#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
KAZN	23254	hgsc.bcm.edu	37	1	15439098	15439098	+	Intron	SNP	C	C	T	rs114844404		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr1:15439098C>T	ENST00000376030.2	+	14	2457					NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein						keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CTTTTTTTCTCCTCCCGGGAG	0.587																																					.													.	.			0			.																																									SO:0001627	intron_variant	200197	.			TTTTCTCCTCCCG	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.2163+61C>T	1.37:g.15439098C>T			Somatic	81	0	0		WXS	Illumina HiSeq	.	93	0.26	24	.	2	0.00	0	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	RNA	SNP	ENST00000376030.2	37	CCDS152.2																																																																																					0.587	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005690.2		NM_001017999	
LOC100129620	100129620	broad.mit.edu	37	1	99474093	99474094	+	RNA	INS	-	-	A	rs531849287|rs75027532|rs57656522	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr1:99474093_99474094insA	ENST00000425113.1	+	0	370					NR_033940.1																						GAACAGCAACTAAAAAAAAAAA	0.356																																					.													.	.			0			.																																											0	.			AGCAACTAAAAAA																													1.37:g.99474104_99474104dupA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	8	0.50	4	.	1	0.00	0		RNA	INS	ENST00000425113.1	37																																																																																						0.356	RP5-896L10.1-001	KNOWN	basic	antisense	antisense		OTTHUMT00000029675.2			
SEC22B	9554	broad.mit.edu	37	1	145109259	145109260	+	RNA	INS	-	-	A	rs61810755|rs11386827		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr1:145109259_145109260insA	ENST00000453618.1	+	0	512							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											cactccagcccgggggcagagc	0.48																																					.													.	.			0			.																																											9554	.			CCAGCCCGGGGGC	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109259_145109260insA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	1	0.00	0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.480	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
FLG	2312	broad.mit.edu;mdanderson.org	37	1	152276832	152276832	+	Silent	SNP	G	G	C			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr1:152276832G>C	ENST00000368799.1	-	3	10565	c.10530C>G	c.(10528-10530)tcC>tcG	p.S3510S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3510	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCGCCTGAGTGGAAGCTTCAT	0.572									Ichthyosis																												p.S3510S													.	FLG	900		0			c.C10530G												236.0	230.0	232.0					1																	152276832		2203	4297	6500	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTGAGTGGAAGCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10530C>G	1.37:g.152276832G>C			Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	86	0.05	4	NM_002016	102	0.00	0	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																					0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033742.1		NM_002016	
FLG	2312	ucsc.edu	37	1	152281562	152281562	+	Missense_Mutation	SNP	A	A	G	rs548103791		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr1:152281562A>G	ENST00000368799.1	-	3	5835	c.5800T>C	c.(5800-5802)Tgg>Cgg	p.W1934R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1934	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCCAGACCACCTCTCAGAG	0.572									Ichthyosis																												p.W1934R													FLG,NS,carcinoma,+2,1	FLG	900	1	0			c.T5800C												215.0	212.0	213.0					1																	152281562		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CAGACCACCTCTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5800T>C	1.37:g.152281562A>G	ENSP00000357789:p.Trp1934Arg		Somatic	155	0.0064516129	1		RNA-Seq	Illumina HiSeq		202	0.00	1	NM_002016	28	0.86	24	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|A	1.176|1.176	-0.639503|-0.639503	0.03557|0.03557	.|.	.|.	ENSG00000143631|ENSG00000143631	ENST00000271820|ENST00000368799	.|T	.|0.01560	.|4.77	3.01|3.01	0.0884|0.0884	0.14455|0.14455	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00300	.|0.0009	N|N	0.04880|0.04880	-0.145|-0.145	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	.|T	.|0.33445	.|-0.9868	.|9	.|0.15952	.|T	.|0.53	.|.	5.5986|5.5986	0.17341|0.17341	0.388:0.0:0.612:0.0|0.388:0.0:0.612:0.0	.|.	.|1934	.|P20930	.|FILA_HUMAN	.|R	-1|1934	.|ENSP00000357789:W1934R	.|ENSP00000357789:W1934R	.|W	-|-	.|1	.|0	FLG|FLG	150548186|150548186	0.011000|0.011000	0.17503|0.17503	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.227000|0.227000	0.17795|0.17795	0.021000|0.021000	0.15133|0.15133	-1.076000|-1.076000	0.02234|0.02234	.|TGG			0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033742.1		NM_002016	
MUC1	4582	broad.mit.edu	37	1	155161799	155161799	+	Missense_Mutation	SNP	T	T	G			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr1:155161799T>G	ENST00000368395.1	-	2	405	c.334A>C	c.(334-336)Acc>Ccc	p.T112P	MUC1_ENST00000343256.5_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000368390.3_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000462215.1_Intron|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000338684.5_Intron|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368398.3_Intron|MUC1_ENST00000368393.3_Intron	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	892					cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCTGGCGGGGTGGTGGAGCCC	0.711			T	IGH@	B-NHL																																p.T121P				Dom	yes		1	1q21	4582	"""mucin 1, transmembrane"""		L	.	MUC1	94		0			c.A361C																																									SO:0001583	missense	4582	exon2			GCGGGGTGGTGGA	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.334A>C	1.37:g.155161799T>G	ENSP00000357380:p.Thr112Pro		Somatic	27	0.2592592593	7		WXS	Illumina HiSeq	Phase_I	47	0.23	11	NM_001204286	8	0.00	0	A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Missense_Mutation	SNP	ENST00000368395.1	37	CCDS55640.1	.	.	.	.	.	.	.	.	.	.	T	8.249	0.808546	0.16467	.	.	ENSG00000185499	ENST00000368395;ENST00000425082	T	0.20200	2.09	2.73	0.35	0.16037	.	2.188600	0.02617	N	0.102742	T	0.11024	0.0269	N	0.14661	0.345	0.09310	N	0.999999	D	0.65815	0.995	D	0.68483	0.958	T	0.17684	-1.0361	10	0.39692	T	0.17	.	3.1844	0.06596	0.0:0.2782:0.2183:0.5034	.	112	P15941	MUC1_HUMAN	P	112	ENSP00000357380:T112P	ENSP00000357380:T112P	T	-	1	0	MUC1	153428423	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.417000	0.07088	0.027000	0.15297	-1.038000	0.02383	ACC			0.711	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000086735.1		NM_002456	
NR1I3	9970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161200952	161200952	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr1:161200952C>T	ENST00000367982.4	-	7	933	c.778G>A	c.(778-780)Gag>Aag	p.E260K	NR1I3_ENST00000511944.1_Intron|NR1I3_ENST00000428574.2_Missense_Mutation_p.E256K|NR1I3_ENST00000367979.2_Missense_Mutation_p.E260K|NR1I3_ENST00000502985.1_Intron|NR1I3_ENST00000367983.4_Missense_Mutation_p.E256K|NR1I3_ENST00000508740.1_Missense_Mutation_p.E227K|NR1I3_ENST00000412844.2_Missense_Mutation_p.E231K|NR1I3_ENST00000504010.1_Intron|NR1I3_ENST00000512372.1_Intron|NR1I3_ENST00000442691.2_Missense_Mutation_p.E260K|NR1I3_ENST00000367985.3_Intron|NR1I3_ENST00000437437.2_Missense_Mutation_p.E227K|NR1I3_ENST00000511748.1_Intron|NR1I3_ENST00000367981.3_Missense_Mutation_p.E227K|NR1I3_ENST00000479324.1_5'UTR|NR1I3_ENST00000367980.2_Missense_Mutation_p.E260K|NR1I3_ENST00000515621.1_Missense_Mutation_p.E181K|NR1I3_ENST00000511676.1_Missense_Mutation_p.E227K|NR1I3_ENST00000506209.1_Missense_Mutation_p.E227K|NR1I3_ENST00000367984.4_Intron|NR1I3_ENST00000508387.1_Intron|NR1I3_ENST00000505005.1_Intron			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3	260					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TACTCAGGCTCTTGGAGCTGC	0.527																																					p.E260K													.	.			0			c.G778A												59.0	60.0	59.0					1																	161200952		2203	4300	6503	SO:0001583	missense	9970	exon7			CAGGCTCTTGGAG	Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347	ENST00000367982.4:c.778G>A	1.37:g.161200952C>T	ENSP00000356961:p.Glu260Lys		Somatic	107	0	0		WXS	Illumina HiSeq	.	146	0.25	36	NM_001077478	0		0	E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Missense_Mutation	SNP	ENST00000367982.4	37	CCDS41430.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403756	0.42613	.	.	ENSG00000143257	ENST00000367983;ENST00000367980;ENST00000437437;ENST00000442691;ENST00000412844;ENST00000428574;ENST00000508740;ENST00000367982;ENST00000511676;ENST00000367981;ENST00000515621;ENST00000367979;ENST00000506209	D;D;D;D;D;D;D;D;D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82	5.56	4.65	0.58169	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.218899	0.47093	N	0.000249	D	0.90700	0.7082	L	0.54908	1.71	0.41678	D	0.989274	P;P;B;B;P;B;B;B;B;P;P;P	0.48350	0.52;0.82;0.279;0.209;0.681;0.452;0.127;0.378;0.321;0.842;0.909;0.82	B;B;B;B;B;B;B;B;B;B;P;B	0.44422	0.297;0.315;0.203;0.136;0.119;0.33;0.039;0.204;0.09;0.334;0.449;0.157	D	0.90168	0.4233	9	0.56958	D	0.05	.	8.5839	0.33646	0.0:0.8276:0.0:0.1724	.	227;231;256;260;260;260;181;227;227;227;227;256	E9PCF2;E9PHN4;F1D8Q1;Q14994;E9PC13;Q4U0F0;D6REZ7;Q6GZ68;E9PH10;Q6GZ84;E9PGH6;E9PB75	.;.;.;NR1I3_HUMAN;.;.;.;.;.;.;.;.	K	256;260;227;260;231;256;227;260;227;227;181;260;227	ENSP00000356962:E256K;ENSP00000356959:E260K;ENSP00000407446:E227K;ENSP00000406493:E260K;ENSP00000399361:E231K;ENSP00000412672:E256K;ENSP00000423666:E227K;ENSP00000356961:E260K;ENSP00000427175:E227K;ENSP00000356960:E227K;ENSP00000421588:E181K;ENSP00000356958:E260K;ENSP00000423089:E227K	ENSP00000356958:E260K	E	-	1	0	NR1I3	159467576	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	2.084000	0.41625	1.353000	0.45828	-0.258000	0.10820	GAG			0.527	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000083048.2			
RBM17	84991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	6157491	6157491	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr10:6157491G>A	ENST00000446108.1	+	12	1822	c.1178G>A	c.(1177-1179)aGg>aAg	p.R393K	RBM17_ENST00000476706.1_3'UTR|RBM17_ENST00000379888.4_Missense_Mutation_p.R393K	NM_001145547.1	NP_001139019.1	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	393					alternative mRNA splicing, via spliceosome (GO:0000380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R393T(2)		NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	19						GACAAATTCAGGGTCTTGGAT	0.408																																					p.R393K													RBM17,NS,carcinoma,0,1	RBM17	0	1	2	Substitution - Missense(2)	lung(2)	c.G1178A												167.0	164.0	165.0					10																	6157491		2203	4300	6503	SO:0001583	missense	84991	exon12			AATTCAGGGTCTT	AF083384	CCDS7077.1	10p15.1	2013-01-28			ENSG00000134453	ENSG00000134453		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	16944	protein-coding gene	gene with protein product	"""splicing factor 45kDa"""	606935				9731529	Standard	NM_032905		Approved	SPF45, MGC14439	uc001ijb.3	Q96I25	OTTHUMG00000017618	ENST00000446108.1:c.1178G>A	10.37:g.6157491G>A	ENSP00000388638:p.Arg393Lys		Somatic	45	0	0		WXS	Illumina HiSeq	.	50	0.20	10	NM_001145547	384	0.49	189	Q96GY6	Missense_Mutation	SNP	ENST00000446108.1	37	CCDS7077.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141150	0.37825	.	.	ENSG00000134453	ENST00000379888;ENST00000446108	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.51753	0.1693	L	0.33753	1.03	0.80722	D	1	B	0.13145	0.007	B	0.08055	0.003	T	0.47018	-0.9149	9	0.13853	T	0.58	-18.7954	18.8842	0.92368	0.0:0.0:1.0:0.0	.	393	Q96I25	SPF45_HUMAN	K	393	.	ENSP00000369218:R393K	R	+	2	0	RBM17	6197497	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.967000	0.93402	2.518000	0.84900	0.655000	0.94253	AGG			0.408	RBM17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046635.1		NM_032905	
DCLRE1C	64421	mdanderson.org	37	10	14951005	14951005	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr10:14951005T>C	ENST00000378278.2	-	14	1518	c.1481A>G	c.(1480-1482)aAa>aGa	p.K494R	DCLRE1C_ENST00000357717.2_Missense_Mutation_p.K379R|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.K374R|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.K379R|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.K374R|DCLRE1C_ENST00000378242.1_Missense_Mutation_p.K147R|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.K374R|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.K374R|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.K374R|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.K379R			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	494					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						ATCATTTCTTTTAAAGAATAC	0.468								Non-homologous end-joining																													p.K494R													.	.			0			c.A1481G												55.0	54.0	55.0					10																	14951005		2203	4300	6503	SO:0001583	missense	64421	exon14			TTTCTTTTAAAGA	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1481A>G	10.37:g.14951005T>C	ENSP00000367527:p.Lys494Arg		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001033855	5	0.00	0	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	ENST00000378278.2	37	CCDS31149.1	.	.	.	.	.	.	.	.	.	.	T	15.27	2.782346	0.49891	.	.	ENSG00000152457	ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000378242	T;T;T;T;T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73	5.76	5.76	0.90799	.	0.200417	0.52532	D	0.000078	T	0.27594	0.0678	M	0.74881	2.28	0.36469	D	0.867132	B;B	0.31153	0.181;0.31	B;B	0.30943	0.122;0.057	T	0.40572	-0.9556	10	0.54805	T	0.06	.	5.7775	0.18287	0.0:0.1394:0.1464:0.7141	.	379;494	Q96SD1-3;Q96SD1	.;DCR1C_HUMAN	R	374;379;379;379;374;374;374;494;374;147	ENSP00000400529:K374R;ENSP00000367492:K379R;ENSP00000350349:K379R;ENSP00000367496:K379R;ENSP00000380030:K374R;ENSP00000367503:K374R;ENSP00000367502:K374R;ENSP00000367527:K494R;ENSP00000367506:K374R;ENSP00000367488:K147R	ENSP00000350349:K379R	K	-	2	0	DCLRE1C	14991011	0.992000	0.36948	1.000000	0.80357	0.987000	0.75469	1.040000	0.30278	2.186000	0.69663	0.533000	0.62120	AAA			0.468	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046934.1		NM_022487	
DEAF1	10522	mdanderson.org	37	11	674705	674705	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr11:674705A>G	ENST00000382409.3	-	10	1818	c.1334T>C	c.(1333-1335)cTg>cCg	p.L445P	RP11-754B17.1_ENST00000527799.1_RNA|DEAF1_ENST00000525904.1_5'UTR|DEAF1_ENST00000338675.6_Missense_Mutation_p.L356P	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	445	Interaction with LMO4. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		TGACAGCTCCAGCCCATTGAC	0.587																																					p.L445P													.	.			0			c.T1334C												69.0	73.0	72.0					11																	674705		2203	4300	6503	SO:0001583	missense	10522	exon10			AGCTCCAGCCCAT	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.1334T>C	11.37:g.674705A>G	ENSP00000371846:p.Leu445Pro		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_021008	164	0.00	0	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	ENST00000382409.3	37	CCDS31327.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.527987	0.44969	.	.	ENSG00000177030	ENST00000382409;ENST00000338675;ENST00000359958;ENST00000388804	T	0.70631	-0.5	3.85	3.85	0.44370	.	0.000000	0.56097	D	0.000024	T	0.73953	0.3653	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.77013	-0.2745	10	0.87932	D	0	-20.209	12.0758	0.53643	1.0:0.0:0.0:0.0	.	445	O75398	DEAF1_HUMAN	P	445;356;431;368	ENSP00000371846:L445P	ENSP00000341902:L356P	L	-	2	0	DEAF1	664705	1.000000	0.71417	1.000000	0.80357	0.274000	0.26718	7.950000	0.87804	1.754000	0.51921	0.459000	0.35465	CTG			0.587	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383614.3		NM_021008	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1261503	1261503	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr11:1261503G>A	ENST00000529681.1	+	30	3926	c.3868G>A	c.(3868-3870)Gga>Aga	p.G1290R	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.G1293R	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1290					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCCATCTGCGGAAGCAACGG	0.607																																					p.G1290R													MUC5B,NS,carcinoma,0,2	MUC5B	0	2	0			c.G3868A												77.0	88.0	84.0					11																	1261503		2145	4252	6397	SO:0001583	missense	727897	exon30			ATCTGCGGAAGCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3868G>A	11.37:g.1261503G>A	ENSP00000436812:p.Gly1290Arg		Somatic	59	0	0		WXS	Illumina HiSeq	.	66	0.27	18	NM_002458	0		0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	11.60	1.685576	0.29962	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.16897	2.31;2.51	4.77	1.68	0.24146	.	.	.	.	.	T	0.10594	0.0259	L	0.38175	1.15	0.09310	N	1	P;P	0.47910	0.902;0.801	B;B	0.32677	0.15;0.08	T	0.17592	-1.0364	9	0.87932	D	0	.	7.8783	0.29608	0.3538:0.0:0.6462:0.0	.	1983;1293	A7Y9J9;E9PBJ0	.;.	R	1290;1293;1291;1360	ENSP00000436812:G1290R;ENSP00000415793:G1293R	ENSP00000343037:G1291R	G	+	1	0	MUC5B	1218079	0.001000	0.12720	0.008000	0.14137	0.031000	0.12232	0.955000	0.29188	0.390000	0.25115	0.462000	0.41574	GGA			0.607	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000390041.2		XM_001126093	
AMBRA1	55626	mdanderson.org	37	11	46563785	46563785	+	Silent	SNP	G	G	T	rs375558035		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr11:46563785G>T	ENST00000458649.2	-	7	2200	c.1782C>A	c.(1780-1782)ggC>ggA	p.G594G	AMBRA1_ENST00000533727.1_Silent_p.G504G|AMBRA1_ENST00000426438.1_Silent_p.G594G|AMBRA1_ENST00000528950.1_Silent_p.G594G|AMBRA1_ENST00000298834.3_Silent_p.G594G|AMBRA1_ENST00000314845.3_Silent_p.G504G|AMBRA1_ENST00000534300.1_Silent_p.G594G			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	594	Ser-rich.				autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AACTAGCCTCGCCAGAGGAGT	0.587																																					p.G504G													.	.			0			c.C1512A												64.0	54.0	57.0					11																	46563785		2201	4299	6500	SO:0001819	synonymous_variant	55626	exon8			AGCCTCGCCAGAG	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1782C>A	11.37:g.46563785G>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_017749	6	0.00	0	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	ENST00000458649.2	37																																																																																						0.587	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000390103.1		NM_017749	
TCN1	6947	mdanderson.org	37	11	59633919	59633919	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr11:59633919G>T	ENST00000257264.3	-	1	129	c.25C>A	c.(25-27)Cta>Ata	p.L9I	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	9					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCCCCACTAGGGGCAGCTGG	0.423																																					p.L9I													.	.			0			c.C25A												97.0	108.0	104.0					11																	59633919		2201	4295	6496	SO:0001583	missense	6947	exon1			CCACTAGGGGCAG	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.25C>A	11.37:g.59633919G>T	ENSP00000257264:p.Leu9Ile		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001062	26	0.00	0	A8KAC5|Q8WV77	Missense_Mutation	SNP	ENST00000257264.3	37	CCDS7978.1	.	.	.	.	.	.	.	.	.	.	G	6.370	0.436434	0.12104	.	.	ENSG00000134827	ENST00000257264	T	0.53640	0.61	4.95	2.91	0.33838	.	0.343884	0.20786	N	0.085708	T	0.60117	0.2244	M	0.70595	2.14	0.21256	N	0.999748	D	0.65815	0.995	D	0.67231	0.95	T	0.51220	-0.8733	10	0.87932	D	0	.	4.9987	0.14253	0.3516:0.0:0.6484:0.0	.	9	P20061	TCO1_HUMAN	I	9	ENSP00000257264:L9I	ENSP00000257264:L9I	L	-	1	2	TCN1	59390495	0.992000	0.36948	0.190000	0.23270	0.159000	0.22180	0.856000	0.27818	0.452000	0.26830	-0.291000	0.09656	CTA			0.423	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394503.1		NM_001062	
ASRGL1	80150	mdanderson.org	37	11	62156700	62156700	+	Missense_Mutation	SNP	G	G	T	rs144391767		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr11:62156700G>T	ENST00000415229.2	+	5	802	c.587G>T	c.(586-588)cGc>cTc	p.R196L	ASRGL1_ENST00000301776.5_Missense_Mutation_p.R196L|ASRGL1_ENST00000535727.1_Missense_Mutation_p.R68L|CTD-2531D15.5_ENST00000526045.1_RNA	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	196	Substrate binding.				asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	ATGGTCGGCCGCGTTGGGGAC	0.582																																					p.R196L													.	.			0			c.G587T												96.0	91.0	93.0					11																	62156700		2202	4299	6501	SO:0001583	missense	80150	exon5			TCGGCCGCGTTGG		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.587G>T	11.37:g.62156700G>T	ENSP00000400057:p.Arg196Leu		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001083926	51	0.00	0	B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Missense_Mutation	SNP	ENST00000415229.2	37	CCDS8019.1	.	.	.	.	.	.	.	.	.	.	.	21.9	4.213820	0.79352	.	.	ENSG00000162174	ENST00000415229;ENST00000535727;ENST00000301776	D;D;D	0.95656	-3.77;-3.77;-3.77	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.99800	4.79	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98936	1.0789	10	0.87932	D	0	-9.7698	16.2454	0.82441	0.0:0.0:1.0:0.0	.	196	Q7L266	ASGL1_HUMAN	L	196;68;196	ENSP00000400057:R196L;ENSP00000443284:R68L;ENSP00000301776:R196L	ENSP00000301776:R196L	R	+	2	0	ASRGL1	61913276	1.000000	0.71417	0.995000	0.50966	0.261000	0.26267	8.339000	0.90041	2.423000	0.82170	0.561000	0.74099	CGC			0.582	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394865.1		NM_001083926	
TSGA10IP	254187	broad.mit.edu	37	11	65715748	65715751	+	RNA	DEL	CATC	CATC	-	rs570848027|rs200343600|rs585897	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	CATC	CATC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr11:65715748_65715751delCATC	ENST00000532620.1	+	0	1382				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						ACTTTTGGATcatccatccatcca	0.422																																					.													.	TSGA10IP	31		0			.																																											254187	.			TTGGATCATCCAT	AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65715756_65715759delCATC			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	Q3SXZ9|Q3SY01|Q96M26	RNA	DEL	ENST00000532620.1	37																																																																																						0.422	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000391373.2		NM_152762	
LRP5	4041	mdanderson.org	37	11	68115709	68115709	+	Silent	SNP	C	C	T	rs191882942	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr11:68115709C>T	ENST00000294304.7	+	2	592	c.486C>T	c.(484-486)caC>caT	p.H162H		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	162	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACCCCGCTCACGGGTAAACCC	0.597													C|||	5	0.000998403	0.0	0.0058	5008	,	,		17781	0.001		0.0	False		,,,				2504	0.0				p.H162H													.	.			0			c.C486T												45.0	49.0	48.0					11																	68115709		2200	4293	6493	SO:0001819	synonymous_variant	4041	exon2			CGCTCACGGGTAA	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.486C>T	11.37:g.68115709C>T			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_002335	16	0.00	0	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1																																																																																			0.001		0.597	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395088.1		NM_002335	
RHNO1	83695	broad.mit.edu	37	12	2997087	2997087	+	Missense_Mutation	SNP	A	A	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr12:2997087A>T	ENST00000489288.2	+	3	331	c.179A>T	c.(178-180)gAt>gTt	p.D60V	TULP3_ENST00000448120.2_5'Flank|TULP3_ENST00000397132.2_5'Flank|RHNO1_ENST00000461997.2_Missense_Mutation_p.D46V|RHNO1_ENST00000464682.2_3'UTR	NM_001252499.2|NM_001257097.1|NM_001257098.1	NP_001239428.1|NP_001244026.1|NP_001244027.1	Q9BSD3	RHNO1_HUMAN	RAD9-HUS1-RAD1 interacting nuclear orphan 1	60					cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|positive regulation of G0 to G1 transition (GO:0070318)|recombinational repair (GO:0000725)	chromosome (GO:0005694)|nucleus (GO:0005634)											GTATCACCTGATTTTGATACA	0.433																																					p.D60V													.	.			0			c.A179T												45.0	42.0	43.0					12																	2997087		2203	4300	6503	SO:0001583	missense	83695	exon3			CACCTGATTTTGA	AK021945	CCDS8518.1, CCDS58199.1	12p13.33	2012-08-23	2012-08-23	2012-08-23	ENSG00000171792	ENSG00000171792			28206	protein-coding gene	gene with protein product	"""Rad9, Rad1, Hus1 interacting nuclear orphan"""	614085	"""chromosome 12 open reading frame 32"""	C12orf32		20811708, 21659603	Standard	NM_001252499		Approved	HKMT1188, MGC13204, RHINO	uc031qfq.1	Q9BSD3	OTTHUMG00000158557	ENST00000489288.2:c.179A>T	12.37:g.2997087A>T	ENSP00000438590:p.Asp60Val		Somatic	82	0.0731707317	6		WXS	Illumina HiSeq	Phase_I	149	0.10	15	NM_001257098	116	0.00	0	B7Z989	Missense_Mutation	SNP	ENST00000489288.2	37	CCDS8518.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149132	0.37923	.	.	ENSG00000171792	ENST00000538636;ENST00000461997;ENST00000489288;ENST00000366285;ENST00000538700	.	.	.	5.42	5.42	0.78866	.	0.340042	0.28420	N	0.015408	T	0.56262	0.1973	.	.	.	0.80722	D	1	B;B	0.25169	0.119;0.119	B;B	0.26416	0.069;0.069	T	0.58053	-0.7704	8	0.72032	D	0.01	0.0038	11.8673	0.52501	1.0:0.0:0.0:0.0	.	46;60	B7Z989;Q9BSD3	.;RHINO_HUMAN	V	60;46;60;60;60	.	ENSP00000444654:D60V	D	+	2	0	C12orf32	2867348	1.000000	0.71417	1.000000	0.80357	0.489000	0.33432	4.549000	0.60726	2.050000	0.60909	0.482000	0.46254	GAT			0.433	RHNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351286.2		NM_031465	
NACA	4666	broad.mit.edu	37	12	57112396	57112396	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr12:57112396G>A	ENST00000454682.1	-	3	3199	c.2918C>T	c.(2917-2919)cCa>cTa	p.P973L	NACA_ENST00000550952.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000552540.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	973	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						ACCTCCTTTTGGGGAGGGAGG	0.652			T	BCL6	NHL																																.				Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	.	NACA	131		0			.												35.0	43.0	40.0					12																	57112396		1364	3140	4504	SO:0001583	missense	4666	.			CCTTTTGGGGAGG	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.2918C>T	12.37:g.57112396G>A	ENSP00000403817:p.Pro973Leu		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	57	0.12	7	.	0		0		Missense_Mutation	SNP	ENST00000454682.1	37		.	.	.	.	.	.	.	.	.	.	g	4.142	0.024795	0.08054	.	.	ENSG00000196531	ENST00000454682	T	0.49720	0.77	2.61	0.515	0.17013	.	.	.	.	.	T	0.26846	0.0657	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.19614	-1.0300	7	.	.	.	.	5.3013	0.15780	0.224:0.1697:0.6064:0.0	.	973	E9PAV3	.	L	973	ENSP00000403817:P973L	.	P	-	2	0	NACA	55398663	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.249000	0.08842	-0.025000	0.13918	-1.341000	0.01249	CCA			0.652	NACA-201	KNOWN	basic	protein_coding	protein_coding				NM_005594	
TMCC3	57458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	94976045	94976045	+	Silent	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr12:94976045C>T	ENST00000261226.4	-	2	479	c.348G>A	c.(346-348)gaG>gaA	p.E116E	TMCC3_ENST00000551457.1_Silent_p.E85E	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	116						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GATTCTTCTTCTCAAAGACTT	0.478																																					p.E116E													.	.			0			c.G348A												121.0	110.0	114.0					12																	94976045		2203	4300	6503	SO:0001819	synonymous_variant	57458	exon2			CTTCTTCTCAAAG	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.348G>A	12.37:g.94976045C>T			Somatic	67	0	0		WXS	Illumina HiSeq	.	114	0.18	21	NM_020698	2	0.00	0	Q8IWB2	Silent	SNP	ENST00000261226.4	37	CCDS31877.1																																																																																					0.478	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408113.1		NM_020698	
SLC5A8	160728	mdanderson.org	37	12	101603481	101603481	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr12:101603481C>T	ENST00000536262.2	-	1	704	c.146G>A	c.(145-147)gGc>gAc	p.G49D		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CATTCTGCGGCCGCCCATCAG	0.657																																					p.G49D	GBM(60;420 1056 13605 22380 47675)												.	.			0			c.G146A												47.0	43.0	44.0					12																	101603481		2203	4300	6503	SO:0001583	missense	160728	exon1			CTGCGGCCGCCCA	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.146G>A	12.37:g.101603481C>T	ENSP00000445340:p.Gly49Asp		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_145913	0		0		Missense_Mutation	SNP	ENST00000536262.2	37	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	C	30	5.050997	0.93740	.	.	ENSG00000256870	ENST00000536262	D	0.91894	-2.93	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.94673	0.8282	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93036	0.6453	10	0.32370	T	0.25	.	19.8575	0.96767	0.0:1.0:0.0:0.0	.	49	Q8N695	SC5A8_HUMAN	D	49	ENSP00000445340:G49D	ENSP00000445340:G49D	G	-	2	0	SLC5A8	100127612	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.818000	0.86416	2.698000	0.92095	0.561000	0.74099	GGC			0.657	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000409401.1		NM_145913	
ATP12A	479	mdanderson.org	37	13	25283966	25283966	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr13:25283966G>T	ENST00000381946.3	+	19	2930	c.2763G>T	c.(2761-2763)tgG>tgT	p.W921C	ATP12A_ENST00000218548.6_Splice_Site_p.W927C			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	921					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GGCAGGAATGGGTGAGTGGCG	0.542																																					p.W927C	Pancreas(156;1582 1935 18898 22665 26498)												.	.			0			c.G2781T												91.0	89.0	90.0					13																	25283966		2203	4300	6503	SO:0001630	splice_region_variant	479	exon19			GGAATGGGTGAGT	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2763+1G>T	13.37:g.25283966G>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001185085	286	0.00	0	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098501	0.56183	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.88431	-2.38;-2.38	6.03	6.03	0.97812	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.64402	D	0.000001	D	0.94132	0.8118	M	0.87971	2.92	0.80722	D	1	P;P	0.50528	0.936;0.697	P;P	0.55112	0.769;0.517	D	0.94506	0.7714	10	0.87932	D	0	.	18.0604	0.89375	0.0:0.0:1.0:0.0	.	927;921	P54707-2;P54707	.;AT12A_HUMAN	C	927;921	ENSP00000218548:W927C;ENSP00000371372:W921C	ENSP00000218548:W927C	W	+	3	0	ATP12A	24181966	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	9.751000	0.98889	2.854000	0.98071	0.655000	0.94253	TGG			0.542	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044199.1		NM_001676	Missense_Mutation
MTCL1P1	100288130	bcgsc.ca	37	13	71498254	71498254	+	IGR	SNP	C	C	G			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr13:71498254C>G								RNU6-54P (464552 upstream) : LINC00348 (91018 downstream)																							GGCAGTCGGTCTTACTCAGCA	0.602																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100288130	.			GTCGGTCTTACTC																													13.37:g.71498254C>G			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_1	46	0.46	21	.	0		0		RNA	SNP		37																																																																																					0	0.602										
ZBTB1	22890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64989758	64989758	+	Silent	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr14:64989758G>A	ENST00000554015.1	+	4	1967	c.1536G>A	c.(1534-1536)agG>agA	p.R512R	ZBTB1_ENST00000358738.3_Silent_p.R512R|ZBTB1_ENST00000394712.2_Silent_p.R512R|RP11-973N13.4_ENST00000554918.1_RNA			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	512					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		ATGATTTTAGGGACAATCATT	0.383																																					p.R512R													.	.			0			c.G1536A												130.0	132.0	131.0					14																	64989758		2203	4300	6503	SO:0001819	synonymous_variant	22890	exon2			TTTTAGGGACAAT	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1536G>A	14.37:g.64989758G>A			Somatic	67	0	0		WXS	Illumina HiSeq	.	68	0.37	25	NM_014950	21	0.38	8	A8K6S8|Q86SW8	Silent	SNP	ENST00000554015.1	37	CCDS45126.1																																																																																					0.383	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411912.1			
GPR68	8111	broad.mit.edu	37	14	91701361	91701363	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	TCA	TCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr14:91701361_91701363delTCA	ENST00000531499.2	-	2	371_373	c.32_34delTGA	c.(31-36)atgagc>agc	p.M11del	GPR68_ENST00000529300.1_5'Flank|GPR68_ENST00000535815.1_In_Frame_Del_p.M11del|GPR68_ENST00000238699.3_In_Frame_Del_p.M21del			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	11					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		ATGGTACAGCTCATCGAGGAGTT	0.606																																					p.11_12del													.	GPR68	32		0			c.32_34del																																									SO:0001651	inframe_deletion	0	exon2			TACAGCTCATCGA	U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.32_34delTGA	14.37:g.91701361_91701363delTCA	ENSP00000434045:p.Met11del		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	100	0.09	9	NM_001177676	9	0.00	0	Q13334|Q4VBB4|Q6IX34	In_Frame_Del	DEL	ENST00000531499.2	37	CCDS9894.2																																																																																					0.606	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395245.2			
SLC25A47	283600	mdanderson.org	37	14	100789780	100789780	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr14:100789780G>T	ENST00000361529.3	+	1	106		c.e1+1		AL157871.1_ENST00000583404.1_RNA|SLC25A47_ENST00000557052.1_Splice_Site	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						GCCATCGGAGGTAACAGACAG	0.622																																					.	GBM(11;1289 1351)												.	.			0			c.28+1G>T												79.0	68.0	72.0					14																	100789780		2203	4300	6503	SO:0001630	splice_region_variant	283600	exon1			TCGGAGGTAACAG		CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.28+1G>T	14.37:g.100789780G>T			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_207117	0		0	B2RP39|Q68CL2|Q6PZD8|Q86U14	Splice_Site	SNP	ENST00000361529.3	37	CCDS9959.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679593	0.47886	.	.	ENSG00000140107	ENST00000361529	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9781	0.64285	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC25A47	99859533	1.000000	0.71417	0.995000	0.50966	0.626000	0.37791	4.423000	0.59861	2.389000	0.81357	0.655000	0.94253	.			0.622	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414231.1			Intron
HERC2	8924	broad.mit.edu	37	15	28459392	28459392	+	Missense_Mutation	SNP	G	G	A	rs138059246	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr15:28459392G>A	ENST00000261609.7	-	41	6493	c.6385C>T	c.(6385-6387)Cgc>Tgc	p.R2129C		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCCTGCGGGCGCACCCTGCGC	0.667																																					p.R2129C													HERC2,NS,carcinoma,0,1	HERC2	501	1	0			c.C6385T												25.0	26.0	25.0					15																	28459392		2195	4292	6487	SO:0001583	missense	8924	exon41			GCGGGCGCACCCT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6385C>T	15.37:g.28459392G>A	ENSP00000261609:p.Arg2129Cys		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	40	0.13	5	NM_004667	1	0.00	0		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.944883	0.53079	.	.	ENSG00000128731	ENST00000261609	T	0.41400	1.0	4.75	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.53594	0.1806	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.55866	-0.8073	10	0.72032	D	0.01	.	12.4051	0.55434	0.0:0.0:0.7652:0.2348	.	2129	O95714	HERC2_HUMAN	C	2129	ENSP00000261609:R2129C	ENSP00000261609:R2129C	R	-	1	0	HERC2	26132987	1.000000	0.71417	0.956000	0.39512	0.126000	0.20510	3.130000	0.50508	2.461000	0.83175	0.484000	0.47621	CGC			0.667	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251358.2		NM_004667	
RYR3	6263	mdanderson.org	37	15	34145883	34145883	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr15:34145883G>T	ENST00000389232.4	+	96	13869	c.13799G>T	c.(13798-13800)tGg>tTg	p.W4600L	RP11-3D4.3_ENST00000560404.1_RNA|RYR3_ENST00000559917.1_3'UTR|RYR3_ENST00000415757.3_Splice_Site_p.W4595L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4600					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTGGTGTCATGGTACAAAAAG	0.428																																					p.W4600L													RYR3,NS,carcinoma,+1,1	RYR3	1	1	0			c.G13799T												66.0	64.0	65.0					15																	34145883		1849	4091	5940	SO:0001630	splice_region_variant	6263	exon96			TGTCATGGTACAA		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.13799+1G>T	15.37:g.34145883G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001036	0		0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.034388	0.54896	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.91180	-2.8	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.92319	0.7563	L	0.35644	1.08	0.58432	D	0.999992	D;D	0.56521	0.964;0.976	D;P	0.66084	0.941;0.893	D	0.91477	0.5201	10	0.37606	T	0.19	.	18.2221	0.89905	0.0:0.0:1.0:0.0	.	4595;4600	Q15413-2;Q15413	.;RYR3_HUMAN	L	4600;4596	ENSP00000373884:W4600L	ENSP00000354735:W4596L	W	+	2	0	RYR3	31933175	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	7.654000	0.83653	2.609000	0.88269	0.655000	0.94253	TGG			0.428	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000417514.1			Missense_Mutation
CASC5	57082	mdanderson.org	37	15	40911197	40911197	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr15:40911197G>T	ENST00000346991.5	+	10	831	c.441G>T	c.(439-441)atG>atT	p.M147I	CASC5_ENST00000399668.2_Missense_Mutation_p.M121I|CASC5_ENST00000527044.1_Intron			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	147	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ATACCCAGATGCAACAGAAGG	0.333																																					p.M147I													.	.			0			c.G441T												180.0	170.0	173.0					15																	40911197		1875	4098	5973	SO:0001583	missense	57082	exon10			CCAGATGCAACAG	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.441G>T	15.37:g.40911197G>T	ENSP00000335463:p.Met147Ile		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_170589	0		0	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	37	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094956	0.56075	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.44083	0.93;0.93	4.78	3.87	0.44632	.	0.584119	0.17365	N	0.176881	T	0.35799	0.0944	L	0.48642	1.525	0.28879	N	0.894534	B;B;B	0.28933	0.228;0.228;0.008	B;B;B	0.26969	0.075;0.075;0.007	T	0.31336	-0.9947	10	0.46703	T	0.11	.	11.5064	0.50468	0.0828:0.0:0.9172:0.0	.	121;147;121	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	I	147;121;121	ENSP00000335463:M147I;ENSP00000382576:M121I	ENSP00000260369:M121I	M	+	3	0	CASC5	38698489	0.974000	0.33945	1.000000	0.80357	0.871000	0.50021	0.606000	0.24194	1.384000	0.46424	0.557000	0.71058	ATG			0.333	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000390224.2		NM_144508	
HEXA	3073	mdanderson.org	37	15	72643501	72643501	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr15:72643501G>T	ENST00000268097.5	-	6	1148	c.645C>A	c.(643-645)agC>agA	p.S215R	HEXA_ENST00000567159.1_Missense_Mutation_p.S215R|HEXA_ENST00000429918.2_Missense_Mutation_p.S42R|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000457859.2_Missense_Mutation_p.S23R|RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000566304.1_Missense_Mutation_p.S226R	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	215					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						GAAAAGTGAAGCTCTCATATG	0.458																																					p.S215R													.	.			0			c.C645A												167.0	134.0	145.0					15																	72643501		2199	4297	6496	SO:0001583	missense	3073	exon6			AGTGAAGCTCTCA	M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.645C>A	15.37:g.72643501G>T	ENSP00000268097:p.Ser215Arg		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_000520	108	0.00	0	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.718420	0.68844	.	.	ENSG00000213614	ENST00000268097;ENST00000457859;ENST00000429918	D;D;D	0.95821	-3.82;-3.82;-3.82	5.78	1.33	0.21861	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	0.000000	0.85682	D	0.000000	D	0.98292	0.9434	H	0.98446	4.235	0.42390	D	0.992527	D;D;D;D;D	0.89917	1.0;0.987;1.0;0.997;1.0	D;D;D;D;D	0.74674	0.984;0.968;0.984;0.974;0.984	D	0.97346	0.9960	10	0.62326	D	0.03	-25.3838	9.8946	0.41311	0.4648:0.0:0.5352:0.0	.	42;226;42;95;215	E9PGL4;B4DVA7;B4DVL8;Q9BVJ8;P06865	.;.;.;.;HEXA_HUMAN	R	215;23;42	ENSP00000268097:S215R;ENSP00000398026:S23R;ENSP00000416187:S42R	ENSP00000268097:S215R	S	-	3	2	HEXA	70430555	0.996000	0.38824	0.579000	0.28588	0.998000	0.95712	2.393000	0.44442	0.362000	0.24319	0.655000	0.94253	AGC			0.458	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257317.2		NM_000520	
PML	5371	mdanderson.org	37	15	74315527	74315527	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr15:74315527G>T	ENST00000268058.3	+	3	1057	c.961G>T	c.(961-963)Gct>Tct	p.A321S	PML_ENST00000435786.2_Missense_Mutation_p.A321S|PML_ENST00000569477.1_Missense_Mutation_p.A321S|PML_ENST00000395135.3_Missense_Mutation_p.A321S|PML_ENST00000359928.4_Missense_Mutation_p.A321S|PML_ENST00000268059.6_Missense_Mutation_p.A321S|PML_ENST00000565898.1_Missense_Mutation_p.A321S|PML_ENST00000436891.3_Missense_Mutation_p.A321S|PML_ENST00000567543.1_Missense_Mutation_p.A321S|PML_ENST00000569965.1_Missense_Mutation_p.A321S|PML_ENST00000395132.2_Missense_Mutation_p.A321S|PML_ENST00000354026.6_Missense_Mutation_p.A321S|PML_ENST00000563500.1_Missense_Mutation_p.A321S|PML_ENST00000564428.1_Missense_Mutation_p.A321S|PML_ENST00000569161.1_3'UTR	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	321					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CCGCCTGGATGCTGTGCTGCA	0.682			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.A321S				Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	.			0			c.G961T												18.0	23.0	21.0					15																	74315527		2187	4276	6463	SO:0001583	missense	5371	exon3			CTGGATGCTGTGC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.961G>T	15.37:g.74315527G>T	ENSP00000268058:p.Ala321Ser		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_033249	21	0.00	0	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	37	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.473551	0.26423	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	T	0.46451	0.87	5.06	-0.813	0.10850	.	0.677280	0.13881	N	0.356333	T	0.44519	0.1297	L	0.54323	1.7	0.09310	N	1	P;B;P;P;P;B;P;P;P;P;P;D;P	0.57571	0.947;0.304;0.914;0.796;0.796;0.313;0.793;0.89;0.951;0.951;0.525;0.98;0.86	P;B;P;B;B;B;B;P;P;P;B;P;B	0.56088	0.701;0.068;0.541;0.326;0.326;0.216;0.354;0.602;0.613;0.613;0.164;0.791;0.306	T	0.30679	-0.9970	10	0.34782	T	0.22	-5.5019	5.6445	0.17582	0.342:0.0:0.5257:0.1323	.	321;271;321;321;321;321;321;321;321;321;321;321;324	P29590-3;Q59GQ8;P29590;P29590-11;P29590-12;P29590-5;E9PBR7;P29590-13;P29590-4;P29590-2;P29590-14;P29590-8;Q59H09	.;.;PML_HUMAN;.;.;.;.;.;.;.;.;.;.	S	321	ENSP00000268058:A321S	ENSP00000268058:A321S	A	+	1	0	PML	72102580	0.000000	0.05858	0.000000	0.03702	0.658000	0.38924	0.720000	0.25896	-0.044000	0.13491	-0.368000	0.07277	GCT			0.682	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269021.3		NM_002675	
WDR24	84219	mdanderson.org	37	16	735454	735454	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:735454C>T	ENST00000248142.6	-	11	2211	c.2212G>A	c.(2212-2214)Gcc>Acc	p.A738T	JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000562111.1_5'Flank|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000609261.1_5'Flank|JMJD8_ENST00000454700.1_5'Flank|WDR24_ENST00000293883.4_Missense_Mutation_p.A608T			Q96S15	WDR24_HUMAN	WD repeat domain 24	738										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				TCCACGGGGGCCAGGGAGGCC	0.701																																					p.A608T													.	.			0			c.G1822A												30.0	38.0	36.0					16																	735454		2199	4294	6493	SO:0001583	missense	84219	exon7			CGGGGGCCAGGGA	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.2212G>A	16.37:g.735454C>T	ENSP00000248142:p.Ala738Thr		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_032259	52	0.00	0	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	ENST00000248142.6	37		.	.	.	.	.	.	.	.	.	.	C	1.829	-0.470204	0.04445	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.76316	-1.01;0.39	4.78	2.66	0.31614	.	0.556807	0.20139	N	0.098401	T	0.42314	0.1197	N	0.01352	-0.895	0.27961	N	0.936757	B	0.02656	0.0	B	0.01281	0.0	T	0.35400	-0.9790	10	0.10111	T	0.7	-4.8384	4.7997	0.13290	0.0:0.6127:0.0:0.3873	.	608	Q96S15-2	.	T	738;608	ENSP00000248142:A738T;ENSP00000293883:A608T	ENSP00000248142:A738T	A	-	1	0	WDR24	675455	1.000000	0.71417	0.002000	0.10522	0.029000	0.11900	3.743000	0.55104	1.235000	0.43724	0.511000	0.50034	GCC			0.701	WDR24-201	KNOWN	basic	protein_coding	protein_coding				NM_032259	
ARHGAP17	55114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24965936	24965936	+	Silent	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:24965936G>A	ENST00000289968.6	-	10	909	c.840C>T	c.(838-840)ggC>ggT	p.G280G	ARHGAP17_ENST00000303665.5_Silent_p.G280G|ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000575975.1_5'Flank	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	280	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CCTCCTTCATGCCTGTCTCCA	0.597																																					p.G280G													.	.			0			c.C840T												117.0	109.0	112.0					16																	24965936		2197	4300	6497	SO:0001819	synonymous_variant	55114	exon10			CTTCATGCCTGTC	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.840C>T	16.37:g.24965936G>A			Somatic	38	0	0		WXS	Illumina HiSeq	.	32	0.38	12	NM_001006634	14	0.00	0	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Silent	SNP	ENST00000289968.6	37	CCDS32409.1																																																																																					0.597	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436548.3		NM_018054	
RRN3P2	653390	broad.mit.edu	37	16	29102416	29102416	+	RNA	DEL	A	A	-			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:29102416delA	ENST00000564580.1	+	0	750							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		tataaaaaataaaaaaaaaaa	0.507																																					.													.	.			0			.																																											0	.			AAAAATAAAAAAA			16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29102416delA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0		RNA	DEL	ENST00000564580.1	37																																																																																						0.507	RRN3P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000433243.1		NR_003369	
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31371099	31371099	+	Missense_Mutation	SNP	T	T	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:31371099T>A	ENST00000268296.4	+	6	630	c.509T>A	c.(508-510)aTg>aAg	p.M170K	ITGAX_ENST00000562522.1_Missense_Mutation_p.M170K	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	170	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TTTGCCACGATGATGAACTTC	0.597																																					p.M170K													.	.			0			c.T509A												90.0	78.0	82.0					16																	31371099		2197	4300	6497	SO:0001583	missense	3687	exon6			CCACGATGATGAA	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.509T>A	16.37:g.31371099T>A	ENSP00000268296:p.Met170Lys		Somatic	67	0	0		WXS	Illumina HiSeq	.	65	0.28	18	NM_000887	0		0	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	T	17.60	3.430798	0.62844	.	.	ENSG00000140678	ENST00000268296	D	0.83755	-1.76	4.82	4.82	0.62117	von Willebrand factor, type A (3);	.	.	.	.	D	0.92182	0.7521	M	0.92026	3.265	0.42367	D	0.992432	D	0.89917	1.0	D	0.97110	1.0	D	0.93689	0.7005	9	0.87932	D	0	.	12.1961	0.54298	0.0:0.0:0.0:1.0	.	170	P20702	ITAX_HUMAN	K	170	ENSP00000268296:M170K	ENSP00000268296:M170K	M	+	2	0	ITGAX	31278600	1.000000	0.71417	0.257000	0.24404	0.033000	0.12548	2.826000	0.48104	1.928000	0.55862	0.383000	0.25322	ATG			0.597	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255628.2		NM_000887	
EDC4	23644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67911669	67911669	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:67911669T>C	ENST00000358933.5	+	7	1054	c.815T>C	c.(814-816)cTc>cCc	p.L272P	EDC4_ENST00000574770.1_3'UTR|AC040162.1_ENST00000408599.1_RNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	272				ML -> IV (in Ref. 1; AAA21833). {ECO:0000305}.	exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CTGGACATGCTCCGCTCCAGC	0.587																																					p.L272P													.	.			0			c.T815C												114.0	81.0	92.0					16																	67911669		2198	4300	6498	SO:0001583	missense	23644	exon7			ACATGCTCCGCTC	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.815T>C	16.37:g.67911669T>C	ENSP00000351811:p.Leu272Pro		Somatic	110	0	0		WXS	Illumina HiSeq	.	163	0.20	33	NM_014329	12	0.33	4	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.940773	0.73557	.	.	ENSG00000038358	ENST00000358933;ENST00000536072	T	0.55930	0.49	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.069481	0.64402	D	0.000017	T	0.49712	0.1573	N	0.24115	0.695	0.80722	D	1	D;D	0.56521	0.976;0.976	P;P	0.51016	0.556;0.656	T	0.51756	-0.8665	10	0.46703	T	0.11	-13.2812	15.2043	0.73165	0.0:0.0:0.0:1.0	.	204;272	B7Z7V8;Q6P2E9	.;EDC4_HUMAN	P	272;204	ENSP00000351811:L272P	ENSP00000351811:L272P	L	+	2	0	EDC4	66469170	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.636000	0.83301	2.089000	0.63090	0.379000	0.24179	CTC			0.587	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268874.2		NM_014329	
VPS4A	27183	mdanderson.org	37	16	69352745	69352745	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:69352745G>T	ENST00000254950.11	+	5	519	c.363G>T	c.(361-363)aaG>aaT	p.K121N	RP11-343C2.11_ENST00000570054.2_Missense_Mutation_p.K145N|COG8_ENST00000564419.1_5'Flank	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				TGATGGAGAAGCCCAACATAC	0.642																																					p.K121N													.	.			0			c.G363T												101.0	111.0	108.0					16																	69352745		1898	4117	6015	SO:0001583	missense	27183	exon5			GGAGAAGCCCAAC	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.363G>T	16.37:g.69352745G>T	ENSP00000254950:p.Lys121Asn		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_013245	149	0.00	0		Missense_Mutation	SNP	ENST00000254950.11	37	CCDS45517.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388552	0.61956	.	.	ENSG00000132612	ENST00000254950	D	0.95554	-3.74	6.17	3.19	0.36642	.	0.089293	0.85682	D	0.000000	D	0.92182	0.7521	L	0.42245	1.32	0.80722	D	1	B	0.16166	0.016	B	0.24974	0.057	D	0.86588	0.1858	10	0.37606	T	0.19	-34.0134	11.1425	0.48411	0.1954:0.0:0.8046:0.0	.	121	Q9UN37	VPS4A_HUMAN	N	121	ENSP00000254950:K121N	ENSP00000254950:K121N	K	+	3	2	VPS4A	67910246	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.536000	0.45693	0.494000	0.27859	0.655000	0.94253	AAG			0.642	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430563.3		NM_013245	
COG8	84342	mdanderson.org	37	16	69369198	69369198	+	Silent	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:69369198G>T	ENST00000306875.4	-	3	753	c.639C>A	c.(637-639)atC>atA	p.I213I	COG8_ENST00000562081.1_Silent_p.I213I|RP11-343C2.9_ENST00000563634.1_Silent_p.I88I|RP11-343C2.12_ENST00000562949.1_5'Flank	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	213					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						TCAGTTGCTGGATCAGCTGGC	0.572																																					p.I213I													.	.			0			c.C639A												61.0	40.0	47.0					16																	69369198		2198	4300	6498	SO:0001819	synonymous_variant	84342	exon3			TTGCTGGATCAGC	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.639C>A	16.37:g.69369198G>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_032382	32	0.00	0	Q0VAK2|Q8WVV6|Q9H6F8	Silent	SNP	ENST00000306875.4	37	CCDS10876.1																																																																																					0.572	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268948.2		NM_032382	
DHODH	1723	mdanderson.org	37	16	72057134	72057134	+	Missense_Mutation	SNP	G	G	T	rs200181357		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr16:72057134G>T	ENST00000219240.4	+	7	911	c.890G>T	c.(889-891)cGc>cTc	p.R297L	DHODH_ENST00000573922.1_3'UTR|DHODH_ENST00000572887.1_Missense_Mutation_p.R297L	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	297					'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	GGTGCCCTGCGCTCTGAAACA	0.562																																					p.R297L													DHODH,NS,carcinoma,+1,1	DHODH	1	1	0			c.G890T												44.0	45.0	45.0					16																	72057134		1923	4135	6058	SO:0001583	missense	1723	exon7			CCCTGCGCTCTGA		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.890G>T	16.37:g.72057134G>T	ENSP00000219240:p.Arg297Leu		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001361	21	0.00	0	A8K8C8|Q6P176	Missense_Mutation	SNP	ENST00000219240.4	37	CCDS42192.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241768	0.58995	.	.	ENSG00000102967	ENST00000219240	D	0.85171	-1.95	5.59	4.62	0.57501	Aldolase-type TIM barrel (1);	0.391760	0.29775	N	0.011234	T	0.76506	0.3997	L	0.31371	0.925	0.47308	D	0.999385	B	0.24651	0.108	B	0.25614	0.062	T	0.72134	-0.4382	10	0.39692	T	0.17	-0.3484	10.1455	0.42760	0.0712:0.1378:0.791:0.0	.	297	Q02127	PYRD_HUMAN	L	297	ENSP00000219240:R297L	ENSP00000219240:R297L	R	+	2	0	DHODH	70614635	0.967000	0.33354	1.000000	0.80357	0.904000	0.53231	2.880000	0.48530	1.458000	0.47871	0.561000	0.74099	CGC			0.562	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_001361	
DNAH2	146754	mdanderson.org	37	17	7689596	7689596	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr17:7689596G>A	ENST00000572933.1	+	40	7744	c.6284G>A	c.(6283-6285)cGc>cAc	p.R2095H	DNAH2_ENST00000389173.2_Missense_Mutation_p.R2095H			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2095	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCCTCATGGCGCATTCTACAG	0.577																																					p.R2095H													.	.			0			c.G6284A												63.0	59.0	61.0					17																	7689596		2203	4300	6503	SO:0001583	missense	146754	exon39			CATGGCGCATTCT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6284G>A	17.37:g.7689596G>A	ENSP00000458355:p.Arg2095His		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_020877	0		0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342002	0.41498	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.47528	0.84	5.44	2.33	0.28932	ATPase, dynein-related, AAA domain (1);	0.211149	0.37178	N	0.002205	T	0.40067	0.1102	L	0.53561	1.675	0.45914	D	0.998751	B	0.33807	0.426	B	0.34346	0.18	T	0.12319	-1.0552	10	0.27082	T	0.32	.	10.3688	0.44042	0.2203:0.0:0.7797:0.0	.	2095	Q9P225	DYH2_HUMAN	H	2095	ENSP00000373825:R2095H	ENSP00000353818:R2095H	R	+	2	0	DNAH2	7630321	0.928000	0.31464	0.033000	0.17914	0.524000	0.34500	1.538000	0.36094	0.402000	0.25451	0.655000	0.94253	CGC			0.577	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440241.1		NM_020877	
ITGA2B	3674	broad.mit.edu	37	17	42460925	42460925	+	Missense_Mutation	SNP	C	C	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr17:42460925C>A	ENST00000262407.5	-	12	1177	c.1146G>T	c.(1144-1146)caG>caT	p.Q382H	ITGA2B_ENST00000353281.4_Missense_Mutation_p.Q382H|ITGA2B_ENST00000377068.3_Missense_Mutation_p.Q67H	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	382					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GCCCATAGAGCTGTGTGCCAG	0.647																																					p.Q382H													.	ITGA2B	88		0			c.G1146T												24.0	22.0	22.0					17																	42460925		2202	4299	6501	SO:0001583	missense	3674	exon12			ATAGAGCTGTGTG		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.1146G>T	17.37:g.42460925C>A	ENSP00000262407:p.Gln382His		Somatic	52	0.0192307692	1		WXS	Illumina HiSeq	Phase_I	62	0.10	6	NM_000419	6	0.00	0	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	37	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253429	0.59212	.	.	ENSG00000005961	ENST00000262407;ENST00000353281;ENST00000377068	T;T;T	0.71579	-0.58;-0.58;-0.58	5.8	3.79	0.43588	.	0.533626	0.13983	N	0.349375	T	0.66416	0.2787	M	0.77486	2.375	0.35140	D	0.768752	P	0.48230	0.907	B	0.39465	0.3	T	0.75712	-0.3222	10	0.72032	D	0.01	.	5.0424	0.14465	0.1478:0.6213:0.0:0.2309	.	382	P08514	ITA2B_HUMAN	H	382;382;67	ENSP00000262407:Q382H;ENSP00000340536:Q382H;ENSP00000366268:Q67H	ENSP00000262407:Q382H	Q	-	3	2	ITGA2B	39816451	0.000000	0.05858	0.997000	0.53966	0.996000	0.88848	-0.708000	0.05035	1.442000	0.47568	0.561000	0.74099	CAG			0.647	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439823.1			
NFE2L1	4779	bcgsc.ca;mdanderson.org	37	17	46136684	46136684	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr17:46136684C>T	ENST00000362042.3	+	6	2616	c.2000C>T	c.(1999-2001)gCg>gTg	p.A667V	NFE2L1_ENST00000583378.1_Missense_Mutation_p.A468V|RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000536222.1_Missense_Mutation_p.A511V|NFE2L1_ENST00000357480.5_Missense_Mutation_p.A637V|NFE2L1_ENST00000585291.1_Missense_Mutation_p.A637V|NFE2L1_ENST00000361665.3_Missense_Mutation_p.A656V|NFE2L1_ENST00000582155.1_Missense_Mutation_p.A479V	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	667	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AACAAGATGGCGGCGCAGAAC	0.592																																					p.A667V													.	NFE2L1	60		0			c.C2000T												44.0	44.0	44.0					17																	46136684		2203	4300	6503	SO:0001583	missense	4779	exon6			AGATGGCGGCGCA	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.2000C>T	17.37:g.46136684C>T	ENSP00000354855:p.Ala667Val		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_1	74	0.07	5	NM_003204	398	0.00	0	D3DTU3|D3DTU5|Q12877|Q96FN6	Missense_Mutation	SNP	ENST00000362042.3	37	CCDS11524.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728385	0.89390	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	D;D	0.92752	-3.1;-3.1	5.89	5.89	0.94794	Basic-leucine zipper (bZIP) transcription factor (3);Eukaryotic transcription factor, Skn-1-like, DNA-binding (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	D	0.97084	0.9047	M	0.91717	3.235	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.997;0.999	D	0.97417	1.0006	10	0.87932	D	0	-25.3159	19.0276	0.92939	0.0:1.0:0.0:0.0	.	511;479;637;667	F5H1B7;B4DYE1;Q14494-2;Q14494	.;.;.;NF2L1_HUMAN	V	686;667;637;511	ENSP00000350072:A637V;ENSP00000445811:A511V	ENSP00000350072:A637V	A	+	2	0	NFE2L1	43491683	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	7.770000	0.85390	2.797000	0.96272	0.563000	0.77884	GCG			0.592	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443019.1		NM_003204	
GIP	2695	broad.mit.edu	37	17	47039146	47039146	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr17:47039146G>T	ENST00000357424.2	-	4	393	c.293C>A	c.(292-294)gCg>gAg	p.A98E		NM_004123.2	NP_004114.1	P09681	GIP_HUMAN	gastric inhibitory polypeptide	98					adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|digestive system development (GO:0055123)|endocrine pancreas development (GO:0031018)|exploration behavior (GO:0035640)|female pregnancy (GO:0007565)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of glucagon secretion (GO:0070094)|positive regulation of glucose transport (GO:0010828)|positive regulation of insulin secretion (GO:0032024)|regulation of insulin secretion (GO:0050796)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to lipid (GO:0033993)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|response to selenium ion (GO:0010269)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|secretory granule lumen (GO:0034774)	hormone activity (GO:0005179)			lung(2)|skin(1)|stomach(1)	4						CAGCTCCAGCGCCCGAGCCTC	0.582																																					p.A98E													.	GIP	15		0			c.C293A												42.0	35.0	37.0					17																	47039146		2203	4300	6503	SO:0001583	missense	2695	exon4			TCCAGCGCCCGAG		CCDS11542.1	17q21.3-q22	2013-02-26			ENSG00000159224	ENSG00000159224		"""Endogenous ligands"""	4270	protein-coding gene	gene with protein product	"""glucose-dependent insulinotropic polypeptide"""	137240				2739653	Standard	NM_004123		Approved		uc002iol.1	P09681	OTTHUMG00000161171	ENST00000357424.2:c.293C>A	17.37:g.47039146G>T	ENSP00000350005:p.Ala98Glu		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	60	0.07	4	NM_004123	434	0.00	0	Q4VB42|Q6NTD3	Missense_Mutation	SNP	ENST00000357424.2	37	CCDS11542.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041005	0.55003	.	.	ENSG00000159224	ENST00000357424	T	0.25749	1.78	5.03	1.66	0.24008	.	0.243209	0.29087	N	0.013185	T	0.18257	0.0438	L	0.32530	0.975	0.09310	N	1	P	0.38827	0.649	B	0.40165	0.321	T	0.08889	-1.0700	10	0.38643	T	0.18	-4.6126	7.7403	0.28837	0.0:0.3689:0.4616:0.1695	.	98	P09681	GIP_HUMAN	E	98	ENSP00000350005:A98E	ENSP00000350005:A98E	A	-	2	0	GIP	44394145	0.009000	0.17119	0.003000	0.11579	0.000000	0.00434	1.099000	0.31013	0.661000	0.30985	-0.175000	0.13238	GCG			0.582	GIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364044.1		NM_004123	
TANC2	26115	mdanderson.org	37	17	61489048	61489048	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr17:61489048G>T	ENST00000424789.2	+	20	3547		c.e20+1		TANC2_ENST00000389520.4_Splice_Site|RP11-269G24.3_ENST00000583552.1_RNA|AC015923.1_ENST00000431604.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2						in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						TGCTGAGGTGGTAAGTACCTT	0.498																																					.													.	.			0			c.3543+1G>T												82.0	78.0	80.0					17																	61489048		2002	4172	6174	SO:0001630	splice_region_variant	26115	exon20			GAGGTGGTAAGTA	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.3543+1G>T	17.37:g.61489048G>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_025185	0		0	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Splice_Site	SNP	ENST00000424789.2	37	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991659	0.74703	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2861	0.98535	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TANC2	58842780	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.836000	0.99456	2.786000	0.95864	0.650000	0.86243	.			0.498	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444765.1			Intron
ARSG	22901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	66339927	66339927	+	Missense_Mutation	SNP	T	T	G			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr17:66339927T>G	ENST00000448504.2	+	3	1197	c.401T>G	c.(400-402)aTa>aGa	p.I134R	ARSG_ENST00000452479.2_De_novo_Start_InFrame	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	134					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTCACTGGGATAATAGGTAAC	0.552																																					p.I134R													.	.			0			c.T401G												59.0	41.0	47.0					17																	66339927		2203	4300	6503	SO:0001583	missense	22901	exon3			CTGGGATAATAGG	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.401T>G	17.37:g.66339927T>G	ENSP00000407193:p.Ile134Arg		Somatic	57	0	0		WXS	Illumina HiSeq	.	89	0.20	18	NM_001267727	3	0.00	0	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996338	0.35226	.	.	ENSG00000141337	ENST00000452479	.	.	.	4.56	4.56	0.56223	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase, conserved site (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.138081	0.64402	D	0.000004	T	0.62804	0.2458	M	0.76433	2.335	0.80722	D	1	B	0.20164	0.042	B	0.28991	0.097	T	0.65425	-0.6171	9	0.66056	D	0.02	.	9.7115	0.40247	0.0:0.0848:0.0:0.9152	.	134	Q96EG1	ARSG_HUMAN	R	134	.	ENSP00000413953:I134R	I	+	2	0	ARSG	63851522	1.000000	0.71417	0.979000	0.43373	0.393000	0.30537	4.983000	0.63832	2.034000	0.60081	0.528000	0.53228	ATA			0.552	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448369.1		NM_014960	
UNC13D	201294	mdanderson.org	37	17	73840402	73840402	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr17:73840402G>T	ENST00000207549.4	-	1	396	c.17C>A	c.(16-18)tCc>tAc	p.S6Y	UNC13D_ENST00000587504.1_5'Flank|UNC13D_ENST00000412096.2_Missense_Mutation_p.S6Y	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	6					defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGCGGATGGGAGAGGAGTGT	0.632									Familial Hemophagocytic Lymphohistiocytosis																												p.S6Y													.	.			0			c.C17A												45.0	46.0	45.0					17																	73840402		2201	4299	6500	SO:0001583	missense	201294	exon1	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GGATGGGAGAGGA	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.17C>A	17.37:g.73840402G>T	ENSP00000207549:p.Ser6Tyr		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_199242	5	0.00	0	B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	37	CCDS11730.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358076	0.41801	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.72051	-0.55;-0.62	4.04	4.04	0.47022	.	0.481169	0.17741	N	0.163565	T	0.65637	0.2710	L	0.44542	1.39	0.09310	N	1	P	0.43094	0.799	B	0.43575	0.424	T	0.61973	-0.6952	10	0.66056	D	0.02	0.8921	11.5623	0.50785	0.0:0.0:1.0:0.0	.	6	Q70J99	UN13D_HUMAN	Y	6	ENSP00000207549:S6Y;ENSP00000388093:S6Y	ENSP00000207549:S6Y	S	-	2	0	UNC13D	71351997	0.049000	0.20398	0.025000	0.17156	0.197000	0.23852	1.240000	0.32731	2.098000	0.63641	0.561000	0.74099	TCC			0.632	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448847.2		XM_113950	
SMARCA4	6597	hgsc.bcm.edu	37	19	11144829	11144829	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr19:11144829G>T	ENST00000429416.3	+	29	4185	c.3904G>T	c.(3904-3906)Gtc>Ttc	p.V1302F	SMARCA4_ENST00000590574.1_Missense_Mutation_p.V1269F|SMARCA4_ENST00000450717.3_Missense_Mutation_p.V1269F|SMARCA4_ENST00000541122.2_Missense_Mutation_p.V1269F|SMARCA4_ENST00000589677.1_Missense_Mutation_p.V1269F|SMARCA4_ENST00000444061.3_Missense_Mutation_p.V1269F|SMARCA4_ENST00000358026.2_Missense_Mutation_p.V1302F|SMARCA4_ENST00000413806.3_Missense_Mutation_p.V1269F|SMARCA4_ENST00000344626.4_Missense_Mutation_p.V1302F|SMARCA4_ENST00000538456.3_3'UTR	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1302					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CGACGAGACCGTCAACCAGAT	0.627			"""F, N, Mis"""		NSCLC																																p.V1302F				Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	.			1	Unknown(1)	lung(1)	c.G3904T												126.0	105.0	112.0					19																	11144829		2203	4300	6503	SO:0001583	missense	6597	exon28			GAGACCGTCAACC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3904G>T	19.37:g.11144829G>T	ENSP00000395654:p.Val1302Phe		Somatic	79	0	0		WXS	Illumina HiSeq	.	84	0.05	4	NM_003072	487	0.00	0	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.405642|4.405642	0.83230|0.83230	.|.	.|.	ENSG00000127616|ENSG00000127616	ENST00000538456|ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.|D;D;D;D;D;D;D	.|0.96104	.|-2.28;-2.25;-2.28;-3.91;-3.91;-3.91;-3.91	4.64|4.64	4.64|4.64	0.57946|0.57946	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.97420|0.97420	0.9156|0.9156	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;P;D	.|0.64830	.|0.987;0.987;0.987;0.994;0.987;0.875;0.987	.|P;P;P;D;P;B;P	.|0.69824	.|0.898;0.898;0.898;0.966;0.808;0.43;0.898	D|D	0.98128|0.98128	1.0429|1.0429	5|10	.|0.87932	.|D	.|0	-51.7476|-51.7476	16.4262|16.4262	0.83815|0.83815	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1269;1269;1269;1302;1269;489;1302	.|B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.|.;.;.;.;.;.;SMCA4_HUMAN	L|F	38|1302;1302;1333;1302;1269;1269;1269;1269	.|ENSP00000395654:V1302F;ENSP00000350720:V1302F;ENSP00000343896:V1302F;ENSP00000445036:V1269F;ENSP00000392837:V1269F;ENSP00000397783:V1269F;ENSP00000414727:V1269F	.|ENSP00000343896:V1302F	R|V	+|+	2|1	0|0	SMARCA4|SMARCA4	11005829|11005829	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.962000|0.962000	0.63368|0.63368	3.651000|3.651000	0.54431|0.54431	2.423000|2.423000	0.82170|0.82170	0.462000|0.462000	0.41574|0.41574	CGT|GTC			0.627	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000452638.2		NM_003072	
ILVBL	10994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15233609	15233609	+	Missense_Mutation	SNP	A	A	C			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr19:15233609A>C	ENST00000263383.3	-	6	750	c.611T>G	c.(610-612)gTg>gGg	p.V204G	ILVBL_ENST00000531635.1_5'UTR|AC003956.1_ENST00000598450.1_RNA|ILVBL_ENST00000534378.1_Missense_Mutation_p.V97G	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	204						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						CTCCACAAACACCGGACCTGC	0.632																																					p.V204G													.	.			0			c.T611G												90.0	79.0	83.0					19																	15233609		2203	4300	6503	SO:0001583	missense	10994	exon6			ACAAACACCGGAC	U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.611T>G	19.37:g.15233609A>C	ENSP00000263383:p.Val204Gly		Somatic	86	0	0		WXS	Illumina HiSeq	.	87	0.30	26	NM_006844	121	0.35	42	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Missense_Mutation	SNP	ENST00000263383.3	37	CCDS12325.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.627900	0.46944	.	.	ENSG00000105135	ENST00000263383;ENST00000527093	T	0.66280	-0.2	4.36	4.36	0.52297	Thiamine pyrophosphate enzyme, N-terminal TPP-binding domain (1);	0.062227	0.64402	D	0.000005	D	0.85461	0.5702	H	0.99169	4.455	0.80722	D	1	D	0.56746	0.977	P	0.61722	0.893	D	0.90163	0.4229	10	0.87932	D	0	-23.1508	11.5444	0.50685	1.0:0.0:0.0:0.0	.	204	A1L0T0	ILVBL_HUMAN	G	204	ENSP00000263383:V204G	ENSP00000263383:V204G	V	-	2	0	ILVBL	15094609	1.000000	0.71417	0.965000	0.40720	0.274000	0.26718	8.630000	0.90987	1.844000	0.53588	0.459000	0.35465	GTG			0.632	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385439.1		NM_006844	
ANO8	57719	mdanderson.org	37	19	17439209	17439209	+	Missense_Mutation	SNP	G	G	T	rs202118586		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr19:17439209G>T	ENST00000159087.4	-	13	2146	c.1988C>A	c.(1987-1989)gCg>gAg	p.A663E		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	663	Glu-rich.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						AGCCCCCTCCGCCTCGTCGTC	0.756																																					p.A663E													.	.			0			c.C1988A												4.0	4.0	4.0					19																	17439209		1970	3908	5878	SO:0001583	missense	57719	exon13			CCCTCCGCCTCGT	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.1988C>A	19.37:g.17439209G>T	ENSP00000159087:p.Ala663Glu		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_020959	6	0.00	0	A6NIJ0	Missense_Mutation	SNP	ENST00000159087.4	37	CCDS32949.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359170	0.41801	.	.	ENSG00000074855	ENST00000159087	T	0.61859	0.07	4.73	3.62	0.41486	.	0.560794	0.18913	N	0.127686	T	0.42877	0.1222	L	0.40543	1.245	0.20196	N	0.999924	B	0.13145	0.007	B	0.15870	0.014	T	0.24941	-1.0146	10	0.30078	T	0.28	.	5.1303	0.14907	0.1203:0.0:0.6838:0.196	.	663	Q9HCE9	ANO8_HUMAN	E	663	ENSP00000159087:A663E	ENSP00000159087:A663E	A	-	2	0	ANO8	17300209	0.007000	0.16637	0.374000	0.26016	0.805000	0.45488	0.476000	0.22180	0.859000	0.35456	0.313000	0.20887	GCG			0.756	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462943.1		XM_050644	
CTC-260E6.6	0	broad.mit.edu	37	19	20317771	20317772	+	RNA	INS	-	-	AC	rs60397012|rs199677845|rs58676761|rs71172573|rs71340320	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr19:20317771_20317772insAC	ENST00000585498.1	-	0	173				CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA																							TGGTTCCTGAAacacacacaca	0.406														1145	0.228634	0.1815	0.2522	5008	,	,		12007	0.1994		0.2843	False		,,,				2504	0.2485				.													.	.			0			.																																											0	.			TCCTGAAACACAC																													19.37:g.20317780_20317781dupAC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	13	0.31	4	.	0		0		RNA	INS	ENST00000585498.1	37																																																																																						0.406	CTC-260E6.6-003	KNOWN	basic	antisense	antisense		OTTHUMT00000452861.1			
MEGF8	1954	mdanderson.org	37	19	42872801	42872801	+	Silent	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr19:42872801C>T	ENST00000251268.6	+	36	6468	c.6468C>T	c.(6466-6468)agC>agT	p.S2156S	MEGF8_ENST00000378073.4_5'Flank|MEGF8_ENST00000334370.4_Silent_p.S2089S	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2156	PSI 7.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GTGGACTCAGCGGCCCCCGTG	0.672																																					p.S2156S													.	.			0			c.C6468T												6.0	8.0	8.0					19																	42872801		2169	4250	6419	SO:0001819	synonymous_variant	1954	exon36			ACTCAGCGGCCCC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6468C>T	19.37:g.42872801C>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001271938	0		0	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																						0.672	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
C2orf16	84226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27804669	27804669	+	Missense_Mutation	SNP	A	A	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:27804669A>T	ENST00000408964.2	+	1	5281	c.5230A>T	c.(5230-5232)Agt>Tgt	p.S1744C	ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000556601.1_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000379717.1_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1744	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AAGCCATCACAGTCCCTCTGA	0.557																																					p.S1744C													.	.			0			c.A5230T												193.0	197.0	196.0					2																	27804669		1920	4140	6060	SO:0001583	missense	84226	exon1			CATCACAGTCCCT	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.5230A>T	2.37:g.27804669A>T	ENSP00000386190:p.Ser1744Cys		Somatic	73	0	0		WXS	Illumina HiSeq	.	98	0.32	31	NM_032266	0		0	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	A	14.57	2.575206	0.45902	.	.	ENSG00000221843	ENST00000408964	T	0.05855	3.38	3.63	0.0672	0.14365	.	.	.	.	.	T	0.16428	0.0395	M	0.65498	2.005	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.13045	-1.0524	9	0.72032	D	0.01	.	2.9709	0.05923	0.4745:0.0:0.3298:0.1957	.	1744	Q68DN1	CB016_HUMAN	C	1744	ENSP00000386190:S1744C	ENSP00000386190:S1744C	S	+	1	0	C2orf16	27658173	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.244000	0.08903	-0.004000	0.14419	0.379000	0.24179	AGT			0.557	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353292.1		NM_032266	
C2orf81	388963	broad.mit.edu	37	2	74642300	74642300	+	Missense_Mutation	SNP	T	T	G			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:74642300T>G	ENST00000517883.1	-	1	1410	c.719A>C	c.(718-720)tAc>tCc	p.Y240S	C2orf81_ENST00000290390.5_Missense_Mutation_p.Y308S			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	301										endometrium(3)|kidney(1)	4						CACAGAGGGGTAGGACACCAA	0.701																																					p.Y308S													.	C2orf81	23		0			c.A923C												14.0	17.0	16.0					2																	74642300		692	1591	2283	SO:0001583	missense	388963	exon4			GAGGGGTAGGACA	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.719A>C	2.37:g.74642300T>G	ENSP00000431103:p.Tyr240Ser		Somatic	90	0.2333333333	21		WXS	Illumina HiSeq	Phase_I	137	0.31	43	NM_001145054	5	0.00	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	7.689	0.690570	0.15039	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.2	-6.96	0.01622	.	3.498430	0.00812	N	0.001503	T	0.07188	0.0182	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21348	-1.0248	9	0.07644	T	0.81	15.6135	1.7949	0.03059	0.2041:0.1456:0.1479:0.5023	.	308	G3XAA6	.	S	240;308	.	ENSP00000290390:Y308S	Y	-	2	0	C2orf81	74495808	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.430000	0.06973	-1.385000	0.02101	-0.712000	0.03635	TAC			0.701	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000377683.1		NM_001145054	
RGPD4	285190	ucsc.edu	37	2	108487826	108487826	+	Silent	SNP	C	C	T	rs2556258	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:108487826C>T	ENST00000408999.3	+	20	3443	c.3366C>T	c.(3364-3366)ccC>ccT	p.P1122P	RGPD4_ENST00000354986.4_Silent_p.P1122P	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1122	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						ACCTGAAGCCCCTGTCTGGAT	0.438													N|||	1974	0.394169	0.4145	0.3199	5008	,	,		10220	0.1458		0.5437	False		,,,				2504	0.5215				p.P1122P													.	RGPD4	112		0			c.C3366T												7.0	6.0	6.0					2																	108487826		280	760	1040	SO:0001819	synonymous_variant	285190	exon20			GAAGCCCCTGTCT	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3366C>T	2.37:g.108487826C>T			Somatic	15	0.1333333333	2		WXS	Illumina HiSeq		13	0.31	4	NM_182588	0		0	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																					0.438	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330096.2		XM_496581	
RGPD4	285190	ucsc.edu	37	2	108487829	108487829	+	Silent	SNP	G	G	C	rs141407602	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:108487829G>C	ENST00000408999.3	+	20	3446	c.3369G>C	c.(3367-3369)ctG>ctC	p.L1123L	RGPD4_ENST00000354986.4_Silent_p.L1123L	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1123	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGAAGCCCCTGTCTGGATCAG	0.448													N|||	2210	0.441294	0.6142	0.3199	5008	,	,		9963	0.1319		0.5358	False		,,,				2504	0.5153				p.L1123L													.	RGPD4	112		0			c.G3369C												7.0	7.0	7.0					2																	108487829		280	762	1042	SO:0001819	synonymous_variant	285190	exon20			GCCCCTGTCTGGA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3369G>C	2.37:g.108487829G>C			Somatic	16	0.125	2		WXS	Illumina HiSeq		13	0.31	4	NM_182588	0		0	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																					0.448	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330096.2		XM_496581	
CSRNP3	80034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	166514444	166514444	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:166514444G>A	ENST00000342316.4	+	3	594	c.322G>A	c.(322-324)Gag>Aag	p.E108K	CSRNP3_ENST00000314499.7_Missense_Mutation_p.E108K|CSRNP3_ENST00000409420.1_Missense_Mutation_p.E140K	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	108					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CACTCTTGGCGAGTTTGCAAG	0.532																																					p.E108K													CSRNP3,NS,carcinoma,0,1	CSRNP3	0	1	0			c.G322A												58.0	50.0	53.0					2																	166514444		2203	4300	6503	SO:0001583	missense	80034	exon5			CTTGGCGAGTTTG	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.322G>A	2.37:g.166514444G>A	ENSP00000344042:p.Glu108Lys		Somatic	154	0	0		WXS	Illumina HiSeq	.	168	0.39	65	NM_001172173	0		0	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	37	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	G	36	5.619415	0.96649	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000409664;ENST00000342316;ENST00000409420	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.48840	0.1522	M	0.84948	2.725	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.52177	-0.8610	10	0.52906	T	0.07	-15.1981	19.2442	0.93895	0.0:0.0:1.0:0.0	.	108	Q8WYN3	CSRN3_HUMAN	K	108;115;108;108;108;140	ENSP00000412081:E108K;ENSP00000318258:E108K;ENSP00000386278:E108K;ENSP00000344042:E108K;ENSP00000387195:E140K	ENSP00000318258:E108K	E	+	1	0	CSRNP3	166222690	1.000000	0.71417	0.956000	0.39512	0.917000	0.54804	9.813000	0.99286	2.544000	0.85801	0.563000	0.77884	GAG			0.532	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255191.2		NM_024969	
FAM117B	150864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	203591019	203591019	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:203591019G>A	ENST00000392238.2	+	4	893	c.893G>A	c.(892-894)cGg>cAg	p.R298Q	FAM117B_ENST00000303116.6_Missense_Mutation_p.R54Q			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	298										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						CACAGCAGTCGGCATCATCGA	0.398																																					p.R298Q													.	.			0			c.G893A												161.0	151.0	154.0					2																	203591019		2203	4300	6503	SO:0001583	missense	150864	exon4			GCAGTCGGCATCA	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.893G>A	2.37:g.203591019G>A	ENSP00000376071:p.Arg298Gln		Somatic	242	0	0		WXS	Illumina HiSeq	.	232	0.41	96	NM_173511	1	1.00	1	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Missense_Mutation	SNP	ENST00000392238.2	37	CCDS33362.2	.	.	.	.	.	.	.	.	.	.	G	34	5.336758	0.95758	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.71	5.71	0.89125	.	0.102535	0.64402	D	0.000006	T	0.76786	0.4036	L	0.55990	1.75	0.51767	D	0.999935	D	0.89917	1.0	D	0.83275	0.996	T	0.74893	-0.3509	9	0.45353	T	0.12	-15.6943	19.4656	0.94935	0.0:0.0:1.0:0.0	.	298	Q6P1L5	F117B_HUMAN	Q	54;298	.	ENSP00000306299:R54Q	R	+	2	0	FAM117B	203299264	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	8.451000	0.90343	2.691000	0.91804	0.563000	0.77884	CGG			0.398	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000335888.3		NM_173511	
VIL1	7429	mdanderson.org	37	2	219301338	219301338	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:219301338G>T	ENST00000248444.5	+	16	2048	c.1960G>T	c.(1960-1962)Gtc>Ttc	p.V654F	VIL1_ENST00000392114.2_Missense_Mutation_p.V343F	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	654	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTACTAGATGTCTGGGACCA	0.532																																					p.V654F													.	.			0			c.G1960T												106.0	109.0	108.0					2																	219301338		2203	4300	6503	SO:0001583	missense	7429	exon16			CTAGATGTCTGGG	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1960G>T	2.37:g.219301338G>T	ENSP00000248444:p.Val654Phe		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	89	0.06	5	NM_007127	1	0.00	0	B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	ENST00000248444.5	37	CCDS2417.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862437	0.71949	.	.	ENSG00000127831	ENST00000248444;ENST00000392114	T;T	0.21932	1.98;1.98	5.36	4.49	0.54785	Gelsolin domain (1);	0.546765	0.17960	N	0.156215	T	0.23965	0.0580	L	0.34521	1.04	0.80722	D	1	P	0.34699	0.464	B	0.43889	0.435	T	0.06215	-1.0839	10	0.87932	D	0	-22.2071	11.4867	0.50358	0.1498:0.0:0.8502:0.0	.	654	P09327	VILI_HUMAN	F	654;343	ENSP00000248444:V654F;ENSP00000375962:V343F	ENSP00000248444:V654F	V	+	1	0	VIL1	219009582	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	2.820000	0.48057	1.398000	0.46701	0.655000	0.94253	GTC			0.532	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256778.3		NM_007127	
COL4A4	1286	mdanderson.org	37	2	227983443	227983443	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr2:227983443G>T	ENST00000396625.3	-	7	614	c.407C>A	c.(406-408)cCt>cAt	p.P136H	COL4A4_ENST00000329662.7_Missense_Mutation_p.P136H	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	136	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ACTCATACCAGGTTTGCCTCT	0.498																																					p.P136H													.	.			0			c.C407A												65.0	65.0	65.0					2																	227983443		1837	4083	5920	SO:0001583	missense	1286	exon7			ATACCAGGTTTGC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.407C>A	2.37:g.227983443G>T	ENSP00000379866:p.Pro136His		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_000092	1	0.00	0	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316730	0.60524	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.96774	-4.12;-4.12	5.44	5.44	0.79542	.	.	.	.	.	D	0.96546	0.8873	M	0.88704	2.975	0.47905	D	0.999543	P	0.47604	0.898	B	0.42138	0.377	D	0.96924	0.9676	9	0.56958	D	0.05	.	15.6466	0.77061	0.0:0.0:0.8624:0.1376	.	136	P53420	CO4A4_HUMAN	H	136	ENSP00000379866:P136H;ENSP00000328553:P136H	ENSP00000328553:P136H	P	-	2	0	COL4A4	227691687	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	1.082000	0.30803	2.538000	0.85594	0.655000	0.94253	CCT			0.498	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000313770.1		NM_000092	
C20orf27	54976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3739195	3739195	+	Missense_Mutation	SNP	G	G	C			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr20:3739195G>C	ENST00000379772.3	-	3	960	c.150C>G	c.(148-150)agC>agG	p.S50R	C20orf27_ENST00000217195.8_Missense_Mutation_p.S75R	NM_001258429.1	NP_001245358.1	Q9GZN8	CT027_HUMAN	chromosome 20 open reading frame 27	50										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	7						TGACCAGAAAGCTGCTGTCAC	0.597																																					p.S75R													.	.			0			c.C225G												152.0	140.0	144.0					20																	3739195		2203	4300	6503	SO:0001583	missense	54976	exon3			CAGAAAGCTGCTG	AK000557	CCDS33436.1, CCDS58763.1	20p13	2011-01-25			ENSG00000101220	ENSG00000101220			15873	protein-coding gene	gene with protein product	"""hypothetical protein LOC54976"""					11780052	Standard	NM_001258429		Approved	FLJ20550	uc002wjh.2	Q9GZN8	OTTHUMG00000031753	ENST00000379772.3:c.150C>G	20.37:g.3739195G>C	ENSP00000369097:p.Ser50Arg		Somatic	35	0	0		WXS	Illumina HiSeq	.	61	0.25	15	NM_001039140	180	0.33	59	A8K4J0|D3DVX8|Q5JX81|Q9NWX3	Missense_Mutation	SNP	ENST00000379772.3	37	CCDS58763.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.50|14.50	2.555201|2.555201	0.45487|0.45487	.|.	.|.	ENSG00000101220|ENSG00000101220	ENST00000399683|ENST00000379772;ENST00000217195;ENST00000399672;ENST00000379765	.|.	.|.	.|.	4.96|4.96	4.01|4.01	0.46588|0.46588	.|.	.|0.120914	.|0.52532	.|U	.|0.000074	T|T	0.51550|0.51550	0.1681|0.1681	L|L	0.27053|0.27053	0.805|0.805	0.37918|0.37918	D|D	0.931581|0.931581	.|P;P;D	.|0.67145	.|0.589;0.839;0.996	.|B;B;P	.|0.62184	.|0.164;0.395;0.899	T|T	0.54262|0.54262	-0.8320|-0.8320	5|9	.|0.37606	.|T	.|0.19	-6.9144|-6.9144	7.516|7.516	0.27602|0.27602	0.1878:0.0:0.8122:0.0|0.1878:0.0:0.8122:0.0	.|.	.|50;75;50	.|Q9GZN8;Q9GZN8-2;E9PAL2	.|CT027_HUMAN;.;.	G|R	44|50;75;50;50	.|.	.|ENSP00000217195:S75R	A|S	-|-	2|3	0|2	C20orf27|C20orf27	3687195|3687195	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	2.977000|2.977000	0.49297|0.49297	1.478000|1.478000	0.48253|0.48253	0.650000|0.650000	0.86243|0.86243	GCT|AGC			0.597	C20orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077750.2		NM_001039140	
GDF5	8200	broad.mit.edu	37	20	34025551	34025551	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr20:34025551A>G	ENST00000374372.1	-	3	661	c.158T>C	c.(157-159)cTg>cCg	p.L53P	GDF5_ENST00000374369.3_Missense_Mutation_p.L53P			P43026	GDF5_HUMAN	growth differentiation factor 5	53					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GTTCCGGGCCAGGGGGGGCCT	0.657																																					p.L53P													.	GDF5	66		0			c.T158C	GRCh37	CD025309|CI025313	GDF5	D|I								12.0	14.0	13.0					20																	34025551		2191	4284	6475	SO:0001583	missense	8200	exon1			CGGGCCAGGGGGG	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.158T>C	20.37:g.34025551A>G	ENSP00000363492:p.Leu53Pro		Somatic	42	0.1666666667	7		WXS	Illumina HiSeq	Phase_I	36	0.22	8	NM_000557	0		0	E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.	.	.	.	.	.	.	.	.	.	A	6.441	0.449538	0.12223	.	.	ENSG00000125965	ENST00000374369;ENST00000374372	T;T	0.34472	1.36;1.36	4.59	2.27	0.28462	.	1.816570	0.02975	N	0.144885	T	0.24812	0.0602	N	0.14661	0.345	0.27812	N	0.942119	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18429	-1.0337	10	0.35671	T	0.21	.	7.5315	0.27685	0.7398:0.0:0.2602:0.0	.	53;53	F1T0J1;P43026	.;GDF5_HUMAN	P	53	ENSP00000363489:L53P;ENSP00000363492:L53P	ENSP00000363489:L53P	L	-	2	0	GDF5	33488965	0.192000	0.23301	0.872000	0.34217	0.915000	0.54546	1.040000	0.30278	0.798000	0.33994	0.260000	0.18958	CTG			0.657	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078875.2			
ANKRD30BP2	149992	broad.mit.edu	37	21	14410884	14410885	+	RNA	INS	-	-	C	rs59687851		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr21:14410884_14410885insC	ENST00000507941.1	+	0	95									ankyrin repeat domain 30B pseudogene 2																		GGCCGTCCTGGCCCCGAGGTCT	0.683																																					.													.	.			0			.																																											0	.			GTCCTGGCCCCGA	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14410888_14410888dupC			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	INS	ENST00000507941.1	37																																																																																						0.683	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000372094.1		NR_026916	
KRTAP10-4	386672	ucsc.edu	37	21	45993851	45993851	+	Silent	SNP	C	C	T	rs201895065		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr21:45993851C>T	ENST00000400374.3	+	1	246	c.216C>T	c.(214-216)tgC>tgT	p.C72C	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_5'Flank	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	72	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CAGTGACCTGCGAGCCCAGCC	0.721																																					p.C72C													.	KRTAP10-4	44		0			c.C216T												20.0	38.0	32.0					21																	45993851		1993	4191	6184	SO:0001819	synonymous_variant	386672	exon1			GACCTGCGAGCCC	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.216C>T	21.37:g.45993851C>T			Somatic	18	0.3888888889	7		WXS	Illumina HiSeq		35	0.34	12	NM_198687	0		0	Q08AS0	Silent	SNP	ENST00000400374.3	37	CCDS42957.1																																																																																					0.721	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128045.1		NM_198687	
CCR9	10803	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45942703	45942703	+	Silent	SNP	C	C	T	rs201764174		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr3:45942703C>T	ENST00000357632.2	+	3	603	c.423C>T	c.(421-423)agC>agT	p.S141S	LZTFL1_ENST00000536047.1_Intron|Y_RNA_ENST00000364765.1_RNA|CCR9_ENST00000395963.2_Silent_p.S129S|LZTFL1_ENST00000539217.1_Intron|CCR9_ENST00000355983.2_Silent_p.S129S|CCR9_ENST00000422395.1_3'UTR	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	141					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		TGTGCATCAGCGTGGACAGGT	0.478																																					p.S141S													.	CCR9	45		0			c.C423T												145.0	136.0	139.0					3																	45942703		2203	4300	6503	SO:0001819	synonymous_variant	10803	exon3			CATCAGCGTGGAC	AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.423C>T	3.37:g.45942703C>T			Somatic	68	0.0147058824	1		WXS	Illumina HiSeq	Phase_I	121	0.16	19	NM_031200	0		0	Q4VBM3|Q549E0|Q9UQQ6	Silent	SNP	ENST00000357632.2	37	CCDS2732.1																																																																																					0.478	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257323.2			
HEG1	57493	mdanderson.org	37	3	124716650	124716650	+	Silent	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr3:124716650G>T	ENST00000311127.4	-	12	3602	c.3535C>A	c.(3535-3537)Cgg>Agg	p.R1179R		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	1179					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GGACTCTTCCGCTTGCACAAG	0.478																																					p.R1179R													.	.			0			c.C3535A												38.0	42.0	41.0					3																	124716650		1948	4154	6102	SO:0001819	synonymous_variant	57493	exon12			TCTTCCGCTTGCA	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.3535C>A	3.37:g.124716650G>T			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	34	0.12	4	NM_020733	1	0.00	0	Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	ENST00000311127.4	37	CCDS46898.1																																																																																					0.478	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355732.2		XM_087386	
PIK3CB	5291	mdanderson.org	37	3	138374260	138374260	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr3:138374260G>T	ENST00000477593.1	-	23	3257	c.3184C>A	c.(3184-3186)Cac>Aac	p.H1062N	PIK3CB_ENST00000289153.2_Missense_Mutation_p.H1062N|PIK3CB_ENST00000544716.1_Missense_Mutation_p.H513N			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	1062	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	CGAACTGTGTGGGCCATCCAG	0.403																																					p.H1062N													.	.			0			c.C3184A												150.0	137.0	141.0					3																	138374260		2203	4300	6503	SO:0001583	missense	5291	exon22			CTGTGTGGGCCAT		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.3184C>A	3.37:g.138374260G>T	ENSP00000418143:p.His1062Asn		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	116	0.04	5	NM_006219	24	0.00	0	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	37	CCDS3104.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356359	0.82243	.	.	ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153	T;T;T	0.80123	-1.34;-0.46;-1.34	5.55	5.55	0.83447	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.93706	0.7989	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.998	D	0.95067	0.8201	10	0.87932	D	0	-20.7509	19.6982	0.96039	0.0:0.0:1.0:0.0	.	1062;649;513	P42338;B4DZI3;Q68DL0	PK3CB_HUMAN;.;.	N	1062;513;1062	ENSP00000418143:H1062N;ENSP00000438259:H513N;ENSP00000289153:H1062N	ENSP00000289153:H1062N	H	-	1	0	PIK3CB	139856950	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.657000	0.98554	2.894000	0.99253	0.655000	0.94253	CAC			0.403	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358019.1			
PDS5A	23244	broad.mit.edu;mdanderson.org	37	4	39864513	39864513	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr4:39864513T>C	ENST00000303538.8	-	25	3486	c.2947A>G	c.(2947-2949)Att>Gtt	p.I983V		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TTCTGCTTAATGTATTCCCTG	0.383																																					p.I983V													.	PDS5A	114		0			c.A2947G												99.0	96.0	97.0					4																	39864513		1895	4114	6009	SO:0001583	missense	23244	exon25			GCTTAATGTATTC	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.2947A>G	4.37:g.39864513T>C	ENSP00000303427:p.Ile983Val		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	53	0.08	4	NM_001100399	6	0.00	0		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.572021	0.45798	.	.	ENSG00000121892	ENST00000303538	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.48502	0.1503	N	0.16790	0.44	0.80722	D	1	B	0.31910	0.346	B	0.40636	0.335	T	0.44636	-0.9315	8	.	.	.	-14.8306	15.8533	0.78952	0.0:0.0:0.0:1.0	.	983	Q29RF7	PDS5A_HUMAN	V	983	.	.	I	-	1	0	PDS5A	39540908	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.060000	0.64312	2.147000	0.66899	0.460000	0.39030	ATT			0.383	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361287.1		NM_015200	
ADAMTS3	9508	mdanderson.org	37	4	73161498	73161498	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr4:73161498G>T	ENST00000286657.4	-	19	2632	c.2596C>A	c.(2596-2598)Cag>Aag	p.Q866K		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	866	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTAGTGTACTGGAAACCTGGA	0.358																																					p.Q866K	NSCLC(168;1941 2048 2918 13048 43078)												.	.			0			c.C2596A												106.0	98.0	101.0					4																	73161498		2203	4300	6503	SO:0001583	missense	9508	exon19			TGTACTGGAAACC	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.2596C>A	4.37:g.73161498G>T	ENSP00000286657:p.Gln866Lys		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_014243	0		0	A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	37	CCDS3553.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878847	0.91740	.	.	ENSG00000156140	ENST00000286657	T	0.55052	0.54	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000001	T	0.63663	0.2530	M	0.79258	2.445	0.80722	D	1	P	0.46395	0.877	P	0.46885	0.53	T	0.68720	-0.5334	10	0.51188	T	0.08	.	18.6029	0.91255	0.0:0.0:1.0:0.0	.	866	O15072	ATS3_HUMAN	K	866	ENSP00000286657:Q866K	ENSP00000286657:Q866K	Q	-	1	0	ADAMTS3	73380362	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.813000	0.99286	2.379000	0.81126	0.650000	0.86243	CAG			0.358	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252164.2			
CLPTM1L	81037	mdanderson.org	37	5	1331993	1331993	+	Silent	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:1331993G>T	ENST00000320895.5	-	8	1154	c.897C>A	c.(895-897)ctC>ctA	p.L299L	CLPTM1L_ENST00000507807.1_Silent_p.L166L|CLPTM1L_ENST00000320927.6_Silent_p.L299L	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	299					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		GGAAATCAAAGAGAAGCTAGA	0.512																																					p.L299L													.	.			0			c.C897A												95.0	89.0	91.0					5																	1331993		2203	4297	6500	SO:0001819	synonymous_variant	81037	exon8			ATCAAAGAGAAGC	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.897C>A	5.37:g.1331993G>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_030782	179	0.00	0	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Silent	SNP	ENST00000320895.5	37	CCDS3862.1																																																																																					0.512	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253649.2		NM_030782	
MAP1B	4131	mdanderson.org	37	5	71495134	71495134	+	Silent	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:71495134G>T	ENST00000296755.7	+	5	6250	c.5952G>T	c.(5950-5952)ctG>ctT	p.L1984L		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1984					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GAAGGCTTCTGGATGACATCA	0.483																																					p.L1984L	Melanoma(17;367 822 11631 31730 47712)												.	.			0			c.G5952T												115.0	121.0	119.0					5																	71495134		2203	4300	6503	SO:0001819	synonymous_variant	4131	exon5			GCTTCTGGATGAC	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.5952G>T	5.37:g.71495134G>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_005909	0		0	A2BDK5	Silent	SNP	ENST00000296755.7	37	CCDS4012.1																																																																																					0.483	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000218561.6		NM_005909	
SERINC5	256987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79465352	79465352	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:79465352C>T	ENST00000507668.2	-	6	719	c.569G>A	c.(568-570)aGt>aAt	p.S190N	SERINC5_ENST00000512972.2_Missense_Mutation_p.S190N|SERINC5_ENST00000509193.1_Missense_Mutation_p.S190N|SERINC5_ENST00000512721.1_Missense_Mutation_p.S190N	NM_001174071.1|NM_178276.5	NP_001167542.1|NP_840060.1	Q86VE9	SERC5_HUMAN	serine incorporator 5	190					myelination (GO:0042552)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(3)|kidney(1)|lung(3)|ovary(1)	8		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)		CAGCTTGTTACTGGCTGTGCC	0.522																																					p.S190N													.	.			0			c.G569A												46.0	47.0	47.0					5																	79465352		2053	4202	6255	SO:0001583	missense	256987	exon6			TTGTTACTGGCTG	AF498273	CCDS54874.1	5q14.1	2014-01-28	2005-10-14	2005-10-14		ENSG00000164300			18825	protein-coding gene	gene with protein product		614551	"""chromosome 5 open reading frame 12"""	C5orf12		12688535	Standard	NM_178276		Approved	TPO1	uc011ctj.2	Q86VE9		ENST00000507668.2:c.569G>A	5.37:g.79465352C>T	ENSP00000426237:p.Ser190Asn		Somatic	83	0	0		WXS	Illumina HiSeq	.	68	0.35	24	NM_001174071	7	0.71	5	B4DMH7|Q495A4|Q495A6	Missense_Mutation	SNP	ENST00000507668.2	37	CCDS54873.1	.	.	.	.	.	.	.	.	.	.	C	4.244	0.044232	0.08196	.	.	ENSG00000164300	ENST00000507668;ENST00000329637;ENST00000509193;ENST00000512972;ENST00000512721	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	5.38	-7.64	0.01286	.	0.855437	0.11085	N	0.601430	T	0.06325	0.0163	L	0.28115	0.83	0.09310	N	1	B;B;B;B	0.32101	0.143;0.027;0.356;0.229	B;B;B;B	0.31390	0.091;0.026;0.129;0.091	T	0.34453	-0.9828	10	0.02654	T	1	.	12.2869	0.54797	0.0:0.099:0.6133:0.2876	.	190;190;190;190	B4DMH7;Q86VE9-2;D6RHG7;Q86VE9	.;.;.;SERC5_HUMAN	N	190;189;190;190;190	ENSP00000426237:S190N;ENSP00000426134:S190N;ENSP00000421665:S190N;ENSP00000420863:S190N	ENSP00000327542:S189N	S	-	2	0	SERINC5	79501108	0.000000	0.05858	0.000000	0.03702	0.996000	0.88848	-0.377000	0.07456	-1.407000	0.02043	0.650000	0.86243	AGT			0.522	SERINC5-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_178276	
ANKRD34B	340120	mdanderson.org	37	5	79855372	79855372	+	Nonsense_Mutation	SNP	A	A	T	rs32857	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:79855372A>T	ENST00000338682.3	-	5	1139	c.467T>A	c.(466-468)tTg>tAg	p.L156*		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	156			L -> S (in dbSNP:rs32857). {ECO:0000269|PubMed:17974005}.			cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CCCACAGGGCAACTTTGCTGT	0.418																																					p.L156X													.	.			0			c.T467A												194.0	189.0	191.0					5																	79855372		2203	4300	6503	SO:0001587	stop_gained	340120	exon5			CAGGGCAACTTTG		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.467T>A	5.37:g.79855372A>T	ENSP00000339802:p.Leu156*		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	111	0.05	5	NM_001004441	0		0	B2RPH1|Q68D79	Nonsense_Mutation	SNP	ENST00000338682.3	37	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	G	38	7.243030	0.98157	.	.	ENSG00000189127	ENST00000338682	.	.	.	5.82	5.82	0.92795	.	0.440736	0.22065	U	0.065114	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-4.5448	13.9291	0.63983	0.0733:0.0:0.9267:0.0	.	.	.	.	X	156	.	ENSP00000339802:L156X	L	-	2	0	ANKRD34B	79891128	0.892000	0.30473	0.069000	0.20011	0.324000	0.28378	2.696000	0.47052	1.476000	0.48215	-0.119000	0.15052	TTG			0.418	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369475.1		NM_001004441	
ACSL6	23305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	131310650	131310650	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:131310650G>A	ENST00000379240.1	-	11	1082	c.929C>T	c.(928-930)cCg>cTg	p.P310L	ACSL6_ENST00000379272.2_Missense_Mutation_p.P325L|ACSL6_ENST00000544770.1_Missense_Mutation_p.P219L|ACSL6_ENST00000543479.1_Intron|ACSL6_ENST00000357096.1_Intron|ACSL6_ENST00000379264.2_Missense_Mutation_p.P335L|ACSL6_ENST00000379255.1_Intron|ACSL6_ENST00000379246.1_Missense_Mutation_p.P321L|ACSL6_ENST00000296869.4_Intron|ACSL6_ENST00000379244.1_Intron|ACSL6_ENST00000431707.1_Missense_Mutation_p.P290L|ACSL6_ENST00000379249.3_Intron			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	310					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTCCTGTCTCGGAAAGATCAC	0.493																																					p.P335L													.	.			0			c.C1004T												59.0	58.0	58.0					5																	131310650		2203	4300	6503	SO:0001583	missense	23305	exon11			TGTCTCGGAAAGA	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.929C>T	5.37:g.131310650G>A	ENSP00000368542:p.Pro310Leu		Somatic	230	0	0		WXS	Illumina HiSeq	.	192	0.31	60	NM_001009185	1	0.00	0	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	37		.	.	.	.	.	.	.	.	.	.	G	15.72	2.917207	0.52546	.	.	ENSG00000164398	ENST00000379264;ENST00000379272;ENST00000379246;ENST00000544770;ENST00000379240;ENST00000431707	T;T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21;3.21	5.02	5.02	0.67125	AMP-dependent synthetase/ligase (1);	.	.	.	.	T	0.05135	0.0137	N	0.05031	-0.125	0.80722	D	1	B;B;B	0.21147	0.045;0.052;0.045	B;B;B	0.20767	0.012;0.031;0.021	T	0.42899	-0.9424	9	0.11182	T	0.66	.	18.4084	0.90542	0.0:0.0:1.0:0.0	.	325;310;335	Q9UKU0-6;Q9UKU0;Q9UKU0-1	.;ACSL6_HUMAN;.	L	335;325;321;219;310;290	ENSP00000368566:P335L;ENSP00000368574:P325L;ENSP00000368548:P321L;ENSP00000445154:P219L;ENSP00000368542:P310L;ENSP00000413329:P290L	ENSP00000368542:P310L	P	-	2	0	ACSL6	131338549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.666000	0.98612	2.368000	0.80403	0.555000	0.69702	CCG			0.493	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000132622.1		NM_015256	
PCDHB14	56122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140604522	140604522	+	Missense_Mutation	SNP	C	C	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:140604522C>A	ENST00000239449.4	+	1	1445	c.1445C>A	c.(1444-1446)aCc>aAc	p.T482N	PCDHB14_ENST00000515856.2_Missense_Mutation_p.T329N	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	482	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACTCAGGCACCAACGCCCAG	0.647																																					p.T482N	Ovarian(141;50 1831 27899 33809 37648)												.	.			0			c.C1445A												103.0	109.0	107.0					5																	140604522		2203	4298	6501	SO:0001583	missense	56122	exon1			CAGGCACCAACGC	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1445C>A	5.37:g.140604522C>A	ENSP00000239449:p.Thr482Asn		Somatic	29	0	0		WXS	Illumina HiSeq	.	54	0.20	11	NM_018934	7	0.71	5	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	11.60	1.686144	0.29962	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.01767	4.65;4.65	4.34	3.45	0.39498	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01661	0.0053	N	0.17631	0.505	0.09310	N	1	P	0.36183	0.542	B	0.38755	0.281	T	0.50101	-0.8867	9	0.44086	T	0.13	.	6.1661	0.20390	0.315:0.5934:0.0:0.0915	.	482	Q9Y5E9	PCDBE_HUMAN	N	329;482	ENSP00000444518:T329N;ENSP00000239449:T482N	ENSP00000239449:T482N	T	+	2	0	PCDHB14	140584706	0.000000	0.05858	0.995000	0.50966	0.921000	0.55340	-1.849000	0.01672	2.157000	0.67596	0.556000	0.70494	ACC			0.647	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251814.2		NM_018934	
TAF7	6879	mdanderson.org	37	5	140699046	140699046	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:140699046G>T	ENST00000313368.5	-	1	1284	c.566C>A	c.(565-567)aCa>aAa	p.T189K		NM_005642.2	NP_005633.2	Q15545	TAF7_HUMAN	TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa	189					DNA-templated transcription, initiation (GO:0006352)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of histone acetylation (GO:0035067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermine transport (GO:0000296)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	histone acetyltransferase binding (GO:0035035)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|vitamin D receptor binding (GO:0042809)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCTCCTTTGTTTCATCTTC	0.433																																					p.T189K													.	.			0			c.C566A												112.0	109.0	110.0					5																	140699046		2203	4300	6503	SO:0001583	missense	6879	exon1			TCCTTTGTTTCAT	AF349038	CCDS4259.1	5q31	2008-02-05	2002-08-29	2001-12-07	ENSG00000178913	ENSG00000178913			11541	protein-coding gene	gene with protein product		600573	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, F, 55kD"""	TAF2F		7824954	Standard	NM_005642		Approved	TAFII55	uc003ljg.3	Q15545	OTTHUMG00000129628	ENST00000313368.5:c.566C>A	5.37:g.140699046G>T	ENSP00000312709:p.Thr189Lys		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	61	0.07	4	NM_005642	310	0.00	0	B2RBV9|Q13036	Missense_Mutation	SNP	ENST00000313368.5	37	CCDS4259.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204195	0.58234	.	.	ENSG00000178913	ENST00000313368	T	0.22539	1.95	4.86	4.86	0.63082	.	0.120802	0.64402	D	0.000020	T	0.24470	0.0593	M	0.75777	2.31	0.49687	D	0.999819	P	0.35433	0.501	B	0.22386	0.039	T	0.13388	-1.0511	10	0.72032	D	0.01	-13.4635	15.8946	0.79325	0.0:0.0:1.0:0.0	.	189	Q15545	TAF7_HUMAN	K	189	ENSP00000312709:T189K	ENSP00000312709:T189K	T	-	2	0	TAF7	140679230	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.976000	0.88070	2.709000	0.92574	0.655000	0.94253	ACA			0.433	TAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251823.2		NM_005642	
MAPK9	5601	mdanderson.org	37	5	179663447	179663447	+	Silent	SNP	C	C	T	rs114045781		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr5:179663447C>T	ENST00000452135.2	-	12	1510	c.1212G>A	c.(1210-1212)acG>acA	p.T404T	MAPK9_ENST00000343111.6_3'UTR|MAPK9_ENST00000347470.4_Silent_p.T319T|MAPK9_ENST00000393360.3_3'UTR|MAPK9_ENST00000455781.1_Silent_p.T404T			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	404					cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGAGGCCAGCGTCTGCTCAG	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		21056	0.0		0.001	False		,,,				2504	0.0				p.T404T													.	.			0			c.G1212A							C	,,,	0,4406		0,0,2203	116.0	99.0	105.0		1212,,,1212	-4.9	0.9	5	dbSNP_132	105	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous,utr-3,utr-3,coding-synonymous	MAPK9	NM_002752.4,NM_139068.2,NM_139069.2,NM_139070.2	,,,	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	,,,	404/425,,,404/425	179663447	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	5601	exon12			GGCCAGCGTCTGC	U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.1212G>A	5.37:g.179663447C>T			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_139070	55	0.02	1	A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Silent	SNP	ENST00000452135.2	37	CCDS4453.1																																																																																			0.001		0.478	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000253530.3			
PBX2	5089	mdanderson.org	37	6	32157666	32157666	+	Silent	SNP	G	G	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr6:32157666G>A	ENST00000375050.4	-	1	297	c.27C>T	c.(25-27)ccC>ccT	p.P9P		NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	9					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						cgcctggagggggcggccccA	0.766																																					p.P9P													.	.			0			c.C27T												3.0	5.0	4.0					6																	32157666		1001	2063	3064	SO:0001819	synonymous_variant	5089	exon1			TGGAGGGGGCGGC		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.27C>T	6.37:g.32157666G>A			Somatic	39	0.0256410256	1		WXS	Illumina HiSeq	Phase_I	60	0.08	5	NM_002586	2	0.00	0	A2BFJ2	Silent	SNP	ENST00000375050.4	37	CCDS4748.1																																																																																					0.766	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076194.4			
KLC4	89953	bcgsc.ca;mdanderson.org	37	6	43041047	43041047	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr6:43041047G>T	ENST00000394056.2	+	15	2211	c.1716G>T	c.(1714-1716)aaG>aaT	p.K572N	KLC4_ENST00000453940.2_Missense_Mutation_p.K495N|KLC4_ENST00000259708.3_Missense_Mutation_p.K590N|PTK7_ENST00000476760.1_5'Flank|KLC4_ENST00000479388.1_Missense_Mutation_p.K572N|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000394058.1_Missense_Mutation_p.K572N|KLC4_ENST00000347162.5_Missense_Mutation_p.K572N|PTK7_ENST00000230419.4_5'Flank			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	572						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			TGGTGAGGAAGCTCCAGGGGA	0.577																																					p.K590N													.	KLC4	89		0			c.G1770T												49.0	50.0	50.0					6																	43041047		2203	4300	6503	SO:0001583	missense	89953	exon14			GAGGAAGCTCCAG	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1716G>T	6.37:g.43041047G>T	ENSP00000377620:p.Lys572Asn		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_1	58	0.09	5	NM_201523	88	0.00	0	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	37	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520124	0.44866	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	D;D;D;D;D;D	0.83755	-1.71;-1.76;-1.72;-1.71;-1.71;-1.71	5.81	4.04	0.47022	.	0.088736	0.49305	D	0.000144	T	0.78848	0.4348	M	0.68317	2.08	0.48696	D	0.999694	B;D;D	0.61697	0.012;0.99;0.983	B;P;P	0.57152	0.006;0.814;0.656	T	0.76214	-0.3041	10	0.18710	T	0.47	-13.3572	8.2956	0.31984	0.2423:0.0:0.7577:0.0	.	495;590;572	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	N	572;495;590;572;572;572	ENSP00000340221:K572N;ENSP00000395806:K495N;ENSP00000259708:K590N;ENSP00000418031:K572N;ENSP00000377620:K572N;ENSP00000377622:K572N	ENSP00000259708:K590N	K	+	3	2	KLC4	43149025	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	1.803000	0.38863	0.807000	0.34208	-0.291000	0.09656	AAG			0.577	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040579.2		NM_138343	
C6orf58	352999	mdanderson.org	37	6	127898393	127898393	+	Silent	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr6:127898393G>T	ENST00000329722.7	+	1	75	c.63G>T	c.(61-63)ggG>ggT	p.G21G	C6orf58_ENST00000498112.1_Intron	NM_001010905.1	NP_001010905.1	Q6P5S2	CF058_HUMAN	chromosome 6 open reading frame 58	21						extracellular vesicular exosome (GO:0070062)				kidney(3)|large_intestine(3)|liver(1)|lung(7)|pancreas(1)	15				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		CCTTAGCAGGGACTTCCAATC	0.502																																					p.G21G													.	.			0			c.G63T												131.0	131.0	131.0					6																	127898393		2203	4300	6503	SO:0001819	synonymous_variant	352999	exon1			AGCAGGGACTTCC	BC062712	CCDS34533.1	6q22.33	2011-12-13			ENSG00000184530	ENSG00000184530			20960	protein-coding gene	gene with protein product							Standard	NM_001010905		Approved		uc003qbh.4	Q6P5S2	OTTHUMG00000015530	ENST00000329722.7:c.63G>T	6.37:g.127898393G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	47	0.09	4	NM_001010905	0		0	B4E1I0|Q5VUP2	Silent	SNP	ENST00000329722.7	37	CCDS34533.1																																																																																					0.502	C6orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042152.1		NM_001010905	
LPA	4018	hgsc.bcm.edu	37	6	160978593	160978593	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr6:160978593C>A	ENST00000316300.5	-	29	4686	c.4642G>T	c.(4642-4644)Gag>Tag	p.E1548*	LPA_ENST00000447678.1_Nonsense_Mutation_p.E1548*			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4056	Kringle 14. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAGTAGTTCTCGGTCAGGCCA	0.478																																					p.E1548X													.	.			0			c.G4642T												68.0	71.0	70.0					6																	160978593		2111	4264	6375	SO:0001587	stop_gained	4018	exon30			AGTTCTCGGTCAG	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4642G>T	6.37:g.160978593C>A	ENSP00000321334:p.Glu1548*		Somatic	73	0	0		WXS	Illumina HiSeq	.	89	0.04	4	NM_005577	1	0.00	0	Q5VTD7|Q9UD88	Nonsense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	N	39	7.703949	0.98444	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.55	-3.11	0.05299	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	5.1967	0.15243	0.1924:0.5669:0.0:0.2407	.	.	.	.	X	1548	.	ENSP00000321334:E1548X	E	-	1	0	LPA	160898583	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-1.450000	0.02390	-0.508000	0.06540	-0.634000	0.03986	GAG			0.478	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042957.1		NM_005577	
SP8	221833	broad.mit.edu;mdanderson.org	37	7	20824970	20824970	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr7:20824970C>T	ENST00000361443.4	-	3	649	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	SP8_ENST00000418710.2_Missense_Mutation_p.G156S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	138					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						ccgccgccgccgctgcccccg	0.761																																					p.G156S													.	SP8	43		0			c.G466A																																									SO:0001583	missense	221833	exon2			CGCCGCCGCTGCC		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.412G>A	7.37:g.20824970C>T	ENSP00000354482:p.Gly138Ser		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_182700	0		0	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	6.365	0.435495	0.12045	.	.	ENSG00000164651	ENST00000418710;ENST00000361443	D;D	0.81821	-1.54;-1.54	3.09	2.16	0.27623	.	0.366549	0.17990	U	0.155235	T	0.58308	0.2113	N	0.08118	0	0.31008	N	0.719562	D;D	0.55605	0.972;0.972	B;B	0.41860	0.368;0.368	T	0.60005	-0.7347	10	0.08837	T	0.75	.	10.7467	0.46185	0.1919:0.8081:0.0:0.0	.	138;138	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	156;138	ENSP00000408792:G156S;ENSP00000354482:G138S	ENSP00000354482:G138S	G	-	1	0	SP8	20791495	.	.	0.969000	0.41365	0.291000	0.27294	.	.	0.455000	0.26910	0.306000	0.20318	GGC			0.761	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000326904.2			
GTF2IRD1	9569	mdanderson.org	37	7	73938405	73938405	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr7:73938405G>T	ENST00000265755.3	+	8	1404	c.1011G>T	c.(1009-1011)aaG>aaT	p.K337N	GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.K337N|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.K337N|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.K369N	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	337					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGATAGAGAAGTGGGACGCCT	0.612																																					p.K369N													.	.			0			c.G1107T												76.0	57.0	64.0					7																	73938405		2203	4300	6503	SO:0001583	missense	9569	exon8			AGAGAAGTGGGAC	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1011G>T	7.37:g.73938405G>T	ENSP00000265755:p.Lys337Asn		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001199207	41	0.00	0	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940105	0.73557	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.49139	0.82;0.8;0.83;0.79	4.63	2.37	0.29283	.	0.000000	0.85682	D	0.000000	T	0.52435	0.1734	L	0.36672	1.1	0.53688	D	0.99997	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.91635	0.922;0.991;0.999;0.999	T	0.49579	-0.8925	10	0.48119	T	0.1	-21.3529	7.3271	0.26561	0.3273:0.0:0.6727:0.0	.	369;337;337;337	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	N	337;369;337;337	ENSP00000265755:K337N;ENSP00000397566:K369N;ENSP00000408477:K337N;ENSP00000418383:K337N	ENSP00000265755:K337N	K	+	3	2	GTF2IRD1	73576341	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.000000	0.57039	1.069000	0.40788	0.561000	0.74099	AAG			0.612	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252654.2		NM_016328	
FAM200A	221786	mdanderson.org	37	7	99144733	99144733	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr7:99144733G>T	ENST00000449309.1	-	2	1677	c.1298C>A	c.(1297-1299)aCt>aAt	p.T433N		NM_145111.3	NP_659802.1	Q8TCP9	F200A_HUMAN	family with sequence similarity 200, member A	433						integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(5)|large_intestine(2)|ovary(2)|skin(1)	11						ataattaaaagtttgagacaa	0.289																																					p.T433N													.	.			0			c.C1298A												10.0	11.0	10.0					7																	99144733		1474	2598	4072	SO:0001583	missense	221786	exon2			TTAAAAGTTTGAG		CCDS5668.1	7q22.1	2010-02-22	2010-02-22	2010-02-22	ENSG00000221909	ENSG00000221909			25401	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 38"""	C7orf38		10607616	Standard	NM_145111		Approved	FLJ36794, DKFZp727G131	uc003ura.3	Q8TCP9	OTTHUMG00000156723	ENST00000449309.1:c.1298C>A	7.37:g.99144733G>T	ENSP00000411372:p.Thr433Asn		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_145111	16	0.00	0	A4D293|A8K3V9|B2RD92|C9J6A8|D6W5T2|Q8N9P3	Missense_Mutation	SNP	ENST00000449309.1	37	CCDS5668.1	.	.	.	.	.	.	.	.	.	.	G	5.516	0.280156	0.10458	.	.	ENSG00000221909	ENST00000449309;ENST00000408938	T;T	0.22743	1.94;1.94	1.69	0.761	0.18448	.	0.682102	0.11781	N	0.530186	T	0.11495	0.0280	N	0.22421	0.69	0.21386	N	0.999704	B	0.22851	0.076	B	0.20955	0.032	T	0.31833	-0.9929	10	0.28530	T	0.3	.	4.4112	0.11434	0.2124:0.0:0.7876:0.0	.	433	Q8TCP9	F200A_HUMAN	N	433	ENSP00000411372:T433N;ENSP00000386191:T433N	ENSP00000386191:T433N	T	-	2	0	FAM200A	98982669	0.999000	0.42202	0.819000	0.32651	0.968000	0.65278	0.338000	0.19858	0.254000	0.21573	0.467000	0.42956	ACT			0.289	FAM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345467.1		NM_145111	
KMT2E	55904	mdanderson.org	37	7	104746451	104746451	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr7:104746451G>T	ENST00000311117.3	+	19	3141		c.e19+1		CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334877.4_Splice_Site|KMT2E_ENST00000334914.7_Splice_Site|KMT2E_ENST00000257745.4_Splice_Site	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TCCCTTCCAGGTAGAATTTTT	0.368																																					.													.	.			0			c.2596+1G>T												83.0	86.0	85.0					7																	104746451		2203	4299	6502	SO:0001630	splice_region_variant	55904	exon18			TTCCAGGTAGAAT	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2596+1G>T	7.37:g.104746451G>T			Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	81	0.05	4	NM_018682	2	0.00	0	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Splice_Site	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902164	0.72754	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0804	0.97772	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MLL5	104533687	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	8.930000	0.92872	2.738000	0.93877	0.655000	0.94253	.			0.368	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348697.1			Intron
FAM86B1	85002	broad.mit.edu	37	8	12042851	12042851	+	Intron	SNP	C	C	G	rs200915866	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr8:12042851C>G	ENST00000448228.2	-	6	840				FAM86B1_ENST00000534520.1_3'UTR|FAM86B1_ENST00000533852.2_Intron|FAM86B1_ENST00000321602.8_Missense_Mutation_p.C81S	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1											kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		ACAGCTCGGGCACCATGTAGG	0.627													c|||	820	0.163738	0.2413	0.134	5008	,	,		11303	0.1419		0.1103	False		,,,				2504	0.1575				.													.	FAM86B1	7		0			.												23.0	33.0	29.0					8																	12042851		1336	2507	3843	SO:0001627	intron_variant	85002	.			CTCGGGCACCATG	BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.790+33G>C	8.37:g.12042851C>G			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	13	0.38	5	.	3	0.00	0		Missense_Mutation	SNP	ENST00000448228.2	37	CCDS59512.1	.	.	.	.	.	.	.	.	.	.	-	0.013	-1.624694	0.00820	.	.	ENSG00000186523	ENST00000321602	T	0.30182	1.54	0.644	-0.447	0.12234	.	.	.	.	.	T	0.11410	0.0278	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32771	-0.9894	7	0.08837	T	0.75	.	.	.	.	.	81	F6QN85	.	S	81	ENSP00000439686:C81S	ENSP00000439686:C81S	C	-	2	0	FAM86B1	12080260	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	-0.057000	0.11768	-0.942000	0.03695	-1.201000	0.01664	TGC			0.627	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000383317.1		NM_032916	
ADAM9	8754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	38871495	38871495	+	Missense_Mutation	SNP	C	C	G			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr8:38871495C>G	ENST00000487273.2	+	4	344	c.266C>G	c.(265-267)cCt>cGt	p.P89R	ADAM9_ENST00000481513.1_Missense_Mutation_p.P89R|ADAM9_ENST00000466936.1_Missense_Mutation_p.P89R	NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	89				Missing (in Ref. 2; no nucleotide entry). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			GACCTTTTGCCTGAAGATTTT	0.348																																					p.P89R													.	.			0			c.C266G												130.0	135.0	134.0					8																	38871495		2203	4300	6503	SO:0001583	missense	8754	exon4			TTTTGCCTGAAGA	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.266C>G	8.37:g.38871495C>G	ENSP00000419446:p.Pro89Arg		Somatic	60	0	0		WXS	Illumina HiSeq	.	90	0.17	15	NM_003816	8	0.13	1	B7ZLN7|Q10718|Q8NFM6	Missense_Mutation	SNP	ENST00000487273.2	37	CCDS6112.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275211	0.80580	.	.	ENSG00000168615	ENST00000466936;ENST00000481513;ENST00000487273	T;T;T	0.06068	3.35;3.35;3.35	5.58	5.58	0.84498	Peptidase M12B, propeptide (1);	0.097486	0.64402	D	0.000001	T	0.30947	0.0781	M	0.86740	2.835	0.53688	D	0.999973	D;D;D	0.89917	0.986;1.0;0.999	D;D;D	0.87578	0.944;0.998;0.993	T	0.04333	-1.0959	10	0.62326	D	0.03	.	16.7262	0.85422	0.0:1.0:0.0:0.0	.	89;89;89	Q13443;C9J6H5;C9JPM3	ADAM9_HUMAN;.;.	R	89	ENSP00000420257:P89R;ENSP00000417066:P89R;ENSP00000419446:P89R	ENSP00000369249:P89R	P	+	2	0	ADAM9	38990652	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.874000	0.56101	2.629000	0.89072	0.655000	0.94253	CCT			0.348	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357291.2			
XKR4	114786	hgsc.bcm.edu;ucsc.edu	37	8	56362215	56362215	+	Intron	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr8:56362215C>T	ENST00000327381.6	+	3	1106					NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			CCCATGGTGGCCATGCCAGGT	0.592																																					.													.	.			0			.																																									SO:0001627	intron_variant	100133234	.			TGGTGGCCATGCC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1007-73625C>T	8.37:g.56362215C>T			Somatic	48	0	0		WXS	Illumina HiSeq	.	97	0.14	14	.	1	0.00	0	Q96PZ8	RNA	SNP	ENST00000327381.6	37	CCDS34893.1																																																																																					0.592	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378129.2		NM_052898	
NSMAF	8439	mdanderson.org	37	8	59571855	59571855	+	Intron	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr8:59571855G>T	ENST00000038176.3	-	1	272				snoU13_ENST00000459488.1_RNA|NSMAF_ENST00000427130.2_Silent_p.I17I	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor						ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				TGCACTGCCGGATAGCTCGGC	0.761																																					p.I17I													NSMAF_ENST00000427130,NS,carcinoma,-1,2	NSMAF_ENST00000427130	-1	2	0			c.C51A												4.0	7.0	6.0					8																	59571855		614	1508	2122	SO:0001627	intron_variant	8439	exon1			CTGCCGGATAGCT	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.59+276C>A	8.37:g.59571855G>T			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001144772	2	0.00	0	B4DFB0|E9PCH0|Q8IW26	Silent	SNP	ENST00000038176.3	37	CCDS6173.1																																																																																					0.761	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378384.1		NM_003580	
LRRCC1	85444	broad.mit.edu	37	8	86019547	86019547	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr8:86019547C>T	ENST00000360375.3	+	1	166	c.17C>T	c.(16-18)gCg>gTg	p.A6V	LRRCC1_ENST00000414626.2_5'Flank	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	6					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						gcggcggcggcggtggtggcg	0.657																																					p.A6V													LRRCC1,colon,carcinoma,0,2	LRRCC1	212	2	0			c.C17T												14.0	25.0	22.0					8																	86019547		1814	4022	5836	SO:0001583	missense	85444	exon1			CGGCGGCGGTGGT	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.17C>T	8.37:g.86019547C>T	ENSP00000353538:p.Ala6Val		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	123	0.05	6	NM_033402	1	0.00	0	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569227	0.28003	.	.	ENSG00000133739	ENST00000360375	T	0.32272	1.46	1.53	-1.48	0.08745	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	0.999995	D	0.53312	0.959	P	0.45971	0.499	T	0.18116	-1.0347	9	0.56958	D	0.05	.	6.716	0.23304	0.3338:0.6662:0.0:0.0	.	6	Q9C099	LRCC1_HUMAN	V	6	ENSP00000353538:A6V	ENSP00000353538:A6V	A	+	2	0	LRRCC1	86206799	0.117000	0.22190	0.000000	0.03702	0.473000	0.32948	0.725000	0.25970	-0.322000	0.08615	-0.410000	0.06199	GCG			0.657	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380267.1		NM_033402	
SLC52A2	79581	mdanderson.org	37	8	145584287	145584287	+	Missense_Mutation	SNP	G	G	T	rs145502954		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr8:145584287G>T	ENST00000532887.1	+	4	1622	c.1039G>T	c.(1039-1041)Gtg>Ttg	p.V347L	SLC52A2_ENST00000530047.1_Missense_Mutation_p.V347L|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000540505.1_Missense_Mutation_p.V259L|SLC52A2_ENST00000527078.1_Missense_Mutation_p.V347L|SLC52A2_ENST00000329994.2_Missense_Mutation_p.V347L|SLC52A2_ENST00000402965.1_Missense_Mutation_p.V347L|FBXL6_ENST00000455319.2_5'Flank|FBXL6_ENST00000331890.5_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	347					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	TCTGCTGGGCGTGTTCTGTGG	0.697																																					p.V347L													.	.			0			c.G1039T												59.0	67.0	64.0					8																	145584287		2203	4300	6503	SO:0001583	missense	79581	exon4			CTGGGCGTGTTCT	AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.1039G>T	8.37:g.145584287G>T	ENSP00000436768:p.Val347Leu		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_024531	326	0.00	0	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	ENST00000532887.1	37	CCDS6423.1	.	.	.	.	.	.	.	.	.	.	G	9.948	1.219312	0.22373	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61;-0.61	4.96	-9.91	0.00458	.	0.694765	0.14438	N	0.319561	T	0.30070	0.0753	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.31110	-0.9955	10	0.14656	T	0.56	.	1.9009	0.03267	0.4065:0.089:0.2956:0.2089	.	347	Q9HAB3	RFT3_HUMAN	L	347;347;347;347;347;259	ENSP00000435820:V347L;ENSP00000434728:V347L;ENSP00000385961:V347L;ENSP00000436768:V347L;ENSP00000333638:V347L;ENSP00000440400:V259L	ENSP00000333638:V347L	V	+	1	0	GPR172A	145555095	0.000000	0.05858	0.011000	0.14972	0.236000	0.25371	0.091000	0.15046	-2.949000	0.00294	-1.263000	0.01449	GTG			0.697	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382405.1		NM_024531	
INSL6	11172	mdanderson.org	37	9	5185598	5185598	+	Missense_Mutation	SNP	G	G	T	rs142813719	byFrequency	TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr9:5185598G>T	ENST00000381641.3	-	1	70	c.5C>A	c.(4-6)cCg>cAg	p.P2Q		NM_007179.2	NP_009110.2	Q9Y581	INSL6_HUMAN	insulin-like 6	2					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(2)	15	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		GAGGAGCCGCGGCATCCCTGT	0.672																																					p.P2Q													INSL6,NS,carcinoma,+1,1	INSL6	1	1	0			c.C5A												26.0	23.0	24.0					9																	5185598		2201	4300	6501	SO:0001583	missense	11172	exon1			AGCCGCGGCATCC	AF156094	CCDS6458.1	9p24	2008-07-21			ENSG00000120210	ENSG00000120210			6089	protein-coding gene	gene with protein product	"""relaxin/insulin-like factor 1"""	606414				10819760	Standard	NM_007179		Approved	RIF1	uc003zix.3	Q9Y581	OTTHUMG00000019489	ENST00000381641.3:c.5C>A	9.37:g.5185598G>T	ENSP00000371054:p.Pro2Gln		Somatic	38	0.0263157895	1		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_007179	0		0	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000381641.3	37	CCDS6458.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547634	0.45383	.	.	ENSG00000120210	ENST00000381641	T	0.68025	-0.3	4.25	-1.2	0.09554	.	0.926036	0.09058	N	0.854732	T	0.64011	0.2560	M	0.73962	2.25	0.09310	N	1	P	0.38167	0.621	B	0.42882	0.401	T	0.58994	-0.7537	10	0.87932	D	0	7.3565	1.1157	0.01714	0.1837:0.1403:0.3909:0.2851	.	2	Q9Y581	INSL6_HUMAN	Q	2	ENSP00000371054:P2Q	ENSP00000371054:P2Q	P	-	2	0	INSL6	5175598	0.001000	0.12720	0.004000	0.12327	0.002000	0.02628	-0.506000	0.06359	-0.213000	0.10094	-0.201000	0.12746	CCG			0.672	INSL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051608.3		NM_007179	
NFX1	4799	bcgsc.ca;mdanderson.org	37	9	33307243	33307243	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr9:33307243G>T	ENST00000379540.3	+	5	1384	c.1322G>T	c.(1321-1323)gGt>gTt	p.G441V	NFX1_ENST00000318524.6_Missense_Mutation_p.G441V|NFX1_ENST00000379521.4_Missense_Mutation_p.G441V	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	441					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		CATAGCTGTGGTGAGGTTTGT	0.443																																					p.G441V													.	NFX1	85		0			c.G1322T												167.0	162.0	164.0					9																	33307243		2203	4300	6503	SO:0001583	missense	4799	exon5			GCTGTGGTGAGGT	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1322G>T	9.37:g.33307243G>T	ENSP00000368856:p.Gly441Val		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_1	89	0.06	5	NM_147134	10	0.00	0	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723654	0.89298	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.55413	0.52;0.52;0.52	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.81148	0.4762	H	0.95780	3.72	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.996;1.0;0.998	D	0.86675	0.1913	10	0.87932	D	0	-7.1113	16.8219	0.85748	0.0:0.0:1.0:0.0	.	441;325;441;441;441	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	V	441	ENSP00000368856:G441V;ENSP00000368836:G441V;ENSP00000317695:G441V	ENSP00000317695:G441V	G	+	2	0	NFX1	33297243	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.507000	0.97996	2.588000	0.87417	0.585000	0.79938	GGT			0.443	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052069.1			
GNAQ	2776	ucsc.edu;mdanderson.org	37	9	80537095	80537095	+	Nonsense_Mutation	SNP	G	G	T	rs200106152		TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr9:80537095G>T	ENST00000286548.4	-	2	525	c.303C>A	c.(301-303)taC>taA	p.Y101*		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	101					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						GCTCATACTTGTATGGGATCT	0.473			Mis		uveal melanoma																																p.Y101X				Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	GNAQ	384		0			c.C303A												202.0	163.0	176.0					9																	80537095		2203	4300	6503	SO:0001587	stop_gained	2776	exon2			ATACTTGTATGGG		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.303C>A	9.37:g.80537095G>T	ENSP00000286548:p.Tyr101*		Somatic	59	0.0169491525	1		WXS	Illumina HiSeq		48	0.10	5	NM_002072	2	0.00	0	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Nonsense_Mutation	SNP	ENST00000286548.4	37	CCDS6658.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	39	7.470181	0.98302	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.877	0.96880	0.0:0.0:1.0:0.0	.	.	.	.	X	101;72	.	ENSP00000286548:Y101X	Y	-	3	2	GNAQ	79726915	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.743000	0.68655	2.696000	0.92011	0.650000	0.86243	TAC			0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052761.1		NM_002072	
GAS1	2619	mdanderson.org	37	9	89561083	89561083	+	Silent	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr9:89561083G>T	ENST00000298743.7	-	1	1021	c.612C>A	c.(610-612)cgC>cgA	p.R204R	RP11-276H19.1_ENST00000415801.1_lincRNA	NM_002048.2	NP_002039.2	P54826	GAS1_HUMAN	growth arrest-specific 1	204					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cerebellum morphogenesis (GO:0021587)|developmental growth (GO:0048589)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|eye morphogenesis (GO:0048592)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein processing (GO:0010955)|negative regulation of smoothened signaling pathway (GO:0045879)|odontogenesis (GO:0042476)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|programmed cell death (GO:0012501)|regulation of apoptotic process (GO:0042981)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|regulation of smoothened signaling pathway (GO:0008589)	anchored component of plasma membrane (GO:0046658)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|lung(2)|skin(1)	4						CAATGACGGTGCGGCATTCGT	0.662																																					p.R204R													.	.			0			c.C612A												24.0	22.0	23.0					9																	89561083		2202	4298	6500	SO:0001819	synonymous_variant	2619	exon1			GACGGTGCGGCAT		CCDS6674.1	9q21.3-q22	2008-07-21			ENSG00000180447	ENSG00000180447			4165	protein-coding gene	gene with protein product	"""Growth arrest-specific gene-1"""	139185				8307588	Standard	NM_002048		Approved		uc004aox.4	P54826	OTTHUMG00000020141	ENST00000298743.7:c.612C>A	9.37:g.89561083G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_002048	11	0.00	0	B9EGM4|Q6B086	Silent	SNP	ENST00000298743.7	37	CCDS6674.1																																																																																					0.662	GAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052928.1		NM_002048	
SARDH	1757	ucsc.edu;bcgsc.ca	37	9	136594903	136594903	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr9:136594903C>T	ENST00000371872.4	-	6	1156	c.899G>A	c.(898-900)cGc>cAc	p.R300H	SARDH_ENST00000422262.2_Missense_Mutation_p.R132H|SARDH_ENST00000439388.1_Missense_Mutation_p.R300H|SARDH_ENST00000371867.1_Missense_Mutation_p.R211H|SARDH_ENST00000298628.5_Missense_Mutation_p.R300H	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	300					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CCCCTCGATGCGCTCGGTGAC	0.632																																					p.R300H													SARDH,NS,carcinoma,-1,1	SARDH	112	1	0			c.G899A												101.0	84.0	89.0					9																	136594903		2203	4300	6503	SO:0001583	missense	1757	exon6			TCGATGCGCTCGG		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.899G>A	9.37:g.136594903C>T	ENSP00000360938:p.Arg300His		Somatic	29	0	0		WXS	Illumina HiSeq		20	0.20	4	NM_007101	4	0.00	0	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807389	0.90623	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227;ENST00000535281;ENST00000371867;ENST00000393050;ENST00000298628	D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51	5.02	5.02	0.67125	FAD dependent oxidoreductase (1);	0.056428	0.64402	D	0.000003	D	0.90349	0.6980	M	0.84948	2.725	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	D	0.90979	0.4826	10	0.48119	T	0.1	-36.4375	18.3365	0.90290	0.0:1.0:0.0:0.0	.	300	Q9UL12	SARDH_HUMAN	H	300;300;132;300;300;300;211;278;300	ENSP00000360938:R300H;ENSP00000403084:R300H;ENSP00000415537:R132H;ENSP00000360933:R211H;ENSP00000298628:R300H	ENSP00000298628:R300H	R	-	2	0	SARDH	135584724	1.000000	0.71417	0.998000	0.56505	0.887000	0.51463	7.244000	0.78228	2.319000	0.78375	0.467000	0.42956	CGC			0.632	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054931.1			
ZNF41	7592	mdanderson.org	37	X	47308136	47308136	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chrX:47308136G>T	ENST00000377065.4	-	5	1672	c.1033C>A	c.(1033-1035)Cat>Aat	p.H345N	ZNF41_ENST00000313116.7_Missense_Mutation_p.H345N|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.H355N	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				ATTTTTTGATGTGTAATGAGG	0.398																																					p.H345N													.	.			0			c.C1033A												56.0	59.0	58.0					X																	47308136		2202	4293	6495	SO:0001583	missense	7592	exon5			TTTGATGTGTAAT	X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.1033C>A	X.37:g.47308136G>T	ENSP00000366265:p.His345Asn		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_007130	1	0.00	0	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	ENST00000377065.4	37	CCDS14279.1	.	.	.	.	.	.	.	.	.	.	G	8.626	0.892567	0.17613	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	D;D;D	0.86865	-2.18;-2.18;-2.18	3.68	3.68	0.42216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36268	N	0.002692	D	0.93442	0.7908	H	0.95151	3.63	0.32059	N	0.595894	D;D;B;D;D	0.54964	0.962;0.962;0.006;0.962;0.969	P;P;B;P;P	0.54544	0.641;0.641;0.004;0.641;0.755	D	0.94675	0.7860	10	0.87932	D	0	.	12.5615	0.56283	0.0:0.0:1.0:0.0	.	345;347;355;379;387	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	N	345;345;355	ENSP00000315173:H345N;ENSP00000366265:H345N;ENSP00000380243:H355N	ENSP00000315173:H345N	H	-	1	0	ZNF41	47193080	1.000000	0.71417	0.918000	0.36340	0.026000	0.11368	5.455000	0.66658	2.116000	0.64780	0.594000	0.82650	CAT			0.398	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056429.1		NM_153380	
HCFC1	3054	mdanderson.org	37	X	153217373	153217373	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chrX:153217373C>T	ENST00000310441.7	-	20	6145	c.5179G>A	c.(5179-5181)Gcc>Acc	p.A1727T	HCFC1_ENST00000354233.3_Missense_Mutation_p.A1658T|HCFC1_ENST00000369984.4_Missense_Mutation_p.A1772T	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1727					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTCTCAATGGCTGGGTCGTTG	0.657																																					p.A1727T													.	.			0			c.G5179A												17.0	20.0	19.0					X																	153217373		2011	4159	6170	SO:0001583	missense	3054	exon20			CAATGGCTGGGTC		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.5179G>A	X.37:g.153217373C>T	ENSP00000309555:p.Ala1727Thr		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_005334	41	0.00	0	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	CCDS44020.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.264|1.264	-0.615077|-0.615077	0.03663|0.03663	.|.	.|.	ENSG00000172534|ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233|ENST00000444191	T;T;T|.	0.03524|.	3.9;3.92;3.9|.	5.21|5.21	-9.92|-9.92	0.00455|0.00455	.|.	0.463064|.	0.24703|.	N|.	0.036298|.	T|T	0.23926|0.23926	0.0579|0.0579	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.29243|0.29243	-1.0018|-1.0018	10|5	0.14656|.	T|.	0.56|.	.|.	11.1023|11.1023	0.48182|0.48182	0.3077:0.5843:0.0:0.108|0.3077:0.5843:0.0:0.108	.|.	1727|.	P51610|.	HCFC1_HUMAN|.	T|N	1727;1772;1658|302	ENSP00000309555:A1727T;ENSP00000359001:A1772T;ENSP00000346174:A1658T|.	ENSP00000309555:A1727T|.	A|S	-|-	1|2	0|0	HCFC1|HCFC1	152870567|152870567	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.361000|0.361000	0.29550|0.29550	-1.313000|-1.313000	0.02718|0.02718	-1.800000|-1.800000	0.01247|0.01247	-0.403000|-0.403000	0.06358|0.06358	GCC|AGC			0.657	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061099.4		NM_005334	
SYNM	23336	hgsc.bcm.edu;mdanderson.org	37	15	99666940	99666940	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SN-A84X-01A-11D-A435-10	TCGA-SN-A84X-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d0b2beb-3dce-4db2-a954-9c296657443b	31d3449d-0532-4ab1-95ab-131b0431c63e	g.chr15:99666940G>T	ENST00000560674.1	+	3	560	c.91G>T	c.(91-93)Gga>Tga	p.G31*	RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000328642.7_Nonsense_Mutation_p.G316*|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000336292.6_Nonsense_Mutation_p.G316*			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	317	Coil 1A.|Interaction with DMD and UTRN.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						CTTATTGGAAGGAGAAAGTAA	0.388																																					.	Pancreas(125;1071 1762 21750 40003 40381)												.	.			0			.												86.0	82.0	83.0					15																	99666940		1847	4101	5948	SO:0001587	stop_gained	23336	.			TTGGAAGGAGAAA	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.91G>T	15.37:g.99666940G>T	ENSP00000453040:p.Gly31*		Somatic	85	0	0		WXS	Illumina HiSeq	.	68	0.07	5	.	0		0	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Nonsense_Mutation	SNP	ENST00000560674.1	37		.	.	.	.	.	.	.	.	.	.	G	39	7.527891	0.98339	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.6976	0.91607	0.0:0.0:1.0:0.0	.	.	.	.	X	316	.	ENSP00000330469:G316X	G	+	1	0	SYNM	97484463	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.831000	0.69330	2.770000	0.95276	0.655000	0.94253	GGA			0.388	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000415698.2		NM_145728	
