00000255087:H330N	H	-	1	0	MTL5	68239913	0.254000	0.23992	0.007000	0.13788	0.862000	0.49288	2.752000	0.47516	2.498000	0.84270	0.655000	0.94253	CAT			0.363	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396844.1		NM_004923	
MYO7A	4647	mdanderson.org	37	11	76867113	76867113	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr11:76867113G>T	ENST00000409709.3	+	5	718	c.446G>T	c.(445-447)aGc>aTc	p.S149I	MYO7A_ENST00000409619.2_Missense_Mutation_p.S138I|MYO7A_ENST00000458637.2_Missense_Mutation_p.S149I|MYO7A_ENST00000409893.1_Missense_Mutation_p.S149I	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	149	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AAACGCAACAGCCGAGACCAG	0.562																																					p.S149I													MYO7A,NS,carcinoma,+1,1	MYO7A	1	1	0			c.G446T												43.0	45.0	44.0					11																	76867113		2041	4193	6234	SO:0001583	missense	4647	exon5			GCAACAGCCGAGA	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.446G>T	11.37:g.76867113G>T	ENSP00000386331:p.Ser149Ile		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001127180	3	0.00	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	g	15.08	2.726574	0.48833	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.27	4.11	0.48088	Myosin head, motor domain (2);	0.122439	0.56097	D	0.000028	T	0.66015	0.2747	M	0.69358	2.11	0.31434	N	0.672773	B;B;B	0.23806	0.091;0.004;0.005	B;B;B	0.29440	0.102;0.038;0.049	T	0.68146	-0.5486	10	0.59425	D	0.04	.	5.5192	0.16923	0.4146:0.0:0.5853:0.0	.	149;149;149	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	I	149;149;149;138;148;148;148;148	ENSP00000386331:S149I;ENSP00000386689:S149I;ENSP00000392185:S149I;ENSP00000386635:S138I	ENSP00000345075:S148I	S	+	2	0	MYO7A	76544761	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	3.062000	0.49971	1.111000	0.41721	0.586000	0.80456	AGC			0.562	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000328133.1		NM_000260	
ERC1	23085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1291122	1291122	+	Missense_Mutation	SNP	G	G	C	rs200296939		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr12:1291122G>C	ENST00000397203.2	+	10	2313	c.1907G>C	c.(1906-1908)aGg>aCg	p.R636T	ERC1_ENST00000546231.2_Missense_Mutation_p.R636T|ERC1_ENST00000355446.5_Missense_Mutation_p.R636T|ERC1_ENST00000360905.4_Missense_Mutation_p.R636T|ERC1_ENST00000543086.3_Missense_Mutation_p.R608T|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000589028.1_Missense_Mutation_p.R636T			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	636					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			AAGGAGCAGAGGGACAGAGAT	0.393																																					p.R636T													.	.			0			c.G1907C												70.0	69.0	70.0					12																	1291122		2203	4300	6503	SO:0001583	missense	23085	exon10			AGCAGAGGGACAG	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.1907G>C	12.37:g.1291122G>C	ENSP00000380386:p.Arg636Thr		Somatic	166	0	0		WXS	Illumina HiSeq	.	184	0.07	13	NM_178040	35	0.26	9	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.618899	0.87460	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971;ENST00000536573	T;T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.78194	0.4245	M	0.78456	2.415	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.984;0.997;0.997;0.994	D;P;D;D;D	0.69479	0.955;0.888;0.917;0.917;0.964	T	0.75150	-0.3419	10	0.21014	T	0.42	-14.5487	18.5152	0.90933	0.0:0.0:1.0:0.0	.	384;276;608;608;636	F5H327;F5GZU8;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;.;RB6I2_HUMAN	T	608;636;608;608;336;608;608;336;636;636;636;608;384;276	ENSP00000340054:R608T;ENSP00000380386:R636T;ENSP00000438546:R608T;ENSP00000442976:R336T;ENSP00000442739:R636T;ENSP00000347621:R636T;ENSP00000354158:R636T;ENSP00000410064:R608T	ENSP00000299183:R336T	R	+	2	0	ERC1	1161383	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	9.869000	0.99810	2.380000	0.81148	0.655000	0.94253	AGG			0.393	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398380.2		NM_015064	
PABPC3	5042	hgsc.bcm.edu	37	13	25671967	25671967	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr13:25671967G>T	ENST00000281589.3	+	1	1668	c.1631G>T	c.(1630-1632)aGg>aTg	p.R544M		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	544	PABC. {ECO:0000255|PROSITE- ProRule:PRU00641}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		ACTGCCTCCAGGTTGGCATCT	0.473																																					p.R544M													.	.			0			c.G1631T												103.0	96.0	98.0					13																	25671967		2203	4300	6503	SO:0001583	missense	5042	exon1			CCTCCAGGTTGGC	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1631G>T	13.37:g.25671967G>T	ENSP00000281589:p.Arg544Met		Somatic	78	0	0		WXS	Illumina HiSeq	.	82	0.05	4	NM_030979	3	1.00	3	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.144124	0.00029	.	.	ENSG00000151846	ENST00000281589	T	0.39229	1.09	0.875	-0.617	0.11579	Polyadenylate-binding protein/Hyperplastic disc protein (4);	0.097289	0.41823	N	0.000817	T	0.04724	0.0128	N	0.00020	-2.765	0.22489	N	0.99906	B	0.02656	0.0	B	0.01281	0.0	T	0.44742	-0.9308	10	0.02654	T	1	.	5.0095	0.14304	0.0:0.0:0.3097:0.6903	.	544	Q9H361	PABP3_HUMAN	M	544	ENSP00000281589:R544M	ENSP00000281589:R544M	R	+	2	0	PABPC3	24569967	1.000000	0.71417	0.879000	0.34478	0.018000	0.09664	3.843000	0.55865	-0.179000	0.10654	-0.875000	0.02981	AGG			0.473	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044220.2		NM_030979	
POTEG	404785	broad.mit.edu	37	14	19553750	19553750	+	Missense_Mutation	SNP	A	A	G	rs537237834		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr14:19553750A>G	ENST00000409832.3	+	1	386	c.334A>G	c.(334-336)Agc>Ggc	p.S112G		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	112										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CTGCAGGGGGAGCGGCAAGAG	0.597													A|||	1	0.000199681	0.0	0.0014	5008	,	,		63351	0.0		0.0	False		,,,				2504	0.0				p.S112G													.	POTEG	118		0			c.A334G												318.0	348.0	338.0					14																	19553750		2201	4298	6499	SO:0001583	missense	404785	exon1			AGGGGGAGCGGCA		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.334A>G	14.37:g.19553750A>G	ENSP00000386971:p.Ser112Gly		Somatic	1172	0.002559727	3		WXS	Illumina HiSeq	Phase_I	1187	0.01	6	NM_001005356	0		0	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	a	6.097	0.386241	0.11524	.	.	ENSG00000222036	ENST00000409832	T	0.28454	1.61	0.568	-0.801	0.10893	.	.	.	.	.	T	0.23846	0.0577	L	0.50333	1.59	0.09310	N	1	B	0.22276	0.067	B	0.24006	0.05	T	0.26780	-1.0093	8	0.40728	T	0.16	.	.	.	.	.	112	Q6S5H5	POTEG_HUMAN	G	112	ENSP00000386971:S112G	ENSP00000386971:S112G	S	+	1	0	POTEG	18623750	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.653000	0.05360	-0.370000	0.08016	0.335000	0.21663	AGC			0.597	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408579.1		NM_001005356	
CHGA	1113	broad.mit.edu;mdanderson.org	37	14	93398975	93398975	+	Missense_Mutation	SNP	C	C	T	rs546878181|rs200576557		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr14:93398975C>T	ENST00000216492.5	+	7	1349	c.1069C>T	c.(1069-1071)Cgg>Tgg	p.R357W	CHGA_ENST00000334654.4_Missense_Mutation_p.R206W	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	357					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		GGCTGAGAAGCGGCTGGAGGG	0.662																																					p.R357W	Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)												.	CHGA	32		0			c.C1069T												23.0	17.0	19.0					14																	93398975		2193	4296	6489	SO:0001583	missense	1113	exon7			GAGAAGCGGCTGG		CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.1069C>T	14.37:g.93398975C>T	ENSP00000216492:p.Arg357Trp		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_001275	25	0.00	0	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	37	CCDS9906.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920006	0.52653	.	.	ENSG00000100604	ENST00000216492;ENST00000334654	T;T	0.01838	4.61;4.61	4.51	3.61	0.41365	.	0.543426	0.17573	N	0.169386	T	0.06325	0.0163	L	0.45137	1.4	0.34367	D	0.69163	D;D	0.89917	1.0;0.976	D;P	0.74674	0.984;0.464	T	0.40156	-0.9578	10	0.39692	T	0.17	-15.6645	6.8095	0.23796	0.1767:0.7335:0.0:0.0898	.	206;357	G5E968;P10645	.;CMGA_HUMAN	W	357;206	ENSP00000216492:R357W;ENSP00000334023:R206W	ENSP00000216492:R357W	R	+	1	2	CHGA	92468728	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	1.098000	0.31000	0.845000	0.35118	-0.324000	0.08512	CGG			0.662	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412411.1		NM_001275	
EVL	51466	mdanderson.org	37	14	100593108	100593108	+	Splice_Site	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr14:100593108G>T	ENST00000402714.2	+	5	1085	c.481G>T	c.(481-483)Ggg>Tgg	p.G161W	EVL_ENST00000544450.2_Splice_Site_p.G167W|EVL_ENST00000392920.3_Splice_Site_p.G163W			Q9UI08	EVL_HUMAN	Enah/Vasp-like	161					actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				CTCGGCCACAGGTGAGAGCCC	0.612																																					p.G163W													.	.			0			c.G487T												78.0	78.0	78.0					14																	100593108		2203	4300	6503	SO:0001630	splice_region_variant	51466	exon5			GCCACAGGTGAGA	AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.481+1G>T	14.37:g.100593108G>T			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_016337	130	0.00	0	A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	ENST00000402714.2	37		.	.	.	.	.	.	.	.	.	.	G	24.2	4.504266	0.85176	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000557153;ENST00000557384	T;T;T;T;T	0.71698	-0.55;-0.58;-0.55;-0.59;0.84	4.98	4.98	0.66077	.	0.138361	0.48767	D	0.000163	D	0.83394	0.5245	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.98;0.999	D	0.84974	0.0884	10	0.62326	D	0.03	-10.2596	17.2131	0.86935	0.0:0.0:1.0:0.0	.	167;163;161	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	W	161;167;163;163;148;57	ENSP00000384720:G161W;ENSP00000437904:G167W;ENSP00000376652:G163W;ENSP00000452327:G148W;ENSP00000450979:G57W	ENSP00000376652:G163W	G	+	1	0	EVL	99662861	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.883000	0.75595	2.468000	0.83385	0.655000	0.94253	GGG			0.612	EVL-006	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000413958.1			Missense_Mutation
MYO5A	4644	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	52671830	52671830	+	Silent	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr15:52671830G>A	ENST00000399231.3	-	18	2443	c.2200C>T	c.(2200-2202)Ctg>Ttg	p.L734L	MYO5A_ENST00000399233.2_Silent_p.L734L|MYO5A_ENST00000356338.6_Silent_p.L734L|MYO5A_ENST00000358212.6_Silent_p.L734L|MYO5A_ENST00000553916.1_Silent_p.L734L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	734	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		ACCAGTATCAGTTTCTCTAAC	0.433																																					p.L734L													.	.			0			c.C2200T												155.0	148.0	151.0					15																	52671830		1912	4148	6060	SO:0001819	synonymous_variant	4644	exon18			GTATCAGTTTCTC		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.2200C>T	15.37:g.52671830G>A			Somatic	106	0	0		WXS	Illumina HiSeq	.	138	0.07	9	NM_000259	50	0.16	8	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	ENST00000399231.3	37	CCDS42037.1																																																																																					0.433	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000268102.1		NM_000259	
ADPGK	83440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	73044820	73044820	+	Silent	SNP	T	T	C			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr15:73044820T>C	ENST00000311669.8	-	7	1446	c.1353A>G	c.(1351-1353)gtA>gtG	p.V451V	ADPGK_ENST00000456471.2_Silent_p.V177V	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	452	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						GCCATTCTACTACTGGCTTGT	0.507																																					p.V451V													.	.			0			c.A1353G												105.0	105.0	105.0					15																	73044820		1894	4113	6007	SO:0001819	synonymous_variant	83440	exon7			TTCTACTACTGGC	AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.1353A>G	15.37:g.73044820T>C			Somatic	156	0	0		WXS	Illumina HiSeq	.	164	0.10	17	NM_031284	154	0.17	26	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Silent	SNP	ENST00000311669.8	37	CCDS42057.1	.	.	.	.	.	.	.	.	.	.	T	2.561	-0.301815	0.05495	.	.	ENSG00000159322	ENST00000331065	.	.	.	5.84	-11.7	0.00046	.	.	.	.	.	T	0.19167	0.0460	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.12268	-1.0554	5	0.06099	T	0.92	-26.3022	5.5851	0.17269	0.1436:0.5544:0.2295:0.0725	.	.	.	.	G	329	.	ENSP00000332964:S329G	S	-	1	0	ADPGK	70831873	0.000000	0.05858	0.001000	0.08648	0.440000	0.31957	-2.435000	0.01020	-2.379000	0.00595	-1.148000	0.01847	AGT			0.507	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000420434.1		NM_031284	
C16orf89	146556	mdanderson.org	37	16	5112523	5112523	+	Silent	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr16:5112523C>T	ENST00000315997.5	-	2	462	c.261G>A	c.(259-261)ccG>ccA	p.P87P	C16orf89_ENST00000350219.4_Silent_p.P125P|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000472572.3_Silent_p.P87P|C16orf89_ENST00000422873.1_Silent_p.P125P|C16orf89_ENST00000474471.3_Silent_p.P87P	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	87						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						GCAGGCTCAGCGGCTGCAGCA	0.567																																					p.P87P													C16orf89_ENST00000422873,NS,carcinoma,-1,3	C16orf89_ENST00000422873	-1	3	0			c.G261A												54.0	58.0	57.0					16																	5112523		1936	4146	6082	SO:0001819	synonymous_variant	146556	exon2			GCTCAGCGGCTGC		CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.261G>A	16.37:g.5112523C>T			Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	83	0.05	4	NM_001098514	1	0.00	0	B4DUM5|Q8N2I3|Q8N4T1	Silent	SNP	ENST00000315997.5	37	CCDS42116.2																																																																																					0.567	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000354524.1		NM_152459	
SNX29P1	100652781	hgsc.bcm.edu	37	16	21396860	21396860	+	IGR	SNP	T	T	C	rs368310563		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr16:21396860T>C								CRYM-AS1 (66948 upstream) : NPIPB3 (16697 downstream)																							cttttttttcttttttttttt	0.348																																					.													.	.			0			.												8.0	8.0	8.0					16																	21396860		691	1582	2273	SO:0001628	intergenic_variant	100652781	.			TTTTTCTTTTTTT																													16.37:g.21396860T>C			Somatic	128	0	0		WXS	Illumina HiSeq	.	137	0.06	8	.	0		0		RNA	SNP		37																																																																																					0	0.348										
SLC12A3	6559	mdanderson.org	37	16	56906331	56906331	+	Silent	SNP	C	C	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr16:56906331C>A	ENST00000563236.1	+	7	946	c.921C>A	c.(919-921)ccC>ccA	p.P307P	SLC12A3_ENST00000566786.1_Silent_p.P306P|SLC12A3_ENST00000438926.2_Silent_p.P307P|SLC12A3_ENST00000262502.5_Silent_p.P306P			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	307					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CGCTGATCCCCCCATCTGAGG	0.582																																					p.P307P													.	.			0			c.C921A												91.0	82.0	85.0					16																	56906331		2198	4300	6498	SO:0001819	synonymous_variant	6559	exon7			GATCCCCCCATCT		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.921C>A	16.37:g.56906331C>A			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001126108	8	0.00	0	A8MSJ2|C9JNN9	Silent	SNP	ENST00000563236.1	37	CCDS58464.1																																																																																					0.582	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000432337.1			
CENPT	80152	mdanderson.org	37	16	67860079	67860079	+	IGR	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr16:67860079G>A	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Missense_Mutation_p.R336H|TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.R321H|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.R390H	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GGCCCAGAGCGCTGGCAGATG	0.647																																					p.R336H													.	.			0			c.G1007A												34.0	38.0	36.0					16																	67860079		2198	4300	6498	SO:0001628	intergenic_variant	55815	exon10			CAGAGCGCTGGCA	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			16.37:g.67860079G>A			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_018430	1	0.00	0	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	37	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752065	0.69533	.	.	ENSG00000102904	ENST00000415766;ENST00000388833;ENST00000431934	.	.	.	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000001	T	0.79476	0.4452	M	0.70275	2.135	0.51233	D	0.99991	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999	T	0.80228	-0.1469	9	0.87932	D	0	-12.2292	18.1584	0.89701	0.0:0.0:1.0:0.0	.	321;390;126;44;336;321	E7ENJ7;B4DXD0;B4DY78;Q2TAA8-2;Q2TAA8;B4E1H3	.;.;.;.;TXIP1_HUMAN;.	H	321;336;126	.	ENSP00000373485:R336H	R	+	2	0	TSNAXIP1	66417580	1.000000	0.71417	0.998000	0.56505	0.461000	0.32589	4.377000	0.59562	2.825000	0.97269	0.655000	0.94253	CGC			0.647	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000422020.1		NM_025082	
CDC27	996	mdanderson.org	37	17	45234325	45234325	+	Nonsense_Mutation	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr17:45234325G>A	ENST00000066544.3	-	7	889	c.796C>T	c.(796-798)Cga>Tga	p.R266*	CDC27_ENST00000531206.1_Nonsense_Mutation_p.R266*|CDC27_ENST00000527547.1_Nonsense_Mutation_p.R266*|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Nonsense_Mutation_p.R205*	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	266					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AATAAACTTCGACCAGTTTTT	0.363																																					p.R266X													.	.			0			c.C796T												60.0	65.0	63.0					17																	45234325		2200	4295	6495	SO:0001587	stop_gained	996	exon7			AACTTCGACCAGT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.796C>T	17.37:g.45234325G>A	ENSP00000066544:p.Arg266*		Somatic	48	0.0208333333	1		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001114091	63	0.00	0	G3V1C4|Q16349|Q96F35	Nonsense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117088	0.77323	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	.	.	.	5.64	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.5002	13.5956	0.61987	0.0:0.0:0.8433:0.1567	.	.	.	.	X	266;266;205;266;266	.	ENSP00000066544:R266X	R	-	1	2	CDC27	42589324	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.123000	0.71614	1.354000	0.45846	0.460000	0.39030	CGA			0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			
CANT1	124583	broad.mit.edu	37	17	76993313	76993313	+	Missense_Mutation	SNP	T	T	C			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr17:76993313T>C	ENST00000302345.2	-	2	886	c.392A>G	c.(391-393)aAg>aGg	p.K131R	CANT1_ENST00000392446.5_Missense_Mutation_p.K131R|CANT1_ENST00000591732.1_5'Flank|CANT1_ENST00000591773.1_Missense_Mutation_p.K131R	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	131					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|proteoglycan biosynthetic process (GO:0030166)|signal transduction (GO:0007165)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|signal transducer activity (GO:0004871)|uridine-diphosphatase activity (GO:0045134)		CANT1/ETV4(3)	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			CAGGTAGCCCTTTTTCAGGTA	0.577			T	ETV4	prostate																																p.K131R				Dom	yes		17	17q25	124583	calcium activated nucleotidase 1		E	CANT1,NS,carcinoma,0,1	CANT1	39	1	0			c.A392G												184.0	181.0	182.0					17																	76993313		2203	4300	6503	SO:0001583	missense	124583	exon4			TAGCCCTTTTTCA	AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302			19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165				12167635	Standard	NM_138793		Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.392A>G	17.37:g.76993313T>C	ENSP00000307674:p.Lys131Arg		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	119	0.03	3	NM_001159772	50	0.00	0	B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	Missense_Mutation	SNP	ENST00000302345.2	37	CCDS11760.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.501139	0.26861	.	.	ENSG00000171302	ENST00000302345;ENST00000392446;ENST00000537282;ENST00000339300	D;D	0.85773	-2.03;-2.03	5.27	4.19	0.49359	.	0.099573	0.64402	D	0.000002	T	0.71065	0.3296	N	0.20357	0.565	0.50632	D	0.999887	B	0.06786	0.001	B	0.10450	0.005	T	0.59440	-0.7454	10	0.13108	T	0.6	-30.8089	8.2417	0.31665	0.0:0.1541:0.0:0.8459	.	131	Q8WVQ1	CANT1_HUMAN	R	131;131;131;80	ENSP00000307674:K131R;ENSP00000376241:K131R	ENSP00000307674:K131R	K	-	2	0	CANT1	74504908	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.832000	0.39151	0.845000	0.35118	0.459000	0.35465	AAG			0.577	CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437723.2		NM_138793	
ENOSF1	55556	broad.mit.edu	37	18	712489	712497	+	Intron	DEL	GGCGTCCGC	GGCGTCCGC	-	rs539018057	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	GGCGTCCGC	GGCGTCCGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr18:712489_712497delGGCGTCCGC	ENST00000251101.7	-	1	173				ENOSF1_ENST00000580982.1_Intron|ENOSF1_ENST00000340116.7_In_Frame_Del_p.ADA4del|ENOSF1_ENST00000539164.1_Intron|ENOSF1_ENST00000383578.3_Intron	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1						cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						CGCTTACCATGGCGTCCGCGCTTACCATG	0.703														7	0.00139776	0.0	0.0043	5008	,	,		16014	0.0		0.004	False		,,,				2504	0.0				p.4_6del													.	ENOSF1	44		0			c.10_18del								,,	18,2376		9,0,1188					,,	0.9	0.0			3	64,4692		28,8,2342	no	coding,intron,intron	ENOSF1	NM_202758.3,NM_017512.5,NM_001126123.3	,,	37,8,3530	A1A1,A1R,RR		1.3457,0.7519,1.1469	,,	,,		82,7068				SO:0001627	intron_variant	55556	exon1			TACCATGGCGTCC	X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.84+6GCGGACGCC>-	18.37:g.712489_712497delGGCGTCCGC			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	8	0.50	4	NM_202758	1	0.00	0	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	In_Frame_Del	DEL	ENST00000251101.7	37	CCDS11822.1																																																																																					0.703	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254312.2		NM_017512	
KLHL14	57565	mdanderson.org	37	18	30260557	30260557	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr18:30260557G>T	ENST00000359358.4	-	6	1682	c.1244C>A	c.(1243-1245)gCc>gAc	p.A415D		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	415						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						ATAGAAACTGGCTCTTCTACA	0.428																																					p.A415D													.	.			0			c.C1244A												45.0	42.0	43.0					18																	30260557		2203	4300	6503	SO:0001583	missense	57565	exon6			AAACTGGCTCTTC	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1244C>A	18.37:g.30260557G>T	ENSP00000352314:p.Ala415Asp		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_020805	0		0	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557057	0.86231	.	.	ENSG00000197705	ENST00000359358	T	0.79033	-1.23	5.57	5.57	0.84162	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.84692	0.5528	L	0.41492	1.28	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.84419	0.0570	10	0.52906	T	0.07	.	19.9024	0.96993	0.0:0.0:1.0:0.0	.	415	Q9P2G3	KLH14_HUMAN	D	415	ENSP00000352314:A415D	ENSP00000352314:A415D	A	-	2	0	KLHL14	28514555	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.642000	0.83385	2.775000	0.95449	0.650000	0.86243	GCC			0.428	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448376.1			
FZR1	51343	mdanderson.org	37	19	3525890	3525890	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr19:3525890A>G	ENST00000395095.3	+	2	94	c.94A>G	c.(94-96)Acg>Gcg	p.T32A	FZR1_ENST00000313639.8_Missense_Mutation_p.T32A|FZR1_ENST00000441788.2_Missense_Mutation_p.T32A	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	32					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGACCCTGACGCCTGCCAG	0.647																																					p.T32A													.	.			0			c.A94G												36.0	36.0	36.0					19																	3525890		2203	4298	6501	SO:0001583	missense	51343	exon3			ACCCTGACGCCTG	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.94A>G	19.37:g.3525890A>G	ENSP00000378529:p.Thr32Ala		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	60	0.05	3	NM_016263	87	0.00	0	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	A	12.20	1.866936	0.32977	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.07908	3.15;3.15;3.15	4.66	3.63	0.41609	.	0.055339	0.64402	D	0.000001	T	0.07143	0.0181	L	0.35487	1.065	0.27626	N	0.948195	B;B;B	0.20052	0.0;0.041;0.001	B;B;B	0.17433	0.001;0.018;0.006	T	0.15636	-1.0430	10	0.52906	T	0.07	-25.4413	9.4626	0.38794	0.9114:0.0:0.0886:0.0	.	32;32;32	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	A	32	ENSP00000410369:T32A;ENSP00000378529:T32A;ENSP00000321800:T32A	ENSP00000321800:T32A	T	+	1	0	FZR1	3476890	1.000000	0.71417	0.945000	0.38365	0.545000	0.35147	8.755000	0.91646	1.731000	0.51592	0.459000	0.35465	ACG			0.647	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000452869.2		NM_016263	
MAG	4099	mdanderson.org	37	19	35800791	35800791	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr19:35800791C>T	ENST00000392213.3	+	8	1405	c.1246C>T	c.(1246-1248)Ctc>Ttc	p.L416F	MAG_ENST00000361922.4_Missense_Mutation_p.L416F|MAG_ENST00000593348.1_3'UTR|MAG_ENST00000537831.2_Missense_Mutation_p.L391F	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	416	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCTGTGCTCCTCCTGGAGTC	0.687																																					p.L416F													.	.			0			c.C1246T												67.0	75.0	72.0					19																	35800791		2203	4299	6502	SO:0001583	missense	4099	exon8			GTGCTCCTCCTGG	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1246C>T	19.37:g.35800791C>T	ENSP00000376048:p.Leu416Phe		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_080600	1	0.00	0	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	37	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976564	0.74360	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.13196	2.61;2.61;2.61	5.33	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	L	0.32530	0.975	0.54753	D	0.999981	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.85130	0.994;0.99;0.997	T	0.00699	-1.1604	10	0.48119	T	0.1	.	13.1496	0.59482	0.0:0.8381:0.1619:0.0	.	453;416;416	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	F	453;416;416;391	ENSP00000355234:L416F;ENSP00000376048:L416F;ENSP00000440695:L391F	ENSP00000262624:L453F	L	+	1	0	MAG	40492631	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	2.740000	0.47418	2.497000	0.84241	0.462000	0.41574	CTC			0.687	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466071.1		NM_080600	
NR1H2	7376	mdanderson.org	37	19	50881647	50881647	+	Silent	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr19:50881647C>T	ENST00000253727.5	+	5	658	c.423C>T	c.(421-423)tgC>tgT	p.C141C	NR1H2_ENST00000599105.1_Silent_p.C141C|NR1H2_ENST00000411902.2_Intron|NR1H2_ENST00000542413.1_Intron|NR1H2_ENST00000593926.1_Silent_p.C141C|NR1H2_ENST00000598168.1_Silent_p.C141C	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	141					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		GGCGCAAGTGCCAGCAGTGCC	0.706																																					p.C141C													.	.			0			c.C423T												28.0	34.0	32.0					19																	50881647		2192	4290	6482	SO:0001819	synonymous_variant	7376	exon5			CAAGTGCCAGCAG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.423C>T	19.37:g.50881647C>T			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_007121	112	0.00	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	CCDS42593.1																																																																																					0.706	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464724.2			
NLRP5	126206	mdanderson.org	37	19	56515190	56515190	+	Silent	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr19:56515190G>A	ENST00000390649.3	+	2	171	c.171G>A	c.(169-171)tcG>tcA	p.S57S		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	57	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GAGACAAATCGCTCACCTTTT	0.423																																					p.S57S													NLRP5_ENST00000390649,NS,carcinoma,0,2	NLRP5_ENST00000390649	0	2	0			c.G171A												119.0	111.0	113.0					19																	56515190		1866	4108	5974	SO:0001819	synonymous_variant	126206	exon2			CAAATCGCTCACC	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.171G>A	19.37:g.56515190G>A			Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_153447	0		0	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	37	CCDS12938.1																																																																																					0.423	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313735.1		NM_153447	
EPAS1	2034	broad.mit.edu	37	2	46605204	46605204	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr2:46605204G>C	ENST00000263734.3	+	10	1931	c.1421G>C	c.(1420-1422)aGc>aCc	p.S474T		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	474	Poly-Ser.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			AGTGCCACCAGCAGCAGCAGC	0.647																																					p.S474T													.	EPAS1	83		0			c.G1421C												11.0	11.0	11.0					2																	46605204		2187	4279	6466	SO:0001583	missense	2034	exon10			CCACCAGCAGCAG	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1421G>C	2.37:g.46605204G>C	ENSP00000263734:p.Ser474Thr		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	83	0.04	3	NM_001430	91	0.00	0	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	G	7.913	0.736896	0.15574	.	.	ENSG00000116016	ENST00000263734	T	0.52057	0.68	0.355	0.355	0.16069	.	0.384965	0.33875	N	0.004469	T	0.31606	0.0802	L	0.46157	1.445	0.26854	N	0.968104	B	0.31931	0.347	B	0.20577	0.03	T	0.15065	-1.0450	9	0.41790	T	0.15	.	.	.	.	.	474	Q99814	EPAS1_HUMAN	T	474	ENSP00000263734:S474T	ENSP00000263734:S474T	S	+	2	0	EPAS1	46458708	0.936000	0.31750	0.816000	0.32577	0.971000	0.66376	0.064000	0.14437	0.458000	0.26988	0.089000	0.15464	AGC			0.647	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250752.2		NM_001430	
PUS10	150962	broad.mit.edu	37	2	61238921	61238921	+	Silent	SNP	T	T	G	rs541492398	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr2:61238921T>G	ENST00000316752.6	-	2	366	c.105A>C	c.(103-105)gcA>gcC	p.A35A	PUS10_ENST00000407787.1_Silent_p.A35A|PUS10_ENST00000398658.2_Silent_p.A35A	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	35					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			GTTTGTAAGGTGCATGAAAAT	0.353													T|||	47	0.00938498	0.0144	0.0086	5008	,	,		14637	0.003		0.007	False		,,,				2504	0.0123				p.A35A													.	PUS10	49		0			c.A105C												67.0	60.0	63.0					2																	61238921		2203	4300	6503	SO:0001819	synonymous_variant	150962	exon2			GTAAGGTGCATGA	AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.105A>C	2.37:g.61238921T>G			Somatic	53	0.0943396226	5		WXS	Illumina HiSeq	Phase_I	73	0.21	15	NM_144709	15	0.00	0	Q5JPJ5|Q96MI8	Silent	SNP	ENST00000316752.6	37	CCDS1865.1																																																																																					0.353	PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251582.2		NM_144709	
TBC1D8	11138	mdanderson.org	37	2	101643904	101643904	+	Missense_Mutation	SNP	C	C	T	rs201720097	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr2:101643904C>T	ENST00000376840.4	-	15	2415	c.2416G>A	c.(2416-2418)Gtt>Att	p.V806I	TBC1D8_ENST00000409318.1_Missense_Mutation_p.V821I			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	806					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TCCGGGATAACGACTCGAAGC	0.542																																					p.V806I													.	.			0			c.G2416A												77.0	78.0	77.0					2																	101643904		1906	4129	6035	SO:0001583	missense	11138	exon15			GGATAACGACTCG	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.2416G>A	2.37:g.101643904C>T	ENSP00000366036:p.Val806Ile		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001102426	29	0.00	0	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	ENST00000376840.4	37	CCDS46375.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978475	0.34942	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.53640	0.61;0.61	5.18	5.18	0.71444	.	0.000000	0.53938	D	0.000043	T	0.55940	0.1952	L	0.35249	1.045	0.35866	D	0.827878	D	0.89917	1.0	D	0.85130	0.997	T	0.53173	-0.8476	10	0.11485	T	0.65	-26.3154	17.2377	0.87004	0.0:1.0:0.0:0.0	.	806	O95759	TBCD8_HUMAN	I	806;821	ENSP00000366036:V806I;ENSP00000386856:V821I	ENSP00000366036:V806I	V	-	1	0	TBC1D8	101010336	0.993000	0.37304	0.151000	0.22473	0.883000	0.51084	3.810000	0.55613	2.554000	0.86153	0.655000	0.94253	GTT			0.542	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376092.1		NM_007063	
KLHL30	377007	broad.mit.edu	37	2	239059588	239059588	+	Missense_Mutation	SNP	G	G	T	rs535668533	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr2:239059588G>T	ENST00000409223.1	+	8	1726	c.1619G>T	c.(1618-1620)cGg>cTg	p.R540L	KLHL30_ENST00000305959.4_Missense_Mutation_p.R522L			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	540										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GACACGGTTCGGGACACCTGG	0.692																																					p.R540L													.	KLHL30	79		0			c.G1619T												15.0	22.0	19.0					2																	239059588		2117	4203	6320	SO:0001583	missense	377007	exon8			CGGTTCGGGACAC		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1619G>T	2.37:g.239059588G>T	ENSP00000386389:p.Arg540Leu		Somatic	143	0.006993007	1		WXS	Illumina HiSeq	Phase_I	117	0.03	3	NM_198582	0		0	Q6ZUS1	Missense_Mutation	SNP	ENST00000409223.1	37	CCDS46555.2	.	.	.	.	.	.	.	.	.	.	G	4.485	0.089861	0.08632	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	T;T	0.64438	-0.1;-0.1	4.66	1.81	0.25067	Kelch-type beta propeller (1);	0.419762	0.22183	N	0.063475	T	0.44307	0.1287	L	0.38175	1.15	0.09310	N	1	P	0.38992	0.653	B	0.36504	0.226	T	0.24584	-1.0156	10	0.35671	T	0.21	.	4.7212	0.12918	0.3394:0.1536:0.5071:0.0	.	540	Q0D2K2	KLH30_HUMAN	L	540;522	ENSP00000386389:R540L;ENSP00000302386:R522L	ENSP00000302386:R522L	R	+	2	0	KLHL30	238724327	0.000000	0.05858	0.008000	0.14137	0.199000	0.23934	1.103000	0.31062	0.584000	0.29591	-0.254000	0.11334	CGG			0.692	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328518.1		NM_198582	
LINC01598	105379478	broad.mit.edu	37	20	29595756	29595757	+	RNA	INS	-	-	T	rs368096278|rs138415542		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr20:29595756_29595757insT	ENST00000432067.1	-	0	74																											tgtggtggctcttgcctgtcat	0.54																																					.													.	.			0			.																																											0	.			GTGGCTCTTGCCT																													20.37:g.29595758_29595758dupT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.67	4	.	0		0		RNA	INS	ENST00000432067.1	37																																																																																						0.540	RP4-610C12.1-002	KNOWN	basic	antisense	antisense		OTTHUMT00000078489.3			
FRG1B	284802	hgsc.bcm.edu	37	20	29625854	29625854	+	Intron	SNP	C	C	G			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr20:29625854C>G	ENST00000278882.3	+	5	496				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TAACTTTTATCTATCTTATTA	0.348																																					.													.	.			0			.																																									SO:0001627	intron_variant	284802	.			TTTTATCTATCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.117-19C>G	20.37:g.29625854C>G			Somatic	126	0	0		WXS	Illumina HiSeq	.	118	0.04	5	.	1	0.00	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																						0.348	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
FRG1B	284802	hgsc.bcm.edu	37	20	29625856	29625856	+	Intron	SNP	A	A	G			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr20:29625856A>G	ENST00000278882.3	+	5	496				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ACTTTTATCTATCTTATTAAT	0.353																																					.													.	.			0			.																																									SO:0001627	intron_variant	284802	.			TTATCTATCTTAT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.117-17A>G	20.37:g.29625856A>G			Somatic	126	0	0		WXS	Illumina HiSeq	.	120	0.04	5	.	1	0.00	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																						0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
RALY	22913	bcgsc.ca;mdanderson.org	37	20	32664877	32664877	+	Silent	SNP	C	C	T	rs539352667	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr20:32664877C>T	ENST00000246194.3	+	8	1204	c.702C>T	c.(700-702)ggC>ggT	p.G234G	RALY_ENST00000375114.3_Silent_p.G218G	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	234	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						gcggcggcggcggtggtggtg	0.667																																					p.G234G													.	RALY	44		0			c.C702T												5.0	7.0	7.0					20																	32664877		2080	4086	6166	SO:0001819	synonymous_variant	22913	exon8			CGGCGGCGGTGGT	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.702C>T	20.37:g.32664877C>T			Somatic	97	0.0103092784	1		WXS	Illumina HiSeq	Phase_1	83	0.07	6	NM_016732	127	0.00	0	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	ENST00000246194.3	37	CCDS13230.1																																																																																					0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078753.1			
AMOTL2	51421	mdanderson.org	37	3	134084676	134084676	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr3:134084676G>A	ENST00000422605.2	-	5	1428	c.1262C>T	c.(1261-1263)gCc>gTc	p.A421V	AMOTL2_ENST00000513145.1_Missense_Mutation_p.A421V|AMOTL2_ENST00000511759.1_5'Flank|AMOTL2_ENST00000514516.1_Missense_Mutation_p.A479V|AMOTL2_ENST00000249883.5_Missense_Mutation_p.A421V			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	421					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						AAGCAGCTTGGCCACCATGTC	0.572																																					p.A421V													.	.			0			c.C1262T												92.0	89.0	90.0					3																	134084676		2203	4300	6503	SO:0001583	missense	51421	exon5			AGCTTGGCCACCA	AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.1262C>T	3.37:g.134084676G>A	ENSP00000409999:p.Ala421Val		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_016201	15	0.00	0	A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Missense_Mutation	SNP	ENST00000422605.2	37		.	.	.	.	.	.	.	.	.	.	G	21.4	4.148941	0.78001	.	.	ENSG00000114019	ENST00000249883;ENST00000422605;ENST00000514516;ENST00000513145	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	4.63	4.63	0.57726	.	0.123656	0.56097	D	0.000030	T	0.25938	0.0632	L	0.52573	1.65	0.58432	D	0.999992	P;P;P	0.38020	0.607;0.607;0.615	B;B;B	0.33121	0.12;0.12;0.158	T	0.11446	-1.0587	10	0.54805	T	0.06	-17.4922	17.6746	0.88227	0.0:0.0:1.0:0.0	.	421;421;479	Q9Y2J4-3;Q9Y2J4-2;E9PHW3	.;.;.	V	421;421;479;421	ENSP00000249883:A421V;ENSP00000409999:A421V;ENSP00000424765:A479V;ENSP00000425475:A421V	ENSP00000249883:A421V	A	-	2	0	AMOTL2	135567366	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.014000	0.76380	2.401000	0.81631	0.305000	0.20034	GCC			0.572	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000358149.1		NM_016201	
CRIPAK	285464	bcgsc.ca	37	4	1389076	1389076	+	Silent	SNP	C	C	T	rs113118213	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr4:1389076C>T	ENST00000324803.4	+	1	3737	c.777C>T	c.(775-777)ccC>ccT	p.P259P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	259					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GTGGAGTGCCCGCCTGCTCAC	0.692																																					p.P259P													.	CRIPAK	185		0			c.C777T							C		15,4389		0,15,2187	154.0	138.0	144.0		777	-1.6	0.0	4	dbSNP_132	144	9,8589		0,9,4290	no	coding-synonymous	CRIPAK	NM_175918.3		0,24,6477	TT,TC,CC		0.1047,0.3406,0.1846		259/447	1389076	24,12978	2202	4299	6501	SO:0001819	synonymous_variant	285464	exon1			AGTGCCCGCCTGC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.777C>T	4.37:g.1389076C>T			Somatic	42	0.0476190476	2		WXS	Illumina HiSeq	Phase_1	23	0.22	5	NM_175918	7	0.00	0	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																					0.692	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241607.2		NM_175918	
CABS1	85438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71201486	71201486	+	Missense_Mutation	SNP	C	C	G			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr4:71201486C>G	ENST00000273936.5	+	1	804	c.730C>G	c.(730-732)Cta>Gta	p.L244V		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	244					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CGAAATTGACCTAAGTGTTTT	0.413																																					p.L244V													.	.			0			c.C730G												107.0	106.0	106.0					4																	71201486		2203	4300	6503	SO:0001583	missense	85438	exon1			ATTGACCTAAGTG	AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.730C>G	4.37:g.71201486C>G	ENSP00000273936:p.Leu244Val		Somatic	86	0	0		WXS	Illumina HiSeq	.	69	0.22	15	NM_033122	0		0	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	ENST00000273936.5	37	CCDS3539.1	.	.	.	.	.	.	.	.	.	.	C	7.934	0.741375	0.15642	.	.	ENSG00000145309	ENST00000273936	T	0.38887	1.11	4.01	-3.6	0.04570	.	0.000000	0.32533	N	0.005967	T	0.43875	0.1267	L	0.34521	1.04	0.09310	N	1	D	0.76494	0.999	D	0.83275	0.996	T	0.42916	-0.9423	10	0.31617	T	0.26	-18.1413	10.0362	0.42131	0.0:0.509:0.0:0.491	.	244	Q96KC9	CABS1_HUMAN	V	244	ENSP00000273936:L244V	ENSP00000273936:L244V	L	+	1	2	CABS1	71236075	0.000000	0.05858	0.006000	0.13384	0.017000	0.09413	-1.020000	0.03618	-0.764000	0.04651	-0.137000	0.14449	CTA			0.413	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251561.3		NM_033122	
NKD2	85409	broad.mit.edu	37	5	1038447	1038449	+	In_Frame_Del	DEL	CAC	CAC	-	rs3840989		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	CAC	CAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr5:1038447_1038449delCAC	ENST00000296849.5	+	10	1544_1546	c.1315_1317delCAC	c.(1315-1317)cacdel	p.H447del	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_In_Frame_Del_p.P86del	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	447	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccacgagcaccaccaccacc	0.69																																					p.439_439del													.	NKD2	39		0			c.1315_1317del																																									SO:0001651	inframe_deletion	85409	exon10			CACGAGCACCACC	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1315_1317delCAC	5.37:g.1038456_1038458delCAC	ENSP00000296849:p.His447del		Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	NM_033120	62	0.00	0	Q96EK8|Q9BSN0	In_Frame_Del	DEL	ENST00000296849.5	37	CCDS3859.1																																																																																					0.690	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000206720.2		NM_033120	
CEP120	153241	mdanderson.org	37	5	122729128	122729128	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr5:122729128G>T	ENST00000306467.5	-	6	980	c.676C>A	c.(676-678)Ctg>Atg	p.L226M	CEP120_ENST00000395431.2_Missense_Mutation_p.L226M|CEP120_ENST00000328236.5_Missense_Mutation_p.L226M|CEP120_ENST00000306481.6_Missense_Mutation_p.L200M			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	226					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						TCATTTCCCAGTAAAGAGTAG	0.353																																					p.L226M													.	.			0			c.C676A												121.0	119.0	120.0					5																	122729128		1826	4083	5909	SO:0001583	missense	153241	exon7			TTCCCAGTAAAGA	AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.676C>A	5.37:g.122729128G>T	ENSP00000303058:p.Leu226Met		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	87	0.05	4	NM_153223	20	0.00	0	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Missense_Mutation	SNP	ENST00000306467.5	37	CCDS4134.2	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113755	0.56398	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481;ENST00000508442;ENST00000395431	T;T;T;T	0.59638	1.58;1.58;1.58;0.25	5.69	2.94	0.34122	.	0.000000	0.64402	D	0.000003	T	0.68604	0.3019	L	0.58669	1.825	0.47123	D	0.999325	D	0.89917	1.0	D	0.91635	0.999	T	0.64198	-0.6464	10	0.38643	T	0.18	-10.1919	10.5241	0.44936	0.3215:0.0:0.6785:0.0	.	226	Q8N960	CE120_HUMAN	M	226;226;200;200;226	ENSP00000303058:L226M;ENSP00000327504:L226M;ENSP00000307419:L200M;ENSP00000421620:L200M	ENSP00000303058:L226M	L	-	1	2	CEP120	122757027	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.067000	0.41461	0.342000	0.23796	0.591000	0.81541	CTG			0.353	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250899.2		NM_153223	
TCTE1	202500	broad.mit.edu;mdanderson.org	37	6	44268395	44268395	+	5'Flank	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr6:44268395G>A	ENST00000371505.4	-	0	0				RP11-444E17.6_ENST00000505802.1_Intron|AARS2_ENST00000491573.1_5'UTR|TMEM151B_ENST00000438774.2_Intron|AARS2_ENST00000244571.4_Silent_p.H949H|TCTE1_ENST00000371503.3_5'Flank	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1											breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGCCCCCCATGTGGCTGCACA	0.617																																					p.H949H													.	AARS2	77		0			c.C2847T												64.0	56.0	59.0					6																	44268395		2203	4300	6503	SO:0001631	upstream_gene_variant	57505	exon22			CCCCATGTGGCTG	BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763		6.37:g.44268395G>A	Exception_encountered		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	55	0.15	8	NM_020745	114	0.23	26	B4DX59|Q8IYS6	Silent	SNP	ENST00000371505.4	37	CCDS4910.1																																																																																					0.617	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040736.1		NM_182539	
RP11-436D23.1	0	broad.mit.edu	37	6	98472766	98472767	+	lincRNA	INS	-	-	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr6:98472766_98472767insA	ENST00000607823.1	+	0	267				MIR2113_ENST00000459007.1_RNA																							TCCGAATATGTAAAAAAAAAAT	0.282																																					.													.	.			0			.																																											0	.			AATATGTAAAAAA																													6.37:g.98472776_98472776dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000607823.1	37																																																																																						0.282	RP11-436D23.1-003	KNOWN	not_organism_supported|basic	lincRNA	lincRNA		OTTHUMT00000471318.1			
LPA	4018	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	160958956	160958956	+	Silent	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr6:160958956G>A	ENST00000316300.5	-	37	5817	c.5773C>T	c.(5773-5775)Ctg>Ttg	p.L1925L	LPA_ENST00000447678.1_Silent_p.L1925L			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4433	Kringle 17. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GGGGATGGCAGACAAGCTGGC	0.498																																					p.L1925L													.	LPA	237		0			c.C5773T												110.0	108.0	108.0					6																	160958956		2203	4300	6503	SO:0001819	synonymous_variant	4018	exon38			ATGGCAGACAAGC	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5773C>T	6.37:g.160958956G>A			Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	127	0.05	6	NM_005577	0		0	Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	37	CCDS43523.1																																																																																					0.498	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042957.1		NM_005577	
RP11-235G24.1	0	broad.mit.edu	37	6	161326647	161326648	+	lincRNA	INS	-	-	T	rs112724223		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr6:161326647_161326648insT	ENST00000454826.1	-	0	207																											TGAATCTATTGTTTTTTTTTAT	0.371																																					.													.	.			0			.																																											0	.			TCTATTGTTTTTT																													6.37:g.161326656_161326656dupT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000454826.1	37																																																																																						0.371	RP11-235G24.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000042968.1			
ADCY1	107	mdanderson.org	37	7	45614334	45614334	+	Silent	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr7:45614334G>A	ENST00000297323.7	+	1	214	c.192G>A	c.(190-192)gcG>gcA	p.A64A	ADCY1_ENST00000432715.1_Intron	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	64					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CGCTGAAGGCGCTGGCCGTTC	0.771																																					p.A64A													.	.			0			c.G192A												1.0	1.0	1.0					7																	45614334		432	961	1393	SO:0001819	synonymous_variant	107	exon1			GAAGGCGCTGGCC	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.192G>A	7.37:g.45614334G>A			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_021116	0		0	A4D2L8|Q75MI1	Silent	SNP	ENST00000297323.7	37	CCDS34631.1																																																																																					0.771	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340055.2		NM_021116	
KCP	375616	broad.mit.edu	37	7	128548302	128548304	+	RNA	DEL	AAG	AAG	-	rs55898241|rs370991615|rs370653893|rs10565205|rs202067497		TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr7:128548302_128548304delAAG	ENST00000476647.2	-	0	263				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						ggaagaaagaaagaagaaagaaa	0.369																																					.													.	KCP	16		0			.																																											375616	.			GAAAGAAAGAAGA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128548305_128548307delAAG			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	9	0.44	4	.	0		0	Q8NBE0	RNA	DEL	ENST00000476647.2	37																																																																																						0.369	KCP-006	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000403051.1		NM_199349	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	110509211	110509211	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr8:110509211A>G	ENST00000378402.5	+	64	10495	c.10391A>G	c.(10390-10392)tAt>tGt	p.Y3464C		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3464					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATGGGATCTATATGAACCAA	0.378										HNSCC(38;0.096)																											p.Y3464C													PKHD1L1,NS,carcinoma,+1,1	PKHD1L1	1	1	0			c.A10391G												160.0	151.0	154.0					8																	110509211		1818	4084	5902	SO:0001583	missense	93035	exon64			GGATCTATATGAA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10391A>G	8.37:g.110509211A>G	ENSP00000367655:p.Tyr3464Cys		Somatic	138	0	0		WXS	Illumina HiSeq	.	163	0.05	8	NM_177531	0		0	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	19.85	3.904503	0.72868	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;T	0.81739	-1.53;-1.43	5.64	5.64	0.86602	Pectin lyase fold/virulence factor (1);	0.000000	0.64402	D	0.000001	D	0.88343	0.6411	M	0.72479	2.2	0.41399	D	0.987665	D	0.76494	0.999	D	0.81914	0.995	D	0.89090	0.3482	10	0.54805	T	0.06	.	13.8179	0.63303	1.0:0.0:0.0:0.0	.	3464	Q86WI1	PKHL1_HUMAN	C	3464;392	ENSP00000367655:Y3464C;ENSP00000437376:Y392C	ENSP00000367655:Y3464C	Y	+	2	0	PKHD1L1	110578387	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	4.264000	0.58859	2.152000	0.67230	0.528000	0.53228	TAT			0.378	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381017.1		NM_177531	
COL14A1	7373	bcgsc.ca	37	8	121344415	121344415	+	Silent	SNP	A	A	G			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr8:121344415A>G	ENST00000297848.3	+	41	4965	c.4695A>G	c.(4693-4695)ccA>ccG	p.P1565P	COL14A1_ENST00000309791.4_Silent_p.P1565P|COL14A1_ENST00000247781.3_Silent_p.P1470P	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CGGGACCTCCAGGACCACCAG	0.468																																					p.P1565P													.	COL14A1	292		0			c.A4695G												77.0	77.0	77.0					8																	121344415		2203	4300	6503	SO:0001819	synonymous_variant	7373	exon41			ACCTCCAGGACCA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4695A>G	8.37:g.121344415A>G			Somatic	150	0	0		WXS	Illumina HiSeq	Phase_1	156	0.04	6	NM_021110	71	0.00	0		Silent	SNP	ENST00000297848.3	37	CCDS34938.1																																																																																					0.468	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313657.2		NM_021110	
CPSF1	29894	mdanderson.org	37	8	145623295	145623295	+	Silent	SNP	G	G	A	rs150747740	byFrequency	TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr8:145623295G>A	ENST00000349769.3	-	20	2041	c.1947C>T	c.(1945-1947)tgC>tgT	p.C649C	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	649					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CGGCCACGGCGCACTGCACGA	0.657																																					p.C649C	NSCLC(133;1088 1848 27708 34777 35269)												.	.			0			c.C1947T							G		0,4406		0,0,2203	40.0	38.0	39.0		1947	-10.9	0.1	8	dbSNP_134	39	3,8591	3.0+/-9.4	0,3,4294	no	coding-synonymous	CPSF1	NM_013291.2		0,3,6497	AA,AG,GG		0.0349,0.0,0.0231		649/1444	145623295	3,12997	2203	4297	6500	SO:0001819	synonymous_variant	29894	exon20			CACGGCGCACTGC	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1947C>T	8.37:g.145623295G>A			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_013291	93	0.00	0	Q96AF0	Silent	SNP	ENST00000349769.3	37	CCDS34966.1																																																																																			0.001		0.657	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382422.2		NM_013291	
FAM27E2	100289124	broad.mit.edu	37	9	45733883	45733884	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr9:45733883_45733884insAC	ENST00000377529.1	+	1	325_326	c.296_297insAC	c.(295-300)agacacfs	p.RH99fs				Q5SNX5	F27E2_HUMAN	family with sequence similarity 27, member E2	99																	gagaatgggagacacacacaca	0.505																																					.													.	.			0			.																																									SO:0001589	frameshift_variant	0	.			ATGGGAGACACAC			9p11.2	2013-03-15			ENSG00000204807				32013	other	unknown							Standard	NR_103712		Approved			Q5SNX5	OTTHUMG00000013305	ENST00000377529.1:c.305_306dupAC	9.37:g.45733892_45733893dupAC	ENSP00000366752:p.Arg99fs		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	15	0.20	3	.	0		0	A8E4L5	Frame_Shift_Ins	INS	ENST00000377529.1	37																																																																																						0.505	FAM27E2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000037095.1		XR_078687	
PCSK5	5125	mdanderson.org	37	9	78936532	78936532	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr9:78936532G>A	ENST00000545128.1	+	30	4536	c.3998G>A	c.(3997-3999)tGc>tAc	p.C1333Y		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1333	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TGTCAGGACTGCATCCATGAG	0.582																																					p.C1333Y													.	.			0			c.G3998A												60.0	51.0	54.0					9																	78936532		876	1991	2867	SO:0001583	missense	5125	exon30			AGGACTGCATCCA		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.3998G>A	9.37:g.78936532G>A	ENSP00000446280:p.Cys1333Tyr		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001190482	0		0	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787414	0.70337	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.50277	0.75;0.77	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.82917	0.5141	H	0.99379	4.54	0.58432	D	0.999991	.	.	.	.	.	.	D	0.90183	0.4244	8	0.87932	D	0	-23.1759	16.7027	0.85363	0.0:0.0:1.0:0.0	.	.	.	.	Y	1333;1063;1033	ENSP00000446280:C1333Y;ENSP00000411654:C1033Y	ENSP00000365945:C1063Y	C	+	2	0	PCSK5	78126352	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	5.677000	0.68142	2.663000	0.90544	0.655000	0.94253	TGC			0.582	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
ALDOB	229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104187142	104187142	+	Missense_Mutation	SNP	A	A	C			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chr9:104187142A>C	ENST00000374855.4	-	8	1106	c.982T>G	c.(982-984)Ttt>Gtt	p.F328V	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	328					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				CGCTTCATAAAAGCCTCCTGG	0.522																																					p.F328V													.	.			0			c.T982G												110.0	106.0	107.0					9																	104187142		2203	4300	6503	SO:0001583	missense	229	exon8			TCATAAAAGCCTC	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.982T>G	9.37:g.104187142A>C	ENSP00000363988:p.Phe328Val		Somatic	192	0	0		WXS	Illumina HiSeq	.	188	0.17	32	NM_000035	0		0	Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	ENST00000374855.4	37	CCDS6756.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.943662	0.92593	.	.	ENSG00000136872	ENST00000374855	D	0.85955	-2.05	5.63	5.63	0.86233	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.93635	0.7967	M	0.84846	2.72	0.80722	D	1	B	0.33299	0.407	P	0.60609	0.877	D	0.93731	0.7041	10	0.87932	D	0	-5.5432	15.3176	0.74092	1.0:0.0:0.0:0.0	.	328	P05062	ALDOB_HUMAN	V	328	ENSP00000363988:F328V	ENSP00000363988:F328V	F	-	1	0	ALDOB	103226963	1.000000	0.71417	0.892000	0.35008	0.980000	0.70556	9.287000	0.95975	2.271000	0.75665	0.459000	0.35465	TTT			0.522	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053434.2			
AMER1	139285	broad.mit.edu	37	X	63412939	63412939	+	Silent	SNP	T	T	C			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chrX:63412939T>C	ENST00000330258.3	-	2	500	c.228A>G	c.(226-228)ggA>ggG	p.G76G	AMER1_ENST00000403336.1_Silent_p.G76G|AMER1_ENST00000374869.3_Silent_p.G76G	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	76					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CTTTGCTCCGTCCCCCTCCAA	0.537																																					p.G76G													.	.			67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.A228G												129.0	102.0	111.0					X																	63412939		2203	4300	6503	SO:0001819	synonymous_variant	139285	exon2			GCTCCGTCCCCCT	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.228A>G	X.37:g.63412939T>C			Somatic	125	0.008	1		WXS	Illumina HiSeq	Phase_I	116	0.03	3	NM_152424	0		0	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2																																																																																					0.537	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316584.1		NM_152424	
FRMPD3	84443	ucsc.edu	37	X	106769929	106769929	+	Silent	SNP	C	C	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chrX:106769929C>T	ENST00000276185.4	+	3	210	c.210C>T	c.(208-210)ggC>ggT	p.G70G	FRMPD3-AS1_ENST00000415252.1_RNA			Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	70	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						TCGTGGCTGGCAGTGAGAGGC	0.547																																					.													.	.			0			.												130.0	115.0	120.0					X																	106769929		876	1991	2867	SO:0001819	synonymous_variant	84443	.			GGCTGGCAGTGAG	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.210C>T	X.37:g.106769929C>T			Somatic	51	0	0		WXS	Illumina HiSeq		43	0.09	4	.	0		0	Q96JK8	Silent	SNP	ENST00000276185.4	37																																																																																						0.547	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_042978	
HAUS7	55559	mdanderson.org	37	X	152722099	152722099	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chrX:152722099G>T	ENST00000370211.4	-	6	530	c.487C>A	c.(487-489)Cac>Aac	p.H163N	HAUS7_ENST00000484394.1_5'UTR|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000421080.2_Missense_Mutation_p.H24N|TREX2_ENST00000370232.1_5'UTR|TREX2_ENST00000334497.2_5'UTR|TREX2_ENST00000338525.2_5'UTR|HAUS7_ENST00000370212.3_Missense_Mutation_p.H163N	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	163					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						TCCTCGAAGTGCTCCATCAGG	0.657																																					p.H163N													.	.			0			c.C487A												54.0	35.0	42.0					X																	152722099		2187	4270	6457	SO:0001583	missense	55559	exon6			CGAAGTGCTCCAT	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.487C>A	X.37:g.152722099G>T	ENSP00000359230:p.His163Asn		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_017518	118	0.00	0	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	ENST00000370211.4	37	CCDS35438.1	.	.	.	.	.	.	.	.	.	.	G	0.167	-1.074871	0.01903	.	.	ENSG00000213397	ENST00000370211;ENST00000370219;ENST00000421080;ENST00000370212	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	4.76	-1.5	0.08691	.	1.350910	0.04839	N	0.440128	T	0.16300	0.0392	L	0.36672	1.1	0.09310	N	1	B;B	0.17465	0.001;0.022	B;B	0.14578	0.003;0.011	T	0.21759	-1.0236	10	0.13108	T	0.6	-3.291	3.0703	0.06229	0.3249:0.0:0.2789:0.3961	.	163;163	Q99871;Q99871-2	HAUS7_HUMAN;.	N	153;163;24;163	ENSP00000359230:H153N;ENSP00000359239:H163N;ENSP00000395447:H24N;ENSP00000359231:H163N	ENSP00000359230:H153N	H	-	1	0	HAUS7	152375293	0.131000	0.22433	0.001000	0.08648	0.818000	0.46254	-0.229000	0.09098	-0.189000	0.10482	0.292000	0.19580	CAC			0.657	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000060963.2		NM_017518	
PCMTD1P1	100874520	bcgsc.ca	37	Y	10011533	10011533	+	IGR	SNP	G	G	T			TCGA-4K-AA1I-01A-11D-A435-10	TCGA-4K-AA1I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a24cf0ce-23cc-43aa-b3ec-2b7a1ea1ab48	5a404d57-b50b-4e7e-83c5-dff65c2c3465	g.chrY:10011533G>T								RNA5SP519 (80931 upstream) : AC010970.1 (22447 downstream)																							ATGATGAGATGCAGGCCAAGG	0.398																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100874520	.			TGAGATGCAGGCC																													Y.37:g.10011533G>T			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_1	59	0.19	11	.	0		0		RNA	SNP		37																																																																																					0	0.398										
