#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CYP4B1	1580	hgsc.bcm.edu	37	1	47276567	47276567	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr1:47276567G>T	ENST00000271153.4	+	2	304	c.268G>T	c.(268-270)Ggc>Tgc	p.G90C	CYP4B1_ENST00000452782.2_5'Flank|CYP4B1_ENST00000371919.4_Missense_Mutation_p.G90C|CYP4B1_ENST00000371923.4_Missense_Mutation_p.G90C			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	90					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	ACAGTTCATTGGCTTCCTGAA	0.572																																					p.G90C													.	.			0			c.G268T												91.0	77.0	81.0					1																	47276567		2203	4300	6503	SO:0001583	missense	1580	exon2			TTCATTGGCTTCC	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.268G>T	1.37:g.47276567G>T	ENSP00000271153:p.Gly90Cys		Somatic	60	0	0		WXS	Illumina HiSeq	.	61	0.07	4	NM_000779	0		0	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	37	CCDS542.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.327061	0.24080	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919	T;T;T	0.79247	-1.25;-1.25;-0.39	5.67	4.76	0.60689	.	0.299613	0.37623	N	0.002017	T	0.80894	0.4711	L	0.43152	1.355	0.30932	N	0.726753	D;D;D	0.67145	0.996;0.98;0.984	D;P;P	0.65684	0.937;0.831;0.895	T	0.79208	-0.1898	9	.	.	.	.	9.7673	0.40567	0.0776:0.1413:0.7811:0.0	.	90;90;90	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	C	90	ENSP00000360991:G90C;ENSP00000271153:G90C;ENSP00000360987:G90C	.	G	+	1	0	CYP4B1	47049154	0.127000	0.22367	0.550000	0.28217	0.327000	0.28475	1.488000	0.35551	1.408000	0.46895	0.655000	0.94253	GGC			0.572	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000021911.1		NM_000779	
ORC1	4998	broad.mit.edu	37	1	52859133	52859133	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr1:52859133G>T	ENST00000371568.3	-	6	1282	c.1064C>A	c.(1063-1065)cCa>cAa	p.P355Q	ORC1_ENST00000371566.1_Missense_Mutation_p.P355Q	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	355					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GATGTTTTCTGGTTTCAGAAT	0.428																																					p.P355Q													.	ORC1	79		0			c.C1064A												239.0	219.0	226.0					1																	52859133		2203	4300	6503	SO:0001583	missense	4998	exon6			TTTTCTGGTTTCA		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.1064C>A	1.37:g.52859133G>T	ENSP00000360623:p.Pro355Gln		Somatic	188	0	0		WXS	Illumina HiSeq	Phase_I	171	0.03	5	NM_004153	74	0.00	0	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669522	0.29693	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.40225	1.04;1.04	4.39	4.39	0.52855	.	0.314552	0.34133	N	0.004225	T	0.41305	0.1153	M	0.64997	1.995	0.37216	D	0.905045	B;B	0.28552	0.215;0.215	B;B	0.28916	0.096;0.096	T	0.49504	-0.8933	10	0.49607	T	0.09	-15.3533	12.7679	0.57403	0.0:0.0:1.0:0.0	.	355;355	B7Z8H0;Q13415	.;ORC1_HUMAN	Q	355	ENSP00000360623:P355Q;ENSP00000360621:P355Q	ENSP00000360621:P355Q	P	-	2	0	ORC1	52631721	0.995000	0.38212	0.950000	0.38849	0.786000	0.44442	3.817000	0.55668	2.724000	0.93272	0.655000	0.94253	CCA			0.428	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022202.1		NM_004153	
ACP6	51205	broad.mit.edu	37	1	147142085	147142085	+	Missense_Mutation	SNP	A	A	C	rs201678741		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr1:147142085A>C	ENST00000369238.6	-	1	533	c.86T>G	c.(85-87)gTg>gGg	p.V29G	ACP6_ENST00000392988.2_Missense_Mutation_p.V29G	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	29					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					GGCCAGGGCCACCCGCCGCTG	0.657																																					p.V29G													.	ACP6	36		0			c.T86G												12.0	10.0	11.0					1																	147142085		2053	4027	6080	SO:0001583	missense	51205	exon1			AGGGCCACCCGCC	BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.86T>G	1.37:g.147142085A>C	ENSP00000358241:p.Val29Gly		Somatic	57	0.2807017544	16		WXS	Illumina HiSeq	Phase_I	95	0.35	33	NM_016361	35	0.14	5	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	ENST00000369238.6	37	CCDS928.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149393	0.37923	.	.	ENSG00000162836	ENST00000369238;ENST00000392988	T;T	0.48522	2.65;0.81	5.28	-5.16	0.02857	.	0.609019	0.16327	N	0.219309	T	0.09555	0.0235	L	0.34521	1.04	0.43385	D	0.99549	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.22730	-1.0208	10	0.19147	T	0.46	.	1.0577	0.01593	0.2021:0.3491:0.2212:0.2275	.	29;29	Q9NPH0-2;Q9NPH0	.;PPA6_HUMAN	G	29	ENSP00000358241:V29G;ENSP00000376714:V29G	ENSP00000358241:V29G	V	-	2	0	ACP6	145608709	0.001000	0.12720	0.927000	0.36925	0.947000	0.59692	-0.635000	0.05471	-0.919000	0.03803	-0.460000	0.05396	GTG			0.657	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039420.2		NM_016361	
PRRC2C	23215	broad.mit.edu	37	1	171535453	171535453	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr1:171535453G>T	ENST00000338920.4	+	21	6430	c.6193G>T	c.(6193-6195)Gaa>Taa	p.E2065*	PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.E2065*|PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.E2067*|PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.E2067*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2065					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										AAATGGAAATGAAAATGAAGT	0.423																																					p.E2065X													.	.			0			c.G6193T												46.0	46.0	46.0					1																	171535453		2203	4300	6503	SO:0001587	stop_gained	23215	exon21			GGAAATGAAAATG	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6193G>T	1.37:g.171535453G>T	ENSP00000343629:p.Glu2065*		Somatic	369	0	0		WXS	Illumina HiSeq	Phase_I	544	0.01	7	NM_015172	271	0.00	0	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	48|48	14.553090|14.553090	0.99800|0.99800	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	.|.	.|.	.|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.000000|.	0.46145|.	D|.	0.000303|.	.|T	.|0.67832	.|0.2935	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.67432	.|-0.5672	.|3	0.52906|.	T|.	0.07|.	.|.	18.2398|18.2398	0.89963|0.89963	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	2067;2019;2065;2067;2065;1822|612	.|.	ENSP00000343629:E2065X|.	E|M	+|+	1|3	0|0	PRRC2C|PRRC2C	169802077|169802077	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.909000|0.909000	0.53808|0.53808	9.334000|9.334000	0.96470|0.96470	2.289000|2.289000	0.77006|0.77006	0.655000|0.655000	0.94253|0.94253	GAA|ATG			0.423	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000314826.4		NM_015172	
METTL13	51603	broad.mit.edu	37	1	171759606	171759606	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr1:171759606delA	ENST00000361735.3	+	5	1590	c.1324delA	c.(1324-1326)aaafs	p.K443fs	METTL13_ENST00000367737.5_Frame_Shift_Del_p.K287fs|METTL13_ENST00000466643.1_Intron|METTL13_ENST00000458517.1_Frame_Shift_Del_p.K442fs|METTL13_ENST00000362019.3_Frame_Shift_Del_p.K357fs	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	443							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GAAGAAGCGGAAAAAGGACAG	0.527																																					p.K442fs													.	METTL13	67		0			c.1324delA												91.0	87.0	88.0					1																	171759606		2203	4300	6503	SO:0001589	frameshift_variant	51603	exon5			AAGCGGAAAAAGG	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1324delA	1.37:g.171759606delA	ENSP00000354920:p.Lys443fs		Somatic	342	0	0		WXS	Illumina HiSeq	Phase_I	543	0.02	9	NM_015935	132	0.00	0	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Frame_Shift_Del	DEL	ENST00000361735.3	37	CCDS1299.1																																																																																					0.527	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084528.5		NM_014955	
PLXNA2	5362	broad.mit.edu	37	1	208224629	208224629	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr1:208224629G>T	ENST00000367033.3	-	16	3890	c.3133C>A	c.(3133-3135)Cgc>Agc	p.R1045S		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1045	IPT/TIG 3.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGCTCGATGCGCTGGACCCGA	0.587																																					p.R1045S													.	PLXNA2	178		0			c.C3133A												83.0	70.0	75.0					1																	208224629		2203	4300	6503	SO:0001583	missense	5362	exon16			CGATGCGCTGGAC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3133C>A	1.37:g.208224629G>T	ENSP00000356000:p.Arg1045Ser		Somatic	290	0.0034482759	1		WXS	Illumina HiSeq	Phase_I	438	0.02	7	NM_025179	199	0.00	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372211	0.61624	.	.	ENSG00000076356	ENST00000367033	T	0.72282	-0.64	5.09	4.16	0.48862	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.100782	0.64402	N	0.000001	T	0.62648	0.2445	L	0.39898	1.24	0.58432	D	0.999998	B	0.17852	0.024	B	0.22152	0.038	T	0.56757	-0.7926	10	0.27785	T	0.31	.	14.852	0.70303	0.0:0.0:0.8551:0.1449	.	1045	O75051	PLXA2_HUMAN	S	1045	ENSP00000356000:R1045S	ENSP00000356000:R1045S	R	-	1	0	PLXNA2	206291252	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.350000	0.66016	1.107000	0.41642	0.557000	0.71058	CGC			0.587	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088932.6		NM_025179	
SLC29A3	55315	hgsc.bcm.edu	37	10	73121735	73121735	+	Silent	SNP	G	G	T	rs370631755		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr10:73121735G>T	ENST00000373189.5	+	6	850	c.798G>T	c.(796-798)gcG>gcT	p.A266A	SLC29A3_ENST00000469204.1_3'UTR	NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	266					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						CTGTTCTTGCGGCCCATGTGT	0.597																																					p.A266A	Esophageal Squamous(200;1319 2142 18949 31248 39672)												.	.			0			c.G798T												76.0	63.0	68.0					10																	73121735		2203	4300	6503	SO:0001819	synonymous_variant	55315	exon6			TCTTGCGGCCCAT	AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.798G>T	10.37:g.73121735G>T			Somatic	77	0	0		WXS	Illumina HiSeq	.	118	0.03	3	NM_018344	45	0.00	0	B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Silent	SNP	ENST00000373189.5	37	CCDS7310.1																																																																																					0.597	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048544.1		NM_018344	
KAT6B	23522	mdanderson.org	37	10	76788681	76788681	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr10:76788681G>T	ENST00000287239.4	+	18	4588	c.4099G>T	c.(4099-4101)Gag>Tag	p.E1367*	KAT6B_ENST00000372714.1_Nonsense_Mutation_p.E1075*|KAT6B_ENST00000372724.1_Nonsense_Mutation_p.E1075*|KAT6B_ENST00000372725.1_Nonsense_Mutation_p.E1075*|KAT6B_ENST00000372711.1_Nonsense_Mutation_p.E1184*	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1367	Poly-Glu.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										agaggaagaagaggaagggga	0.443																																					p.E1367X													.	.			0			c.G4099T												46.0	45.0	46.0					10																	76788681		2203	4300	6503	SO:0001587	stop_gained	23522	exon18			GAAGAAGAGGAAG	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4099G>T	10.37:g.76788681G>T	ENSP00000287239:p.Glu1367*		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_012330	46	0.00	0	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Nonsense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	g	22.1	4.242012	0.79912	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	.	.	.	0.521	0.521	0.17046	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	.	.	.	.	.	.	.	X	1075;1075;1367;1075;1184	.	ENSP00000287239:E1367X	E	+	1	0	KAT6B	76458687	0.670000	0.27512	0.047000	0.18901	0.014000	0.08584	0.729000	0.26028	0.585000	0.29608	0.434000	0.28630	GAG			0.443	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000048771.1		NM_012330	
ZFYVE27	118813	mdanderson.org	37	10	99504637	99504637	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr10:99504637G>T	ENST00000393677.4	+	4	624	c.420G>T	c.(418-420)ctG>ctT	p.L140L	ZFYVE27_ENST00000337540.7_Silent_p.L108L|ZFYVE27_ENST00000357540.4_Intron|ZFYVE27_ENST00000370613.3_Intron|ZFYVE27_ENST00000370610.3_Silent_p.L42L|ZFYVE27_ENST00000356257.4_Silent_p.L140L|ZFYVE27_ENST00000453958.2_Silent_p.L140L|ZFYVE27_ENST00000359980.3_Silent_p.L140L	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	140					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		GAGGTCGCCTGTCTCGTCCCG	0.592																																					p.L140L													.	.			0			c.G420T												39.0	33.0	35.0					10																	99504637		2202	4300	6502	SO:0001819	synonymous_variant	118813	exon3			TCGCCTGTCTCGT	BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.420G>T	10.37:g.99504637G>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001002261	41	0.00	0	B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Silent	SNP	ENST00000393677.4	37	CCDS31263.1																																																																																					0.592	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000049745.2		NM_144588	
KRTAP5-5	439915	bcgsc.ca	37	11	1651127	1651127	+	Silent	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:1651127C>T	ENST00000399676.2	+	1	95	c.57C>T	c.(55-57)tcC>tcT	p.S19S		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	19						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		gccgtggctccggctgtgggg	0.697																																					p.S19S													.	KRTAP5-5	86		0			c.C57T																																									SO:0001819	synonymous_variant	439915	exon1			TGGCTCCGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.57C>T	11.37:g.1651127C>T			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_1	105	0.07	7	NM_001001480	0		0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																					0.697	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127919.1			
MRGPRE	116534	mdanderson.org	37	11	3249138	3249138	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:3249138C>T	ENST00000389832.5	-	2	1198	c.892G>A	c.(892-894)Gcc>Acc	p.A298T	MRGPRE_ENST00000436689.2_Missense_Mutation_p.A297T|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCCTGACGGCCCCCAGCTCA	0.721																																					p.A298T													.	.			0			c.G892A												5.0	7.0	6.0					11																	3249138		1794	3892	5686	SO:0001583	missense	116534	exon2			TGACGGCCCCCAG	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.892G>A	11.37:g.3249138C>T	ENSP00000374482:p.Ala298Thr		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_001039165	0		0	Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	37		.	.	.	.	.	.	.	.	.	.	c	11.22	1.574892	0.28092	.	.	ENSG00000184350	ENST00000436689;ENST00000389832	.	.	.	3.38	0.191	0.15130	.	0.794104	0.09786	U	0.756032	T	0.23926	0.0579	N	0.14661	0.345	0.09310	N	1	B	0.18610	0.029	B	0.20384	0.029	T	0.22906	-1.0203	9	0.49607	T	0.09	-1.5885	5.5259	0.16957	0.0:0.4269:0.4477:0.1253	.	297	Q86SM8	MRGRE_HUMAN	T	298;297	.	ENSP00000374482:A297T	A	-	1	0	MRGPRE	3205714	0.000000	0.05858	0.000000	0.03702	0.685000	0.39939	-3.610000	0.00415	-0.179000	0.10654	0.462000	0.41574	GCC			0.721	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000032346.5		XM_171536	
SAAL1	113174	mdanderson.org	37	11	18127494	18127494	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:18127494C>T	ENST00000524803.1	-	1	144	c.95G>A	c.(94-96)aGc>aAc	p.S32N	SAAL1_ENST00000529318.1_Missense_Mutation_p.S32N|SAAL1_ENST00000533851.1_5'UTR|SAAL1_ENST00000300013.4_Missense_Mutation_p.S32N			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	32										breast(2)|large_intestine(5)|lung(8)	15						CCAGTGTTTGCTGTAGACCGT	0.672											OREG0020819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S32N													.	.			0			c.G95A												67.0	47.0	54.0					11																	18127494		2200	4292	6492	SO:0001583	missense	113174	exon1			TGTTTGCTGTAGA	AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.95G>A	11.37:g.18127494C>T	ENSP00000432487:p.Ser32Asn		Somatic	44	0	0	723	WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_138421	48	0.00	0	A6NH05	Missense_Mutation	SNP	ENST00000524803.1	37	CCDS31439.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.432434|5.432434	0.96150|0.96150	.|.	.|.	ENSG00000166788|ENSG00000166788	ENST00000532452|ENST00000524803;ENST00000300013;ENST00000529318;ENST00000530180	.|T;T;T;T	.|0.45276	.|0.9;0.9;0.9;0.9	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66167|0.66167	0.2762|0.2762	M|M	0.76170|0.76170	2.325|2.325	0.51767|0.51767	D|D	0.999938|0.999938	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.85130	.|0.997;0.997;0.997	T|T	0.68804|0.68804	-0.5312|-0.5312	5|10	.|0.87932	.|D	.|0	-10.1274|-10.1274	17.4532|17.4532	0.87599|0.87599	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|32;32;32	.|E9PRZ1;G1UCX3;Q96ER3	.|.;.;SAAL1_HUMAN	T|N	25|32	.|ENSP00000432487:S32N;ENSP00000300013:S32N;ENSP00000432216:S32N;ENSP00000431489:S32N	.|ENSP00000300013:S32N	A|S	-|-	1|2	0|0	SAAL1|SAAL1	18084070|18084070	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	5.335000|5.335000	0.65929|0.65929	2.720000|2.720000	0.93068|0.93068	0.655000|0.655000	0.94253|0.94253	GCA|AGC			0.672	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000389728.1		NM_138421	
NAT10	55226	mdanderson.org	37	11	34153768	34153768	+	Splice_Site	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:34153768G>T	ENST00000257829.3	+	15	1823	c.1617G>T	c.(1615-1617)aaG>aaT	p.K539N	NAT10_ENST00000527971.1_Intron|NAT10_ENST00000531159.2_Splice_Site_p.K467N	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	539						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				CTCACTACAAGGTAACTGCAG	0.463																																					p.K539N													.	.			0			c.G1617T												155.0	151.0	152.0					11																	34153768		2202	4298	6500	SO:0001630	splice_region_variant	55226	exon15			CTACAAGGTAACT	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.1617+1G>T	11.37:g.34153768G>T			Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	76	0.05	4	NM_024662	86	0.00	0	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	G	35	5.453799	0.96223	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.49720	0.77;0.77	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.80025	0.4548	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85010	0.0905	10	0.87932	D	0	-34.0042	20.2963	0.98556	0.0:0.0:1.0:0.0	.	539	Q9H0A0	NAT10_HUMAN	N	539;467	ENSP00000257829:K539N;ENSP00000433011:K467N	ENSP00000257829:K539N	K	+	3	2	NAT10	34110344	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.869000	0.99810	2.813000	0.96785	0.655000	0.94253	AAG			0.463	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388693.1		NM_024662	Missense_Mutation
TMEM132A	54972	mdanderson.org	37	11	60698031	60698031	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:60698031C>T	ENST00000453848.2	+	5	1074	c.916C>T	c.(916-918)Ccc>Tcc	p.P306S	TMEM132A_ENST00000005286.4_Missense_Mutation_p.P306S			Q24JP5	T132A_HUMAN	transmembrane protein 132A	306						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CCCAGCCCAGCCCACACTCTG	0.612																																					p.P306S													.	.			0			c.C916T												89.0	96.0	94.0					11																	60698031		2203	4299	6502	SO:0001583	missense	54972	exon5			GCCCAGCCCACAC	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.916C>T	11.37:g.60698031C>T	ENSP00000405823:p.Pro306Ser		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_017870	96	0.00	0	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425693	0.62733	.	.	ENSG00000006118	ENST00000544065;ENST00000444690;ENST00000453848;ENST00000005286	T;T;T	0.12147	2.71;2.88;2.88	5.4	4.49	0.54785	.	0.000000	0.64402	D	0.000006	T	0.25827	0.0629	L	0.59436	1.845	0.39060	D	0.960511	D;P;P;D	0.58620	0.983;0.873;0.767;0.97	P;P;B;P	0.54544	0.755;0.638;0.439;0.558	T	0.04961	-1.0915	10	0.87932	D	0	.	12.4202	0.55516	0.0:0.9211:0.0:0.0789	.	295;56;306;306	Q24JP5-3;Q24JP5-4;Q24JP5;Q24JP5-2	.;.;T132A_HUMAN;.	S	44;56;306;306	ENSP00000442754:P44S;ENSP00000405823:P306S;ENSP00000005286:P306S	ENSP00000005286:P306S	P	+	1	0	TMEM132A	60454607	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	4.696000	0.61774	1.432000	0.47375	-0.136000	0.14681	CCC			0.612	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000396352.1		NM_017870	
AP5B1	91056	broad.mit.edu	37	11	65545364	65545364	+	Missense_Mutation	SNP	G	G	T	rs375436485		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:65545364G>T	ENST00000532090.2	-	2	2810	c.2600C>A	c.(2599-2601)gCg>gAg	p.A867E		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	867					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						GTAGTCCCCCGCCAGGGGCAG	0.711																																					p.A867E													.	AP5B1	40		0			c.C2600A												5.0	7.0	6.0					11																	65545364		1902	3995	5897	SO:0001583	missense	91056	exon2			TCCCCCGCCAGGG	JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.2600C>A	11.37:g.65545364G>T	ENSP00000454303:p.Ala867Glu		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_138368	11	0.00	0	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	ENST00000532090.2	37	CCDS58146.1																																																																																					0.711	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390636.2		NM_138368	
DLG2	1740	mdanderson.org	37	11	84028172	84028172	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:84028172G>T	ENST00000398301.2	-	1	210	c.17C>A	c.(16-18)aCc>aAc	p.T6N	DLG2_ENST00000543673.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000280241.8_Missense_Mutation_p.T6N|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000532653.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GTGTTGCTTGGTGAGGTATGC	0.572																																					p.T6N													.	.			0			c.C17A												218.0	198.0	204.0					11																	84028172		876	1990	2866	SO:0001583	missense	1740	exon1			TGCTTGGTGAGGT	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000398301.2:c.17C>A	11.37:g.84028172G>T	ENSP00000381346:p.Thr6Asn		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001206769	0		0	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000398301.2	37		.	.	.	.	.	.	.	.	.	.	G	10.42	1.345537	0.24426	.	.	ENSG00000150672	ENST00000280241;ENST00000398301	T;T	0.19394	2.65;2.15	5.72	5.72	0.89469	.	.	.	.	.	T	0.10121	0.0248	N	0.08118	0	0.80722	D	1	B	0.30482	0.281	B	0.19946	0.027	T	0.31024	-0.9958	8	.	.	.	.	12.7953	0.57556	0.0757:0.0:0.9243:0.0	.	6	Q6ZSU2	.	N	6	ENSP00000280241:T6N;ENSP00000381346:T6N	.	T	-	2	0	DLG2	83705820	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.856000	0.48341	2.687000	0.91594	0.585000	0.79938	ACC			0.572	DLG2-002	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000259244.2		NM_001364	
OR6X1	390260	mdanderson.org	37	11	123624888	123624888	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr11:123624888G>T	ENST00000327930.2	-	1	365	c.339C>A	c.(337-339)ctC>ctA	p.L113L		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ACATGATAGTGAGGATCAAGA	0.537																																					p.L113L													.	.			0			c.C339A												158.0	154.0	156.0					11																	123624888		2202	4299	6501	SO:0001819	synonymous_variant	390260	exon1			GATAGTGAGGATC	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.339C>A	11.37:g.123624888G>T			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	79	0.05	4	NM_001005188	0		0	B9EGW9|Q6IFA0	Silent	SNP	ENST00000327930.2	37	CCDS31695.1																																																																																					0.537	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387436.1		NM_001005188	
GXYLT1	283464	hgsc.bcm.edu	37	12	42481617	42481617	+	Missense_Mutation	SNP	G	G	C	rs75740340		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:42481617G>C	ENST00000398675.3	-	8	1526	c.1294C>G	c.(1294-1296)Cgt>Ggt	p.R432G	GXYLT1_ENST00000280876.6_Missense_Mutation_p.R401G	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	432					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						CTGGCATAACGATCTCTTACA	0.328																																					p.R432G													Q8IXV1_HUMAN,NS,carcinoma,+1,2	Q8IXV1_HUMAN	1	2	0			c.C1294G												105.0	93.0	97.0					12																	42481617		1836	4080	5916	SO:0001583	missense	283464	exon8			CATAACGATCTCT	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.1294C>G	12.37:g.42481617G>C	ENSP00000381666:p.Arg432Gly		Somatic	83	0	0		WXS	Illumina HiSeq	.	73	0.04	3	NM_173601	20	0.00	0	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	ENST00000398675.3	37	CCDS41772.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.647203	0.00792	.	.	ENSG00000151233	ENST00000398675;ENST00000280876	.	.	.	4.9	2.75	0.32379	.	0.707951	0.13008	N	0.421091	T	0.29093	0.0723	L	0.29908	0.895	0.09310	N	1	B;B	0.24721	0.043;0.11	B;B	0.27608	0.068;0.081	T	0.18209	-1.0344	9	0.25751	T	0.34	-7.8089	7.8107	0.29230	0.1594:0.0:0.6532:0.1874	.	401;432	Q4G148-2;Q4G148	.;GXLT1_HUMAN	G	432;401	.	ENSP00000280876:R401G	R	-	1	0	GXYLT1	40767884	0.003000	0.15002	0.006000	0.13384	0.029000	0.11900	0.908000	0.28545	1.214000	0.43395	-0.119000	0.15052	CGT	0.002		0.328	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403778.1		XM_290597	
KCNH3	23416	mdanderson.org	37	12	49943881	49943881	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:49943881G>T	ENST00000257981.6	+	10	1947	c.1687G>T	c.(1687-1689)Gac>Tac	p.D563Y		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	563					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GAGCCTCCCTGACGAGCTGCG	0.687																																					p.D563Y													.	.			0			c.G1687T												16.0	17.0	17.0					12																	49943881		2194	4284	6478	SO:0001583	missense	23416	exon10			CTCCCTGACGAGC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1687G>T	12.37:g.49943881G>T	ENSP00000257981:p.Asp563Tyr		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_012284	16	0.00	0	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939698	0.52972	.	.	ENSG00000135519	ENST00000257981	D	0.96745	-4.11	5.48	5.48	0.80851	Cyclic nucleotide-binding-like (1);	0.000000	0.50627	D	0.000104	D	0.96084	0.8724	L	0.50919	1.6	0.58432	D	0.999995	B	0.31503	0.326	B	0.43413	0.419	D	0.95198	0.8314	10	0.54805	T	0.06	.	17.2178	0.86949	0.0:0.0:1.0:0.0	.	563	Q9ULD8	KCNH3_HUMAN	Y	563	ENSP00000257981:D563Y	ENSP00000257981:D563Y	D	+	1	0	KCNH3	48230148	1.000000	0.71417	0.292000	0.24919	0.024000	0.10985	9.790000	0.99075	2.755000	0.94549	0.655000	0.94253	GAC			0.687	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404571.2		NM_012284	
SPRYD4	283377	broad.mit.edu	37	12	56862911	56862911	+	Silent	SNP	A	A	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:56862911A>G	ENST00000338146.5	+	2	249	c.174A>G	c.(172-174)ggA>ggG	p.G58G	MIP_ENST00000555551.1_5'UTR	NM_207344.3	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	58	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)	7						GCTTGGTGGGATTGGAGCCCA	0.572																																					p.G58G													.	SPRYD4	13		0			c.A174G												45.0	50.0	48.0					12																	56862911		2203	4300	6503	SO:0001819	synonymous_variant	283377	exon2			GGTGGGATTGGAG	AL832247	CCDS8920.1	12q13.3	2006-03-09				ENSG00000176422			27468	protein-coding gene	gene with protein product							Standard	NM_207344		Approved	DKFZp686N0877	uc001sli.4	Q8WW59		ENST00000338146.5:c.174A>G	12.37:g.56862911A>G			Somatic	60	0.2166666667	13		WXS	Illumina HiSeq	Phase_I	63	0.16	10	NM_207344	49	0.14	7	A8K7A5	Silent	SNP	ENST00000338146.5	37	CCDS8920.1																																																																																					0.572	SPRYD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_207344	
ZFC3H1	196441	hgsc.bcm.edu;broad.mit.edu	37	12	72023401	72023405	+	Frame_Shift_Del	DEL	TTTCA	TTTCA	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	TTTCA	TTTCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:72023401_72023405delTTTCA	ENST00000378743.3	-	19	4168_4172	c.3810_3814delTGAAA	c.(3808-3816)aatgaaagtfs	p.NES1270fs		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1270					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TGACCTTTACTTTCATTGATATTGC	0.346																																					p.1271_1272del													.	ZFC3H1	172		0			c.3811_3815del																																									SO:0001589	frameshift_variant	196441	exon19			CTTTACTTTCATT	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.3810_3814delTGAAA	12.37:g.72023401_72023405delTTTCA	ENSP00000368017:p.Asn1270fs		Somatic	48	0	0		WXS	Illumina HiSeq	.	72	0.14	10	NM_144982	17	0.00	0	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Frame_Shift_Del	DEL	ENST00000378743.3	37	CCDS41813.1																																																																																					0.346	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404751.1		NM_144982	
CUX2	23316	mdanderson.org	37	12	111776097	111776097	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:111776097G>T	ENST00000261726.6	+	20	3358	c.3204G>T	c.(3202-3204)cgG>cgT	p.R1068R	RNA5SP373_ENST00000517271.1_RNA	NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1068					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CAGGGCAGCGGCTGTTTGGGG	0.632																																					p.R1068R													CUX2,colon,carcinoma,+2,1	CUX2	2	1	0			c.G3204T												46.0	51.0	50.0					12																	111776097		1943	4144	6087	SO:0001819	synonymous_variant	23316	exon20			GCAGCGGCTGTTT	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3204G>T	12.37:g.111776097G>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_015267	23	0.00	0	A7E2Y4	Silent	SNP	ENST00000261726.6	37	CCDS41837.1																																																																																					0.632	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404765.1		NM_015267	
RNF10	9921	broad.mit.edu	37	12	121004666	121004666	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:121004666T>C	ENST00000325954.4	+	13	2385	c.1924T>C	c.(1924-1926)Ttt>Ctt	p.F642L	RNF10_ENST00000413266.2_Missense_Mutation_p.F647L	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	642					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTACAGCAGTTTCCTGCCTT	0.453																																					p.F642L													.	RNF10	75		0			c.T1924C												108.0	105.0	106.0					12																	121004666		2203	4300	6503	SO:0001583	missense	9921	exon13			CAGCAGTTTCCTG	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.1924T>C	12.37:g.121004666T>C	ENSP00000322242:p.Phe642Leu		Somatic	255	0	0		WXS	Illumina HiSeq	Phase_I	309	0.02	7	NM_014868	479	0.01	3	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.609316	0.87258	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000546262;ENST00000540046	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.87	5.87	0.94306	.	0.047703	0.85682	D	0.000000	T	0.45935	0.1367	M	0.69358	2.11	0.80722	D	1	P;D	0.69078	0.778;0.997	B;D	0.75020	0.397;0.985	T	0.40001	-0.9586	10	0.62326	D	0.03	.	16.279	0.82658	0.0:0.0:0.0:1.0	.	647;642	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	L	642;642;647;90;186	ENSP00000322242:F642L;ENSP00000415682:F647L;ENSP00000439221:F90L;ENSP00000439859:F186L	ENSP00000322242:F642L	F	+	1	0	RNF10	119489049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.991000	0.76232	2.239000	0.73571	0.523000	0.50628	TTT			0.453	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000401898.4			
PITPNM2	57605	ucsc.edu	37	12	123475099	123475099	+	Silent	SNP	G	G	A	rs376540906		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:123475099G>A	ENST00000542749.1	-	15	2625	c.2562C>T	c.(2560-2562)atC>atT	p.I854I	PITPNM2_ENST00000320201.4_Silent_p.I854I|PITPNM2_ENST00000280562.5_Silent_p.I902I|PITPNM2_ENST00000392428.1_Silent_p.I575I			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	854	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CACTCTGGGCGATGCTGGATG	0.632																																					p.I854I													.	PITPNM2	105		0			c.C2562T												67.0	53.0	57.0					12																	123475099		2202	4300	6502	SO:0001819	synonymous_variant	57605	exon16			CTGGGCGATGCTG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2562C>T	12.37:g.123475099G>A			Somatic	31	0	0		WXS	Illumina HiSeq		41	0.10	4	NM_020845	19	0.00	0	Q9P271	Silent	SNP	ENST00000542749.1	37	CCDS9242.1																																																																																					0.632	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401342.1		NM_020845	
DDX55	57696	broad.mit.edu	37	12	124103201	124103202	+	Intron	DEL	TG	TG	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:124103201_124103202delTG	ENST00000238146.4	+	12	1214				DDX55_ENST00000421670.3_De_novo_Start_InFrame|DDX55_ENST00000541259.1_Intron|DDX55_ENST00000538744.1_Intron|SNORA9_ENST00000384170.1_RNA	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55							membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		GAATGTGGTATGTGTGTGTGTG	0.52											OREG0022230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	DDX55	51		0			.																																									SO:0001627	intron_variant	57696	.			GTGGTATGTGTGT	AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1165-14TG>-	12.37:g.124103211_124103212delTG			Somatic	63	0	0	1531	WXS	Illumina HiSeq	Phase_I	95	0.09	9	.	22	0.00	0	Q658L6|Q8IYH0|Q9HCH7	Translation_Start_Site	DEL	ENST00000238146.4	37	CCDS9251.1																																																																																					0.520	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400616.2			
SFSWAP	6433	mdanderson.org	37	12	132241078	132241078	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr12:132241078G>T	ENST00000261674.4	+	11	1750	c.1609G>T	c.(1609-1611)Ggg>Tgg	p.G537W	SFSWAP_ENST00000541286.1_Missense_Mutation_p.G537W|RP11-495K9.5_ENST00000537032.1_lincRNA	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	537					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						AAGTGATGCTGGGGAGGATGG	0.582																																					p.G537W													SFSWAP,colon,carcinoma,-1,1	SFSWAP	-1	1	0			c.G1609T												64.0	69.0	67.0					12																	132241078		2203	4300	6503	SO:0001583	missense	6433	exon11			GATGCTGGGGAGG	U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.1609G>T	12.37:g.132241078G>T	ENSP00000261674:p.Gly537Trp		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001261411	89	0.00	0	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Missense_Mutation	SNP	ENST00000261674.4	37	CCDS9273.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112025	0.37242	.	.	ENSG00000061936	ENST00000261674;ENST00000544623;ENST00000535236;ENST00000541286	T;T;T	0.24151	2.87;1.87;2.88	5.34	5.34	0.76211	.	0.847820	0.10940	N	0.617342	T	0.36468	0.0968	N	0.19112	0.55	0.26300	N	0.977989	D;D	0.59357	0.985;0.975	P;P	0.61592	0.891;0.498	T	0.38693	-0.9649	10	0.66056	D	0.02	-14.706	16.1819	0.81915	0.0:0.0:1.0:0.0	.	537;537	F5H6B8;Q12872	.;SFSWA_HUMAN	W	537;474;330;537	ENSP00000261674:G537W;ENSP00000443045:G330W;ENSP00000437738:G537W	ENSP00000261674:G537W	G	+	1	0	SFSWAP	130807031	0.074000	0.21230	0.229000	0.23960	0.010000	0.07245	1.726000	0.38085	2.505000	0.84491	0.561000	0.74099	GGG			0.582	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000399276.1		NM_004592	
FLT1	2321	mdanderson.org	37	13	28883002	28883002	+	Missense_Mutation	SNP	G	G	T	rs115595062	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr13:28883002G>T	ENST00000282397.4	-	28	3949	c.3698C>A	c.(3697-3699)cCg>cAg	p.P1233Q	FLT1_ENST00000543394.1_Missense_Mutation_p.P256Q|FLT1_ENST00000540678.1_Missense_Mutation_p.P451Q	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	1233					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGTGGCATTCGGTAAAAGTTC	0.408																																					p.P1233Q													.	.			0			c.C3698A												111.0	97.0	102.0					13																	28883002		2203	4300	6503	SO:0001583	missense	2321	exon28			GCATTCGGTAAAA	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3698C>A	13.37:g.28883002G>T	ENSP00000282397:p.Pro1233Gln		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	60	0.07	4	NM_002019	14	0.00	0	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.666029	0.67700	.	.	ENSG00000102755	ENST00000282397;ENST00000543394;ENST00000540678	T;T;T	0.77877	-0.91;-1.13;-1.12	5.11	5.11	0.69529	.	0.551613	0.19907	N	0.103366	T	0.73001	0.3531	L	0.42245	1.32	0.80722	D	1	D	0.55385	0.971	B	0.43783	0.431	T	0.72724	-0.4207	10	0.33141	T	0.24	.	15.8181	0.78621	0.0:0.0:1.0:0.0	.	1233	P17948	VGFR1_HUMAN	Q	1233;256;451	ENSP00000282397:P1233Q;ENSP00000437841:P256Q;ENSP00000443311:P451Q	ENSP00000282397:P1233Q	P	-	2	0	FLT1	27781002	0.898000	0.30612	0.147000	0.22382	0.925000	0.55904	3.556000	0.53734	2.551000	0.86045	0.561000	0.74099	CCG			0.408	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044322.1			
RFC3	5983	mdanderson.org	37	13	34540232	34540232	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr13:34540232G>T	ENST00000434425.1	+	9	998	c.888G>T	c.(886-888)aaG>aaT	p.K296N		NM_181558.2	NP_853536.2	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	296					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		AGGCATGTAAGGAGGAATCAA	0.378																																					p.K296N													RFC3_ENST00000434425,NS,carcinoma,0,1	RFC3_ENST00000434425	0	1	0			c.G888T												94.0	91.0	92.0					13																	34540232		1862	4100	5962	SO:0001583	missense	5983	exon9			ATGTAAGGAGGAA		CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000434425.1:c.888G>T	13.37:g.34540232G>T	ENSP00000401001:p.Lys296Asn		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_181558	4	0.00	0	C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	ENST00000434425.1	37	CCDS45025.1	.	.	.	.	.	.	.	.	.	.	G	4.573	0.106456	0.08780	.	.	ENSG00000133119	ENST00000434425	T	0.41065	1.01	3.83	0.169	0.15017	.	.	.	.	.	T	0.21103	0.0508	N	0.08118	0	0.09310	N	1	B	0.18013	0.025	B	0.26770	0.073	T	0.28073	-1.0055	9	0.29301	T	0.29	.	6.3133	0.21176	0.4339:0.0:0.5661:0.0	.	296	C9JU95	.	N	296	ENSP00000401001:K296N	ENSP00000401001:K296N	K	+	3	2	RFC3	33438232	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.214000	0.17541	-0.011000	0.14247	-0.150000	0.13652	AAG			0.378	RFC3-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_002915	
PCDH8	5100	mdanderson.org	37	13	53420855	53420855	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr13:53420855G>T	ENST00000377942.3	-	1	1920	c.1717C>A	c.(1717-1719)Cgc>Agc	p.R573S	PCDH8_ENST00000338862.4_Missense_Mutation_p.R573S	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	573	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		TCGAGTTGGCGCAGCGTCTCA	0.662																																					p.R573S	GBM(36;25 841 9273 49207)												.	.			0			c.C1717A												15.0	15.0	15.0					13																	53420855		2184	4280	6464	SO:0001583	missense	5100	exon1			GTTGGCGCAGCGT	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.1717C>A	13.37:g.53420855G>T	ENSP00000367177:p.Arg573Ser		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_002590	0		0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.310458	0.40895	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000448969	T;T	0.59502	0.26;0.26	4.08	4.08	0.47627	Cadherin (5);Cadherin-like (1);	0.000000	0.43416	D	0.000566	T	0.38799	0.1054	N	0.05259	-0.085	0.43657	D	0.996075	P;P	0.36162	0.484;0.54	B;B	0.40901	0.232;0.343	T	0.47275	-0.9130	10	0.87932	D	0	.	9.8687	0.41160	0.0:0.0:0.6338:0.3662	.	573;573	O95206-2;O95206	.;PCDH8_HUMAN	S	573;573;416	ENSP00000367177:R573S;ENSP00000341350:R573S	ENSP00000341350:R573S	R	-	1	0	PCDH8	52318856	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	6.467000	0.73547	2.106000	0.64143	0.511000	0.50034	CGC			0.662	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000045108.2		NM_002590	
DIAPH3	81624	mdanderson.org	37	13	60565332	60565332	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr13:60565332G>T	ENST00000400324.4	-	12	1541	c.1321C>A	c.(1321-1323)Ctt>Att	p.L441I	DIAPH3_ENST00000400320.1_Missense_Mutation_p.L395I|DIAPH3_ENST00000400319.1_Missense_Mutation_p.L371I|DIAPH3_ENST00000267215.4_Missense_Mutation_p.L441I|DIAPH3_ENST00000400330.1_Missense_Mutation_p.L441I|DIAPH3_ENST00000377908.2_Missense_Mutation_p.L430I|DIAPH3_ENST00000465066.1_5'UTR	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	441	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		AGATGCTGAAGAATAGAAATA	0.299																																					p.L441I													.	.			0			c.C1321A												85.0	86.0	86.0					13																	60565332		1804	4061	5865	SO:0001583	missense	81624	exon12			GCTGAAGAATAGA	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.1321C>A	13.37:g.60565332G>T	ENSP00000383178:p.Leu441Ile		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001042517	15	0.00	0	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931854	0.92389	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	5.63	5.63	0.86233	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.95726	0.8610	H	0.94582	3.555	0.53688	D	0.999976	D;D;P	0.76494	0.999;0.993;0.939	D;D;D	0.87578	0.998;0.997;0.976	D	0.96489	0.9362	10	0.87932	D	0	.	19.6704	0.95910	0.0:0.0:1.0:0.0	.	178;178;441	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	I	441;441;430;395;371;430;371;395;441;178;441	ENSP00000383178:L441I;ENSP00000383184:L441I;ENSP00000367141:L430I;ENSP00000383173:L371I;ENSP00000383174:L395I;ENSP00000267215:L441I	ENSP00000267214:L178I	L	-	1	0	DIAPH3	59463333	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.029000	0.76477	2.635000	0.89317	0.655000	0.94253	CTT			0.299	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000045166.3		NM_001042517	
NKX2-1	7080	mdanderson.org	37	14	36988198	36988198	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr14:36988198A>G	ENST00000518149.1	-	2	970	c.365T>C	c.(364-366)tTc>tCc	p.F122S	NKX2-1_ENST00000354822.5_Missense_Mutation_p.F152S|NKX2-1-AS1_ENST00000521292.2_RNA|NKX2-1_ENST00000522719.2_Missense_Mutation_p.F122S|NKX2-1_ENST00000498187.2_Missense_Mutation_p.F122S|RP11-896J10.3_ENST00000521945.1_RNA			P43699	NKX21_HUMAN	NK2 homeobox 1	122					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		ACTGGCGGGGAAGCGCGGGTC	0.726			A		NSCLC																																p.F152S				Dom	yes		14	14q13	7080	NK2 homeobox 1		E	.	.			0			c.T455C												6.0	8.0	7.0					14																	36988198		1947	4083	6030	SO:0001583	missense	7080	exon2			GCGGGGAAGCGCG		CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000518149.1:c.365T>C	14.37:g.36988198A>G	ENSP00000428341:p.Phe122Ser		Somatic	11	0.0909090909	1		WXS	Illumina HiSeq	Phase_I	14	0.43	6	NM_001079668	0		0	D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	Missense_Mutation	SNP	ENST00000518149.1	37	CCDS9659.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.801777	0.90538	.	.	ENSG00000136352	ENST00000354822;ENST00000498187;ENST00000518149;ENST00000522719	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.79598	0.4473	M	0.81942	2.565	0.80722	D	1	D;D	0.62365	0.991;0.985	P;P	0.58130	0.833;0.686	T	0.78244	-0.2279	10	0.20519	T	0.43	.	13.3643	0.60674	1.0:0.0:0.0:0.0	.	152;122	P43699-3;P43699	.;NKX21_HUMAN	S	152;122;122;122	ENSP00000346879:F152S;ENSP00000429607:F122S;ENSP00000428341:F122S;ENSP00000429519:F122S	ENSP00000346879:F152S	F	-	2	0	NKX2-1	36057949	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.445000	0.90326	1.819000	0.53055	0.374000	0.22700	TTC			0.726	NKX2-1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376225.2		NM_003317	
SYNE2	23224	mdanderson.org	37	14	64593514	64593514	+	Missense_Mutation	SNP	C	C	A			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr14:64593514C>A	ENST00000344113.4	+	73	14118	c.13906C>A	c.(13906-13908)Cgc>Agc	p.R4636S	SYNE2_ENST00000358025.3_Missense_Mutation_p.R4636S|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.R1021S|SYNE2_ENST00000394768.2_Missense_Mutation_p.R1021S|SYNE2_ENST00000554584.1_Missense_Mutation_p.R4587S|SYNE2_ENST00000555002.1_Missense_Mutation_p.R1270S	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4636					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CGATTACAACCGCAGTTACCA	0.478																																					p.R4636S													SYNE2,NS,carcinoma,-2,1	SYNE2	-2	1	0			c.C13906A												75.0	65.0	68.0					14																	64593514		2203	4300	6503	SO:0001583	missense	23224	exon73			TACAACCGCAGTT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13906C>A	14.37:g.64593514C>A	ENSP00000341781:p.Arg4636Ser		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_015180	30	0.00	0	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	1.686	-0.505299	0.04261	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.55234	1.31;1.31;1.31;0.53;1.31;1.31	5.76	1.48	0.22813	.	1.071720	0.07217	N	0.860236	T	0.33644	0.0870	N	0.24115	0.695	0.09310	N	1	B;B;B	0.12630	0.0;0.006;0.004	B;B;B	0.11329	0.001;0.006;0.005	T	0.22906	-1.0203	10	0.08599	T	0.76	.	6.391	0.21587	0.2193:0.5455:0.0:0.2352	.	1021;4636;4636	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	S	4636;1021;4636;4587;4587;1270;1021	ENSP00000350719:R4636S;ENSP00000349969:R1021S;ENSP00000341781:R4636S;ENSP00000452570:R4587S;ENSP00000450831:R1270S;ENSP00000378249:R1021S	ENSP00000261678:R4587S	R	+	1	0	SYNE2	63663267	0.037000	0.19845	0.002000	0.10522	0.004000	0.04260	0.787000	0.26858	0.096000	0.17463	-1.814000	0.00607	CGC			0.478	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276994.2		NM_182914	
CCNK	8812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	99959052	99959052	+	Missense_Mutation	SNP	C	C	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr14:99959052C>G	ENST00000389879.5	+	2	161	c.38C>G	c.(37-39)aCt>aGt	p.T13S	CCNK_ENST00000557165.1_3'UTR|CCNK_ENST00000555049.1_Missense_Mutation_p.T13S	NM_001099402.1	NP_001092872.1	O75909	CCNK_HUMAN	cyclin K	13					cellular response to DNA damage stimulus (GO:0006974)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of cell cycle arrest (GO:0071157)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cyclin K-CDK12 complex (GO:0002944)|cyclin K-CDK13 complex (GO:0002945)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|endometrium(2)|lung(3)	6		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				CCTTCAGTAACTTCAGCAAAC	0.413																																					p.T13S													.	.			0			c.C38G												66.0	63.0	64.0					14																	99959052		1889	4116	6005	SO:0001583	missense	8812	exon2			CAGTAACTTCAGC	AF060515	CCDS45160.1	14q32.2	2014-07-03			ENSG00000090061	ENSG00000090061			1596	protein-coding gene	gene with protein product		603544				9632813, 10574912	Standard	NM_001099402		Approved	CPR4	uc001ygi.4	O75909	OTTHUMG00000171495	ENST00000389879.5:c.38C>G	14.37:g.99959052C>G	ENSP00000374529:p.Thr13Ser		Somatic	143	0	0		WXS	Illumina HiSeq	.	139	0.17	23	NM_001099402	131	0.20	26	Q59FT6|Q86U16|Q96B63|Q9NNY9	Missense_Mutation	SNP	ENST00000389879.5	37	CCDS45160.1	.	.	.	.	.	.	.	.	.	.	C	5.699	0.313561	0.10789	.	.	ENSG00000090061	ENST00000437596;ENST00000216279;ENST00000380246;ENST00000389879;ENST00000557441;ENST00000555049;ENST00000555842	T;T;T;T	0.40756	2.29;2.04;2.33;1.02	6.16	5.27	0.74061	Cyclin-like (1);	0.269970	0.36665	N	0.002475	T	0.22936	0.0554	N	0.14661	0.345	0.22066	N	0.99938	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.12578	-1.0542	10	0.08179	T	0.78	-7.9123	11.6561	0.51320	0.1294:0.804:0.0:0.0666	.	13;13	O75909;O75909-2	CCNK_HUMAN;.	S	13	ENSP00000374529:T13S;ENSP00000450792:T13S;ENSP00000452307:T13S;ENSP00000450440:T13S	ENSP00000216279:T13S	T	+	2	0	CCNK	99028805	0.990000	0.36364	0.984000	0.44739	0.998000	0.95712	3.165000	0.50778	2.937000	0.99478	0.650000	0.86243	ACT			0.413	CCNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413721.1			
IGHV2-70	28454	broad.mit.edu;mdanderson.org	37	14	107178963	107178963	+	RNA	SNP	T	T	G	rs374012300	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr14:107178963T>G	ENST00000390634.2	-	0	289									immunoglobulin heavy variable 2-70																		TCCCAATCAATGAGTGCAAGC	0.517																																					.													.	.			0			.												116.0	96.0	102.0					14																	107178963		2056	4171	6227			0	.			AATCAATGAGTGC	L21969		14q32.33	2012-02-08			ENSG00000211974	ENSG00000211974		"""Immunoglobulins / IGH locus"""	5577	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151870		14.37:g.107178963T>G			Somatic	267	0.0074906367	2		WXS	Illumina HiSeq	Phase_I	302	0.05	15	.	63	0.02	1		RNA	SNP	ENST00000390634.2	37																																																																																						0.517	IGHV2-70-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000324215.1		NG_001019	
GOLGA6L2	283685	bcgsc.ca	37	15	23685618	23685618	+	Silent	SNP	C	C	T	rs558395608	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr15:23685618C>T	ENST00000567107.1	-	8	2056	c.2004G>A	c.(2002-2004)gtG>gtA	p.V668V	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						ttcctgctcccacatcttctc	0.572													-|||	129	0.0257588	0.0908	0.0086	5008	,	,		20885	0.0		0.001	False		,,,				2504	0.002				.													.	.			0			.																																									SO:0001819	synonymous_variant	283685	.			TGCTCCCACATCT	AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2004G>A	15.37:g.23685618C>T			Somatic	35	0	0		WXS	Illumina HiSeq	Phase_1	43	0.14	6	.	0		0	A1L301	Silent	SNP	ENST00000567107.1	37																																																																																						0.572	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000431937.1		NM_182561	
NANOGP8	388112	bcgsc.ca	37	15	35376761	35376761	+	IGR	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr15:35376761C>T								RP11-463I20.2 (73369 upstream) : RP11-323I15.5 (14461 downstream)																							CACCAGGCATCCCTGGTGGTA	0.547																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	388112	.			AGGCATCCCTGGT																													15.37:g.35376761C>T			Somatic	308	0	0		WXS	Illumina HiSeq	Phase_1	336	0.11	36	.	916	0.00	0		RNA	SNP		37																																																																																					0	0.547										
CD276	80381	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	73995180	73995180	+	Silent	SNP	C	C	T	rs146911233	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr15:73995180C>T	ENST00000318443.5	+	4	788	c.486C>T	c.(484-486)acC>acT	p.T162T	CD276_ENST00000564751.1_Intron|CD276_ENST00000561213.1_Silent_p.T162T|CD276_ENST00000537340.2_Silent_p.T16T|CD276_ENST00000318424.5_Intron	NM_001024736.1	NP_001019907.1	Q5ZPR3	CD276_HUMAN	CD276 molecule	162	Ig-like C2-type 1.				cell proliferation (GO:0008283)|immune response (GO:0006955)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of bone mineralization (GO:0030501)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			endometrium(3)|lung(5)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	13						ACACGGTGACCATCACGTGCT	0.647																																					p.T162T													.	.			0			c.C486T												86.0	77.0	80.0					15																	73995180		2198	4297	6495	SO:0001819	synonymous_variant	80381	exon4			GGTGACCATCACG	AF302102	CCDS10251.1, CCDS32288.1	15q23-q24	2013-01-11	2006-03-28		ENSG00000103855	ENSG00000103855		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19137	protein-coding gene	gene with protein product		605715	"""CD276 antigen"""			11224528, 12055244	Standard	XM_005254699		Approved	B7-H3, B7H3, B7RP-2	uc002avv.1	Q5ZPR3	OTTHUMG00000137585	ENST00000318443.5:c.486C>T	15.37:g.73995180C>T			Somatic	118	0	0		WXS	Illumina HiSeq	.	125	0.18	23	NM_001024736	138	0.17	24	Q6P5Y4|Q6UXI2|Q8NBI8|Q8NC34|Q8NCB6|Q9BXR1	Silent	SNP	ENST00000318443.5	37	CCDS32288.1																																																																																					0.647	CD276-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268979.1		NM_025240	
LOC645752	645752	broad.mit.edu	37	15	78217296	78217296	+	lincRNA	SNP	A	A	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr15:78217296A>G	ENST00000565869.1	+	0	706				RP11-114H24.2_ENST00000567226.1_RNA																							GTGAGTGGCAACCACCAGAAG	0.527																																					.													.	.			0			.																																											0	.			GTGGCAACCACCA																													15.37:g.78217296A>G			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	107	0.12	13	.	0		0		RNA	SNP	ENST00000565869.1	37																																																																																						0.527	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000421587.1			
PRR25	388199	mdanderson.org	37	16	863659	863659	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr16:863659G>T	ENST00000301698.1	+	3	1007	c.1007G>T	c.(1006-1008)gGg>gTg	p.G336V		NM_001013638.1	NP_001013660.1	Q96S07	PRR25_HUMAN	proline rich 25	336										large_intestine(1)|lung(1)|skin(1)	3						GTGGAGCCCGGGGAGGCCGCC	0.766																																					p.G336V													.	.			0			c.G1007T												5.0	5.0	5.0					16																	863659		1831	3970	5801	SO:0001583	missense	388199	exon3			AGCCCGGGGAGGC	BC156145	CCDS45372.1	16p13.3	2009-09-11			ENSG00000167945	ENSG00000167945			37230	protein-coding gene	gene with protein product						11157797	Standard	NM_001013638		Approved	gs64	uc010uut.2	Q96S07		ENST00000301698.1:c.1007G>T	16.37:g.863659G>T	ENSP00000301698:p.Gly336Val		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001013638	0		0		Missense_Mutation	SNP	ENST00000301698.1	37	CCDS45372.1	.	.	.	.	.	.	.	.	.	.	G	8.381	0.837511	0.16891	.	.	ENSG00000167945	ENST00000301698	T	0.46063	0.88	0.84	0.84	0.18912	.	.	.	.	.	T	0.16685	0.0401	N	0.08118	0	0.09310	N	1	P	0.41498	0.752	B	0.30105	0.111	T	0.11665	-1.0578	9	0.87932	D	0	.	4.972	0.14121	0.0:0.0:1.0:0.0	.	336	Q96S07	PRR25_HUMAN	V	336	ENSP00000301698:G336V	ENSP00000301698:G336V	G	+	2	0	PRR25	803660	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.129000	0.10515	0.728000	0.32382	0.407000	0.27541	GGG			0.766	PRR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440563.1		NM_001013638	
TELO2	9894	mdanderson.org	37	16	1550145	1550145	+	Missense_Mutation	SNP	C	C	T	rs140327619		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr16:1550145C>T	ENST00000262319.6	+	7	1261	c.982C>T	c.(982-984)Cgg>Tgg	p.R328W		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	328					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GGACAGCCAGCGGCGCCCGCT	0.687																																					p.R328W													.	.			0			c.C982T								TRP/ARG	1,4381		0,1,2190	14.0	15.0	15.0		982	5.0	1.0	16	dbSNP_134	15	0,8576		0,0,4288	no	missense	TELO2	NM_016111.3	101	0,1,6478	TT,TC,CC		0.0,0.0228,0.0077	probably-damaging	328/838	1550145	1,12957	2191	4288	6479	SO:0001583	missense	9894	exon7			AGCCAGCGGCGCC	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.982C>T	16.37:g.1550145C>T	ENSP00000262319:p.Arg328Trp		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_016111	70	0.00	0	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	c	23.2	4.388485	0.82902	2.28E-4	0.0	ENSG00000100726	ENST00000262319	D	0.85339	-1.97	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.91600	0.7346	M	0.78637	2.42	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.91526	0.5238	10	0.46703	T	0.11	-39.8052	13.8505	0.63494	0.0:1.0:0.0:0.0	.	328	Q9Y4R8	TELO2_HUMAN	W	328	ENSP00000262319:R328W	ENSP00000262319:R328W	R	+	1	2	TELO2	1490146	0.998000	0.40836	1.000000	0.80357	0.941000	0.58515	4.972000	0.63756	2.344000	0.79699	0.651000	0.88453	CGG	0		0.687	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103602.2		NM_016111	
RRN3P2	653390	broad.mit.edu	37	16	29096900	29096900	+	RNA	DEL	A	A	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr16:29096900delA	ENST00000564580.1	+	0	589							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		TGTCTTCTTTAAAAAAAAAAG	0.418																																					.													.	.			0			.																																											0	.			TTCTTTAAAAAAA			16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29096900delA			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	13	0.31	4	.	0		0		RNA	DEL	ENST00000564580.1	37																																																																																						0.418	RRN3P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000433243.1		NR_003369	
RRN3P2	653390	broad.mit.edu	37	16	29110438	29110438	+	RNA	SNP	T	T	C			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr16:29110438T>C	ENST00000564580.1	+	0	1111							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2									p.L368P(6)									TTGCAGTATCTTCAGAGTCTG	0.328																																					.													.	.			6	Substitution - Missense(6)	endometrium(5)|kidney(1)	.																																											0	.			AGTATCTTCAGAG			16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29110438T>C			Somatic	338	0	0		WXS	Illumina HiSeq	Phase_I	390	0.01	4	.	0		0		RNA	SNP	ENST00000564580.1	37		.	.	.	.	.	.	.	.	.	.	t	5.164	0.215759	0.09810	.	.	ENSG00000103472	ENST00000427965	.	.	.	1.93	1.93	0.25924	.	0.000000	0.64402	U	0.000008	T	0.52645	0.1747	.	.	.	.	.	.	.	.	.	.	.	.	T	0.63580	-0.6605	5	0.56958	D	0.05	.	7.5159	0.27600	0.0:0.0:0.0:1.0	.	.	.	.	P	368	.	ENSP00000398611:L368P	L	+	2	0	AC009093.1	29017939	1.000000	0.71417	0.752000	0.31206	0.354000	0.29330	6.384000	0.73177	0.893000	0.36288	0.155000	0.16302	CTT			0.328	RRN3P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000433243.1		NR_003369	
CTB-134H23.3	0	broad.mit.edu	37	16	29118702	29118704	+	RNA	DEL	AGC	AGC	-	rs374747642		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	AGC	AGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr16:29118702_29118704delAGC	ENST00000562618.1	-	0	328_330				RRN3P2_ENST00000564580.1_RNA																							GCCAGGTCCAagcagcagcagca	0.66																																					.													.	.			0			.																																											0	.			GGTCCAAGCAGCA																													16.37:g.29118711_29118713delAGC			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	38	0.18	7	.	1	0.00	0		RNA	DEL	ENST00000562618.1	37																																																																																						0.660	CTB-134H23.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000433241.1			
RFWD3	55159	broad.mit.edu	37	16	74660394	74660394	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr16:74660394G>T	ENST00000361070.4	-	12	2125	c.2028C>A	c.(2026-2028)gaC>gaA	p.D676E	RFWD3_ENST00000571750.1_Missense_Mutation_p.D676E	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	676					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						GATTTCCAGTGTCATCCAGTC	0.458																																					p.D676E													.	RFWD3	49		0			c.C2028A												154.0	143.0	147.0					16																	74660394		2198	4300	6498	SO:0001583	missense	55159	exon12			TCCAGTGTCATCC	AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.2028C>A	16.37:g.74660394G>T	ENSP00000354361:p.Asp676Glu		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	163	0.03	5	NM_018124	199	0.00	0	A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Missense_Mutation	SNP	ENST00000361070.4	37	CCDS32486.1	.	.	.	.	.	.	.	.	.	.	G	6.036	0.375088	0.11409	.	.	ENSG00000168411	ENST00000361070;ENST00000444004	T	0.17370	2.28	5.49	-9.19	0.00685	.	0.574961	0.19160	N	0.121209	T	0.07234	0.0183	N	0.22421	0.69	0.09310	N	1	B	0.18741	0.03	B	0.12156	0.007	T	0.35301	-0.9794	10	0.14656	T	0.56	-15.5519	11.6707	0.51399	0.1188:0.1377:0.6569:0.0866	.	676	Q6PCD5	RFWD3_HUMAN	E	676;165	ENSP00000354361:D676E	ENSP00000354361:D676E	D	-	3	2	RFWD3	73217895	0.006000	0.16342	0.000000	0.03702	0.084000	0.17831	-0.060000	0.11712	-1.118000	0.02961	0.561000	0.74099	GAC			0.458	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436506.2		NM_018124	
ASIC2	40	mdanderson.org	37	17	31618506	31618506	+	Intron	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr17:31618506G>T	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.R210S	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	TGGCCCAGGCGGTCCATGAAG	0.692																																					p.R210S													.	.			0			c.C628A												28.0	30.0	29.0					17																	31618506		2194	4284	6478	SO:0001627	intron_variant	40	exon1			CCAGGCGGTCCAT	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179421C>A	17.37:g.31618506G>T			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_183377	3	0.00	0	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159509	0.57368	.	.	ENSG00000108684	ENST00000225823	T	0.65364	-0.15	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.76499	0.3996	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.75453	-0.3312	10	0.35671	T	0.21	-9.8882	10.34	0.43873	0.0:0.0:0.8041:0.1959	.	210	E9PBX2	.	S	210	ENSP00000225823:R210S	ENSP00000225823:R210S	R	-	1	0	ACCN1	28642619	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.017000	0.64047	1.205000	0.43262	0.313000	0.20887	CGC			0.692	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447552.1		NM_183377, NM_001094	
KRT33B	3884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39525812	39525812	+	Missense_Mutation	SNP	T	T	C	rs199518913	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr17:39525812T>C	ENST00000251646.3	-	1	240	c.191A>G	c.(190-192)aAc>aGc	p.N64S		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	64	Coil 1A.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				CAGGCGGTCGTTCAGGAACTG	0.627													T|||	2	0.000399361	0.0	0.0	5008	,	,		19127	0.002		0.0	False		,,,				2504	0.0				p.N64S													KRT33B,NS,carcinoma,+1,3	KRT33B	1	3	0			c.A191G												72.0	72.0	72.0					17																	39525812		2203	4297	6500	SO:0001583	missense	3884	exon1			CGGTCGTTCAGGA	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.191A>G	17.37:g.39525812T>C	ENSP00000251646:p.Asn64Ser		Somatic	161	0	0		WXS	Illumina HiSeq	.	166	0.27	44	NM_002279	0		0	O76010	Missense_Mutation	SNP	ENST00000251646.3	37	CCDS11389.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	N	23.0	4.365487	0.82463	.	.	ENSG00000131738	ENST00000251646	D	0.96587	-4.06	4.26	4.26	0.50523	Filament (1);	0.000000	0.64402	D	0.000001	D	0.98773	0.9587	H	0.98199	4.17	0.39290	D	0.964714	D	0.89917	1.0	D	0.97110	1.0	D	0.99898	1.1153	10	0.87932	D	0	.	12.9995	0.58667	0.0:0.0:0.0:1.0	.	64	Q14525	KT33B_HUMAN	S	64	ENSP00000251646:N64S	ENSP00000251646:N64S	N	-	2	0	KRT33B	36779338	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	6.000000	0.70678	1.915000	0.55452	0.528000	0.53228	AAC	0		0.627	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257292.1		NM_002279	
RGS9	8787	mdanderson.org	37	17	63221447	63221447	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr17:63221447G>T	ENST00000262406.9	+	18	1802	c.1735G>T	c.(1735-1737)Gct>Tct	p.A579S	RGS9_ENST00000449996.3_Missense_Mutation_p.A576S|RGS9_ENST00000443584.3_Missense_Mutation_p.A576S	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	579					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						GGCCCGCATGGCTCTGTCCTT	0.677																																					p.A579S													RGS9,NS,carcinoma,0,1	RGS9	0	1	0			c.G1735T												74.0	78.0	77.0					17																	63221447		1936	4127	6063	SO:0001583	missense	8787	exon18			CGCATGGCTCTGT	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1735G>T	17.37:g.63221447G>T	ENSP00000262406:p.Ala579Ser		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_003835	0		0	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189412	0.57909	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.39056	1.13;1.1	4.76	2.67	0.31697	.	0.206528	0.39834	N	0.001260	T	0.41050	0.1142	L	0.55481	1.735	0.38215	D	0.940595	B;P;P	0.48407	0.025;0.91;0.86	B;B;P	0.44561	0.014;0.388;0.453	T	0.49254	-0.8959	10	0.72032	D	0.01	.	11.5591	0.50766	0.0:0.1357:0.7233:0.141	.	579;579;576	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	S	579;576	ENSP00000262406:A579S;ENSP00000396329:A576S	ENSP00000262406:A579S	A	+	1	0	RGS9	60651909	0.983000	0.35010	0.007000	0.13788	0.996000	0.88848	1.859000	0.39418	0.628000	0.30357	0.561000	0.74099	GCT			0.677	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000445885.1		NM_003835	
LPIN2	9663	mdanderson.org	37	18	2931429	2931429	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr18:2931429G>T	ENST00000261596.4	-	9	1519	c.1281C>A	c.(1279-1281)ccC>ccA	p.P427P		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	427					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GCCTGGAACCGGGCTCCGATT	0.567																																					p.P427P													.	.			0			c.C1281A												38.0	27.0	31.0					18																	2931429		2202	4300	6502	SO:0001819	synonymous_variant	9663	exon9			GGAACCGGGCTCC	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1281C>A	18.37:g.2931429G>T			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_014646	35	0.00	0	A7MD25|D3DUH3	Silent	SNP	ENST00000261596.4	37	CCDS11829.1																																																																																					0.567	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254363.2		NM_014646	
ARID3A	1820	mdanderson.org	37	19	932484	932484	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:932484G>T	ENST00000263620.3	+	3	762	c.435G>T	c.(433-435)gaG>gaT	p.E145D		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	145	Acidic.|Glu-rich.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aggaggaggaggattacgagg	0.657																																					p.E145D	Pancreas(29;54 1022 32760 50921)												.	.			0			c.G435T												13.0	11.0	12.0					19																	932484		2188	4276	6464	SO:0001583	missense	1820	exon3			GGAGGAGGATTAC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.435G>T	19.37:g.932484G>T	ENSP00000263620:p.Glu145Asp		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	52	0.08	4	NM_005224	11	0.00	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	37	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	G	0.028	-1.358116	0.01245	.	.	ENSG00000116017	ENST00000263620	T	0.09723	2.95	3.66	-5.32	0.02722	.	2115.840000	0.01081	U	0.004984	T	0.07369	0.0186	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36261	-0.9755	10	0.12766	T	0.61	.	7.8841	0.29640	0.0:0.209:0.2856:0.5054	.	145	Q99856	ARI3A_HUMAN	D	145	ENSP00000263620:E145D	ENSP00000263620:E145D	E	+	3	2	ARID3A	883484	0.028000	0.19301	0.181000	0.23098	0.381000	0.30169	-1.319000	0.02702	-0.259000	0.09432	0.457000	0.33378	GAG			0.657	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458219.1		NM_005224	
REEP6	92840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1496326	1496326	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:1496326G>T	ENST00000233596.3	+	4	495	c.391G>T	c.(391-393)Ggg>Tgg	p.G131W		NM_138393.1	NP_612402.1	Q96HR9	REEP6_HUMAN	receptor accessory protein 6	131					regulation of intracellular transport (GO:0032386)	apical part of cell (GO:0045177)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				lung(1)|ovary(1)	2		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCTGGAACGGGGCTCTCAT	0.662																																					p.G131W													.	.			0			c.G391T												78.0	68.0	71.0					19																	1496326		2201	4300	6501	SO:0001583	missense	92840	exon4			TGGAACGGGGCTC	BC008201	CCDS12070.1	19p13.3	2012-12-20	2006-02-08	2006-02-07	ENSG00000115255	ENSG00000115255		"""Receptor accessory proteins"""	30078	protein-coding gene	gene with protein product	"""polyposis locus protein 1-like 1"", ""deleted in polyposis 1-like 1"""	609346	"""chromosome 19 open reading frame 32"""	C19orf32		16271481, 15550249	Standard	NM_138393		Approved	DP1L1, FLJ25383	uc002ltc.3	Q96HR9	OTTHUMG00000180072	ENST00000233596.3:c.391G>T	19.37:g.1496326G>T	ENSP00000233596:p.Gly131Trp		Somatic	49	0	0		WXS	Illumina HiSeq	.	54	0.11	6	NM_138393	268	0.00	0	B2RE01|D6W5Z0|Q96LM0	Missense_Mutation	SNP	ENST00000233596.3	37	CCDS12070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.0|24.0	4.486211|4.486211	0.84854|0.84854	.|.	.|.	ENSG00000115255|ENSG00000115255	ENST00000233596;ENST00000395479|ENST00000395484	D|.	0.97455|.	-4.39|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	.|.	.|.	.|.	.|.	D|D	0.91395|0.91395	0.7285|0.7285	H|H	0.99525|0.99525	4.61|4.61	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.95063|0.95063	0.8197|0.8197	9|6	0.87932|0.62326	D|D	0|0.03	-7.1936|-7.1936	17.2553|17.2553	0.87053|0.87053	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	131|.	Q96HR9|.	REEP6_HUMAN|.	W|L	131|198	ENSP00000233596:G131W|.	ENSP00000233596:G131W|ENSP00000378865:R198L	G|R	+|+	1|2	0|0	REEP6|REEP6	1447326|1447326	1.000000|1.000000	0.71417|0.71417	0.606000|0.606000	0.28943|0.28943	0.010000|0.010000	0.07245|0.07245	7.598000|7.598000	0.82745|0.82745	2.318000|2.318000	0.78349|0.78349	0.552000|0.552000	0.68991|0.68991	GGG|CGG			0.662	REEP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449623.1		NM_138393	
AMH	268	hgsc.bcm.edu;broad.mit.edu	37	19	2249483	2249484	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:2249483_2249484delAA	ENST00000221496.4	+	1	174_175	c.152_153delAA	c.(151-153)caafs	p.Q51fs	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	51					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCAGCCCACAAGAGCCTCTGT	0.663									Persistant Mullerian Duct Syndrome (type I and II)																												p.51_51del													.	AMH	12		0			c.151_152del																																									SO:0001589	frameshift_variant	268	exon1	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	GCCCACAAGAGCC	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.152_153delAA	19.37:g.2249483_2249484delAA	ENSP00000221496:p.Gln51fs		Somatic	24	0	0		WXS	Illumina HiSeq	.	39	0.26	10	NM_000479	18	0.44	8	O75246|Q6GTN3	Frame_Shift_Del	DEL	ENST00000221496.4	37	CCDS12085.1																																																																																					0.663	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451276.3		NM_000479	
YIPF2	78992	bcgsc.ca;mdanderson.org	37	19	11038590	11038590	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:11038590G>A	ENST00000586748.1	-	3	249	c.77C>T	c.(76-78)gCc>gTc	p.A26V	C19orf52_ENST00000270502.6_5'Flank|YIPF2_ENST00000253031.2_Missense_Mutation_p.A26V|YIPF2_ENST00000590329.1_Missense_Mutation_p.A26V			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	26						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						GCTGGTGGTGGCTGCATCTGG	0.597																																					p.A26V													.	YIPF2	13		0			c.C77T												94.0	93.0	93.0					19																	11038590		2203	4300	6503	SO:0001583	missense	78992	exon3			GTGGTGGCTGCAT	BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.77C>T	19.37:g.11038590G>A	ENSP00000466055:p.Ala26Val		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_1	102	0.05	5	NM_024029	271	0.00	0		Missense_Mutation	SNP	ENST00000586748.1	37	CCDS12251.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053505	0.55218	.	.	ENSG00000130733	ENST00000253031	.	.	.	4.78	1.55	0.23275	.	0.636404	0.16173	N	0.226187	T	0.31231	0.0790	L	0.43152	1.355	0.09310	N	1	B	0.28713	0.22	B	0.21708	0.036	T	0.17167	-1.0378	9	0.52906	T	0.07	-16.622	8.5612	0.33511	0.2553:0.0:0.7447:0.0	.	26	Q9BWQ6	YIPF2_HUMAN	V	26	.	ENSP00000253031:A26V	A	-	2	0	YIPF2	10899590	0.495000	0.26051	0.001000	0.08648	0.819000	0.46315	3.578000	0.53892	0.251000	0.21505	0.655000	0.94253	GCC			0.597	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453045.1		NM_024029	
RASAL3	64926	mdanderson.org	37	19	15574979	15574979	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:15574979C>T	ENST00000343625.7	-	2	276	c.191G>A	c.(190-192)cGc>cAc	p.R64H		NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	64					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						GAATATCGAGCGAGGGGCTGG	0.677																																					p.R64H													.	.			0			c.G191A												18.0	21.0	20.0					19																	15574979		1968	4152	6120	SO:0001583	missense	64926	exon2			ATCGAGCGAGGGG		CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.191G>A	19.37:g.15574979C>T	ENSP00000341905:p.Arg64His		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_022904	25	0.00	0	Q8N2T9|Q9H735	Missense_Mutation	SNP	ENST00000343625.7	37	CCDS46006.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064832	0.55432	.	.	ENSG00000105122	ENST00000343625	T	0.34072	1.38	4.11	4.11	0.48088	.	0.000000	0.29653	U	0.011559	T	0.54919	0.1888	M	0.64997	1.995	0.30063	N	0.81075	D	0.76494	0.999	D	0.76071	0.987	T	0.56013	-0.8049	10	0.72032	D	0.01	.	12.5683	0.56322	0.0:1.0:0.0:0.0	.	64	Q86YV0	RASL3_HUMAN	H	64	ENSP00000341905:R64H	ENSP00000341905:R64H	R	-	2	0	RASAL3	15435979	0.922000	0.31269	0.900000	0.35374	0.140000	0.21249	2.290000	0.43531	2.232000	0.73038	0.462000	0.41574	CGC			0.677	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461331.3		NM_022904	
COLGALT1	79709	mdanderson.org	37	19	17688822	17688822	+	Missense_Mutation	SNP	G	G	A	rs372215750		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:17688822G>A	ENST00000252599.4	+	9	1310	c.1190G>A	c.(1189-1191)cGg>cAg	p.R397Q		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	397					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										CCTGGCTACCGGGACCCCTAC	0.642																																					p.R397Q													.	.			0			c.G1190A							G	GLN/ARG	0,4406		0,0,2203	47.0	45.0	46.0		1190	0.1	1.0	19		46	1,8599	1.2+/-3.3	0,1,4299	no	missense	GLT25D1	NM_024656.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	397/623	17688822	1,13005	2203	4300	6503	SO:0001583	missense	79709	exon9			GCTACCGGGACCC	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1190G>A	19.37:g.17688822G>A	ENSP00000252599:p.Arg397Gln		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_024656	207	0.00	0	Q8NC64	Missense_Mutation	SNP	ENST00000252599.4	37	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	G	2.479	-0.320186	0.05386	0.0	1.16E-4	ENSG00000130309	ENST00000379714;ENST00000252599	T	0.76839	-1.05	5.03	0.0504	0.14293	.	0.697259	0.14708	N	0.303110	T	0.50718	0.1632	N	0.11364	0.135	0.30035	N	0.813112	B;B	0.21821	0.002;0.061	B;B	0.13407	0.005;0.009	T	0.42799	-0.9430	10	0.08381	T	0.77	-21.8634	6.7112	0.23278	0.5985:0.0:0.4015:0.0	.	125;397	E9PC06;Q8NBJ5	.;GT251_HUMAN	Q	125;397	ENSP00000252599:R397Q	ENSP00000252599:R397Q	R	+	2	0	GLT25D1	17549822	0.000000	0.05858	0.997000	0.53966	0.307000	0.27823	0.171000	0.16685	0.175000	0.19841	-0.657000	0.03884	CGG			0.642	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464216.1		NM_024656	
MYBPC2	4606	broad.mit.edu	37	19	50955169	50955169	+	Missense_Mutation	SNP	C	C	T	rs11879768	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:50955169C>T	ENST00000357701.5	+	16	1709	c.1658C>T	c.(1657-1659)gCg>gTg	p.A553V		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	553	Ig-like C2-type 5.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		TCAGAGAATGCGATTGTGGTT	0.592													c|||	17	0.00339457	0.0121	0.0014	5008	,	,		16105	0.0		0.0	False		,,,				2504	0.0				p.A553V													.	MYBPC2	103		0			c.C1658T							C	VAL/ALA	29,3935		1,27,1954	48.0	55.0	53.0		1658	3.2	0.0	19	dbSNP_120	53	3,8317		0,3,4157	yes	missense	MYBPC2	NM_004533.3	64	1,30,6111	TT,TC,CC		0.0361,0.7316,0.2605	benign	553/1142	50955169	32,12252	1982	4160	6142	SO:0001583	missense	4606	exon16			AGAATGCGATTGT		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1658C>T	19.37:g.50955169C>T	ENSP00000350332:p.Ala553Val		Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	234	0.02	4	NM_004533	3	0.00	0	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	CCDS46152.1	8	0.003663003663003663	8	0.016260162601626018	0	0.0	0	0.0	0	0.0	c	13.61	2.289404	0.40494	0.007316	3.61E-4	ENSG00000086967	ENST00000357701	T	0.67345	-0.26	3.15	3.15	0.36227	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.218410	0.07080	U	0.836961	T	0.31199	0.0789	N	0.05230	-0.09	0.09310	N	0.999993	B	0.10296	0.003	B	0.09377	0.004	T	0.09509	-1.0671	10	0.23891	T	0.37	.	13.5581	0.61773	0.0:1.0:0.0:0.0	rs11879768;rs11879768	553	Q14324	MYPC2_HUMAN	V	553	ENSP00000350332:A553V	ENSP00000350332:A553V	A	+	2	0	MYBPC2	55646981	0.008000	0.16893	0.008000	0.14137	0.837000	0.47467	1.879000	0.39618	1.778000	0.52293	0.431000	0.28591	GCG			0.592	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464751.1		NM_004533	
KLK2	3817	bcgsc.ca	37	19	51376760	51376760	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr19:51376760T>C	ENST00000325321.3	+	1	256	c.31T>C	c.(31-33)Tct>Cct	p.S11P	KLK2_ENST00000391810.2_5'UTR|KLK2_ENST00000358049.4_Missense_Mutation_p.S11P|KLK2_ENST00000597509.1_Intron			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	11					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)		KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		CATCGCCTTGTCTGTGGGGTG	0.612			T	ETV4	prostate																																p.S11P				Dom	yes		19	19q13.41	3817	kallikrein-related peptidase 2		E	.	KLK2	66		0			c.T31C												73.0	56.0	62.0					19																	51376760		2203	4300	6503	SO:0001583	missense	3817	exon1			GCCTTGTCTGTGG	M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.31T>C	19.37:g.51376760T>C	ENSP00000313581:p.Ser11Pro		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_1	54	0.07	4	NM_001002231	0		0	B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	CCDS12808.1	.	.	.	.	.	.	.	.	.	.	T	11.70	1.715753	0.30413	.	.	ENSG00000167751	ENST00000325321;ENST00000358049	D;D	0.89196	-2.48;-2.43	2.77	0.426	0.16479	.	0.273876	0.19729	N	0.107387	D	0.86594	0.5970	L	0.27053	0.805	0.09310	N	0.999999	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.961	T	0.75258	-0.3381	10	0.42905	T	0.14	.	2.6547	0.05008	0.2256:0.1427:0.0:0.6318	.	11;11	P20151-2;P20151	.;KLK2_HUMAN	P	11	ENSP00000313581:S11P;ENSP00000350748:S11P	ENSP00000313581:S11P	S	+	1	0	KLK2	56068572	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.391000	0.07323	-0.134000	0.11516	-0.388000	0.06559	TCT			0.612	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464438.3		NM_005551.3	
ROCK2	9475	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	11355177	11355178	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr2:11355177_11355178delAG	ENST00000315872.6	-	16	2172_2173	c.1724_1725delCT	c.(1723-1725)tctfs	p.S575fs	ROCK2_ENST00000401753.1_Frame_Shift_Del_p.S332fs	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	575	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CTGCAGTATCAGACTCTGTTCG	0.386																																					p.575_576del													.	ROCK2	224		0			c.1725_1726del																																									SO:0001589	frameshift_variant	9475	exon16			AGTATCAGACTCT	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1724_1725delCT	2.37:g.11355177_11355178delAG	ENSP00000317985:p.Ser575fs		Somatic	134	0	0		WXS	Illumina HiSeq	.	144	0.22	31	NM_004850	15	0.00	0	Q53QZ0|Q53SJ7|Q9UQN5	Frame_Shift_Del	DEL	ENST00000315872.6	37	CCDS42654.1																																																																																					0.386	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313886.3			
ARHGEF4	50649	mdanderson.org	37	2	131803741	131803741	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr2:131803741G>T	ENST00000326016.5	+	14	2571	c.2052G>T	c.(2050-2052)cgG>cgT	p.R684R	ARHGEF4_ENST00000525839.1_3'UTR|ARHGEF4_ENST00000428230.2_Silent_p.R186R|ARHGEF4_ENST00000355771.3_Silent_p.R613R|ARHGEF4_ENST00000392953.3_3'UTR|ARHGEF4_ENST00000409303.1_Silent_p.R624R	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	684					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		GCATCAGCCGGCTGGCACCCT	0.672																																					p.R684R													.	.			0			c.G2052T												31.0	34.0	33.0					2																	131803741		2202	4300	6502	SO:0001819	synonymous_variant	50649	exon14			CAGCCGGCTGGCA	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.2052G>T	2.37:g.131803741G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_015320	28	0.00	0	Q9HDC6|Q9UPP0	Silent	SNP	ENST00000326016.5	37	CCDS2165.1																																																																																					0.672	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000254554.4			
SCN7A	6332	broad.mit.edu	37	2	167301385	167301385	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr2:167301385G>T	ENST00000409855.1	-	12	1639	c.1513C>A	c.(1513-1515)Cca>Aca	p.P505T		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	505					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TCAGTAAATGGTGCCATTATA	0.328																																					p.P505T													.	SCN7A	410		0			c.C1513A												69.0	67.0	68.0					2																	167301385		1826	4092	5918	SO:0001583	missense	6332	exon12			TAAATGGTGCCAT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1513C>A	2.37:g.167301385G>T	ENSP00000386796:p.Pro505Thr		Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	185	0.02	4	NM_002976	0		0		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.091099	0.55968	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.97831	-4.56;-4.56	5.43	5.43	0.79202	.	0.000000	0.51477	D	0.000097	D	0.98960	0.9646	M	0.91768	3.24	0.58432	D	0.999995	D	0.89917	1.0	D	0.85130	0.997	D	0.99470	1.0945	10	0.87932	D	0	.	16.7875	0.85577	0.0:0.0:1.0:0.0	.	505	Q01118	SCN7A_HUMAN	T	505	ENSP00000386796:P505T;ENSP00000413699:P505T	ENSP00000259060:P505T	P	-	1	0	SCN7A	167009631	1.000000	0.71417	0.967000	0.41034	0.023000	0.10783	7.827000	0.86722	2.823000	0.97156	0.650000	0.86243	CCA			0.328	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333745.1			
HECW2	57520	broad.mit.edu	37	2	197092904	197092904	+	Nonsense_Mutation	SNP	A	A	C			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr2:197092904A>C	ENST00000260983.3	-	22	4021	c.3839T>G	c.(3838-3840)tTa>tGa	p.L1280*	HECW2_ENST00000409111.1_Nonsense_Mutation_p.L924*	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1280	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						ATATTCAAATAAGCCATAATA	0.368																																					p.L1280X													.	HECW2	239		0			c.T3839G												94.0	96.0	95.0					2																	197092904		2203	4300	6503	SO:0001587	stop_gained	57520	exon22			TCAAATAAGCCAT	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3839T>G	2.37:g.197092904A>C	ENSP00000260983:p.Leu1280*		Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	251	0.02	6	NM_020760	10	0.00	0	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Nonsense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	A	44	11.178893	0.99527	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	.	.	.	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6649	0.77221	1.0:0.0:0.0:0.0	.	.	.	.	X	924;1280	.	ENSP00000260983:L1280X	L	-	2	0	HECW2	196801149	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.139000	0.94554	2.281000	0.76405	0.533000	0.62120	TTA			0.368	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335199.3		NM_020760	
IKZF2	22807	broad.mit.edu	37	2	214012404	214012405	+	Intron	DEL	AA	AA	-	rs550073377|rs6738070|rs547307585|rs112988286	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr2:214012404_214012405delAA	ENST00000434687.1	-	4	449				IKZF2_ENST00000442445.1_Frame_Shift_Del_p.L62fs|IKZF2_ENST00000342002.2_Intron|IKZF2_ENST00000457361.1_Intron|IKZF2_ENST00000421754.2_Intron|IKZF2_ENST00000413091.3_Intron|IKZF2_ENST00000451136.2_Intron|IKZF2_ENST00000374327.4_Intron|IKZF2_ENST00000374319.4_Intron			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		ACACACACACAAAAAAAAATCA	0.411																																					.													.	IKZF2	71		0			.																																									SO:0001627	intron_variant	22807	.			ACACACAAAAAAA	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.139+26TT>-	2.37:g.214012410_214012411delAA			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	55	0.16	9	.	0		0	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Frame_Shift_Del	DEL	ENST00000434687.1	37	CCDS2395.1																																																																																					0.411	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256593.3		NM_016260	
NSFL1C	55968	mdanderson.org	37	20	1447419	1447419	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr20:1447419G>T	ENST00000216879.4	-	1	918	c.51C>A	c.(49-51)ggC>ggA	p.G17G	NSFL1C_ENST00000476071.1_Silent_p.G17G|NSFL1C_ENST00000350991.4_Silent_p.G17G|NSFL1C_ENST00000353088.2_Silent_p.G17G|NSFL1C_ENST00000381658.4_5'UTR	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	17						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						CCTCCTCGGCGCCCGTCACCG	0.751																																					p.G17G													.	.			0			c.C51A												7.0	8.0	7.0					20																	1447419		1970	3905	5875	SO:0001819	synonymous_variant	55968	exon1			CTCGGCGCCCGTC	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.51C>A	20.37:g.1447419G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_016143	190	0.01	2	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Silent	SNP	ENST00000216879.4	37	CCDS13015.1																																																																																					0.751	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077525.2		NM_016143	
SNRPB2	6629	bcgsc.ca;mdanderson.org	37	20	16721614	16721614	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr20:16721614G>T	ENST00000246071.6	+	7	858	c.642G>T	c.(640-642)ccG>ccT	p.P214P	SNRPB2_ENST00000377943.5_Silent_p.P214P	NM_003092.4	NP_003083.1	P08579	RU2B_HUMAN	small nuclear ribonucleoprotein polypeptide B	214	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	nucleotide binding (GO:0000166)|snRNA binding (GO:0017069)			large_intestine(2)|lung(2)|urinary_tract(1)	5						AGATCACACCGTCCCATGCTA	0.413																																					p.P214P													SNRPB2,NS,carcinoma,0,1	SNRPB2	12	1	0			c.G642T												94.0	86.0	89.0					20																	16721614		2203	4300	6503	SO:0001819	synonymous_variant	6629	exon7			CACACCGTCCCAT		CCDS13123.1	20p12.1	2013-02-12	2010-07-07		ENSG00000125870	ENSG00000125870		"""RNA binding motif (RRM) containing"""	11155	protein-coding gene	gene with protein product		603520	"""small nuclear ribonucleoprotein polypeptide B2"", ""small nuclear ribonucleoprotein polypeptide B''"""			2951739	Standard	NM_198220		Approved	Msl1	uc002wpi.2	P08579	OTTHUMG00000031933	ENST00000246071.6:c.642G>T	20.37:g.16721614G>T			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_1	92	0.05	5	NM_003092	454	0.00	0	B2R7J3|D3DW21|Q9UJD4	Silent	SNP	ENST00000246071.6	37	CCDS13123.1																																																																																					0.413	SNRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078110.1		NM_003092	
GMEB2	26205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62221817	62221817	+	Silent	SNP	C	C	T	rs368204390		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr20:62221817C>T	ENST00000266068.1	-	9	1696	c.1218G>A	c.(1216-1218)ccG>ccA	p.P406P	GMEB2_ENST00000370077.1_Silent_p.P406P|GMEB2_ENST00000370069.1_Silent_p.P355P			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	406					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			GGACGGTGGACGGCAGGGTGG	0.711																																					p.P406P													.	.			0			c.G1218A							C		1,4321		0,1,2160	13.0	14.0	13.0		1218	-7.1	0.3	20		13	0,8482		0,0,4241	no	coding-synonymous	GMEB2	NM_012384.3		0,1,6401	TT,TC,CC		0.0,0.0231,0.0078		406/531	62221817	1,12803	2161	4241	6402	SO:0001819	synonymous_variant	26205	exon10			GGTGGACGGCAGG	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.1218G>A	20.37:g.62221817C>T			Somatic	84	0	0		WXS	Illumina HiSeq	.	108	0.21	23	NM_012384	43	0.40	17	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Silent	SNP	ENST00000266068.1	37	CCDS13528.1																																																																																					0.711	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080166.1		NM_012384	
NPBWR2	2832	mdanderson.org	37	20	62738008	62738008	+	Silent	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr20:62738008C>T	ENST00000369768.1	-	1	516	c.177G>A	c.(175-177)ggG>ggA	p.G59G		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	59					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					TGCCAGTCAGCCCCACAGCAC	0.612																																					p.G59G													.	.			0			c.G177A												80.0	69.0	73.0					20																	62738008		2203	4300	6503	SO:0001819	synonymous_variant	2832	exon1			AGTCAGCCCCACA	U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.177G>A	20.37:g.62738008C>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_005286	2	0.00	0	Q6NWQ6|Q9H4K3	Silent	SNP	ENST00000369768.1	37	CCDS13557.1																																																																																					0.612	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080300.1		NM_005286	
EVA1C	59271	mdanderson.org	37	21	33840041	33840041	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr21:33840041G>T	ENST00000300255.2	+	4	992	c.519G>T	c.(517-519)gaG>gaT	p.E173D	EVA1C_ENST00000401402.3_Missense_Mutation_p.E173D|EVA1C_ENST00000382699.3_Missense_Mutation_p.E173D	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	173	SUEL-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00260}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										AAGACCAGGAGCTGAAACTGC	0.488																																					p.E173D													.	.			0			c.G519T												97.0	80.0	86.0					21																	33840041		2203	4300	6503	SO:0001583	missense	59271	exon4			CCAGGAGCTGAAA	AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.519G>T	21.37:g.33840041G>T	ENSP00000300255:p.Glu173Asp		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_058187	9	0.00	0	A6ND58|Q8IXZ0	Missense_Mutation	SNP	ENST00000300255.2	37	CCDS13614.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171597	0.78452	.	.	ENSG00000166979	ENST00000300255;ENST00000401402;ENST00000382699;ENST00000412833	T;T;T	0.08807	3.05;3.06;3.05	5.61	1.73	0.24493	D-galactoside/L-rhamnose binding SUEL lectin domain (1);	0.320352	0.34906	N	0.003595	T	0.20292	0.0488	L	0.60455	1.87	0.40176	D	0.977235	D;D;D	0.89917	1.0;0.999;0.997	D;D;D	0.80764	0.994;0.934;0.918	T	0.00509	-1.1698	10	0.41790	T	0.15	-0.1677	9.9101	0.41399	0.4015:0.0:0.5985:0.0	.	173;173;173	A6ND58;P58658;B5MC74	.;CU063_HUMAN;.	D	173;173;173;78	ENSP00000300255:E173D;ENSP00000384594:E173D;ENSP00000372146:E173D	ENSP00000300255:E173D	E	+	3	2	C21orf63	32761912	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.393000	0.34497	0.329000	0.23460	0.650000	0.86243	GAG			0.488	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000139403.1		NM_058187	
MED15	51586	mdanderson.org	37	22	20937421	20937421	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr22:20937421G>T	ENST00000263205.7	+	12	1628	c.1559G>T	c.(1558-1560)aGc>aTc	p.S520I	MED15_ENST00000292733.7_Missense_Mutation_p.S480I|MED15_ENST00000478831.1_3'UTR|MED15_ENST00000382974.2_Missense_Mutation_p.S409I|MED15_ENST00000406969.1_Missense_Mutation_p.S454I|MED15_ENST00000541476.1_Missense_Mutation_p.S454I|MED15_ENST00000425759.2_Missense_Mutation_p.S369I|MED15_ENST00000542773.1_3'UTR	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	520					gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			TCTGTCATGAGCCCAGCTGGC	0.632																																					p.S520I													.	.			0			c.G1559T												37.0	41.0	40.0					22																	20937421		2203	4300	6503	SO:0001583	missense	51586	exon12			TCATGAGCCCAGC	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1559G>T	22.37:g.20937421G>T	ENSP00000263205:p.Ser520Ile		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001003891	405	0.00	1	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	ENST00000263205.7	37	CCDS33602.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844205	0.91197	.	.	ENSG00000099917	ENST00000425759;ENST00000292733;ENST00000263205;ENST00000406969;ENST00000382974;ENST00000541476;ENST00000542312	.	.	.	5.6	5.6	0.85130	Mediator complex, subunit Med15, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.79452	0.4448	M	0.75615	2.305	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.87578	0.971;0.998;0.998;0.996;0.982;0.998	T	0.80732	-0.1251	9	0.62326	D	0.03	.	17.0901	0.86619	0.0:0.0:1.0:0.0	.	450;499;136;454;480;520	B4DGD6;Q6PKB8;B3KWF1;G3V1P5;Q96RN5-2;Q96RN5	.;.;.;.;.;MED15_HUMAN	I	369;480;520;454;409;454;450	.	ENSP00000263205:S520I	S	+	2	0	MED15	19267421	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.231000	0.95317	2.633000	0.89246	0.561000	0.74099	AGC			0.632	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000320177.2		NM_015889	
MYH9	4627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	36716924	36716924	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr22:36716924G>A	ENST00000216181.5	-	8	1017	c.787C>T	c.(787-789)Cgt>Tgt	p.R263C		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	263	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CGGATAGCACGAGATTTCTCC	0.473			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.R263C				Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	MYH9,NS,malignant_melanoma,0,1	MYH9	0	1	0			c.C787T												72.0	68.0	69.0					22																	36716924		2203	4300	6503	SO:0001583	missense	4627	exon8	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	TAGCACGAGATTT		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.787C>T	22.37:g.36716924G>A	ENSP00000216181:p.Arg263Cys		Somatic	65	0	0		WXS	Illumina HiSeq	.	76	0.16	12	NM_002473	366	0.11	41	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945290	0.73672	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.96940	-4.18	5.13	2.84	0.33178	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.99089	0.9687	H	0.99929	4.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98243	1.0489	10	0.87932	D	0	.	14.0388	0.64663	0.0:0.0:0.728:0.272	.	263	P35579	MYH9_HUMAN	C	127;263	ENSP00000216181:R263C	ENSP00000216181:R263C	R	-	1	0	MYH9	35046870	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	3.809000	0.55606	1.242000	0.43836	0.591000	0.81541	CGT			0.473	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000259110.3		NM_002473	
MGAT3	4248	broad.mit.edu	37	22	39884889	39884889	+	Missense_Mutation	SNP	T	T	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr22:39884889T>G	ENST00000341184.6	+	2	1752	c.1537T>G	c.(1537-1539)Tgg>Ggg	p.W513G		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	513					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					GGCGGGCGGGTGGCGCCACAG	0.652																																					p.W513G													.	MGAT3	65		0			c.T1537G												15.0	19.0	18.0					22																	39884889		2180	4262	6442	SO:0001583	missense	4248	exon2			GGCGGGTGGCGCC	D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.1537T>G	22.37:g.39884889T>G	ENSP00000345270:p.Trp513Gly		Somatic	66	0.2424242424	16		WXS	Illumina HiSeq	Phase_I	58	0.22	13	NM_002409	127	0.09	12	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	ENST00000341184.6	37	CCDS13994.2	.	.	.	.	.	.	.	.	.	.	C	7.702	0.693339	0.15039	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.53	-0.759	0.11045	.	1.788660	0.03551	N	0.225503	T	0.17195	0.0413	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09684	-1.0663	9	0.25106	T	0.35	.	2.1254	0.03737	0.1212:0.2808:0.3567:0.2414	.	513	Q09327	MGAT3_HUMAN	G	513	.	ENSP00000345270:W513G	W	+	1	0	MGAT3	38214835	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.213000	0.09305	-0.404000	0.07610	-0.128000	0.14901	TGG			0.652	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075039.2		NM_002409	
POMGNT2	84892	hgsc.bcm.edu	37	3	43121453	43121453	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr3:43121453G>T	ENST00000344697.2	-	2	1816	c.1471C>A	c.(1471-1473)Cag>Aag	p.Q491K	POMGNT2_ENST00000441964.1_Missense_Mutation_p.Q491K	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	491	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										ACTGACGCCTGGCACCGTGCC	0.612																																					p.Q491K													.	.			0			c.C1471A												70.0	65.0	67.0					3																	43121453		2203	4300	6503	SO:0001583	missense	84892	exon2			ACGCCTGGCACCG	AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1471C>A	3.37:g.43121453G>T	ENSP00000344125:p.Gln491Lys		Somatic	68	0	0		WXS	Illumina HiSeq	.	84	0.05	4	NM_032806	57	0.00	0	B3KWC3|Q96SY3	Missense_Mutation	SNP	ENST00000344697.2	37	CCDS2709.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980799	0.34942	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.77098	-1.07;-1.07	5.57	5.57	0.84162	Fibronectin, type III (1);	0.056896	0.64402	D	0.000001	T	0.80319	0.4601	M	0.79926	2.475	0.80722	D	1	B	0.16603	0.018	B	0.15052	0.012	T	0.76615	-0.2894	10	0.45353	T	0.12	-3.6479	18.5282	0.90981	0.0:0.0:1.0:0.0	.	491	Q8NAT1	AGO61_HUMAN	K	491	ENSP00000408992:Q491K;ENSP00000344125:Q491K	ENSP00000344125:Q491K	Q	-	1	0	C3orf39	43096457	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	9.470000	0.97683	2.618000	0.88619	0.655000	0.94253	CAG			0.612	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256643.1		NM_032806	
GOLGB1	2804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121448824	121448824	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr3:121448824G>A	ENST00000340645.5	-	3	262	c.137C>T	c.(136-138)aCa>aTa	p.T46I	GOLGB1_ENST00000393667.3_Missense_Mutation_p.T46I|GOLGB1_ENST00000472829.1_5'UTR	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	46					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		ATCTTCTTGTGTAGTATTATT	0.393																																					p.T46I													.	.			0			c.C137T												104.0	96.0	99.0					3																	121448824		2203	4300	6503	SO:0001583	missense	2804	exon3			TCTTGTGTAGTAT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.137C>T	3.37:g.121448824G>A	ENSP00000341848:p.Thr46Ile		Somatic	61	0	0		WXS	Illumina HiSeq	.	100	0.22	22	NM_004487	11	0.45	5	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	8.587	0.883750	0.17467	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.24908	2.43;2.43;1.83	5.37	4.49	0.54785	.	0.468902	0.19967	N	0.102061	T	0.30103	0.0754	M	0.70595	2.14	0.09310	N	1	B;B;B;B;B	0.19583	0.037;0.037;0.021;0.037;0.037	B;B;B;B;B	0.26202	0.039;0.067;0.021;0.039;0.039	T	0.22173	-1.0224	10	0.49607	T	0.09	.	10.0983	0.42488	0.0927:0.0:0.9073:0.0	.	7;46;46;46;46	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	I	46	ENSP00000341848:T46I;ENSP00000377275:T46I;ENSP00000418231:T46I	ENSP00000341848:T46I	T	-	2	0	GOLGB1	122931514	0.032000	0.19561	0.009000	0.14445	0.014000	0.08584	1.477000	0.35431	1.399000	0.46721	0.585000	0.79938	ACA			0.393	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000355159.1		NM_004487	
SPATA16	83893	broad.mit.edu	37	3	172643226	172643226	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr3:172643226delG	ENST00000351008.3	-	7	1321	c.1138delC	c.(1138-1140)caafs	p.Q381fs		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	381					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			AGATATTGTTGGGGAGGAAAA	0.383																																					p.Q380fs													.	SPATA16	111		0			c.1138delC												87.0	85.0	86.0					3																	172643226		2203	4300	6503	SO:0001589	frameshift_variant	83893	exon7			ATTGTTGGGGAGG	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1138delC	3.37:g.172643226delG	ENSP00000341765:p.Gln381fs		Somatic	271	0	0		WXS	Illumina HiSeq	Phase_I	296	0.03	8	NM_031955	0		0	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Frame_Shift_Del	DEL	ENST00000351008.3	37	CCDS3221.1																																																																																					0.383	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346322.1		NM_031955	
LINC00969	440993	broad.mit.edu	37	3	195412514	195412515	+	lincRNA	INS	-	-	C	rs140203535	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr3:195412514_195412515insC	ENST00000445430.1	+	0	3711_3712									long intergenic non-protein coding RNA 969																		tcatttacagtcccctgttgcg	0.376													|||unknown(NO_COVERAGE)	1724	0.344249	0.2526	0.3689	5008	,	,		33784	0.3889		0.3797	False		,,,				2504	0.3681				.													.	.			0			.																																											0	.			TTACAGTCCCCTG	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195412518_195412518dupC			Somatic	7	0.1428571429	1		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	48	0.00	0		RNA	INS	ENST00000445430.1	37																																																																																						0.376	LINC00969-038	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000341951.1			
MUC4	4585	mdanderson.org	37	3	195510622	195510622	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr3:195510622G>T	ENST00000463781.3	-	2	8288	c.7829C>A	c.(7828-7830)cCt>cAt	p.P2610H	MUC4_ENST00000475231.1_Missense_Mutation_p.P2610H|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACAGGAAGAGGGGT	0.572																																					p.P2610H													.	.			0			c.C7829A																																									SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7829C>A	3.37:g.195510622G>T	ENSP00000417498:p.Pro2610His		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_018406	7	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	2.807	-0.247843	0.05867	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.42;1.42	.	.	.	.	.	.	.	.	T	0.26340	0.0643	N	0.19112	0.55	0.09310	N	1	D	0.67145	0.996	P	0.55112	0.769	T	0.10451	-1.0629	7	.	.	.	.	4.9831	0.14176	0.278:0.0:0.722:0.0	.	2610	E7ESK3	.	H	2610	ENSP00000417498:P2610H;ENSP00000420243:P2610H	.	P	-	2	0	MUC4	196995017	0.003000	0.15002	0.122000	0.21767	0.000000	0.00434	1.472000	0.35376	0.482000	0.27582	0.000000	0.15137	CCT			0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MUC4	4585	broad.mit.edu	37	3	195516898	195516898	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr3:195516898G>T	ENST00000463781.3	-	2	2012	c.1553C>A	c.(1552-1554)aCa>aAa	p.T518K	MUC4_ENST00000475231.1_Missense_Mutation_p.T518K|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	523					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGATTTCCTGTGACAAGCCT	0.527																																					p.T518K													.	MUC4	1505		0			c.C1553A												117.0	110.0	112.0					3																	195516898		1976	4160	6136	SO:0001583	missense	4585	exon2			TTTCCTGTGACAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.1553C>A	3.37:g.195516898G>T	ENSP00000417498:p.Thr518Lys		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	174	0.03	5	NM_018406	10	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.082	0.013065	0.07912	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.45668	0.89;0.9	2.29	-0.867	0.10655	.	5.661800	0.01164	U	0.006703	T	0.33933	0.0880	L	0.34521	1.04	0.09310	N	1	P;P	0.42993	0.797;0.743	B;B	0.44108	0.441;0.334	T	0.11275	-1.0594	10	0.25106	T	0.35	.	3.4725	0.07573	0.2493:0.2245:0.5262:0.0	.	518;523	E7ESK3;Q99102	.;MUC4_HUMAN	K	518;518;492	ENSP00000417498:T518K;ENSP00000420243:T518K	ENSP00000376209:T492K	T	-	2	0	MUC4	197001293	0.004000	0.15560	0.000000	0.03702	0.012000	0.07955	-0.138000	0.10374	-0.215000	0.10063	0.459000	0.35465	ACA			0.527	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
PIGX	54965	mdanderson.org	37	3	196443744	196443744	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr3:196443744G>T	ENST00000421265.1	+	2	58	c.5G>T	c.(4-6)tGt>tTt	p.C2F	PIGX_ENST00000541663.1_5'UTR|PIGX_ENST00000495440.1_3'UTR|PIGX_ENST00000314118.4_Missense_Mutation_p.C2F			Q8TBF5	PIGX_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class X	43					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(5)|lung(4)|stomach(1)	11	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;1.08e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00322)		AGGGCCATGTGTTCTGAAATT	0.259																																					p.C43F													.	.			0			c.G128T												88.0	89.0	89.0					3																	196443744		2203	4300	6503	SO:0001583	missense	54965	exon2			CCATGTGTTCTGA	AK000529	CCDS3320.1, CCDS3320.2, CCDS54701.1	3q29	2013-02-26	2006-06-28		ENSG00000163964	ENSG00000163964		"""Phosphatidylinositol glycan anchor biosynthesis"""	26046	protein-coding gene	gene with protein product		610276	"""phosphatidylinositol glycan, class X"""			15635094	Standard	NM_017861		Approved	FLJ20522	uc010iaj.3	Q8TBF5	OTTHUMG00000155535	ENST00000421265.1:c.5G>T	3.37:g.196443744G>T	ENSP00000416446:p.Cys2Phe		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	97	0.05	5	NM_017861	15	0.00	0	Q9NWZ2	Missense_Mutation	SNP	ENST00000421265.1	37		.	.	.	.	.	.	.	.	.	.	G	15.71	2.912604	0.52439	.	.	ENSG00000163964	ENST00000426755;ENST00000392391;ENST00000314118;ENST00000296333;ENST00000421265;ENST00000451319	T;T;T;T;T;T	0.52526	1.32;0.73;1.3;0.66;0.68;0.74	5.0	5.0	0.66597	.	0.161580	0.42964	D	0.000626	T	0.57110	0.2031	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.61481	-0.7054	10	0.87932	D	0	-13.2566	16.2801	0.82672	0.0:0.0:1.0:0.0	.	43;43	Q8TBF5-2;Q8TBF5	.;PIGX_HUMAN	F	2;43;2;43;2;2	ENSP00000409073:C2F;ENSP00000376192:C43F;ENSP00000317301:C2F;ENSP00000296333:C43F;ENSP00000416446:C2F;ENSP00000390804:C2F	ENSP00000296333:C43F	C	+	2	0	PIGX	197928141	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	5.407000	0.66363	2.601000	0.87937	0.650000	0.86243	TGT			0.259	PIGX-008	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000340684.1		NM_017861	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000453894.1_Missense_Mutation_p.T396P|IDUA_ENST00000514224.1_Missense_Mutation_p.T242P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P													.	IDUA	33		0			c.A1120C												26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro		Somatic	90	0.3222222222	29		WXS	Illumina HiSeq	Phase_I	113	0.35	39	NM_000203	4	0.00	0	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC			0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000201812.1		NM_000203	
POLN	353497	hgsc.bcm.edu	37	4	2077181	2077181	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr4:2077181G>T	ENST00000511885.2	-	24	2806	c.2453C>A	c.(2452-2454)gCa>gAa	p.A818E	POLN_ENST00000382865.1_Missense_Mutation_p.A818E			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	818					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CAGGCTACCTGCACACTCCGG	0.607								DNA polymerases (catalytic subunits)																													p.A818E													.	.			0			c.C2453A												75.0	61.0	66.0					4																	2077181		2203	4300	6503	SO:0001583	missense	353497	exon22			CTACCTGCACACT	AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.2453C>A	4.37:g.2077181G>T	ENSP00000435506:p.Ala818Glu		Somatic	80	0	0		WXS	Illumina HiSeq	.	80	0.05	4	NM_181808	0		0	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	ENST00000511885.2	37	CCDS3360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.286|2.286	-0.363630|-0.363630	0.05103|0.05103	.|.	.|.	ENSG00000130997|ENSG00000130997	ENST00000511885;ENST00000382865;ENST00000253313|ENST00000511098	D;D|.	0.97352|.	-4.35;-4.35|.	3.07|3.07	3.07|3.07	0.35406|0.35406	DNA-directed DNA polymerase, family A, palm domain (1);|.	0.241761|.	0.31577|.	N|.	0.007415|.	T|T	0.61009|0.61009	0.2313|0.2313	L|L	0.56396|0.56396	1.775|1.775	0.44366|0.44366	D|D	0.997261|0.997261	D;B|.	0.58268|.	0.982;0.028|.	P;B|.	0.55055|.	0.767;0.1|.	T|T	0.59225|0.59225	-0.7494|-0.7494	10|5	0.10902|.	T|.	0.67|.	-6.2793|-6.2793	9.8885|9.8885	0.41276|0.41276	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	509;818|.	E9PE06;Q7Z5Q5|.	.;DPOLN_HUMAN|.	E|K	818;818;509|451	ENSP00000435506:A818E;ENSP00000372316:A818E|.	ENSP00000253313:A509E|.	A|Q	-|-	2|1	0|0	POLN|POLN	2046979|2046979	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.166000|0.166000	0.22503|0.22503	5.985000|5.985000	0.70556|0.70556	2.034000|2.034000	0.60081|0.60081	0.561000|0.561000	0.74099|0.74099	GCA|CAG			0.607	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000205684.2		NM_181808	
HTT	3064	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3237461	3237461	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr4:3237461G>T	ENST00000355072.5	+	63	8886	c.8741G>T	c.(8740-8742)cGg>cTg	p.R2914L		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2914					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.R2914L(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGCCCGCACCGGGCCATGGCG	0.627																																					p.R2914L													HTT,NS,carcinoma,0,1	HTT	221	1	1	Substitution - Missense(1)	endometrium(1)	c.G8741T												29.0	34.0	32.0					4																	3237461		2130	4244	6374	SO:0001583	missense	3064	exon63			CGCACCGGGCCAT	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8741G>T	4.37:g.3237461G>T	ENSP00000347184:p.Arg2914Leu		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	22	0.18	4	NM_002111	111	0.00	0	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841469	0.71488	.	.	ENSG00000197386	ENST00000355072	T	0.71461	-0.57	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	D	0.82715	0.5097	M	0.74258	2.255	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.80495	-0.1357	10	0.27785	T	0.31	.	17.0288	0.86455	0.0:0.0:1.0:0.0	.	2914	P42858	HD_HUMAN	L	2914	ENSP00000347184:R2914L	ENSP00000347184:R2914L	R	+	2	0	HTT	3207259	1.000000	0.71417	0.995000	0.50966	0.789000	0.44602	9.208000	0.95075	2.571000	0.86741	0.561000	0.74099	CGG			0.627	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358234.2		NM_002111	
RASGEF1B	153020	mdanderson.org	37	4	82368726	82368726	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr4:82368726G>T	ENST00000264400.2	-	6	812	c.661C>A	c.(661-663)Ctc>Atc	p.L221I	RASGEF1B_ENST00000335927.7_Missense_Mutation_p.L179I|RASGEF1B_ENST00000509081.1_Missense_Mutation_p.L220I	NM_152545.1	NP_689758.1	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	221	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			endometrium(2)|kidney(5)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	26						ATATAATTGAGCCTCTCCTGA	0.433																																					p.L221I													.	.			0			c.C661A												68.0	65.0	66.0					4																	82368726		2203	4300	6503	SO:0001583	missense	153020	exon6			AATTGAGCCTCTC	AK056257	CCDS34022.1, CCDS75151.1, CCDS75152.1	4q21.21	2013-09-24				ENSG00000138670			24881	protein-coding gene	gene with protein product		614532				12488504	Standard	XM_005262776		Approved	GPIG4, FLJ31695	uc003hmi.1	Q0VAM2		ENST00000264400.2:c.661C>A	4.37:g.82368726G>T	ENSP00000264400:p.Leu221Ile		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_152545	5	0.00	0	Q0VAM1|Q4W5L7|Q4W5M3|Q96MY8	Missense_Mutation	SNP	ENST00000264400.2	37	CCDS34022.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.838022	0.50951	.	.	ENSG00000138670	ENST00000509081;ENST00000264400;ENST00000335927;ENST00000504863	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.01	5.01	0.66863	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.064067	0.64402	D	0.000005	T	0.47948	0.1473	M	0.63428	1.95	0.80722	D	1	B;B;B	0.28850	0.188;0.188;0.225	B;B;B	0.41202	0.238;0.238;0.35	T	0.47661	-0.9100	10	0.48119	T	0.1	.	18.107	0.89523	0.0:0.0:1.0:0.0	.	179;220;221	Q0VAM2-2;Q0VAM2-3;Q0VAM2	.;.;RGF1B_HUMAN	I	220;221;179;66	ENSP00000425393:L220I;ENSP00000264400:L221I;ENSP00000338437:L179I;ENSP00000426929:L66I	ENSP00000264400:L221I	L	-	1	0	RASGEF1B	82587750	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	7.243000	0.78219	2.606000	0.88127	0.655000	0.94253	CTC			0.433	RASGEF1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000362830.1		NM_152545	
SEC31A	22872	mdanderson.org	37	4	83763615	83763615	+	Silent	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr4:83763615C>T	ENST00000395310.2	-	22	2828	c.2646G>A	c.(2644-2646)ccG>ccA	p.P882P	SEC31A_ENST00000264405.5_Silent_p.P646P|SEC31A_ENST00000311785.7_Intron|SEC31A_ENST00000355196.2_Silent_p.P882P|SEC31A_ENST00000500777.2_Intron|SEC31A_ENST00000505984.1_Silent_p.P843P|SEC31A_ENST00000326950.5_Silent_p.P843P|SEC31A_ENST00000505472.1_Silent_p.P913P|SEC31A_ENST00000432794.1_Silent_p.P882P|SEC31A_ENST00000448323.1_Silent_p.P882P|SEC31A_ENST00000509142.1_Intron|SEC31A_ENST00000348405.4_Silent_p.P843P|SEC31A_ENST00000443462.2_Silent_p.P877P|SEC31A_ENST00000513858.1_Intron|SEC31A_ENST00000508502.1_Silent_p.P882P	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	882	Interaction with PDCD6.|Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				CGAAGGGATACGGCTGGGCTG	0.433																																					p.P882P													.	.			0			c.G2646A												29.0	26.0	27.0					4																	83763615		2203	4297	6500	SO:0001819	synonymous_variant	22872	exon22			GGGATACGGCTGG	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.2646G>A	4.37:g.83763615C>T			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001077207	287	0.00	0	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Silent	SNP	ENST00000395310.2	37	CCDS3596.1	.	.	.	.	.	.	.	.	.	.	C	8.745	0.919855	0.17982	.	.	ENSG00000138674	ENST00000503937	.	.	.	6.04	4.3	0.51218	.	.	.	.	.	T	0.62816	0.2459	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61628	-0.7024	4	.	.	.	0.0035	11.5732	0.50845	0.0:0.8071:0.1262:0.0667	.	.	.	.	H	32	.	.	R	-	2	0	SEC31A	83982639	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.314000	0.65804	1.546000	0.49388	0.563000	0.77884	CGT			0.433	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252640.1		NM_016211	
UFSP2	55325	broad.mit.edu;mdanderson.org	37	4	186324768	186324768	+	Silent	SNP	T	T	C	rs370422258		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr4:186324768T>C	ENST00000264689.6	-	11	1319	c.1203A>G	c.(1201-1203)ggA>ggG	p.G401G		NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	401						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		CCAAAACTCCTCCCCCTATAG	0.418																																					p.G401G													UFSP2,bladder,carcinoma,-2,1	UFSP2	33	1	0			c.A1203G												85.0	81.0	82.0					4																	186324768		2203	4300	6503	SO:0001819	synonymous_variant	55325	exon11			AACTCCTCCCCCT	AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.1203A>G	4.37:g.186324768T>C			Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	82	0.05	4	NM_018359	97	0.00	0	Q6IA77|Q96FS3	Silent	SNP	ENST00000264689.6	37	CCDS3842.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.179|8.179	0.793348|0.793348	0.16327|0.16327	.|.	.|.	ENSG00000109775|ENSG00000109775	ENST00000509180|ENST00000511485	.|.	.|.	.|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|.	.|.	.|.	.|.	T|T	0.63450|0.63450	0.2512|0.2512	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.62459|0.62459	-0.6850|-0.6850	4|4	.|.	.|.	.|.	-15.9808|-15.9808	11.2412|11.2412	0.48970|0.48970	0.1365:0.0:0.0:0.8635|0.1365:0.0:0.0:0.8635	.|.	.|.	.|.	.|.	G|G	130|300	.|.	.|.	E|R	-|-	2|1	0|2	UFSP2|UFSP2	186561762|186561762	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.854000|0.854000	0.48673|0.48673	0.945000|0.945000	0.29056|0.29056	2.259000|2.259000	0.74868|0.74868	0.533000|0.533000	0.62120|0.62120	GAG|AGG			0.418	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000360589.2		NM_018359	
AGXT2	64902	mdanderson.org	37	5	35035382	35035382	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr5:35035382G>T	ENST00000231420.6	-	5	726	c.526C>A	c.(526-528)Ctg>Atg	p.L176M	AC010368.1_ENST00000390793.2_RNA	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	176					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	AGCATGGCCAGCTCATTGGCT	0.428																																					p.L176M													.	.			0			c.C526A												126.0	136.0	133.0					5																	35035382		2203	4300	6503	SO:0001583	missense	64902	exon5			TGGCCAGCTCATT	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.526C>A	5.37:g.35035382G>T	ENSP00000231420:p.Leu176Met		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_031900	0		0	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	ENST00000231420.6	37	CCDS3908.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896368	0.52121	.	.	ENSG00000113492	ENST00000231420	D	0.85773	-2.03	6.06	-0.0664	0.13764	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.86506	0.5949	M	0.69248	2.105	0.43160	D	0.994943	P;D;P	0.55605	0.766;0.972;0.914	P;P;P	0.59115	0.51;0.852;0.541	T	0.82920	-0.0218	10	0.52906	T	0.07	-0.8334	5.8543	0.18710	0.4111:0.0:0.3967:0.1922	.	84;176;176	B7Z3M3;E9PDL7;Q9BYV1	.;.;AGT2_HUMAN	M	176	ENSP00000231420:L176M	ENSP00000231420:L176M	L	-	1	2	AGXT2	35071139	0.567000	0.26626	0.993000	0.49108	0.907000	0.53573	0.818000	0.27295	0.155000	0.19261	-0.137000	0.14449	CTG			0.428	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207574.2		NM_031900	
CUL9	23113	mdanderson.org	37	6	43166534	43166534	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr6:43166534G>T	ENST00000252050.4	+	12	3075	c.2991G>T	c.(2989-2991)ctG>ctT	p.L997L	CUL9_ENST00000372647.2_Silent_p.L997L|CUL9_ENST00000354495.3_Silent_p.L887L	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	997					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CTTTCCTCCTGTTGCTGCGGA	0.647																																					p.L997L													.	.			0			c.G2991T												43.0	47.0	46.0					6																	43166534		2202	4300	6502	SO:0001819	synonymous_variant	23113	exon12			CCTCCTGTTGCTG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2991G>T	6.37:g.43166534G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_015089	18	0.00	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	CCDS4890.1																																																																																					0.647	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040582.2		NM_015089	
KCNQ5	56479	broad.mit.edu	37	6	73331984	73331986	+	In_Frame_Del	DEL	GCG	GCG	-	rs568022266	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	GCG	GCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr6:73331984_73331986delGCG	ENST00000370398.1	+	1	176_178	c.67_69delGCG	c.(67-69)gcgdel	p.A27del	KCNQ5_ENST00000355635.3_In_Frame_Del_p.A27del|KCNQ5_ENST00000403813.2_In_Frame_Del_p.A27del|KCNQ5_ENST00000370392.1_In_Frame_Del_p.A27del|KCNQ5_ENST00000414165.2_In_Frame_Del_p.A27del|KCNQ5_ENST00000342056.2_In_Frame_Del_p.A27del|KCNQ5_ENST00000402622.2_In_Frame_Del_p.A27del|KCNQ5_ENST00000355194.4_In_Frame_Del_p.A27del	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	27					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GAgcggcgcagcggcggcggcgg	0.783														6	0.00119808	0.0023	0.0	5008	,	,		8498	0.0		0.0	False		,,,				2504	0.0031				p.23_23del	GBM(142;1375 1859 14391 23261 44706)												.	KCNQ5	153		0			c.67_69del								,,,,	12,562		4,4,279					,,,,	0.5	1.0			2	19,1923		3,13,955	no	coding,coding,coding,coding,coding	KCNQ5	NM_019842.3,NM_001160134.1,NM_001160133.1,NM_001160132.1,NM_001160130.1	,,,,	7,17,1234	A1A1,A1R,RR		0.9784,2.0906,1.2321	,,,,	,,,,		31,2485				SO:0001651	inframe_deletion	56479	exon1			GGCGCAGCGGCGG	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.67_69delGCG	6.37:g.73331993_73331995delGCG	ENSP00000359425:p.Ala27del		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	NM_001160132	0		0	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	In_Frame_Del	DEL	ENST00000370398.1	37	CCDS4976.1																																																																																					0.783	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000041198.3		NM_019842	
MRAP2	112609	mdanderson.org	37	6	84765083	84765083	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr6:84765083G>T	ENST00000257776.4	+	2	181	c.46G>T	c.(46-48)Gca>Tca	p.A16S		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	16					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						CCAGCAATCGGCATCTAATTC	0.413																																					p.A16S													.	.			0			c.G46T												85.0	86.0	86.0					6																	84765083		2203	4300	6503	SO:0001583	missense	112609	exon2			CAATCGGCATCTA	AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	ENST00000257776.4:c.46G>T	6.37:g.84765083G>T	ENSP00000257776:p.Ala16Ser		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_138409	7	0.00	0	A8K9M1|Q8IXM9|Q8N2D1	Missense_Mutation	SNP	ENST00000257776.4	37	CCDS5001.1	.	.	.	.	.	.	.	.	.	.	G	9.471	1.095754	0.20552	.	.	ENSG00000135324	ENST00000257776	D	0.86230	-2.09	5.58	-1.71	0.08133	.	0.645172	0.16224	N	0.223925	T	0.45716	0.1356	N	0.12961	0.28	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.45498	-0.9257	10	0.11485	T	0.65	.	2.9702	0.05920	0.1585:0.0932:0.2002:0.5481	.	16	Q96G30	MRAP2_HUMAN	S	16	ENSP00000257776:A16S	ENSP00000257776:A16S	A	+	1	0	MRAP2	84821802	0.014000	0.17966	0.010000	0.14722	0.855000	0.48748	-0.025000	0.12413	-0.203000	0.10251	-0.152000	0.13540	GCA			0.413	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041367.1		NM_138409	
CDK13	8621	mdanderson.org	37	7	39991320	39991320	+	Silent	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:39991320C>T	ENST00000181839.4	+	1	1685	c.1080C>T	c.(1078-1080)agC>agT	p.S360S	CDK13_ENST00000340829.5_Silent_p.S360S|RP11-467D6.1_ENST00000569710.1_RNA	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	360					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						GCTCCCCGAGCCCCTACAGTC	0.721																																					p.S360S													.	.			0			c.C1080T												6.0	8.0	7.0					7																	39991320		1632	3417	5049	SO:0001819	synonymous_variant	8621	exon1			CCCGAGCCCCTAC	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.1080C>T	7.37:g.39991320C>T			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_003718	44	0.00	0	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	ENST00000181839.4	37	CCDS5461.1																																																																																					0.721	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250726.2		NM_003718	
ZNF733P	643955	broad.mit.edu	37	7	62759066	62759067	+	RNA	INS	-	-	T	rs530561459	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:62759066_62759067insT	ENST00000331425.6	-	0	107					NR_003952.1				zinc finger protein 733, pseudogene																		ttcttttcttctttttttttga	0.411													|||unknown(STR3?)	27	0.00539137	0.0182	0.0029	5008	,	,		21486	0.0		0.001	False		,,,				2504	0.0				.													.	.			0			.																																											0	.			TTTCTTCTTTTTT			7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62759075_62759075dupT			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	10	0.30	3	.	0		0		RNA	INS	ENST00000331425.6	37																																																																																						0.411	ZNF733P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000343679.1			
RABGEF1	27342	ucsc.edu	37	7	66270306	66270306	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:66270306A>G	ENST00000284957.5	+	8	1077	c.1000A>G	c.(1000-1002)Aat>Gat	p.N334D	RABGEF1_ENST00000484547.2_3'UTR|RABGEF1_ENST00000450873.2_Missense_Mutation_p.N334D|RABGEF1_ENST00000439720.2_Missense_Mutation_p.N347D|RABGEF1_ENST00000437078.2_Missense_Mutation_p.N348D|KCTD7_ENST00000510829.2_Missense_Mutation_p.N334D|KCTD7_ENST00000380828.2_Missense_Mutation_p.N374D|KCTD7_ENST00000451741.2_Missense_Mutation_p.N334D			Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	551					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein targeting to membrane (GO:0006612)	early endosome (GO:0005769)	DNA binding (GO:0003677)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|stomach(1)	27						CCTTCAGTCTAATATCCAGTA	0.502																																					p.N334D													.	RABGEF1	56		0			c.A1000G												112.0	97.0	102.0					7																	66270306		2203	4300	6503	SO:0001583	missense	27342	exon8			CAGTCTAATATCC	AJ250042	CCDS5535.1, CCDS69308.1, CCDS75610.1	7q11.21	2010-07-09			ENSG00000154710	ENSG00000154710			17676	protein-coding gene	gene with protein product		609700				12505986, 11098082	Standard	NM_014504		Approved	rabex-5, RABEX5	uc003tvh.3	Q9UJ41	OTTHUMG00000129547	ENST00000284957.5:c.1000A>G	7.37:g.66270306A>G	ENSP00000284957:p.Asn334Asp		Somatic	73	0	0		RNA-Seq	Illumina HiSeq		125	0.01	1	NM_014504	102	0.12	12	B4DZM7|Q3HKR2|Q3HKR3|Q53FG0	Missense_Mutation	SNP	ENST00000284957.5	37	CCDS5535.1	.	.	.	.	.	.	.	.	.	.	A	33	5.281764	0.95489	.	.	ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000154710;ENSG00000154710;ENSG00000154710;ENSG00000154710	ENST00000380827;ENST00000380828;ENST00000510829;ENST00000451741;ENST00000539561;ENST00000284957;ENST00000450873;ENST00000439720;ENST00000437078	T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.6	5.6	0.85130	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.000000	0.85682	D	0.000000	T	0.61060	0.2317	M	0.78801	2.425	0.80722	D	1	D;D;P	0.69078	0.997;0.997;0.95	D;D;D	0.71870	0.975;0.954;0.962	T	0.66217	-0.5979	10	0.87932	D	0	-21.4594	14.9658	0.71193	1.0:0.0:0.0:0.0	.	348;168;551	B4DZM7;B3KMF1;Q9UJ41	.;.;RABX5_HUMAN	D	418;374;334;334;250;334;334;347;348	ENSP00000370208:N374D;ENSP00000421124:N334D;ENSP00000398177:N334D;ENSP00000284957:N334D;ENSP00000415815:N334D;ENSP00000403429:N347D;ENSP00000390480:N348D	ENSP00000370207:N418D	N	+	1	0	RABGEF1;KCTD7	65907741	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.802000	0.91910	2.135000	0.66039	0.533000	0.62120	AAT			0.502	RABGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251737.3		NM_014504	
ZNF789	285989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99084226	99084227	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:99084226_99084227delGT	ENST00000331410.5	+	5	663_664	c.393_394delGT	c.(391-396)aagtgtfs	p.C132fs	ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000448667.1_3'UTR|ZNF789_ENST00000494186.1_Intron	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	132					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AGTTACATAAGTGTAAAGAATT	0.366																																					p.131_131del													.	ZNF789	33		0			c.392_393del																																									SO:0001589	frameshift_variant	285989	exon5			ACATAAGTGTAAA	AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.393_394delGT	7.37:g.99084228_99084229delGT	ENSP00000331927:p.Cys132fs		Somatic	191	0	0		WXS	Illumina HiSeq	.	189	0.14	27	NM_213603	40	0.00	0	A4D282|A6NH61|Q6ZMZ9	Frame_Shift_Del	DEL	ENST00000331410.5	37	CCDS34693.1																																																																																					0.366	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336266.1		NM_213603	
FAM185A	222234	broad.mit.edu	37	7	102401776	102401776	+	Silent	SNP	T	T	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:102401776T>G	ENST00000413034.2	+	4	711	c.711T>G	c.(709-711)ggT>ggG	p.G237G	FAM185A_ENST00000409231.3_Silent_p.G120G|FAM185A_ENST00000481697.1_3'UTR	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	237										kidney(1)	1						CCGAAGATGGTTTGCTGAAAG	0.383																																					p.G237G													.	FAM185A	10		0			c.T711G												207.0	168.0	180.0					7																	102401776		692	1591	2283	SO:0001819	synonymous_variant	222234	exon4			AGATGGTTTGCTG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.711T>G	7.37:g.102401776T>G			Somatic	395	0.0025316456	1		WXS	Illumina HiSeq	Phase_I	414	0.01	4	NM_001145268	14	0.00	0	A8MUR7|B4DQD3|C9IZ91	Silent	SNP	ENST00000413034.2	37	CCDS47676.1																																																																																					0.383	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349482.1		NM_001145268	
DPY19L2P2	349152	hgsc.bcm.edu	37	7	102825785	102825785	+	RNA	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:102825785G>T	ENST00000312132.4	-	0	3813							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										gtgtgtgtgtgtgtgtgtgtg	0.393																																					.													.	.			0			.																																											349152	.			GTGTGTGTGTGTG	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102825785G>T			Somatic	57	0	0		WXS	Illumina HiSeq	.	88	0.11	10	.	3	0.00	0	Q8N9V4|Q8ND62	RNA	SNP	ENST00000312132.4	37																																																																																						0.393	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000347877.1		NM_182634	
ZNF777	27153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149153033	149153033	+	Silent	SNP	G	G	A			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:149153033G>A	ENST00000247930.4	-	2	404	c.81C>T	c.(79-81)ctC>ctT	p.L27L		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TTTCTCGGGGGAGTCCAGCAG	0.547																																					p.L27L													.	.			0			c.C81T												64.0	70.0	68.0					7																	149153033		1897	4113	6010	SO:0001819	synonymous_variant	27153	exon2			TCGGGGGAGTCCA	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.81C>T	7.37:g.149153033G>A			Somatic	98	0	0		WXS	Illumina HiSeq	.	112	0.21	23	NM_015694	49	0.39	19	Q8N2R2|Q8N659	Silent	SNP	ENST00000247930.4	37	CCDS43675.1																																																																																					0.547	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352708.1		NM_015694	
CHPF2	54480	mdanderson.org	37	7	150932588	150932588	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr7:150932588C>T	ENST00000035307.2	+	2	2231	c.718C>T	c.(718-720)Cgg>Tgg	p.R240W	CHPF2_ENST00000495645.1_Missense_Mutation_p.R232W|MIR671_ENST00000390183.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	240					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						GCTTCGTCTGCGGCCACATCT	0.622																																					p.R240W													.	.			0			c.C718T												86.0	81.0	82.0					7																	150932588		2203	4299	6502	SO:0001583	missense	54480	exon2			CGTCTGCGGCCAC	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.718C>T	7.37:g.150932588C>T	ENSP00000035307:p.Arg240Trp		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_019015	46	0.00	0	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745010	0.69418	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.27557	1.66;1.66	5.85	3.09	0.35607	.	0.286386	0.41001	N	0.000969	T	0.37433	0.1003	L	0.42245	1.32	0.43296	D	0.995283	D;B	0.76494	0.999;0.003	P;B	0.59546	0.859;0.001	T	0.08764	-1.0706	10	0.56958	D	0.05	-8.3494	6.5658	0.22511	0.0:0.6611:0.1286:0.2103	.	240;232	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	W	232;240;240	ENSP00000418914:R232W;ENSP00000035307:R240W	ENSP00000035307:R240W	R	+	1	2	CHPF2	150563521	1.000000	0.71417	0.990000	0.47175	0.937000	0.57800	2.004000	0.40854	0.394000	0.25230	-0.140000	0.14226	CGG			0.622	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348648.2		NM_019015	
ASH2L	9070	mdanderson.org	37	8	37963102	37963102	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr8:37963102G>T	ENST00000343823.6	+	1	343	c.34G>T	c.(34-36)Gcg>Tcg	p.A12S	ASH2L_ENST00000428278.2_5'Flank|ASH2L_ENST00000545394.1_5'UTR|ASH2L_ENST00000521652.1_5'Flank|ASH2L_ENST00000250635.7_5'UTR	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	12					cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				TGGCCAGGAAGCGGGTGCCGG	0.672																																					p.A12S													.	.			0			c.G34T												13.0	16.0	15.0					8																	37963102		2191	4275	6466	SO:0001583	missense	9070	exon1			CAGGAAGCGGGTG	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.34G>T	8.37:g.37963102G>T	ENSP00000340896:p.Ala12Ser		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_004674	78	0.00	0	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	ENST00000343823.6	37	CCDS6101.1	.	.	.	.	.	.	.	.	.	.	G	9.605	1.129692	0.21041	.	.	ENSG00000129691	ENST00000343823;ENST00000517719	T	0.63580	-0.05	5.06	2.16	0.27623	.	0.625852	0.14269	N	0.330248	T	0.37210	0.0995	N	0.08118	0	0.24387	N	0.994767	B	0.06786	0.001	B	0.06405	0.002	T	0.25047	-1.0143	10	0.59425	D	0.04	.	5.1515	0.15011	0.0959:0.0:0.5287:0.3754	.	12	Q9UBL3	ASH2L_HUMAN	S	12	ENSP00000340896:A12S	ENSP00000340896:A12S	A	+	1	0	ASH2L	38082259	0.871000	0.30034	0.043000	0.18650	0.003000	0.03518	0.681000	0.25320	0.727000	0.32360	0.655000	0.94253	GCG			0.672	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376749.4		NM_004674	
SLC20A2	6575	broad.mit.edu	37	8	42329669	42329669	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr8:42329669G>T	ENST00000342228.3	-	2	609	c.240C>A	c.(238-240)taC>taA	p.Y80*	SLC20A2_ENST00000520179.1_Nonsense_Mutation_p.Y80*|SLC20A2_ENST00000520262.1_Nonsense_Mutation_p.Y80*	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	80					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CCGTCTCGTTGTACAGGTTCA	0.502																																					p.Y80X													.	SLC20A2	64		0			c.C240A												265.0	222.0	237.0					8																	42329669		2203	4300	6503	SO:0001587	stop_gained	6575	exon2			CTCGTTGTACAGG		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.240C>A	8.37:g.42329669G>T	ENSP00000340465:p.Tyr80*		Somatic	301	0	0		WXS	Illumina HiSeq	Phase_I	328	0.02	7	NM_001257181	36	0.00	0		Nonsense_Mutation	SNP	ENST00000342228.3	37	CCDS6132.1	.	.	.	.	.	.	.	.	.	.	G	36	5.789508	0.96945	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-26.5671	17.6287	0.88100	0.0:0.0:1.0:0.0	.	.	.	.	X	80	.	ENSP00000340465:Y80X	Y	-	3	2	SLC20A2	42448826	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	6.772000	0.75001	2.763000	0.94921	0.591000	0.81541	TAC			0.502	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377578.1			
PUF60	22827	broad.mit.edu	37	8	144899807	144899807	+	Silent	SNP	G	G	T	rs202135558	byFrequency	TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr8:144899807G>T	ENST00000526683.1	-	9	1518	c.963C>A	c.(961-963)gcC>gcA	p.A321A	PUF60_ENST00000524570.1_5'UTR|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000456095.2_Silent_p.A292A|PUF60_ENST00000313352.7_Silent_p.A261A|SCRIB_ENST00000320476.3_5'Flank|SCRIB_ENST00000356994.2_5'Flank|PUF60_ENST00000349157.6_Silent_p.A304A|PUF60_ENST00000453551.2_Silent_p.A278A|PUF60_ENST00000527197.1_Silent_p.A275A	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	321	Ala-rich.|Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CCACAGCAGCGGCAGGTGGGA	0.662																																					p.A321A													.	PUF60	26		0			c.C963A												29.0	37.0	34.0					8																	144899807		1937	4032	5969	SO:0001819	synonymous_variant	22827	exon9			AGCAGCGGCAGGT	AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.963C>A	8.37:g.144899807G>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	69	0.04	3	NM_078480	623	0.00	0	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Silent	SNP	ENST00000526683.1	37	CCDS47934.1	.	.	.	.	.	.	.	.	.	.	G	8.297	0.819011	0.16607	.	.	ENSG00000179950	ENST00000532884;ENST00000527744	.	.	.	3.93	-3.77	0.04346	.	.	.	.	.	T	0.36880	0.0983	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38845	-0.9642	4	.	.	.	.	1.3552	0.02181	0.3102:0.1266:0.102:0.4612	.	.	.	.	Q	191;319	.	.	P	-	2	0	PUF60	144971795	0.967000	0.33354	0.998000	0.56505	0.967000	0.64934	0.176000	0.16782	-0.173000	0.10761	-1.686000	0.00732	CCG			0.662	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000382222.1		NM_014281	
SLC44A1	23446	broad.mit.edu	37	9	108118213	108118214	+	Intron	DEL	TG	TG	-	rs149701367		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr9:108118213_108118214delTG	ENST00000374720.3	+	6	747				SLC44A1_ENST00000374724.1_Intron|SLC44A1_ENST00000343170.7_De_novo_Start_OutOfFrame|SLC44A1_ENST00000374723.1_Intron	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1						choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	tgtgtgtgtatgtgtgtgtgtg	0.441																																					.													.	SLC44A1	61		0			.																																									SO:0001627	intron_variant	23446	.			TGTGTATGTGTGT	AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.501-279TG>-	9.37:g.108118223_108118224delTG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Translation_Start_Site	DEL	ENST00000374720.3	37	CCDS6763.1																																																																																					0.441	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000053500.1		NM_080546	
LAMC3	10319	mdanderson.org	37	9	133951288	133951288	+	Missense_Mutation	SNP	G	G	T	rs375541717		TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr9:133951288G>T	ENST00000361069.4	+	21	3698	c.3565G>T	c.(3565-3567)Gcg>Tcg	p.A1189S	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1189	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CACCAGCTACGCGCTTCTCTG	0.627																																					p.A1189S													.	.			0			c.G3565T												52.0	46.0	48.0					9																	133951288		2203	4300	6503	SO:0001583	missense	10319	exon21			AGCTACGCGCTTC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3565G>T	9.37:g.133951288G>T	ENSP00000354360:p.Ala1189Ser		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_006059	101	0.00	0	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	1.056	-0.674284	0.03378	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.26957	1.7	5.03	-7.63	0.01290	.	1.692860	0.02631	N	0.104267	T	0.18045	0.0433	L	0.44542	1.39	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.20107	-1.0285	10	0.10902	T	0.67	.	9.2118	0.37322	0.2791:0.0:0.6101:0.1108	.	1189	Q9Y6N6	LAMC3_HUMAN	S	1189	ENSP00000354360:A1189S	ENSP00000347156:A1189S	A	+	1	0	LAMC3	132941109	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.901000	0.04093	-1.654000	0.01499	-0.681000	0.03757	GCG			0.627	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054717.3		NM_006059	
LAMC3	10319	mdanderson.org	37	9	133952608	133952608	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr9:133952608A>G	ENST00000361069.4	+	22	3797	c.3664A>G	c.(3664-3666)Agg>Ggg	p.R1222G	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1222	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GAAAGCACTGAGGACGGCTGT	0.652																																					p.R1222G													.	.			0			c.A3664G												63.0	62.0	62.0					9																	133952608		2203	4300	6503	SO:0001583	missense	10319	exon22			GCACTGAGGACGG	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3664A>G	9.37:g.133952608A>G	ENSP00000354360:p.Arg1222Gly		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_006059	91	0.00	0	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	A	4.962	0.178756	0.09443	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.27720	1.65	4.83	1.93	0.25924	.	0.720518	0.13281	N	0.399774	T	0.08935	0.0221	N	0.00621	-1.32	0.21967	N	0.999446	B	0.02656	0.0	B	0.04013	0.001	T	0.33675	-0.9859	10	0.22706	T	0.39	.	8.5915	0.33690	0.2675:0.0:0.7325:0.0	.	1222	Q9Y6N6	LAMC3_HUMAN	G	1222	ENSP00000354360:R1222G	ENSP00000347156:R1222G	R	+	1	2	LAMC3	132942429	0.936000	0.31750	0.925000	0.36789	0.039000	0.13416	1.056000	0.30480	0.567000	0.29293	-0.220000	0.12472	AGG			0.652	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054717.3		NM_006059	
ABCA2	20	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	9	139907669	139907669	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr9:139907669C>T	ENST00000371605.3	-	29	4796	c.4649G>A	c.(4648-4650)gGc>gAc	p.G1550D	ABCA2_ENST00000341511.6_Missense_Mutation_p.G1551D|ABCA2_ENST00000265662.5_Missense_Mutation_p.G1551D			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1550					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CCCCAGCGAGCCGTTGGCGGG	0.692																																					p.G1581D													.	.			0			c.G4742A												7.0	11.0	10.0					9																	139907669		1848	3930	5778	SO:0001583	missense	20	exon30			AGCGAGCCGTTGG	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4649G>A	9.37:g.139907669C>T	ENSP00000360666:p.Gly1550Asp		Somatic	40	0	0		WXS	Illumina HiSeq	.	34	0.18	6	NM_212533	22	0.23	5	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	C	7.714	0.695857	0.15106	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.86297	-2.1;-2.1;-2.1	4.68	3.7	0.42460	.	0.250633	0.23515	U	0.047359	T	0.71508	0.3348	N	0.14661	0.345	0.29537	N	0.852396	B;B	0.22346	0.038;0.068	B;B	0.13407	0.009;0.009	T	0.59418	-0.7458	10	0.10902	T	0.67	.	8.4378	0.32797	0.0:0.7461:0.1591:0.0948	.	1550;1581	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	D	1551;1550;1581;1551	ENSP00000265662:G1551D;ENSP00000360666:G1550D;ENSP00000344155:G1551D	ENSP00000265662:G1551D	G	-	2	0	ABCA2	139027490	1.000000	0.71417	0.849000	0.33467	0.126000	0.20510	4.020000	0.57189	2.142000	0.66516	0.491000	0.48974	GGC			0.692	ABCA2-202	KNOWN	basic	protein_coding	protein_coding				NM_001606	
DPP7	29952	broad.mit.edu	37	9	140006326	140006326	+	Splice_Site	SNP	A	A	C			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chr9:140006326A>C	ENST00000371579.2	-	10	1210	c.1206T>G	c.(1204-1206)ggT>ggG	p.G402G		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	402						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.D403fs*1(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		CAGCCTTACCACCCCCCCAGA	0.701																																					p.G402G													.	DPP7	22		1	Insertion - Frameshift(1)	large_intestine(1)	c.T1206G												23.0	30.0	28.0					9																	140006326		2200	4298	6498	SO:0001630	splice_region_variant	29952	exon10			CTTACCACCCCCC	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.1207+1T>G	9.37:g.140006326A>C			Somatic	67	0.1194029851	8		WXS	Illumina HiSeq	Phase_I	75	0.19	14	NM_013379	154	0.04	6	A8K7U7|Q5VSF1|Q969X4	Splice_Site	SNP	ENST00000371579.2	37	CCDS7030.1																																																																																					0.701	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055279.1		NM_013379	Silent
HSD17B10	3028	mdanderson.org	37	X	53459354	53459354	+	Silent	SNP	G	G	T			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chrX:53459354G>T	ENST00000168216.6	-	3	225	c.198C>A	c.(196-198)acC>acA	p.T66T	HSD17B10_ENST00000375304.5_Silent_p.T66T|HSD17B10_ENST00000375298.4_Silent_p.T66T|RP3-339A18.6_ENST00000418049.1_RNA|HSD17B10_ENST00000495986.1_5'UTR	NM_001037811.2|NM_004493.2	NP_001032900.1|NP_004484.1	Q99714	HCD2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 10	66					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity (GO:0047015)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|cholate 7-alpha-dehydrogenase activity (GO:0008709)|poly(A) RNA binding (GO:0044822)|testosterone dehydrogenase [NAD(P)] activity (GO:0030283)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	8						CCTTCTCAGAGGTCACCTTCA	0.542																																					p.T66T													.	.			0			c.C198A												92.0	71.0	78.0					X																	53459354		2203	4300	6503	SO:0001819	synonymous_variant	3028	exon3			CTCAGAGGTCACC	U96132	CCDS14354.1, CCDS35300.1	Xp11.2	2014-09-17	2006-11-22	2006-11-22	ENSG00000072506	ENSG00000072506	1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	4800	protein-coding gene	gene with protein product	"""type 10 17b-HSD"", ""type 10 17beta-hydroxysteroid dehydrogenase"", ""AB-binding alcohol dehydrogenase"", ""short chain dehydrogenase/reductase family 5C, member 1"", ""mitochondrial RNase P subunit 2"""	300256	"""hydroxyacyl-Coenzyme A dehydrogenase, type II, hydroxyacyl-Coenzyme A dehydrogenase, type II"", ""mental retardation, X-linked, syndromic 10"""	HADH2, MRXS10		9338779, 16899120, 19027726, 18984158, 17236142	Standard	NM_004493		Approved	ERAB, MHBD, 17b-HSD10, ABAD, SDR5C1, MRPP2, CAMR	uc004dsl.1	Q99714	OTTHUMG00000021612	ENST00000168216.6:c.198C>A	X.37:g.53459354G>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	35	0.11	4	NM_004493	761	0.00	0	Q5H927|Q6IBS9|Q8TCV9|Q96HD5	Silent	SNP	ENST00000168216.6	37	CCDS14354.1																																																																																					0.542	HSD17B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056750.1		NM_004493	
SPIN2A	54466	broad.mit.edu	37	X	57162583	57162583	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A6IS-01A-11D-A435-10	TCGA-SN-A6IS-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca87b2ae-6a7b-45a2-af22-eaee181811e4	80864d22-97cf-4c45-89b2-fea8dc595170	g.chrX:57162583T>C	ENST00000374908.1	-	1	847	c.448A>G	c.(448-450)Atg>Gtg	p.M150V	SPIN2A_ENST00000374906.3_Missense_Mutation_p.M150V			Q99865	SPI2A_HUMAN	spindlin family, member 2A	150					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				breast(1)|kidney(1)|ovary(1)	3						GCTAAGACCATCCCCCTCCAT	0.413																																					p.M150V													.	SPIN2A	7		0			c.A448G												88.0	79.0	82.0					X																	57162583		2201	4294	6495	SO:0001583	missense	54466	exon2			AGACCATCCCCCT	Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.448A>G	X.37:g.57162583T>C	ENSP00000364043:p.Met150Val		Somatic	351	0.0028490028	1		WXS	Illumina HiSeq	Phase_I	443	0.01	5	NM_019003	0		0	O75650|Q6IPW2|Q9UJJ0	Missense_Mutation	SNP	ENST00000374908.1	37	CCDS35312.1	.	.	.	.	.	.	.	.	.	.	.	10.86	1.471027	0.26423	.	.	ENSG00000147059	ENST00000374908;ENST00000374906	T;T	0.45276	0.9;0.9	2.74	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	L	0.33753	1.03	0.39768	D	0.972128	P	0.42827	0.791	P	0.62740	0.906	T	0.32428	-0.9907	10	0.23302	T	0.38	-23.7792	8.4178	0.32681	0.0:0.0:0.0:1.0	.	150	Q99865	SPI2A_HUMAN	V	150	ENSP00000364043:M150V;ENSP00000364041:M150V	ENSP00000364041:M150V	M	-	1	0	SPIN2A	57179308	1.000000	0.71417	0.997000	0.53966	0.897000	0.52465	6.373000	0.73128	1.327000	0.45338	0.345000	0.21793	ATG			0.413	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058915.1		NM_019003	
