#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SPEN	23013	mdanderson.org	37	1	16265332	16265332	+	Silent	SNP	G	G	T	rs138107503		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr1:16265332G>T	ENST00000375759.3	+	14	11028	c.10824G>T	c.(10822-10824)gcG>gcT	p.A3608A		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3608	SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCAAGCAGGCGGCAGGGATCA	0.592																																					p.A3608A													.	.			0			c.G10824T												146.0	110.0	122.0					1																	16265332		2203	4300	6503	SO:0001819	synonymous_variant	23013	exon14			GCAGGCGGCAGGG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10824G>T	1.37:g.16265332G>T			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_015001	56	0.00	0	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	37	CCDS164.1																																																																																					0.592	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025993.1		NM_015001	
EIF4G3	8672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	21133864	21133864	+	Missense_Mutation	SNP	G	G	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr1:21133864G>C	ENST00000264211.8	-	31	4900	c.4706C>G	c.(4705-4707)aCg>aGg	p.T1569R	EIF4G3_ENST00000537738.1_Missense_Mutation_p.T1059R|EIF4G3_ENST00000536266.1_Missense_Mutation_p.T1173R|EIF4G3_ENST00000602326.1_Missense_Mutation_p.T1575R|EIF4G3_ENST00000374937.3_Missense_Mutation_p.T1575R|EIF4G3_ENST00000400422.1_Missense_Mutation_p.T1569R|EIF4G3_ENST00000374935.3_Missense_Mutation_p.T1289R	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1569	EIF4A-binding. {ECO:0000250}.|W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GAAGAATGCCGTGACAGATTT	0.453																																					p.T1605R													.	.			0			c.C4814G												196.0	194.0	195.0					1																	21133864		2203	4300	6503	SO:0001583	missense	8672	exon35			AATGCCGTGACAG	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.4706C>G	1.37:g.21133864G>C	ENSP00000264211:p.Thr1569Arg		Somatic	273	0	0		WXS	Illumina HiSeq	.	272	0.13	36	NM_001198801	110	0.19	21	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434966	0.83885	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	D;D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	5.6	5.6	0.85130	eIF4-gamma/eIF5/eIF2-epsilon (3);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.050239	0.85682	D	0.000000	D	0.90772	0.7103	M	0.66506	2.035	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;0.997;0.998	D;D;D;D;D	0.83275	0.996;0.991;0.981;0.966;0.974	D	0.91178	0.4974	10	0.87932	D	0	-10.8595	19.6136	0.95619	0.0:0.0:1.0:0.0	.	1764;1289;1173;1575;1569	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	R	1569;1765;1569;1289;1059;1575;1173	ENSP00000264211:T1569R;ENSP00000383274:T1569R;ENSP00000364071:T1289R;ENSP00000442010:T1059R;ENSP00000364073:T1575R;ENSP00000444693:T1173R	ENSP00000264211:T1569R	T	-	2	0	EIF4G3	21006451	1.000000	0.71417	0.948000	0.38648	0.972000	0.66771	9.835000	0.99442	2.641000	0.89580	0.585000	0.79938	ACG			0.453	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000007467.3		NM_003760	
WASF2	10163	broad.mit.edu	37	1	27736268	27736268	+	Silent	SNP	C	C	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr1:27736268C>T	ENST00000430629.2	-	8	1472	c.1257G>A	c.(1255-1257)ccG>ccA	p.P419P	WASF2_ENST00000536657.1_Intron	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	419					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		TATCAGAAAGCGGTGGTGGTA	0.612																																					p.P419P													.	WASF2	41		0			c.G1257A												75.0	71.0	72.0					1																	27736268		2203	4300	6503	SO:0001819	synonymous_variant	10163	exon8			AGAAAGCGGTGGT	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.1257G>A	1.37:g.27736268C>T			Somatic	276	0.0036231884	1		WXS	Illumina HiSeq	Phase_I	257	0.02	5	NM_006990	96	0.00	0	B4DZN0|O60794|Q9UDY7	Silent	SNP	ENST00000430629.2	37	CCDS304.1																																																																																					0.612	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009516.1		NM_006990	
CELSR2	1952	mdanderson.org	37	1	109792751	109792751	+	Missense_Mutation	SNP	T	T	C	rs200277265		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr1:109792751T>C	ENST00000271332.3	+	1	111	c.50T>C	c.(49-51)cTg>cCg	p.L17P		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	17					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ccgccgccgctgctgctgctg	0.751																																					p.L17P	NSCLC(158;1285 2011 34800 34852 42084)												CELSR2,colon,carcinoma,0,1	CELSR2	0	1	0			c.T50C												8.0	10.0	9.0					1																	109792751		1799	3668	5467	SO:0001583	missense	1952	exon1			CGCCGCTGCTGCT	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.50T>C	1.37:g.109792751T>C	ENSP00000271332:p.Leu17Pro		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001408	2	0.00	0	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	5.977	0.364215	0.11296	.	.	ENSG00000143126	ENST00000271332	T	0.70631	-0.5	4.25	-3.77	0.04346	.	.	.	.	.	T	0.20251	0.0487	N	0.08118	0	0.58432	P	4.000000000004E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.13098	-1.0522	8	0.51188	T	0.08	.	1.1702	0.01823	0.161:0.339:0.1649:0.3351	.	17	Q9HCU4	CELR2_HUMAN	P	17	ENSP00000271332:L17P	ENSP00000271332:L17P	L	+	2	0	CELSR2	109594274	0.000000	0.05858	0.003000	0.11579	0.062000	0.15995	-0.618000	0.05578	-0.422000	0.07405	0.404000	0.27445	CTG			0.751	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033200.1		NM_001408	
LOC400794	400794	broad.mit.edu	37	1	165467666	165467666	+	RNA	DEL	A	A	-	rs148043370	byFrequency	TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr1:165467666delA	ENST00000438275.1	-	0	1445				RP11-280O1.2_ENST00000418925.1_RNA|RP11-280O1.2_ENST00000421273.1_RNA|RP11-280O1.2_ENST00000416424.1_RNA|RP11-280O1.2_ENST00000452283.1_RNA|RP11-280O1.2_ENST00000415000.1_RNA																							TGTTATTATTAAAAAATCAAC	0.378													AAAAA|AAAAAA|AAAAA|insertion	410	0.081869	0.1021	0.1297	5008	,	,		15451	0.0794		0.0338	False		,,,				2504	0.0726				.													.	.			0			.																																											0	.			ATTATTAAAAAAT																													1.37:g.165467666delA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	DEL	ENST00000438275.1	37																																																																																						0.378	RP11-280O1.2-002	KNOWN	non_canonical_TEC|basic	antisense	antisense		OTTHUMT00000083787.1			
TPR	7175	broad.mit.edu	37	1	186295344	186295344	+	Missense_Mutation	SNP	A	A	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr1:186295344A>T	ENST00000367478.4	-	41	6209	c.5913T>A	c.(5911-5913)gaT>gaA	p.D1971E		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1971	Poly-Asp.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.D1971E(2)|p.D1958E(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		catcatcatcatcttcctcat	0.423			T	NTRK1	papillary thyroid																																p.D1971E				Dom	yes		1	1q25	7175	translocated promoter region		E	TPR_ENST00000367478,NS,carcinoma,0,2	TPR	441	2	3	Substitution - Missense(3)	prostate(3)	c.T5913A												89.0	85.0	86.0					1																	186295344		2060	4205	6265	SO:0001583	missense	7175	exon41			ATCATCATCTTCC	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5913T>A	1.37:g.186295344A>T	ENSP00000356448:p.Asp1971Glu		Somatic	62	0.0161290323	1		WXS	Illumina HiSeq	Phase_I	103	0.04	4	NM_003292	218	0.00	0	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.380356	0.00205	.	.	ENSG00000047410	ENST00000367478	T	0.29917	1.55	4.03	-8.06	0.01102	.	1.066870	0.07167	N	0.851712	T	0.12347	0.0300	N	0.25890	0.77	0.21355	N	0.999713	B	0.02656	0.0	B	0.01281	0.0	T	0.25502	-1.0130	10	0.05351	T	0.99	.	2.0739	0.03619	0.2947:0.0732:0.2235:0.4085	.	1971	P12270	TPR_HUMAN	E	1971	ENSP00000356448:D1971E	ENSP00000356448:D1971E	D	-	3	2	TPR	184561967	0.017000	0.18338	0.023000	0.16930	0.542000	0.35054	-2.198000	0.01239	-4.545000	0.00043	-2.200000	0.00306	GAT			0.423	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086353.2		NM_003292	
ARL5B	221079	mdanderson.org	37	10	18948572	18948572	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr10:18948572G>T	ENST00000377275.3	+	1	239	c.6G>T	c.(4-6)ggG>ggT	p.G2G	ARL5B-AS1_ENST00000449529.1_lincRNA	NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	2					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						TCGTGATGGGGCTGATCTTCG	0.711																																					p.G2G													.	.			0			c.G6T												21.0	21.0	21.0					10																	18948572		2200	4298	6498	SO:0001819	synonymous_variant	221079	exon1			GATGGGGCTGATC	AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.6G>T	10.37:g.18948572G>T			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	74	0.05	4	NM_178815	10	0.00	0		Silent	SNP	ENST00000377275.3	37	CCDS7131.1																																																																																					0.711	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047078.1		NM_178815	
PIPSL	266971	broad.mit.edu	37	10	95718362	95718365	+	RNA	DEL	TTTC	TTTC	-			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	TTTC	TTTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr10:95718362_95718365delTTTC	ENST00000480546.1	-	0	2932_2935					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										tttcttttcttttctttctttctt	0.333																																					.													.	.			0			.																																											0	.			TTTTCTTTTCTTT	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95718370_95718373delTTTC			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	15	0.67	10	.	0		0	Q6NUK8	RNA	DEL	ENST00000480546.1	37																																																																																						0.333	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene		OTTHUMT00000351483.1		NR_002319	
ALDH18A1	5832	mdanderson.org	37	10	97397175	97397175	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr10:97397175G>T	ENST00000371224.2	-	4	459	c.322C>A	c.(322-324)Cag>Aag	p.Q108K	ALDH18A1_ENST00000371221.3_Missense_Mutation_p.Q108K|ALDH18A1_ENST00000483788.1_5'UTR	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	108	Glutamate 5-kinase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		TCTCTGCCCTGATTCTGCAGC	0.542																																					p.Q108K													.	.			0			c.C322A												102.0	86.0	91.0					10																	97397175		2203	4300	6503	SO:0001583	missense	5832	exon4			TGCCCTGATTCTG	X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.322C>A	10.37:g.97397175G>T	ENSP00000360268:p.Gln108Lys		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	58	0.07	4	NM_001017423	126	0.00	0	B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Missense_Mutation	SNP	ENST00000371224.2	37	CCDS7443.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.612815	0.66672	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	T;T	0.71341	-0.56;-0.56	5.6	5.6	0.85130	Aspartate/glutamate/uridylate kinase (3);	0.049227	0.85682	D	0.000000	T	0.59595	0.2205	N	0.20357	0.565	0.80722	D	1	B;B	0.21381	0.055;0.045	B;B	0.29353	0.101;0.039	T	0.53906	-0.8372	10	0.22706	T	0.39	-14.9541	17.102	0.86652	0.0:0.0:1.0:0.0	.	108;108	P54886;P54886-2	P5CS_HUMAN;.	K	108	ENSP00000360268:Q108K;ENSP00000360265:Q108K	ENSP00000360265:Q108K	Q	-	1	0	ALDH18A1	97387165	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.259000	0.95561	2.642000	0.89623	0.555000	0.69702	CAG			0.542	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049552.1		NM_002860	
CFAP46	54777	mdanderson.org	37	10	134672665	134672665	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr10:134672665T>C	ENST00000368586.5	-	38	5385	c.5285A>G	c.(5284-5286)gAt>gGt	p.D1762G	TTC40_ENST00000263170.5_5'Flank	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CAACAGGCCATCATCCATCTC	0.522																																					p.D1762G													.	.			0			c.A5285G																																									SO:0001583	missense	54777	exon38			AGGCCATCATCCA																												ENST00000368586.5:c.5285A>G	10.37:g.134672665T>C	ENSP00000357575:p.Asp1762Gly		Somatic	90	0.0111111111	1		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_001200049	0		0		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	t	11.59	1.683906	0.29872	.	.	ENSG00000171811	ENST00000368586	T	0.10382	2.88	4.17	0.435	0.16544	.	.	.	.	.	T	0.06917	0.0176	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.39231	-0.9624	7	0.48119	T	0.1	.	6.3051	0.21135	0.0:0.321:0.0:0.679	.	.	.	.	G	1762	ENSP00000357575:D1762G	ENSP00000357575:D1762G	D	-	2	0	C10orf93	134522655	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.539000	0.06113	-0.014000	0.14175	-0.268000	0.10319	GAT			0.522	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000051095.3			
FJX1	24147	mdanderson.org	37	11	35640729	35640729	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr11:35640729G>T	ENST00000317811.4	+	1	995	c.545G>T	c.(544-546)gGc>gTc	p.G182V		NM_014344.3	NP_055159.2	Q86VR8	FJX1_HUMAN	four jointed box 1 (Drosophila)	182					retina layer formation (GO:0010842)	extracellular space (GO:0005615)				lung(1)|urinary_tract(1)	2	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				GTGCGCTACGGCATCAACCCG	0.731																																					p.G182V	Melanoma(161;10 2587 27165 47356)												.	.			0			c.G545T												8.0	10.0	9.0					11																	35640729		1655	3632	5287	SO:0001583	missense	24147	exon1			GCTACGGCATCAA	AJ245599	CCDS44570.1	11p13	2012-05-18				ENSG00000179431			17166	protein-coding gene	gene with protein product	"""putative secreted ligand homologous to fjx1"""	612206				7647465, 10072791	Standard	NM_014344		Approved	FLJ22416, FLJ25593	uc001mwh.3	Q86VR8		ENST00000317811.4:c.545G>T	11.37:g.35640729G>T	ENSP00000400223:p.Gly182Val		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_014344	5	0.00	0	B2RCA9|Q9UGK6	Missense_Mutation	SNP	ENST00000317811.4	37	CCDS44570.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.979646	0.53827	.	.	ENSG00000179431	ENST00000317811	T	0.35789	1.29	4.23	4.23	0.50019	.	.	.	.	.	T	0.53753	0.1816	L	0.58101	1.795	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	T	0.51309	-0.8722	9	0.33940	T	0.23	-8.8104	14.1062	0.65091	0.0:0.0:1.0:0.0	.	182	Q86VR8	FJX1_HUMAN	V	182	ENSP00000400223:G182V	ENSP00000400223:G182V	G	+	2	0	FJX1	35597305	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.002000	0.76304	1.893000	0.54813	0.462000	0.41574	GGC			0.731	FJX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389078.1		NM_014344	
OR5AP2	338675	mdanderson.org	37	11	56409844	56409844	+	Silent	SNP	G	G	A			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr11:56409844G>A	ENST00000302981.1	-	1	71	c.72C>T	c.(70-72)tcC>tcT	p.S24S	OR5AP2_ENST00000544374.1_Silent_p.S25S	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						CTGGATTGTCGGAAAGTCCTA	0.388																																					p.S24S													.	.			0			c.C72T												101.0	94.0	96.0					11																	56409844		2201	4296	6497	SO:0001819	synonymous_variant	338675	exon1			ATTGTCGGAAAGT	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.72C>T	11.37:g.56409844G>A			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_001002925	0		0	B2RNM8	Silent	SNP	ENST00000302981.1	37	CCDS31534.1																																																																																					0.388	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000391613.1		NM_001002925	
CTNND1	1500	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	57573388	57573392	+	Frame_Shift_Del	DEL	TATCA	TATCA	-			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	TATCA	TATCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr11:57573388_57573392delTATCA	ENST00000399050.4	+	10	2293_2297	c.1757_1761delTATCA	c.(1756-1761)ttatcafs	p.LS586fs	CTNND1_ENST00000524630.1_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000526938.1_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000526772.1_Frame_Shift_Del_p.LS263fs|CTNND1_ENST00000428599.2_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000528232.1_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000528621.1_Frame_Shift_Del_p.LS532fs|CTNND1_ENST00000358694.6_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000527467.1_Frame_Shift_Del_p.LS263fs|CTNND1_ENST00000532844.1_Frame_Shift_Del_p.LS532fs|CTNND1_ENST00000533667.1_Frame_Shift_Del_p.LS263fs|CTNND1_ENST00000399039.4_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000415361.2_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000531014.1_Frame_Shift_Del_p.LS263fs|CTNND1_ENST00000530748.1_Frame_Shift_Del_p.LS532fs|CTNND1_ENST00000532245.1_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000529526.1_Frame_Shift_Del_p.LS532fs|CTNND1_ENST00000426142.2_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000532463.1_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000360682.6_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000532787.1_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000361796.4_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000526357.1_Frame_Shift_Del_p.LS532fs|CTNND1_ENST00000361332.4_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000529919.1_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000529986.1_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000530094.1_Frame_Shift_Del_p.LS485fs|CTNND1_ENST00000534579.1_Frame_Shift_Del_p.LS532fs|CTNND1_ENST00000529873.1_Frame_Shift_Del_p.LS532fs|CTNND1_ENST00000361391.6_Frame_Shift_Del_p.LS586fs|CTNND1_ENST00000525902.1_Frame_Shift_Del_p.LS263fs|CTNND1_ENST00000532649.1_Frame_Shift_Del_p.LS532fs	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	586					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				CTTCGGAACTTATCATATCAAGTTC	0.468																																					p.586_587del													.	CTNND1	203		0			c.1756_1760del																																									SO:0001589	frameshift_variant	1500	exon10			GGAACTTATCATA	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.1757_1761delTATCA	11.37:g.57573393_57573397delTATCA	ENSP00000382004:p.Leu586fs		Somatic	99	0	0		WXS	Illumina HiSeq	.	86	0.36	31	NM_001085461	61	0.00	0	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Frame_Shift_Del	DEL	ENST00000399050.4	37	CCDS44604.1																																																																																					0.468	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000393944.1		NM_001331	
ZP1	22917	mdanderson.org	37	11	60640737	60640737	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr11:60640737G>T	ENST00000278853.5	+	7	1215	c.1215G>T	c.(1213-1215)ctG>ctT	p.L405L		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	405	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CCGGCCCCCTGCGGCTTGAGC	0.597																																					p.L405L													.	.			0			c.G1215T												97.0	96.0	96.0					11																	60640737		2203	4299	6502	SO:0001819	synonymous_variant	22917	exon7			CCCCCTGCGGCTT	BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.1215G>T	11.37:g.60640737G>T			Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	65	0.06	4	NM_207341	0		0		Silent	SNP	ENST00000278853.5	37	CCDS31572.1																																																																																					0.597	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396329.1		NM_207341	
ZNHIT2	741	mdanderson.org	37	11	64884376	64884376	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr11:64884376G>T	ENST00000310597.4	-	1	794	c.750C>A	c.(748-750)gcC>gcA	p.A250A	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	250							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						GGGCACCCAGGGCTCCGGAAA	0.672																																					p.A250A													.	.			0			c.C750A												15.0	17.0	16.0					11																	64884376		2189	4279	6468	SO:0001819	synonymous_variant	741	exon1			ACCCAGGGCTCCG		CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.750C>A	11.37:g.64884376G>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_014205	41	0.00	0	Q3SY14|Q8IUV0	Silent	SNP	ENST00000310597.4	37	CCDS8094.1																																																																																					0.672	ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385260.1		NM_014205	
RNASEH2C	84153	mdanderson.org	37	11	65487864	65487864	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr11:65487864C>T	ENST00000308418.4	-	2	385	c.197G>A	c.(196-198)cGc>cAc	p.R66H	RNASEH2C_ENST00000527610.1_Missense_Mutation_p.R66H|RNASEH2C_ENST00000528220.1_5'UTR	NM_032193.3	NP_115569.2	Q8TDP1	RNH2C_HUMAN	ribonuclease H2, subunit C	66					RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)				cervix(1)	1						CCGTAGACAGCGGCCCCGAAA	0.672																																					p.R66H													.	.			0			c.G197A												43.0	50.0	48.0					11																	65487864		2201	4296	6497	SO:0001583	missense	84153	exon2			AGACAGCGGCCCC	AF312034	CCDS8111.1	11q13.1	2014-09-17							24116	protein-coding gene	gene with protein product	"""Aicardi-Goutieres syndrome 3"""	610330				8244390, 16845400	Standard	NM_032193		Approved	AYP1, AGS3	uc001ofn.3	Q8TDP1		ENST00000308418.4:c.197G>A	11.37:g.65487864C>T	ENSP00000308193:p.Arg66His		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_032193	193	0.00	0	Q9H7F5	Missense_Mutation	SNP	ENST00000308418.4	37	CCDS8111.1	.	.	.	.	.	.	.	.	.	.	C	34	5.355090	0.95854	.	.	ENSG00000172922	ENST00000308418;ENST00000527610	D;D	0.95272	-3.66;-3.66	4.31	4.31	0.51392	.	0.000000	0.53938	D	0.000047	D	0.97427	0.9158	M	0.88906	2.99	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.98194	1.0464	10	0.72032	D	0.01	-21.6934	14.7185	0.69289	0.0:1.0:0.0:0.0	.	66	Q8TDP1	RNH2C_HUMAN	H	66	ENSP00000308193:R66H;ENSP00000432897:R66H	ENSP00000308193:R66H	R	-	2	0	RNASEH2C	65244440	0.998000	0.40836	0.910000	0.35882	0.905000	0.53344	4.707000	0.61852	2.125000	0.65367	0.549000	0.68633	CGC			0.672	RNASEH2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390693.2		NM_032193	
PDE2A	5138	broad.mit.edu	37	11	72299854	72299854	+	Silent	SNP	G	G	A	rs138984931		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr11:72299854G>A	ENST00000334456.5	-	13	1289	c.1044C>T	c.(1042-1044)tgC>tgT	p.C348C	PDE2A_ENST00000540345.1_Silent_p.C339C|PDE2A_ENST00000544570.1_Silent_p.C341C|RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000418754.2_Silent_p.C233C|PDE2A_ENST00000376450.3_Intron|PDE2A_ENST00000444035.2_Silent_p.C339C	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	348	GAF 1.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	TGTTGAAGGCGCAGGCCAAGG	0.562													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21278	0.0		0.0	False		,,,				2504	0.0				p.C348C													.	PDE2A	156		0			c.C1044T							G	,,	2,4398	4.2+/-10.8	0,2,2198	81.0	76.0	77.0		1023,1017,1044	-0.2	1.0	11	dbSNP_134	77	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous,coding-synonymous	PDE2A	NM_001143839.3,NM_001146209.2,NM_002599.4	,,	0,3,6490	AA,AG,GG		0.0116,0.0455,0.0231	,,	341/935,339/933,348/942	72299854	3,12983	2200	4293	6493	SO:0001819	synonymous_variant	5138	exon13			GAAGGCGCAGGCC	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.1044C>T	11.37:g.72299854G>A			Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	135	0.03	4	NM_002599	1	0.00	0	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Silent	SNP	ENST00000334456.5	37	CCDS8216.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	10.09	1.254940	0.22965	4.55E-4	1.16E-4	ENSG00000186642	ENST00000538299	.	.	.	4.95	-0.238	0.13055	.	.	.	.	.	T	0.55130	0.1901	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46527	-0.9185	4	.	.	.	.	8.9027	0.35503	0.4753:0.0:0.5247:0.0	.	.	.	.	C	110	.	.	R	-	1	0	PDE2A	71977502	0.659000	0.27411	0.990000	0.47175	0.986000	0.74619	-0.076000	0.11412	-0.231000	0.09825	0.491000	0.48974	CGC			0.562	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219839.2		NM_002599	
PDE3A	5139	broad.mit.edu	37	12	20522511	20522511	+	Missense_Mutation	SNP	C	C	A	rs200052001		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr12:20522511C>A	ENST00000359062.3	+	1	333	c.293C>A	c.(292-294)gCg>gAg	p.A98E	RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	98	Poly-Ala.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.A98V(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GCGGCGGCGGCGGAGGAGGAG	0.741													A|||	1	0.000199681	0.0	0.0	5008	,	,		11314	0.0		0.001	False		,,,				2504	0.0				p.A98E													PDE3A,colon,NS,0,1	PDE3A	184	1	1	Substitution - Missense(1)	large_intestine(1)	c.C293A							A	GLU/ALA	0,4082		0,0,2041	4.0	4.0	4.0		293	-5.4	0.0	12		4	2,8076		0,2,4037	no	missense	PDE3A	NM_000921.4	107	0,2,6078	AA,AC,CC		0.0248,0.0,0.0164	benign	98/1142	20522511	2,12158	2041	4039	6080	SO:0001583	missense	5139	exon1			CGGCGGCGGAGGA		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.293C>A	12.37:g.20522511C>A	ENSP00000351957:p.Ala98Glu		Somatic	45	0.0222222222	1		WXS	Illumina HiSeq	Phase_I	88	0.05	4	NM_000921	0		0	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.464469	0.01053	0.0	2.48E-4	ENSG00000172572	ENST00000359062	T	0.61627	0.09	4.4	-5.38	0.02673	.	1.144360	0.06539	N	0.742936	T	0.33206	0.0855	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42120	-0.9470	10	0.02654	T	1	.	9.2036	0.37275	0.6781:0.2354:0.0:0.0865	.	98	Q14432	PDE3A_HUMAN	E	98	ENSP00000351957:A98E	ENSP00000351957:A98E	A	+	2	0	PDE3A	20413778	0.000000	0.05858	0.003000	0.11579	0.068000	0.16541	-1.510000	0.02262	-1.958000	0.01019	-3.067000	0.00067	GCG			0.741	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401756.2			
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57898052	57898052	+	Silent	SNP	G	G	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr12:57898052G>C	ENST00000262027.5	+	11	1472	c.1338G>C	c.(1336-1338)tcG>tcC	p.S446S	MARS_ENST00000315473.5_Silent_p.S212S|MARS_ENST00000447721.2_3'UTR	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	446					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	TGGTGCAGTCGAGCCAGCACC	0.542																																					p.S446S													MARS,colon,carcinoma,+1,3	MARS	1	3	0			c.G1338C												134.0	125.0	128.0					12																	57898052		2203	4300	6503	SO:0001819	synonymous_variant	4141	exon11			GCAGTCGAGCCAG	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.1338G>C	12.37:g.57898052G>C			Somatic	156	0.0064102564	1		WXS	Illumina HiSeq	.	187	0.10	19	NM_004990	570	0.11	63	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Silent	SNP	ENST00000262027.5	37	CCDS8942.1																																																																																					0.542	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407014.1		NM_004990	
PLBD2	196463	mdanderson.org	37	12	113826311	113826311	+	Silent	SNP	C	C	T	rs377323141		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr12:113826311C>T	ENST00000280800.3	+	12	1681	c.1650C>T	c.(1648-1650)agC>agT	p.S550S	PLBD2_ENST00000545182.2_Silent_p.S518S	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	550					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TGGCGGCCAGCGGTCCCACGT	0.692																																					p.S550S													.	.			0			c.C1650T								,	0,4402		0,0,2201	27.0	27.0	27.0		1554,1650	-1.9	1.0	12		27	1,8597		0,1,4298	no	coding-synonymous,coding-synonymous	PLBD2	NM_001159727.1,NM_173542.3	,	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	,	518/558,550/590	113826311	1,12999	2201	4299	6500	SO:0001819	synonymous_variant	196463	exon12			GGCCAGCGGTCCC	BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.1650C>T	12.37:g.113826311C>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_173542	49	0.00	0	F5H5E2	Silent	SNP	ENST00000280800.3	37	CCDS9168.1																																																																																					0.692	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404835.1		NM_173542	
TMEM132D	121256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130184692	130184692	+	Missense_Mutation	SNP	C	C	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr12:130184692C>G	ENST00000422113.2	-	2	957	c.631G>C	c.(631-633)Ggg>Cgg	p.G211R	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	211					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.G211R(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTCCTCCTCCCGGCAACCACC	0.706																																					p.G211R													TMEM132D,face,carcinoma,0,1	TMEM132D	0	1	1	Substitution - Missense(1)	skin(1)	c.G631C												25.0	28.0	27.0					12																	130184692		2201	4297	6498	SO:0001583	missense	121256	exon2			TCCTCCCGGCAAC	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.631G>C	12.37:g.130184692C>G	ENSP00000408581:p.Gly211Arg		Somatic	97	0	0		WXS	Illumina HiSeq	.	85	0.18	15	NM_133448	8	0.38	3	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671085	0.29693	.	.	ENSG00000151952	ENST00000422113	T	0.12569	2.67	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000003	T	0.33411	0.0862	M	0.68317	2.08	0.43338	D	0.995387	D	0.89917	1.0	D	0.87578	0.998	T	0.01520	-1.1334	9	.	.	.	-43.1854	11.519	0.50541	0.0:0.9184:0.0:0.0816	.	211	Q14C87	T132D_HUMAN	R	211	ENSP00000408581:G211R	.	G	-	1	0	TMEM132D	128750645	1.000000	0.71417	0.329000	0.25429	0.009000	0.06853	5.481000	0.66826	2.482000	0.83794	0.650000	0.86243	GGG			0.706	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399592.1		NM_133448	
ULK1	8408	mdanderson.org	37	12	132398927	132398927	+	Silent	SNP	C	C	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr12:132398927C>T	ENST00000321867.4	+	16	1629	c.1278C>T	c.(1276-1278)tgC>tgT	p.C426C		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	426					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GCAGCAGGTGCGGCGCCTCTG	0.627																																					p.C426C													.	.			0			c.C1278T												68.0	64.0	65.0					12																	132398927		2203	4295	6498	SO:0001819	synonymous_variant	8408	exon16			CAGGTGCGGCGCC	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.1278C>T	12.37:g.132398927C>T			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_003565	97	0.00	0	Q9UQ28	Silent	SNP	ENST00000321867.4	37	CCDS9274.1																																																																																					0.627	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397769.3			
SUGT1P3	283507	broad.mit.edu	37	13	41495331	41495332	+	RNA	INS	-	-	A	rs71298970		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr13:41495331_41495332insA	ENST00000304932.4	-	0	214					NR_003365.2				SUGT1 pseudogene 3																		TTCTAGTCATTAAAAAAAAAAA	0.371																																					.													.	SUGT1P3	1		0			.																																											0	.			AGTCATTAAAAAA			13q14.11	2013-10-18	2013-10-18	2010-10-27	ENSG00000239827	ENSG00000239827			20513	pseudogene	pseudogene			"""SGT1, suppressor of G2 allele of SKP1 like 1 (S. cerevisiae)"", ""suppressor of G2 allele of SKP1 (S. cerevisiae) pseudogene 3"""	SUGT1L1			Standard	NR_003365		Approved		uc001uxq.3		OTTHUMG00000016780		13.37:g.41495342_41495342dupA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	10	0.50	5	.	1	0.00	0		RNA	INS	ENST00000304932.4	37																																																																																						0.371	SUGT1P3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000044647.3			
FAM155A	728215	mdanderson.org	37	13	108518661	108518661	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr13:108518661T>C	ENST00000375915.2	-	1	422	c.284A>G	c.(283-285)cAg>cGg	p.Q95R		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	95	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ctgccgccgctgctgctgctg	0.731																																					p.Q95R													FAM155A,NS,carcinoma,0,2	FAM155A	0	2	0			c.A284G												8.0	11.0	10.0					13																	108518661		1836	3781	5617	SO:0001583	missense	728215	exon1			CGCCGCTGCTGCT	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.284A>G	13.37:g.108518661T>C	ENSP00000365080:p.Gln95Arg		Somatic	25	0.04	1		WXS	Illumina HiSeq	Phase_I	29	0.07	2	NM_001080396	8	0.00	0	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	T	0.110	-1.140286	0.01728	.	.	ENSG00000204442	ENST00000375915	T	0.57436	0.4	5.23	3.12	0.35913	Armadillo-like helical (1);	0.660669	0.12437	N	0.469027	T	0.30417	0.0764	N	0.25332	0.735	0.19300	N	0.999978	B	0.02656	0.0	B	0.01281	0.0	T	0.27806	-1.0063	10	0.07030	T	0.85	.	3.3913	0.07290	0.0:0.517:0.2156:0.2674	.	95	B1AL88	F155A_HUMAN	R	95	ENSP00000365080:Q95R	ENSP00000365080:Q95R	Q	-	2	0	FAM155A	107316662	0.206000	0.23470	1.000000	0.80357	0.982000	0.71751	0.127000	0.15790	1.195000	0.43115	-0.181000	0.13052	CAG			0.731	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045736.2		NM_001080396	
COL4A2	1284	mdanderson.org	37	13	111080922	111080922	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr13:111080922G>T	ENST00000360467.5	+	7	775	c.469G>T	c.(469-471)Ggg>Tgg	p.G157W		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	157					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGGGTTCACCGGGCCTCCCGT	0.687																																					p.G157W													.	.			0			c.G469T												23.0	30.0	28.0					13																	111080922		1881	4092	5973	SO:0001583	missense	1284	exon7			TTCACCGGGCCTC	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.469G>T	13.37:g.111080922G>T	ENSP00000353654:p.Gly157Trp		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001846	111	0.00	0	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378308	0.61735	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.99369	-5.78	5.38	5.38	0.77491	.	0.000000	0.53938	D	0.000059	D	0.99732	0.9895	H	0.98769	4.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97031	0.9750	10	0.87932	D	0	.	19.1515	0.93491	0.0:0.0:1.0:0.0	.	157	P08572	CO4A2_HUMAN	W	157	ENSP00000353654:G157W	ENSP00000257309:G157W	G	+	1	0	COL4A2	109878923	1.000000	0.71417	0.231000	0.23993	0.009000	0.06853	7.151000	0.77411	2.514000	0.84764	0.655000	0.94253	GGG			0.687	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045761.2		NM_001846	
GAS6	2621	mdanderson.org	37	13	114542742	114542742	+	Missense_Mutation	SNP	C	C	A			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr13:114542742C>A	ENST00000327773.6	-	5	571	c.425G>T	c.(424-426)tGc>tTc	p.C142F	GAS6_ENST00000357389.3_Missense_Mutation_p.C142F|GAS6_ENST00000355761.4_Missense_Mutation_p.C88F|GAS6-AS1_ENST00000458001.1_RNA	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	142	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				TTTACACAGGCAGAAGAAGTT	0.617																																					p.C142F													.	.			0			c.G425T												126.0	116.0	119.0					13																	114542742		2203	4300	6503	SO:0001583	missense	2621	exon5			CACAGGCAGAAGA		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.425G>T	13.37:g.114542742C>A	ENSP00000331831:p.Cys142Phe		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_000820	67	0.00	0	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	37	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	c	24.7	4.565135	0.86439	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000327773	D;D;D	0.96265	-3.96;-3.96;-3.96	4.59	4.59	0.56863	.	.	.	.	.	D	0.98918	0.9633	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99585	1.0974	9	0.87932	D	0	-32.7963	17.4297	0.87536	0.0:1.0:0.0:0.0	.	142	Q14393-2	.	F	142;88;142	ENSP00000349962:C142F;ENSP00000348003:C88F;ENSP00000331831:C142F	ENSP00000331831:C142F	C	-	2	0	GAS6	113571201	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.961000	0.70356	2.097000	0.63578	0.479000	0.44913	TGC			0.617	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000045946.2		NM_000820	
CHGA	1113	mdanderson.org	37	14	93398725	93398725	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr14:93398725G>T	ENST00000216492.5	+	7	1099	c.819G>T	c.(817-819)gaG>gaT	p.E273D	CHGA_ENST00000334654.4_Missense_Mutation_p.E122D	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	273					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		GTCGGTCGGAGGCTCTGGCTG	0.652																																					p.E273D	Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)												.	.			0			c.G819T												23.0	18.0	20.0					14																	93398725		2200	4296	6496	SO:0001583	missense	1113	exon7			GTCGGAGGCTCTG		CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.819G>T	14.37:g.93398725G>T	ENSP00000216492:p.Glu273Asp		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001275	72	0.00	0	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	37	CCDS9906.1	.	.	.	.	.	.	.	.	.	.	G	5.729	0.318919	0.10845	.	.	ENSG00000100604	ENST00000216492;ENST00000334654	T;T	0.01560	4.77;4.77	4.36	3.45	0.39498	.	1.537520	0.03778	N	0.260850	T	0.02571	0.0078	L	0.46614	1.455	0.09310	N	1	B;B	0.14438	0.002;0.01	B;B	0.15484	0.006;0.013	T	0.54316	-0.8312	10	0.12430	T	0.62	-9.1907	7.9596	0.30064	0.0:0.1748:0.6449:0.1803	.	122;273	G5E968;P10645	.;CMGA_HUMAN	D	273;122	ENSP00000216492:E273D;ENSP00000334023:E122D	ENSP00000216492:E273D	E	+	3	2	CHGA	92468478	0.859000	0.29813	0.026000	0.17262	0.573000	0.36030	2.089000	0.41672	0.941000	0.37499	0.561000	0.74099	GAG			0.652	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412411.1		NM_001275	
NUDT14	256281	mdanderson.org	37	14	105639424	105639424	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr14:105639424G>T	ENST00000392568.2	-	5	696	c.603C>A	c.(601-603)acC>acA	p.T201T	NUDT14_ENST00000550912.1_5'UTR|RP11-44N21.4_ENST00000548203.1_RNA	NM_177533.4	NP_803877.2	O95848	NUD14_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 14	201	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ADP-ribose diphosphatase activity (GO:0047631)|metal ion binding (GO:0046872)|UDP-sugar diphosphatase activity (GO:0008768)			cervix(2)|endometrium(1)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	14		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TGACGCCGAGGGTCTTGGGGA	0.632										HNSCC(42;0.11)																											p.T201T													.	.			0			c.C603A												81.0	81.0	81.0					14																	105639424		2202	4295	6497	SO:0001819	synonymous_variant	256281	exon5			GCCGAGGGTCTTG	AB087802	CCDS10000.1	14q32.33	2013-02-15			ENSG00000183828	ENSG00000183828		"""Nudix motif containing"""	20141	protein-coding gene	gene with protein product		609219				12429023	Standard	NM_177533		Approved	UGPP	uc010tyn.3	O95848	OTTHUMG00000170372	ENST00000392568.2:c.603C>A	14.37:g.105639424G>T			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_177533	122	0.00	0	Q86SJ8	Silent	SNP	ENST00000392568.2	37	CCDS10000.1																																																																																					0.632	NUDT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000074544.4		NM_177533	
VPS13C	54832	broad.mit.edu	37	15	62283898	62283898	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr15:62283898T>C	ENST00000261517.5	-	17	1530	c.1457A>G	c.(1456-1458)aAg>aGg	p.K486R	VPS13C_ENST00000249837.3_Missense_Mutation_p.K443R|VPS13C_ENST00000395896.4_Missense_Mutation_p.K486R|VPS13C_ENST00000395898.3_Missense_Mutation_p.K443R	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTCTTCGTCCTTTTTCTTAGA	0.373																																					p.K486R													.	VPS13C	506		0			c.A1457G												163.0	170.0	168.0					15																	62283898		2203	4300	6503	SO:0001583	missense	54832	exon17			TCGTCCTTTTTCT	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.1457A>G	15.37:g.62283898T>C	ENSP00000261517:p.Lys486Arg		Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	286	0.01	4	NM_020821	1	0.00	0		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.955074	0.53293	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.47177	0.86;0.85;1.02	5.78	4.67	0.58626	.	0.251660	0.39341	N	0.001393	T	0.38348	0.1037	L	0.41573	1.285	0.29349	N	0.865443	B;B;B;B	0.12013	0.002;0.002;0.005;0.001	B;B;B;B	0.12837	0.005;0.005;0.008;0.003	T	0.30327	-0.9982	10	0.38643	T	0.18	.	10.9823	0.47501	0.0:0.0738:0.0:0.9262	.	443;486;443;486	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	R	443;486;486;486	ENSP00000249837:K443R;ENSP00000261517:K486R;ENSP00000379233:K486R	ENSP00000249837:K443R	K	-	2	0	VPS13C	60071190	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.844000	0.55873	1.032000	0.39892	0.482000	0.46254	AAG			0.373	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000415997.1		NM_017684	
IGDCC4	57722	mdanderson.org	37	15	65688201	65688201	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr15:65688201G>T	ENST00000352385.2	-	7	1507	c.1298C>A	c.(1297-1299)aCg>aAg	p.T433K		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	433	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						AGTGACCCGCGTGGGGGCGCT	0.692																																					p.T433K													.	.			0			c.C1298A												11.0	11.0	11.0					15																	65688201		2167	4248	6415	SO:0001583	missense	57722	exon7			ACCCGCGTGGGGG		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.1298C>A	15.37:g.65688201G>T	ENSP00000319623:p.Thr433Lys		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_020962	0		0	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.583470	0.28268	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.57752	0.38	4.45	4.45	0.53987	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.326366	0.31145	N	0.008176	T	0.40222	0.1108	L	0.34521	1.04	0.32132	N	0.586653	B	0.23442	0.085	B	0.27170	0.077	T	0.45145	-0.9281	10	0.21540	T	0.41	-13.1258	11.0657	0.47974	0.0:0.0:0.6766:0.3234	.	433	Q8TDY8	IGDC4_HUMAN	K	433;162	ENSP00000319623:T433K	ENSP00000319623:T433K	T	-	2	0	IGDCC4	63475254	0.999000	0.42202	1.000000	0.80357	0.729000	0.41735	2.855000	0.48333	2.187000	0.69744	0.462000	0.41574	ACG			0.692	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000256825.2		NM_020962	
PCSK6	5046	broad.mit.edu	37	15	101968168	101968168	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr15:101968168G>A	ENST00000348070.1	-	7	748	c.749C>T	c.(748-750)gCg>gTg	p.A250V	PCSK6_ENST00000331826.7_Missense_Mutation_p.A85V|PCSK6_ENST00000358417.3_Missense_Mutation_p.A250V|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000398181.2_Missense_Mutation_p.A250V|PCSK6_ENST00000344273.2_Missense_Mutation_p.A250V	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	251	Peptidase S8.				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AACTTCTCCCGCACAACGAGT	0.522																																					.													.	PCSK6	202		0			.												28.0	31.0	30.0					15																	101968168		2053	4190	6243	SO:0001583	missense	5046	.			TCTCCCGCACAAC		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.749C>T	15.37:g.101968168G>A	ENSP00000305056:p.Ala250Val		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	.	16	0.00	0	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	ENST00000348070.1	37		.	.	.	.	.	.	.	.	.	.	G	29.0	4.968884	0.92855	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	D;D;D;D;D	0.90676	-2.71;-2.71;-2.71;-2.71;-2.71	5.0	5.0	0.66597	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.111338	0.64402	D	0.000010	D	0.97598	0.9213	H	0.99130	4.44	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.995;0.998;1.0;1.0;1.0;1.0;0.996;1.0;1.0	D	0.99741	1.1015	10	0.87932	D	0	-23.9203	17.3048	0.87192	0.0:0.0:1.0:0.0	.	251;156;250;251;250;250;251;251;250	P29122;Q59H04;E7EUC8;P29122-4;E7EWH5;E7EQ62;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.;.;.;.;.	V	250;250;155;250;250;85	ENSP00000305056:A250V;ENSP00000351193:A250V;ENSP00000344410:A250V;ENSP00000381243:A250V;ENSP00000332052:A85V	ENSP00000332052:A85V	A	-	2	0	PCSK6	99785691	1.000000	0.71417	0.991000	0.47740	0.927000	0.56198	8.761000	0.91691	2.298000	0.77334	0.655000	0.94253	GCG			0.522	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_002570	
CLCN7	1186	mdanderson.org	37	16	1510494	1510494	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:1510494G>T	ENST00000382745.4	-	6	1124	c.519C>A	c.(517-519)tcC>tcA	p.S173S	CLCN7_ENST00000448525.1_Silent_p.S149S|CLCN7_ENST00000262318.8_Silent_p.S149S	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	173					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				ACAGGGAGAAGGACAGTCCGC	0.607																																					p.S173S													.	.			0			c.C519A												151.0	111.0	125.0					16																	1510494		2199	4300	6499	SO:0001819	synonymous_variant	1186	exon6			GGAGAAGGACAGT	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.519C>A	16.37:g.1510494G>T			Somatic	58	0.0172413793	1		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001287	50	0.00	0	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Silent	SNP	ENST00000382745.4	37	CCDS32361.1																																																																																					0.607	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103598.2		NM_001287	
C16orf59	80178	mdanderson.org	37	16	2514567	2514567	+	Silent	SNP	G	G	A	rs560400790		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:2514567G>A	ENST00000361837.4	+	10	1265	c.1200G>A	c.(1198-1200)ccG>ccA	p.P400P	C16orf59_ENST00000563531.1_3'UTR|C16orf59_ENST00000483320.1_Silent_p.P233P|C16orf59_ENST00000569496.1_3'UTR|RP11-715J22.2_ENST00000563775.1_RNA	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59	400										lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				CTGCACAGCCGCAGGGGCCGC	0.687																																					p.P400P													.	.			0			c.G1200A												21.0	24.0	23.0					16																	2514567		1929	4111	6040	SO:0001819	synonymous_variant	80178	exon10			ACAGCCGCAGGGG	AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.1200G>A	16.37:g.2514567G>A			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_025108	53	0.00	0	B4DXD7|Q96H61|Q9H872	Silent	SNP	ENST00000361837.4	37	CCDS10468.2																																																																																					0.687	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250802.3		NM_025108	
USP7	7874	mdanderson.org	37	16	9057131	9057131	+	Missense_Mutation	SNP	C	C	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:9057131C>G	ENST00000344836.4	-	1	210	c.12G>C	c.(10-12)caG>caC	p.Q4H	RP11-77H9.8_ENST00000564485.1_lincRNA	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	4	Interaction with TSPYL5.|Poly-Gln.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						gctgctgctgctgGTGGTTCA	0.796																																					p.Q4H													USP7,colon,carcinoma,0,1	USP7	0	1	0			c.G12C																																									SO:0001583	missense	7874	exon1			CTGCTGCTGGTGG	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.12G>C	16.37:g.9057131C>G	ENSP00000343535:p.Gln4His		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	12	0.25	3	NM_003470	31	0.00	0	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311193	0.23821	.	.	ENSG00000187555	ENST00000344836	T	0.07688	3.17	2.25	2.25	0.28309	.	.	.	.	.	T	0.04272	0.0118	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38607	-0.9653	9	0.14656	T	0.56	.	7.4373	0.27162	0.259:0.741:0.0:0.0	.	4	Q93009	UBP7_HUMAN	H	4	ENSP00000343535:Q4H	ENSP00000343535:Q4H	Q	-	3	2	USP7	8964632	0.999000	0.42202	0.997000	0.53966	0.803000	0.45373	0.376000	0.20535	0.968000	0.38212	0.271000	0.19318	CAG			0.796	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434268.2			
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30748991	30748991	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:30748991C>T	ENST00000262518.4	+	34	8015	c.7630C>T	c.(7630-7632)Ccc>Tcc	p.P2544S	SRCAP_ENST00000395059.2_Missense_Mutation_p.P2482S|SRCAP_ENST00000344771.4_Missense_Mutation_p.P2386S|RP11-2C24.4_ENST00000483578.1_lincRNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2544	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CACTAATCTCCCCTTGGGCTT	0.567																																					p.P2544S													.	.			0			c.C7630T												128.0	121.0	124.0					16																	30748991		2197	4300	6497	SO:0001583	missense	10847	exon34			AATCTCCCCTTGG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.7630C>T	16.37:g.30748991C>T	ENSP00000262518:p.Pro2544Ser		Somatic	117	0	0		WXS	Illumina HiSeq	.	117	0.26	31	NM_006662	152	0.38	57	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	1.323	-0.598905	0.03744	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.90900	-2.75;-2.75;-2.75	4.8	-2.26	0.06867	.	0.851259	0.09996	N	0.729120	T	0.74596	0.3737	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.60627	-0.7226	10	0.52906	T	0.07	0.3188	0.318	0.00298	0.2944:0.2977:0.1437:0.2641	.	2482;2544	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	S	2544;2482;2386	ENSP00000262518:P2544S;ENSP00000378499:P2482S;ENSP00000343042:P2386S	ENSP00000262518:P2544S	P	+	1	0	SRCAP	30656492	0.016000	0.18221	0.400000	0.26346	0.095000	0.18619	-0.764000	0.04735	-0.593000	0.05844	0.467000	0.42956	CCC			0.567	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255523.1		NM_006662	
CNOT1	23019	mdanderson.org	37	16	58589745	58589745	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:58589745G>T	ENST00000317147.5	-	20	2879	c.2547C>A	c.(2545-2547)aaC>aaA	p.N849K	CNOT1_ENST00000441024.2_Missense_Mutation_p.N849K|CNOT1_ENST00000569240.1_Missense_Mutation_p.N844K|CNOT1_ENST00000569732.1_5'UTR	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	849	Interaction with ZFP36.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GGAAATAGCTGTTTGCTTCAT	0.418																																					p.N849K													CNOT1_ENST00000441024,NS,carcinoma,-2,2	CNOT1_ENST00000441024	-2	2	0			c.C2547A												221.0	175.0	190.0					16																	58589745		2198	4300	6498	SO:0001583	missense	23019	exon20			ATAGCTGTTTGCT	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2547C>A	16.37:g.58589745G>T	ENSP00000320949:p.Asn849Lys		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_016284	101	0.00	0	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409568	0.83340	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.54279	0.63;0.58	5.88	2.91	0.33838	.	0.000000	0.85682	D	0.000000	T	0.68329	0.2989	M	0.73430	2.235	0.80722	D	1	D;D;D	0.89917	0.989;0.999;1.0	D;D;D	0.91635	0.979;0.96;0.999	T	0.66452	-0.5920	10	0.49607	T	0.09	.	9.9457	0.41607	0.2642:0.0:0.7358:0.0	.	849;849;844	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	K	849;278;844;849	ENSP00000320949:N849K;ENSP00000413113:N849K	ENSP00000320949:N849K	N	-	3	2	CNOT1	57147246	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.149000	0.58091	0.408000	0.25621	-0.142000	0.14014	AAC			0.418	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257385.3		NM_016284	
LRRC36	55282	mdanderson.org	37	16	67360773	67360773	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:67360773A>G	ENST00000329956.6	+	1	27	c.8A>G	c.(7-9)gAg>gGg	p.E3G	LRRC36_ENST00000563303.1_Intron|KCTD19_ENST00000304372.5_5'Flank	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	3										endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		ggGATGGCGGAGCAATGGGAG	0.776											OREG0023877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E3G													.	.			0			c.A8G												8.0	11.0	10.0					16																	67360773		2133	4165	6298	SO:0001583	missense	55282	exon1			TGGCGGAGCAATG	BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.8A>G	16.37:g.67360773A>G	ENSP00000329943:p.Glu3Gly		Somatic	16	0	0	1098	WXS	Illumina HiSeq	Phase_I	16	0.31	5	NM_018296	0		0	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Missense_Mutation	SNP	ENST00000329956.6	37	CCDS32467.1	.	.	.	.	.	.	.	.	.	.	A	12.63	1.996809	0.35226	.	.	ENSG00000159708	ENST00000329956	T	0.11495	2.77	4.7	4.7	0.59300	.	0.870911	0.10036	N	0.724085	T	0.19287	0.0463	L	0.38175	1.15	0.80722	D	1	D	0.57257	0.979	P	0.56563	0.801	T	0.01056	-1.1466	10	0.87932	D	0	-10.9019	10.4877	0.44733	1.0:0.0:0.0:0.0	.	3	Q1X8D7	LRC36_HUMAN	G	3	ENSP00000329943:E3G	ENSP00000329943:E3G	E	+	2	0	LRRC36	65918274	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	3.134000	0.50538	1.959000	0.56917	0.460000	0.39030	GAG			0.776	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421770.1		NM_018296	
ZFHX3	463	mdanderson.org	37	16	72821624	72821624	+	Silent	SNP	G	G	A			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:72821624G>A	ENST00000268489.5	-	10	11223	c.10551C>T	c.(10549-10551)ggC>ggT	p.G3517G	RP5-991G20.1_ENST00000563328.2_RNA|AC004943.1_ENST00000584072.1_RNA|RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Silent_p.G2603G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3517	Poly-Gly.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				cgccaccgccgccgccgccgc	0.706																																					p.G3517G													.	.			0			c.C10551T												6.0	10.0	9.0					16																	72821624		1525	3163	4688	SO:0001819	synonymous_variant	463	exon10			ACCGCCGCCGCCG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10551C>T	16.37:g.72821624G>A			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_006885	0		0	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																					0.706	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269008.1		NM_006885	
PIEZO1	9780	mdanderson.org	37	16	88798823	88798823	+	Missense_Mutation	SNP	T	T	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr16:88798823T>G	ENST00000301015.9	-	21	3157	c.2911A>C	c.(2911-2913)Acc>Ccc	p.T971P	RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	971					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						TGCTGGCGGGTGCCGCTGGCA	0.627																																					p.T971P													.	.			0			c.A2911C																																									SO:0001583	missense	9780	exon21			GGCGGGTGCCGCT	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2911A>C	16.37:g.88798823T>G	ENSP00000301015:p.Thr971Pro		Somatic	106	0.3018867925	32		WXS	Illumina HiSeq	Phase_I	68	0.34	23	NM_001142864	17	0.12	2	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.06|18.06	3.540286|3.540286	0.65085|0.65085	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.47177	.|0.85	4.8|4.8	2.5|2.5	0.30297|0.30297	.|.	.|0.320500	.|0.32918	.|N	.|0.005500	T|T	0.55097|0.55097	0.1899|0.1899	M|M	0.84082|0.84082	2.675|2.675	0.80722|0.80722	D|D	1|1	.|D	.|0.62365	.|0.991	.|P	.|0.52793	.|0.709	T|T	0.56601|0.56601	-0.7952|-0.7952	5|10	.|0.66056	.|D	.|0.02	-43.4071|-43.4071	3.5214|3.5214	0.07744|0.07744	0.2616:0.1701:0.0:0.5683|0.2616:0.1701:0.0:0.5683	.|.	.|971	.|Q92508	.|PIEZ1_HUMAN	P|P	916|971	.|ENSP00000301015:T971P	.|ENSP00000301015:T971P	H|T	-|-	2|1	0|0	FAM38A|FAM38A	87326324|87326324	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.714000|0.714000	0.41099|0.41099	0.727000|0.727000	0.25999|0.25999	0.789000|0.789000	0.33779|0.33779	0.387000|0.387000	0.25754|0.25754	CAC|ACC			0.627	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000345699.4		NM_014745	
FAM101B	359845	broad.mit.edu	37	17	295717	295717	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr17:295717A>G	ENST00000329099.4	-	1	13	c.14T>C	c.(13-15)cTc>cCc	p.L5P		NM_182705.2	NP_874364.1	Q8N5W9	F101B_HUMAN	family with sequence similarity 101, member B	75					actin cytoskeleton organization (GO:0030036)|epithelial to mesenchymal transition (GO:0001837)	actin cytoskeleton (GO:0015629)	filamin binding (GO:0031005)			breast(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)|urinary_tract(1)	13		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		AGCCAGGGGGAGAGACGCTGG	0.443																																					.													.	FAM101B	19		0			.												10.0	12.0	11.0					17																	295717		1968	4090	6058	SO:0001583	missense	359845	.			AGGGGGAGAGACG			17p13	2008-10-23			ENSG00000183688	ENSG00000183688			28705	protein-coding gene	gene with protein product		615928				12477932	Standard	NM_182705		Approved	MGC45871	uc002frj.3	Q8N5W9	OTTHUMG00000132483	ENST00000329099.4:c.14T>C	17.37:g.295717A>G	ENSP00000331915:p.Leu5Pro		Somatic	525	0.0095238095	5		WXS	Illumina HiSeq	Phase_I	538	0.01	7	.	18	0.00	0		Missense_Mutation	SNP	ENST00000329099.4	37		.	.	.	.	.	.	.	.	.	.	A	12.70	2.017632	0.35606	.	.	ENSG00000183688	ENST00000329099	.	.	.	5.05	2.77	0.32553	.	0.516357	0.18702	N	0.133545	T	0.21881	0.0527	N	0.14661	0.345	.	.	.	B	0.02656	0.0	B	0.06405	0.002	T	0.11203	-1.0597	8	0.48119	T	0.1	4.5954	3.5824	0.07958	0.658:0.0:0.1788:0.1632	.	75	Q8N5W9	F101B_HUMAN	P	5	.	ENSP00000331915:L5P	L	-	2	0	FAM101B	295945	0.981000	0.34729	0.000000	0.03702	0.020000	0.10135	3.519000	0.53458	0.240000	0.21263	0.528000	0.53228	CTC			0.443	FAM101B-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000255652.1		NM_182705	
SREBF1	6720	broad.mit.edu	37	17	17716753	17716753	+	Missense_Mutation	SNP	G	G	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr17:17716753G>C	ENST00000261646.5	-	18	3327	c.3143C>G	c.(3142-3144)gCc>gGc	p.A1048G	SREBF1_ENST00000338854.5_Intron|SREBF1_ENST00000355815.4_Missense_Mutation_p.A1078G|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000395757.1_Missense_Mutation_p.A794G	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	1048					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						TGTGGGGCTGGCCCCCGCCAT	0.697																																					p.A1078G													.	SREBF1	47		0			c.C3233G												14.0	18.0	16.0					17																	17716753		2184	4290	6474	SO:0001583	missense	6720	exon19			GGGCTGGCCCCCG	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.3143C>G	17.37:g.17716753G>C	ENSP00000261646:p.Ala1048Gly		Somatic	59	0.0508474576	3		WXS	Illumina HiSeq	Phase_I	48	0.19	9	NM_001005291	92	0.07	6	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	37	CCDS11189.1	.	.	.	.	.	.	.	.	.	.	G	35	5.531372	0.96446	.	.	ENSG00000072310	ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161	T;T;T	0.16897	2.31;2.31;2.31	5.03	5.03	0.67393	.	0.060381	0.64402	N	0.000004	T	0.49660	0.1570	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	T	0.59188	-0.7501	10	0.72032	D	0.01	-20.7725	18.3525	0.90343	0.0:0.0:1.0:0.0	.	1048;1078;667	P36956;P36956-4;A8MTU8	SRBP1_HUMAN;.;.	G	1078;1048;794;667;885;974	ENSP00000348069:A1078G;ENSP00000261646:A1048G;ENSP00000379106:A794G	ENSP00000261646:A1048G	A	-	2	0	SREBF1	17657478	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.665000	0.98609	2.331000	0.79229	0.561000	0.74099	GCC			0.697	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131771.1		NM_004176	
HDAC5	10014	mdanderson.org	37	17	42155923	42155923	+	Missense_Mutation	SNP	G	G	T	rs377012839		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr17:42155923G>T	ENST00000393622.2	-	26	3605	c.3274C>A	c.(3274-3276)Ctg>Atg	p.L1092M	HDAC5_ENST00000586802.1_Missense_Mutation_p.L1092M|HDAC5_ENST00000225983.6_Missense_Mutation_p.L1093M|HDAC5_ENST00000336057.5_Missense_Mutation_p.L1007M	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	1092					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		CCCACCGACAGCAAGGCCATG	0.692																																					p.L1093M													.	.			0			c.C3277A												71.0	81.0	78.0					17																	42155923		2203	4299	6502	SO:0001583	missense	10014	exon26			CCGACAGCAAGGC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.3274C>A	17.37:g.42155923G>T	ENSP00000377244:p.Leu1092Met		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001015053	172	0.00	0	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	ENST00000393622.2	37	CCDS45696.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152411	0.78001	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.62639	0.01;0.01;0.57	5.35	4.39	0.52855	.	0.000000	0.64402	D	0.000012	T	0.77458	0.4133	M	0.81112	2.525	0.58432	D	0.999998	D;D;D	0.89917	0.969;1.0;1.0	P;D;D	0.97110	0.839;1.0;0.999	T	0.79222	-0.1892	10	0.87932	D	0	-10.9574	9.3413	0.38082	0.1657:0.0:0.8343:0.0	.	1007;1093;1092	Q9UQL6-2;Q9UQL6-3;Q9UQL6	.;.;HDAC5_HUMAN	M	1093;1092;1007	ENSP00000225983:L1093M;ENSP00000377244:L1092M;ENSP00000337290:L1007M	ENSP00000225983:L1093M	L	-	1	2	HDAC5	39511449	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.934000	0.63491	1.264000	0.44198	-0.136000	0.14681	CTG			0.692	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000457686.1		NM_001015053	
C17orf104	284071	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42744013	42744016	+	Frame_Shift_Del	DEL	CTAA	CTAA	-			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	CTAA	CTAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr17:42744013_42744016delCTAA	ENST00000409122.2	+	5	876_879	c.734_737delCTAA	c.(733-738)tctaacfs	p.SN245fs	C17orf104_ENST00000409464.1_Frame_Shift_Del_p.SN79fs|C17orf104_ENST00000359945.3_Frame_Shift_Del_p.SN245fs	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	245										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						AGTGATCATTCTAACTGTCACAAT	0.358																																					p.245_246del													.	C17orf104	75		0			c.733_736del																																									SO:0001589	frameshift_variant	284071	exon5			ATCATTCTAACTG		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.734_737delCTAA	17.37:g.42744013_42744016delCTAA	ENSP00000386452:p.Ser245fs		Somatic	65	0	0		WXS	Illumina HiSeq	.	153	0.24	36	NM_001145080	7	0.00	0	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Frame_Shift_Del	DEL	ENST00000409122.2	37	CCDS45703.2																																																																																					0.358	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000329171.2		NM_001145080	
SLC16A6P1	440459	broad.mit.edu	37	17	62937153	62937154	+	lincRNA	INS	-	-	TAGA	rs367701196|rs143058612|rs112724309		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr17:62937153_62937154insTAGA	ENST00000583416.1	+	0	0				RP11-927P21.11_ENST00000606688.1_RNA|SLC16A6P1_ENST00000577423.1_RNA																							GACTGATtaggtagatagatag	0.485																																					.													.	.			0			.																																											0	.			GATTAGGTAGATA																													17.37:g.62937158_62937161dupTAGA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000583416.1	37																																																																																						0.485	RP11-583F2.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000445719.1			
OGFOD3	79701	mdanderson.org	37	17	80361826	80361826	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr17:80361826G>T	ENST00000313056.5	-	7	837	c.686C>A	c.(685-687)gCg>gAg	p.A229E	RP13-20L14.4_ENST00000579188.1_RNA|OGFOD3_ENST00000329197.5_Missense_Mutation_p.A229E	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	229	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										GTCCACGTGCGCATGCCAGTA	0.662																																					p.A229E													.	.			0			c.C686A												84.0	62.0	69.0					17																	80361826		2203	4300	6503	SO:0001583	missense	79701	exon7			ACGTGCGCATGCC	BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.686C>A	17.37:g.80361826G>T	ENSP00000320116:p.Ala229Glu		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_175902	50	0.00	0	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	ENST00000313056.5	37	CCDS11811.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669585	0.67814	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.59906	0.23;1.49	5.32	4.35	0.52113	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.120183	0.56097	D	0.000025	T	0.46014	0.1371	N	0.12182	0.205	0.35456	D	0.79609	P;P	0.52692	0.911;0.955	P;P	0.48166	0.565;0.569	T	0.60757	-0.7200	10	0.54805	T	0.06	-3.3873	12.5636	0.56297	0.081:0.0:0.919:0.0	.	229;229	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	E	229	ENSP00000320116:A229E;ENSP00000330075:A229E	ENSP00000320116:A229E	A	-	2	0	C17orf101	77955115	1.000000	0.71417	0.003000	0.11579	0.684000	0.39900	7.321000	0.79088	1.243000	0.43853	0.655000	0.94253	GCG			0.662	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442895.1		NM_175902	
CELF4	56853	mdanderson.org	37	18	34844656	34844656	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr18:34844656G>T	ENST00000591282.1	-	10	1229	c.1230C>A	c.(1228-1230)atC>atA	p.I410I	CELF4_ENST00000591287.1_Silent_p.I408I|CELF4_ENST00000603232.1_Silent_p.I409I|CELF4_ENST00000334919.5_Silent_p.I400I|CELF4_ENST00000588597.1_Silent_p.I398I|CELF4_ENST00000361795.5_Silent_p.I408I|CELF4_ENST00000412753.1_Silent_p.I409I|CELF4_ENST00000420428.2_Silent_p.I410I|CELF4_ENST00000601019.1_Silent_p.I408I			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	410	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						GCTGCTGGGGGATCATTGGAG	0.637																																					p.I410I													.	.			0			c.C1230A												34.0	31.0	32.0					18																	34844656		2200	4299	6499	SO:0001819	synonymous_variant	56853	exon10			CTGGGGGATCATT	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.1230C>A	18.37:g.34844656G>T			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_020180	4	0.00	0	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Silent	SNP	ENST00000591282.1	37	CCDS32818.1																																																																																					0.637	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000440892.1		NM_020180	
CXXC1	30827	hgsc.bcm.edu	37	18	47812290	47812290	+	Missense_Mutation	SNP	C	C	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr18:47812290C>G	ENST00000285106.6	-	5	1182	c.468G>C	c.(466-468)caG>caC	p.Q156H	CXXC1_ENST00000412036.2_Missense_Mutation_p.Q156H|CXXC1_ENST00000587396.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.Q156H	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	156					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.Q156H(1)		autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						gctgctgctgctggtgatgct	0.557																																					p.Q156H													CXXC1,NS,carcinoma,0,1	CXXC1	0	1	1	Substitution - Missense(1)	lung(1)	c.G468C												43.0	39.0	40.0					18																	47812290		2203	4300	6503	SO:0001583	missense	30827	exon5			CTGCTGCTGGTGA	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.468G>C	18.37:g.47812290C>G	ENSP00000285106:p.Gln156His		Somatic	122	0.0081967213	1		WXS	Illumina HiSeq	.	75	0.04	3	NM_001101654	53	0.02	1	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	37	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	C	5.912	0.352385	0.11182	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.24151	1.88;1.87	2.57	-0.917	0.10485	.	0.739778	0.10861	U	0.626054	T	0.08758	0.0217	N	0.14661	0.345	0.27196	N	0.960293	P;B;B;B;B	0.43094	0.799;0.438;0.42;0.296;0.191	B;B;B;B;B	0.24006	0.05;0.02;0.031;0.014;0.014	T	0.22800	-1.0206	10	0.40728	T	0.16	-0.5462	4.5447	0.12074	0.0:0.4012:0.4494:0.1494	.	156;156;156;156;23	B4DGL1;B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;.;CXXC1_HUMAN;.	H	156	ENSP00000285106:Q156H;ENSP00000390475:Q156H	ENSP00000285106:Q156H	Q	-	3	2	CXXC1	46066288	0.955000	0.32602	0.993000	0.49108	0.749000	0.42624	-0.083000	0.11286	0.025000	0.15241	0.542000	0.68232	CAG			0.557	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255927.2		NM_014593	
WDR7	23335	mdanderson.org	37	18	54398712	54398712	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr18:54398712G>T	ENST00000254442.3	+	14	2084	c.1873G>T	c.(1873-1875)Gca>Tca	p.A625S	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.A625S	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	625					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TAGTCATCCAGCAGTCAACCT	0.443																																					p.A625S													.	.			0			c.G1873T												143.0	117.0	126.0					18																	54398712		2203	4300	6503	SO:0001583	missense	23335	exon14			CATCCAGCAGTCA	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.1873G>T	18.37:g.54398712G>T	ENSP00000254442:p.Ala625Ser		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	108	0.05	5	NM_052834	3	0.00	0	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725207	0.89298	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.69306	-0.39;-0.38	5.3	5.3	0.74995	.	0.111802	0.64402	D	0.000011	T	0.68467	0.3004	N	0.12746	0.255	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.77557	0.99;0.978	T	0.68780	-0.5318	10	0.27785	T	0.31	.	18.5514	0.91066	0.0:0.0:1.0:0.0	.	625;625	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	S	625	ENSP00000254442:A625S;ENSP00000350187:A625S	ENSP00000254442:A625S	A	+	1	0	WDR7	52549710	1.000000	0.71417	0.903000	0.35520	0.816000	0.46133	9.542000	0.98086	2.479000	0.83701	0.563000	0.77884	GCA			0.443	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256062.1			
APC2	10297	mdanderson.org	37	19	1468858	1468858	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:1468858C>T	ENST00000535453.1	+	14	7271	c.5558C>T	c.(5557-5559)gCg>gTg	p.A1853V	C19orf25_ENST00000588427.1_Intron|APC2_ENST00000233607.2_Missense_Mutation_p.A1853V|APC2_ENST00000238483.4_Missense_Mutation_p.A1579V			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGAGCTGGCGACGCTGAGC	0.751																																					p.A1853V													.	.			0			c.C5558T												3.0	6.0	5.0					19																	1468858		1915	3837	5752	SO:0001583	missense	10297	exon15			AGCTGGCGACGCT		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.5558C>T	19.37:g.1468858C>T	ENSP00000442954:p.Ala1853Val		Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_005883	0		0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	ENST00000535453.1	37	CCDS12068.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261360	0.39995	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	D;D;D	0.83163	-1.69;-1.69;-1.69	4.22	3.17	0.36434	Adenomatous polyposis coli protein basic domain (1);	0.587434	0.15872	N	0.240519	T	0.71117	0.3302	L	0.47716	1.5	0.38313	D	0.943306	P;P	0.43938	0.786;0.822	B;B	0.30716	0.073;0.119	T	0.70956	-0.4731	10	0.56958	D	0.05	-18.2067	6.9172	0.24367	0.0:0.7238:0.1792:0.097	.	1852;1853	O95996-3;O95996	.;APC2_HUMAN	V	1853;1579;1853	ENSP00000233607:A1853V;ENSP00000238483:A1579V;ENSP00000442954:A1853V	ENSP00000233607:A1853V	A	+	2	0	APC2	1419858	0.001000	0.12720	0.601000	0.28877	0.004000	0.04260	1.004000	0.29822	0.779000	0.33543	-0.287000	0.09952	GCG			0.751	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449539.2		NM_005883	
CATSPERD	257062	mdanderson.org	37	19	5720014	5720014	+	5'Flank	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:5720014G>T	ENST00000381624.3	+	0	0				LONP1_ENST00000590511.1_5'UTR|LONP1_ENST00000540670.2_Intron|LONP1_ENST00000590729.1_5'Flank|LONP1_ENST00000585374.1_Intron|LONP1_ENST00000360614.3_Silent_p.R44R|LONP1_ENST00000593119.1_Intron|CATSPERD_ENST00000381614.2_5'Flank	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta						multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TCGCAGGTCCGCTGGCCTCGG	0.751																																					p.G44S													.	.			0			c.G130A												4.0	5.0	5.0					19																	5720014		1964	3892	5856	SO:0001631	upstream_gene_variant	9361	exon1			AGGTCCGCTGGCC	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036		19.37:g.5720014G>T	Exception_encountered		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	52	0.08	4	NM_004793	51	0.00	0	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2																																																																																					0.751	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000286953.2		NM_152784	
EMR1	2015	mdanderson.org	37	19	6921799	6921799	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:6921799G>T	ENST00000312053.4	+	14	1733	c.1696G>T	c.(1696-1698)Ggc>Tgc	p.G566C	EMR1_ENST00000381404.4_Missense_Mutation_p.G514C|EMR1_ENST00000381407.5_Missense_Mutation_p.G425C|EMR1_ENST00000450315.3_Missense_Mutation_p.G389C|EMR1_ENST00000250572.8_Missense_Mutation_p.G566C	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	566	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.|Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					GACATCCTTTGGCTGTGTGAT	0.458																																					p.G566C													.	.			0			c.G1696T												139.0	122.0	128.0					19																	6921799		2203	4300	6503	SO:0001583	missense	2015	exon14			TCCTTTGGCTGTG	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.1696G>T	19.37:g.6921799G>T	ENSP00000311545:p.Gly566Cys		Somatic	117	0.0085470085	1		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_001974	3	0.00	0	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.712109	0.68730	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9	4.43	4.43	0.53597	GPS domain (3);	.	.	.	.	D	0.95020	0.8388	H	0.97611	4.04	0.37633	D	0.921765	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98122	1.0426	9	0.87932	D	0	.	14.9777	0.71286	0.0:0.0:1.0:0.0	.	389;425;566;514;566	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	C	566;566;514;566;425;389	ENSP00000311545:G566C;ENSP00000370811:G514C;ENSP00000250572:G566C;ENSP00000370814:G425C;ENSP00000405974:G389C	ENSP00000250572:G566C	G	+	1	0	EMR1	6872799	1.000000	0.71417	0.804000	0.32291	0.116000	0.19942	6.068000	0.71201	2.192000	0.70111	0.650000	0.86243	GGC			0.458	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458485.1			
DNMT1	1786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10260600	10260600	+	Silent	SNP	C	C	A			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:10260600C>A	ENST00000340748.4	-	24	2497	c.2262G>T	c.(2260-2262)gcG>gcT	p.A754A	DNMT1_ENST00000540357.1_Silent_p.A754A|DNMT1_ENST00000359526.4_Silent_p.A770A			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	754	Autoinhibitory linker.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CCAGGGTTTCCGCATCAATGC	0.438																																					p.A770A													DNMT1,NS,carcinoma,0,1	DNMT1	0	1	0			c.G2310T												189.0	162.0	171.0					19																	10260600		2203	4300	6503	SO:0001819	synonymous_variant	1786	exon25			GGTTTCCGCATCA	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2262G>T	19.37:g.10260600C>A			Somatic	274	0	0		WXS	Illumina HiSeq	.	188	0.41	77	NM_001130823	91	0.53	48	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	37	CCDS12228.1																																																																																					0.438	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451166.1		NM_001379	
ASF1B	55723	mdanderson.org	37	19	14236985	14236985	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:14236985G>T	ENST00000263382.3	-	2	673	c.174C>A	c.(172-174)gaC>gaA	p.D58E	ASF1B_ENST00000592798.1_Missense_Mutation_p.D58E|ASF1B_ENST00000474890.1_Missense_Mutation_p.D58E	NM_018154.2	NP_060624.1	Q9NVP2	ASF1B_HUMAN	anti-silencing function 1B histone chaperone	58	Interaction with CHAF1B.|Interaction with histone H3. {ECO:0000250}.				cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7						CCAGCACCGAGTCTAGGATCT	0.468																																					p.D58E													.	.			0			c.C174A												127.0	117.0	120.0					19																	14236985		2203	4300	6503	SO:0001583	missense	55723	exon2			CACCGAGTCTAGG	AF279307	CCDS12306.1	19p13.12	2013-05-01	2013-05-01		ENSG00000105011	ENSG00000105011			20996	protein-coding gene	gene with protein product		609190	"""ASF1 anti-silencing function 1 homolog B (S. cerevisiae)"""			11897662, 11470414	Standard	NM_018154		Approved	FLJ10604	uc002mye.3	Q9NVP2	OTTHUMG00000150401	ENST00000263382.3:c.174C>A	19.37:g.14236985G>T	ENSP00000263382:p.Asp58Glu		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_018154	106	0.00	0	Q53G51|Q9NVZ0	Missense_Mutation	SNP	ENST00000263382.3	37	CCDS12306.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.800832	0.50315	.	.	ENSG00000105011	ENST00000263382	.	.	.	5.95	2.64	0.31445	.	0.000000	0.85682	D	0.000000	T	0.68274	0.2983	M	0.66560	2.04	0.58432	D	0.999999	D	0.63046	0.992	D	0.76575	0.988	T	0.63180	-0.6695	9	0.30854	T	0.27	.	8.247	0.31695	0.3099:0.0:0.6901:0.0	.	58	Q9NVP2	ASF1B_HUMAN	E	58	.	ENSP00000263382:D58E	D	-	3	2	ASF1B	14097985	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	1.808000	0.38912	0.411000	0.25702	-0.140000	0.14226	GAC			0.468	ASF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317946.1		NM_018154	
MAU2	23383	broad.mit.edu;mdanderson.org	37	19	19466173	19466173	+	Silent	SNP	C	C	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:19466173C>T	ENST00000392313.6	+	18	1919	c.1740C>T	c.(1738-1740)tgC>tgT	p.C580C	MAU2_ENST00000262815.8_Silent_p.C580C	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	580					maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						TTGAGGCCTGCAGCCTCCCCG	0.607																																					p.C580C													.	MAU2	38		0			c.C1740T												97.0	90.0	93.0					19																	19466173		2203	4300	6503	SO:0001819	synonymous_variant	23383	exon18			GGCCTGCAGCCTC	AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.1740C>T	19.37:g.19466173C>T			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	46	0.09	4	NM_015329	51	0.00	0	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	Silent	SNP	ENST00000392313.6	37	CCDS32969.2	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937163	0.52972	.	.	ENSG00000129933	ENST00000262816;ENST00000499453	.	.	.	5.33	3.0	0.34707	.	.	.	.	.	T	0.63319	0.2501	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65195	-0.6227	5	0.87932	D	0	.	7.3401	0.26632	0.0:0.6784:0.0:0.3216	.	.	.	.	V	24	.	ENSP00000262816:A24V	A	+	2	0	MAU2	19327173	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.417000	0.34770	1.224000	0.43551	0.561000	0.74099	GCA			0.607	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000316748.6		NM_015329	
SPTBN4	57731	bcgsc.ca	37	19	41025454	41025454	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:41025454G>T	ENST00000352632.3	+	16	3136	c.3050G>T	c.(3049-3051)gGc>gTc	p.G1017V	SPTBN4_ENST00000338932.3_Missense_Mutation_p.G1017V|SPTBN4_ENST00000598249.1_Missense_Mutation_p.G1017V|SPTBN4_ENST00000344104.3_Missense_Mutation_p.G1017V|SPTBN4_ENST00000595535.1_Missense_Mutation_p.G1017V			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1017					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ccccgggccggcggcgcccTG	0.736																																					p.G1017V													.	SPTBN4	213		0			c.G3050T												8.0	11.0	10.0					19																	41025454		2146	4232	6378	SO:0001583	missense	57731	exon16			GGGCCGGCGGCGC	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3050G>T	19.37:g.41025454G>T	ENSP00000263373:p.Gly1017Val		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_1	33	0.12	4	NM_020971	0		0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550769	0.86127	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.76839	-1.05;-1.03;-1.05	4.63	4.63	0.57726	.	0.000000	0.64402	D	0.000005	D	0.82481	0.5046	L	0.49126	1.545	0.80722	D	1	D;D	0.71674	0.998;0.991	P;D	0.64321	0.873;0.924	T	0.78478	-0.2188	10	0.18710	T	0.47	.	16.4166	0.83744	0.0:0.0:1.0:0.0	.	1017;1017	Q9H254;Q71S06	SPTN4_HUMAN;.	V	1017	ENSP00000263373:G1017V;ENSP00000340345:G1017V;ENSP00000340741:G1017V	ENSP00000340345:G1017V	G	+	2	0	SPTBN4	45717294	1.000000	0.71417	0.500000	0.27589	0.979000	0.70002	9.479000	0.97929	2.418000	0.82041	0.462000	0.41574	GGC			0.736	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462559.2			
ARHGEF1	9138	mdanderson.org	37	19	42399474	42399474	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:42399474G>T	ENST00000354532.3	+	12	1078	c.930G>T	c.(928-930)cgG>cgT	p.R310R	ARHGEF1_ENST00000337665.4_Silent_p.R325R|ARHGEF1_ENST00000347545.4_Silent_p.R277R|ARHGEF1_ENST00000378152.4_Silent_p.R292R|ARHGEF1_ENST00000599846.1_Silent_p.R310R	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	310					cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		TGCCCTCTCGGGACCGGAATA	0.617																																					p.R325R													.	.			0			c.G975T												75.0	82.0	80.0					19																	42399474		2203	4300	6503	SO:0001819	synonymous_variant	9138	exon12			CTCTCGGGACCGG	U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.930G>T	19.37:g.42399474G>T			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_199002	69	0.00	0	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Silent	SNP	ENST00000354532.3	37	CCDS12591.1																																																																																					0.617	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000463360.1		NM_199002	
ZNF497	162968	mdanderson.org	37	19	58868528	58868528	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr19:58868528G>T	ENST00000311044.3	-	3	662	c.474C>A	c.(472-474)ggC>ggA	p.G158G	CTD-2619J13.9_ENST00000599952.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|ZNF497_ENST00000425453.3_Silent_p.G158G|A1BG-AS1_ENST00000593374.1_RNA	NM_198458.2	NP_940860.2	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|lung(3)|skin(2)	7		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		AGGGCTTCTCGCCGCTGTGGA	0.677																																					p.G158G													.	.			0			c.C474A												36.0	31.0	33.0					19																	58868528		2202	4300	6502	SO:0001819	synonymous_variant	162968	exon3			CTTCTCGCCGCTG	AK126727	CCDS12977.1	19q13.43	2013-01-08			ENSG00000174586	ENSG00000174586		"""Zinc fingers, C2H2-type"""	23714	protein-coding gene	gene with protein product							Standard	NM_198458		Approved	FLJ44773	uc002qsi.2	Q6ZNH5		ENST00000311044.3:c.474C>A	19.37:g.58868528G>T			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	55	0.07	4	NM_198458	9	0.00	0	Q05AG8|Q0VF48|Q6ZTD2|Q9UIA8	Silent	SNP	ENST00000311044.3	37	CCDS12977.1																																																																																					0.677	ZNF497-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466942.2		NM_198458	
NT5C1B	93034	mdanderson.org	37	2	18766181	18766181	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:18766181G>T	ENST00000359846.2	-	5	579	c.502C>A	c.(502-504)Ccg>Acg	p.P168T	NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.P168T|NT5C1B_ENST00000600945.1_Missense_Mutation_p.P168T|NT5C1B_ENST00000304081.4_Missense_Mutation_p.P108T|NT5C1B_ENST00000460052.1_5'Flank|RNU6-1215P_ENST00000384441.1_RNA	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	168	Pro-rich.|Ser-rich.				nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				AGCGGCGGCGGTGAGGAGTCA	0.716																																					p.P185T													.	.			0			c.C553A												12.0	20.0	17.0					2																	18766181		2050	4116	6166	SO:0001583	missense	93034	exon5			GCGGCGGTGAGGA	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.502C>A	2.37:g.18766181G>T	ENSP00000352904:p.Pro168Thr		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_001199087	0		0	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848076	0.32699	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846;ENST00000416783	D	0.90385	-2.66	4.22	0.855	0.19013	.	0.257949	0.20380	U	0.093479	D	0.82287	0.5004	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B;B;B;B	0.33103	0.397;0.067;0.118;0.397;0.009;0.11;0.124;0.204	B;B;B;B;B;B;B;B	0.32465	0.146;0.017;0.017;0.146;0.005;0.038;0.074;0.073	T	0.73319	-0.4020	10	0.87932	D	0	.	6.9756	0.24672	0.0:0.151:0.4081:0.4409	.	151;185;108;151;110;108;168;168	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;.;5NT1B_HUMAN;.	T	168;110;108;168;185	ENSP00000412639:P110T	ENSP00000305979:P108T	P	-	1	0	NT5C1B-RDH14;NT5C1B	18629662	0.023000	0.18921	0.000000	0.03702	0.044000	0.14063	2.314000	0.43743	0.001000	0.14605	0.467000	0.42956	CCG			0.716	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000323822.1			
C2orf81	388963	mdanderson.org	37	2	74642106	74642106	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:74642106G>T	ENST00000517883.1	-	1	1604	c.913C>A	c.(913-915)Cgc>Agc	p.R305S	C2orf81_ENST00000290390.5_Missense_Mutation_p.R373S			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	366										endometrium(3)|kidney(1)	4						TCCAAGGGGCGTGTTTGAGAG	0.721																																					p.R373S													.	.			0			c.C1117A												8.0	12.0	11.0					2																	74642106		690	1589	2279	SO:0001583	missense	388963	exon4			AGGGGCGTGTTTG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.913C>A	2.37:g.74642106G>T	ENSP00000431103:p.Arg305Ser		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001145054	3	0.00	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	g	16.86	3.240662	0.58995	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.86	2.95	0.34219	.	1.014940	0.07887	N	0.970576	T	0.39733	0.1089	L	0.54323	1.7	0.09310	N	1	P	0.41748	0.761	B	0.40702	0.338	T	0.17992	-1.0351	9	0.29301	T	0.29	-2.4721	8.1643	0.31217	0.2087:0.0:0.7913:0.0	.	373	G3XAA6	.	S	305;373	.	ENSP00000290390:R373S	R	-	1	0	C2orf81	74495614	0.046000	0.20272	0.000000	0.03702	0.009000	0.06853	1.138000	0.31491	0.496000	0.27904	0.556000	0.70494	CGC			0.721	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000377683.1		NM_001145054	
AC096579.13	0	broad.mit.edu	37	2	89111346	89111346	+	RNA	DEL	C	C	-			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:89111346delC	ENST00000452230.1	-	0	195				MIR4436A_ENST00000585278.1_RNA																							AGGGGAGCAACCCCTGGCCGA	0.672																																					.													.	.			0			.																																											0	.			GAGCAACCCCTGG																													2.37:g.89111346delC			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000452230.1	37																																																																																						0.672	AC096579.13-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000323493.1			
ANKRD36	375248	broad.mit.edu	37	2	97877455	97877455	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:97877455A>G	ENST00000461153.2	+	58	3690	c.3446A>G	c.(3445-3447)aAg>aGg	p.K1149R	ANKRD36_ENST00000420699.2_Missense_Mutation_p.K1149R			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1149										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						ACGGAAAAAAAGGATGAACAA	0.348																																					p.K1149R													.	ANKRD36	170		0			c.A3446G												138.0	131.0	133.0					2																	97877455		692	1591	2283	SO:0001583	missense	375248	exon58			AAAAAAAGGATGA	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.3446A>G	2.37:g.97877455A>G	ENSP00000419530:p.Lys1149Arg		Somatic	237	0.0042194093	1		WXS	Illumina HiSeq	Phase_I	429	0.02	7	NM_001164315	3	0.00	0	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	.	11.65	1.702083	0.30232	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.79352	-1.26;-1.26	1.17	-0.222	0.13122	.	.	.	.	.	T	0.72526	0.3471	L	0.34521	1.04	0.09310	N	1	D	0.57571	0.98	P	0.57009	0.811	T	0.60276	-0.7295	9	0.31617	T	0.26	.	3.9247	0.09259	0.6124:0.3876:0.0:0.0	.	1149	A6QL64	AN36A_HUMAN	R	1149;1149;409	ENSP00000419530:K1149R;ENSP00000391950:K1149R	ENSP00000391950:K1149R	K	+	2	0	ANKRD36	97241182	0.125000	0.22332	0.001000	0.08648	0.005000	0.04900	1.780000	0.38634	-0.062000	0.13088	0.358000	0.22013	AAG			0.348	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339154.5			
GPR39	2863	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	133175132	133175132	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:133175132G>T	ENST00000329321.3	+	1	986	c.517G>T	c.(517-519)Gcc>Tcc	p.A173S		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	173					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTTGCTGTTTGCCATGGGTAC	0.637																																					p.A173S													.	.			0			c.G517T												78.0	67.0	70.0					2																	133175132		2203	4300	6503	SO:0001583	missense	2863	exon1			CTGTTTGCCATGG	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.517G>T	2.37:g.133175132G>T	ENSP00000327417:p.Ala173Ser		Somatic	117	0	0		WXS	Illumina HiSeq	.	76	0.05	4	NM_001508	2	0.00	0	B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	37	CCDS2170.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815893	0.90790	.	.	ENSG00000183840	ENST00000329321	T	0.72051	-0.62	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.82688	0.5091	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.78084	-0.2342	10	0.22109	T	0.4	.	19.2005	0.93710	0.0:0.0:1.0:0.0	.	173	O43194	GPR39_HUMAN	S	173	ENSP00000327417:A173S	ENSP00000327417:A173S	A	+	1	0	GPR39	132891602	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.600000	0.67599	2.782000	0.95742	0.585000	0.79938	GCC			0.637	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254582.1			
TTN	7273	mdanderson.org	37	2	179477207	179477207	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:179477207G>T	ENST00000591111.1	-	216	45346	c.45122C>A	c.(45121-45123)cCc>cAc	p.P15041H	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P7809H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P7742H|TTN_ENST00000460472.2_Missense_Mutation_p.P7617H|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P16682H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P14114H|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15041	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGGTGATGGGGGACCCTCC	0.478																																					p.P16682H													.	.			0			c.C50045A												122.0	105.0	110.0					2																	179477207		1927	4141	6068	SO:0001583	missense	7273	exon266			GTGATGGGGGACC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45122C>A	2.37:g.179477207G>T	ENSP00000465570:p.Pro15041His		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_001267550	1	0.00	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	11.42	1.632746	0.29068	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.71	5.71	0.89125	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80722	0.4677	M	0.87827	2.91	0.53005	D	0.999966	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77004	0.979;0.979;0.979;0.989	T	0.83303	-0.0027	9	0.87932	D	0	.	19.85	0.96736	0.0:0.0:1.0:0.0	.	7617;7742;7809;15041	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	14114;7617;7809;7742;7617	ENSP00000343764:P14114H;ENSP00000434586:P7617H;ENSP00000340554:P7809H;ENSP00000352154:P7742H	ENSP00000340554:P7809H	P	-	2	0	TTN	179185452	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.653000	0.83643	2.697000	0.92050	0.563000	0.77884	CCC			0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
FARSB	10056	broad.mit.edu	37	2	223488401	223488401	+	Missense_Mutation	SNP	C	C	T	rs531236483	byFrequency	TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:223488401C>T	ENST00000281828.6	-	13	1482	c.1219G>A	c.(1219-1221)Gct>Act	p.A407T	FARSB_ENST00000536361.1_Missense_Mutation_p.A308T	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	407					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	GTGAAGCCAGCGGCTGCCATG	0.378																																					p.A407T													FARSB,NS,carcinoma,0,1	FARSB	49	1	0			c.G1219A												104.0	108.0	107.0					2																	223488401		2203	4300	6503	SO:0001583	missense	10056	exon13			AGCCAGCGGCTGC	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.1219G>A	2.37:g.223488401C>T	ENSP00000281828:p.Ala407Thr		Somatic	482	0.0041493776	2		WXS	Illumina HiSeq	Phase_I	450	0.01	6	NM_005687	120	0.00	0	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	ENST00000281828.6	37	CCDS2454.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553380	0.86127	.	.	ENSG00000116120	ENST00000281828;ENST00000536361	.	.	.	5.11	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.75568	0.3867	H	0.96547	3.84	0.80722	D	1	D;D	0.59767	0.984;0.986	B;P	0.45913	0.29;0.497	T	0.81887	-0.0726	9	0.35671	T	0.21	-11.487	13.8461	0.63468	0.0:0.9257:0.0:0.0743	.	407;407	A8K666;Q9NSD9	.;SYFB_HUMAN	T	407;308	.	ENSP00000281828:A407T	A	-	1	0	FARSB	223196645	1.000000	0.71417	0.875000	0.34327	0.990000	0.78478	5.628000	0.67791	1.277000	0.44412	-0.142000	0.14014	GCT			0.378	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256855.2		NM_005687	
NGEF	25791	ucsc.edu	37	2	233748732	233748732	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr2:233748732G>T	ENST00000264051.3	-	11	1838	c.1560C>A	c.(1558-1560)ttC>ttA	p.F520L	NGEF_ENST00000539537.1_Missense_Mutation_p.F243L|NGEF_ENST00000373552.4_Missense_Mutation_p.F428L	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	520	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		CGTTGAACAGGAAGAGGTAAA	0.612																																					p.F520L													.	NGEF	198		0			c.C1560A												103.0	95.0	97.0					2																	233748732		2203	4300	6503	SO:0001583	missense	25791	exon11			GAACAGGAAGAGG	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.1560C>A	2.37:g.233748732G>T	ENSP00000264051:p.Phe520Leu		Somatic	83	0	0		WXS	Illumina HiSeq		41	0.10	4	NM_019850	131	0.00	0	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	ENST00000264051.3	37	CCDS2500.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.22|16.22	3.060269|3.060269	0.55432|0.55432	.|.	.|.	ENSG00000066248|ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537|ENST00000424488	D;D;D|.	0.90844|.	-2.74;-2.74;-2.74|.	5.11|5.11	3.31|3.31	0.37934|0.37934	Pleckstrin homology-type (1);Pleckstrin homology domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62085|0.62085	0.2399|0.2399	L|L	0.60904|0.60904	1.88|1.88	0.80722|0.80722	D|D	1|1	B;D|.	0.69078|.	0.22;0.997|.	B;D|.	0.75020|.	0.074;0.985|.	T|T	0.57682|0.57682	-0.7769|-0.7769	10|5	0.32370|.	T|.	0.25|.	-37.3361|-37.3361	11.4244|11.4244	0.50001|0.50001	0.1477:0.0:0.8523:0.0|0.1477:0.0:0.8523:0.0	.|.	428;520|.	E9PC42;Q8N5V2|.	.;NGEF_HUMAN|.	L|Y	520;428;410;243|112	ENSP00000264051:F520L;ENSP00000362653:F428L;ENSP00000439035:F243L|.	ENSP00000264051:F520L|.	F|S	-|-	3|2	2|0	NGEF|NGEF	233456976|233456976	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	4.633000|4.633000	0.61318|0.61318	0.553000|0.553000	0.29044|0.29044	-0.140000|-0.140000	0.14226|0.14226	TTC|TCC			0.612	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000257051.2		XM_044799	
FRG1B	284802	bcgsc.ca	37	20	29628233	29628233	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr20:29628233A>G	ENST00000278882.3	+	6	615	c.235A>G	c.(235-237)Atg>Gtg	p.M79V	FRG1B_ENST00000358464.4_Missense_Mutation_p.M79V|FRG1B_ENST00000439954.2_Missense_Mutation_p.M84V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	79										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTAGGGGAAAATGGCTTTGTT	0.363																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	284802	.			GGGAAAATGGCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.235A>G	20.37:g.29628233A>G	ENSP00000278882:p.Met79Val		Somatic	329	0.0121580547	4		WXS	Illumina HiSeq	Phase_1	418	0.04	15	.	79	0.00	0	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	3.138	-0.176853	0.06380	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.41065	1.01	2.08	2.08	0.27032	Actin cross-linking (1);	0.040228	0.85682	D	0.000000	T	0.23370	0.0565	.	.	.	0.41063	D	0.985397	B;B	0.17852	0.002;0.024	B;B	0.25140	0.03;0.058	T	0.04593	-1.0940	9	0.11794	T	0.64	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	84;79	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	79;84;79	ENSP00000408863:M84V	ENSP00000278882:M79V	M	+	1	0	FRG1B	28241894	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	4.813000	0.62620	1.208000	0.43306	0.347000	0.21830	ATG			0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
BHLHE23	128408	mdanderson.org	37	20	61637701	61637701	+	Silent	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr20:61637701G>T	ENST00000370346.2	-	1	686	c.378C>A	c.(376-378)gtC>gtA	p.V126V		NM_080606.3	NP_542173	Q8NDY6	BHE23_HUMAN	basic helix-loop-helix family, member e23	126	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)	1						CGTAGGGGATGACGGCTCGCA	0.687																																					p.V126V													.	.			0			c.C378A												25.0	23.0	24.0					20																	61637701		2198	4298	6496	SO:0001819	synonymous_variant	128408	exon1			GGGGATGACGGCT	AL121673	CCDS33507.1, CCDS33507.2	20q13.33	2009-01-12	2009-01-12	2009-01-12	ENSG00000125533	ENSG00000125533		"""Basic helix-loop-helix proteins"""	16093	protein-coding gene	gene with protein product		609331	"""basic helix-loop-helix domain containing, class B, 4"""	BHLHB4		11863370, 18557763	Standard	NM_080606		Approved	bA305P22.3, Beta4, bHLHe23	uc002yeb.2	Q8NDY6	OTTHUMG00000032948	ENST00000370346.2:c.378C>A	20.37:g.61637701G>T			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_080606	17	0.00	0	B2RP69	Silent	SNP	ENST00000370346.2	37	CCDS33507.1																																																																																					0.687	BHLHE23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080095.2		NM_080606	
THAP7	80764	broad.mit.edu	37	22	21357115	21357115	+	5'Flank	SNP	A	A	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr22:21357115A>G	ENST00000215742.4	-	0	0				THAP7_ENST00000399133.2_5'Flank|THAP7-AS1_ENST00000436079.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000429962.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GGAAATTTTAATAGGTAATTA	0.557																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			ATTTTAATAGGTA	BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879		22.37:g.21357115A>G	Exception_encountered		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	.	10	0.10	1	B2RD97|D3DX40	RNA	SNP	ENST00000215742.4	37	CCDS13787.1																																																																																					0.557	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320405.1		NM_030573	
HRH1	3269	mdanderson.org	37	3	11301767	11301767	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr3:11301767G>T	ENST00000397056.1	+	3	1235	c.1044G>T	c.(1042-1044)gaG>gaT	p.E348D	HRH1_ENST00000438284.2_Missense_Mutation_p.E348D|HRH1_ENST00000431010.2_Missense_Mutation_p.E348D	NM_000861.3|NM_001098211.1	NP_000852.1|NP_001091681.1	P35367	HRH1_HUMAN	histamine receptor H1	348					cellular response to histamine (GO:0071420)|eosinophil chemotaxis (GO:0048245)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|inositol phosphate-mediated signaling (GO:0048016)|memory (GO:0007613)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|regulation of vascular permeability (GO:0043114)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|histamine receptor activity (GO:0004969)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25					Aceprometazine(DB01615)|Alcaftadine(DB06766)|Alimemazine(DB01246)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Antazoline(DB08799)|Aripiprazole(DB01238)|Asenapine(DB06216)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzatropine(DB00245)|Bepotastine(DB04890)|Betahistine(DB06698)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlorcyclizine(DB08936)|Chloropyramine(DB08800)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clemastine(DB00283)|Clofedanol(DB04837)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Dimetindene(DB08801)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Escitalopram(DB01175)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Iloperidone(DB04946)|Imipramine(DB00458)|Isothipendyl(DB08802)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Loxapine(DB00408)|Maprotiline(DB00934)|Meclizine(DB00737)|Mepyramine(DB06691)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Paliperidone(DB01267)|Phenindamine(DB01619)|Pheniramine(DB01620)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	AGATATCAGAGGATCAGATGT	0.537																																					p.E348D													.	.			0			c.G1044T												127.0	109.0	115.0					3																	11301767		2203	4300	6503	SO:0001583	missense	3269	exon3			ATCAGAGGATCAG		CCDS2604.1	3p25	2012-11-12			ENSG00000196639	ENSG00000196639		"""GPCR / Class A : Histamine receptors"""	5182	protein-coding gene	gene with protein product		600167				8003029	Standard	NM_001098211		Approved		uc010hds.3	P35367	OTTHUMG00000129719	ENST00000397056.1:c.1044G>T	3.37:g.11301767G>T	ENSP00000380247:p.Glu348Asp		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_000861	1	0.00	0	A8K047|Q6P9E5	Missense_Mutation	SNP	ENST00000397056.1	37	CCDS2604.1	.	.	.	.	.	.	.	.	.	.	G	8.917	0.960133	0.18507	.	.	ENSG00000196639	ENST00000438284;ENST00000431010;ENST00000397056	T;T;T	0.66815	-0.23;-0.23;-0.23	6.08	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.275746	0.39985	N	0.001206	T	0.50718	0.1632	N	0.25890	0.77	0.31390	N	0.677979	B	0.10296	0.003	B	0.17722	0.019	T	0.50634	-0.8805	10	0.18276	T	0.48	-13.2542	11.7324	0.51746	0.0697:0.1958:0.7345:0.0	.	348	P35367	HRH1_HUMAN	D	348	ENSP00000406705:E348D;ENSP00000397028:E348D;ENSP00000380247:E348D	ENSP00000380247:E348D	E	+	3	2	HRH1	11276767	0.919000	0.31177	0.860000	0.33809	0.022000	0.10575	0.484000	0.22308	1.586000	0.49944	0.655000	0.94253	GAG			0.537	HRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251928.2			
CDC25A	993	mdanderson.org	37	3	48229409	48229409	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr3:48229409C>T	ENST00000302506.3	-	1	437	c.29G>A	c.(28-30)cGc>cAc	p.R10H	CDC25A_ENST00000351231.3_Missense_Mutation_p.R10H	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	10				EPPHR -> SPAP (in Ref. 1; AAA58415). {ECO:0000305}.	cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		CAGGCGGCGGCGGTGCGGGGG	0.766																																					p.R10H													.	.			0			c.G29A												3.0	4.0	4.0					3																	48229409		1718	3386	5104	SO:0001583	missense	993	exon1			CGGCGGCGGTGCG	M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.29G>A	3.37:g.48229409C>T	ENSP00000303706:p.Arg10His		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_201567	47	0.00	0	Q8IZH5|Q96IL3|Q9H2F2	Missense_Mutation	SNP	ENST00000302506.3	37	CCDS2760.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450179	0.63290	.	.	ENSG00000164045	ENST00000302506;ENST00000351231;ENST00000443342;ENST00000437972	T;T;T;T	0.54279	2.26;2.09;1.62;0.58	3.96	3.96	0.45880	.	0.386006	0.24645	N	0.036761	T	0.44498	0.1296	N	0.16368	0.405	0.38290	D	0.942688	D;D	0.59767	0.979;0.986	P;B	0.50270	0.636;0.432	T	0.54470	-0.8289	10	0.72032	D	0.01	.	11.6876	0.51497	0.0:1.0:0.0:0.0	.	10;10	P30304-2;P30304	.;MPIP1_HUMAN	H	10	ENSP00000303706:R10H;ENSP00000343166:R10H;ENSP00000416483:R10H;ENSP00000404285:R10H	ENSP00000303706:R10H	R	-	2	0	CDC25A	48204413	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.398000	0.52579	2.184000	0.69523	0.555000	0.69702	CGC			0.766	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257512.2		NM_001789	
GLYCTK	132158	mdanderson.org	37	3	52326751	52326751	+	Missense_Mutation	SNP	C	C	A	rs9813489	byFrequency	TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr3:52326751C>A	ENST00000436784.2	+	5	1241	c.1181C>A	c.(1180-1182)aCc>aAc	p.T394N	GLYCTK_ENST00000477382.1_3'UTR|GLYCTK_ENST00000461183.1_Intron|GLYCTK_ENST00000305690.8_Intron|GLYCTK_ENST00000354773.4_3'UTR|GLYCTK-AS1_ENST00000493616.1_RNA|MIR135A1_ENST00000385191.1_RNA|GLYCTK_ENST00000473032.1_Intron|GLYCTK_ENST00000471180.1_Intron			Q8IVS8	GLCTK_HUMAN	glycerate kinase	394			T -> I (in dbSNP:rs9813489).		protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		GCTCTGGAGACCATGGCATGG	0.652																																					p.T394N													.	.			0			c.C1181A												36.0	40.0	39.0					3																	52326751		2203	4300	6503	SO:0001583	missense	132158	exon5			TGGAGACCATGGC		CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.1181C>A	3.37:g.52326751C>A	ENSP00000389175:p.Thr394Asn		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_145262	29	0.00	0	Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	ENST00000436784.2	37	CCDS2852.1	.	.	.	.	.	.	.	.	.	.	C	0.053	-1.245071	0.01481	.	.	ENSG00000168237	ENST00000436784;ENST00000411757	T	0.54279	0.58	5.85	2.13	0.27403	.	0.284540	0.40222	N	0.001144	T	0.28101	0.0693	N	0.08118	0	0.38748	D	0.954045	B	0.23806	0.091	B	0.27262	0.078	T	0.06144	-1.0843	9	.	.	.	-0.1724	8.2245	0.31560	0.0:0.6979:0.1132:0.1889	.	394	Q8IVS8	GLCTK_HUMAN	N	394;328	ENSP00000389175:T394N	.	T	+	2	0	GLYCTK	52301791	0.844000	0.29557	0.031000	0.17742	0.003000	0.03518	1.555000	0.36277	0.113000	0.18004	-0.819000	0.03115	ACC			0.652	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350835.1		NM_145262	
STAB1	23166	mdanderson.org	37	3	52545761	52545761	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr3:52545761G>T	ENST00000321725.6	+	26	2959	c.2883G>T	c.(2881-2883)ctG>ctT	p.L961L		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	961	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCCACGGCCTGGTAAGGGGGT	0.662																																					p.L961L													.	.			0			c.G2883T												18.0	15.0	16.0					3																	52545761		2193	4294	6487	SO:0001630	splice_region_variant	23166	exon26			CGGCCTGGTAAGG	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.2883+1G>T	3.37:g.52545761G>T			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_015136	0		0	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	37	CCDS33768.1																																																																																					0.662	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351380.2		NM_015136	Silent
ACTR8	93973	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	53905293	53905293	+	Silent	SNP	C	C	G	rs371208984		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr3:53905293C>G	ENST00000335754.3	-	11	1633	c.1533G>C	c.(1531-1533)ctG>ctC	p.L511L	ACTR8_ENST00000488802.1_5'Flank|ACTR8_ENST00000231909.7_Silent_p.L216L|ACTR8_ENST00000482349.1_Silent_p.L400L	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	511					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TGGCTTTATCCAGGCCCAGGG	0.512																																					p.L511L													.	ACTR8	56		0			c.G1533C												95.0	94.0	94.0					3																	53905293		2203	4300	6503	SO:0001819	synonymous_variant	93973	exon11			TTTATCCAGGCCC		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.1533G>C	3.37:g.53905293C>G			Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	164	0.07	12	NM_022899	77	0.03	2	B3KSW7|Q8N566|Q9H663	Silent	SNP	ENST00000335754.3	37	CCDS2875.1	.	.	.	.	.	.	.	.	.	.	C	8.916	0.959926	0.18507	.	.	ENSG00000113812	ENST00000486794	.	.	.	5.67	2.73	0.32206	.	.	.	.	.	T	0.58221	0.2107	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50259	-0.8849	4	.	.	.	3.2025	8.9246	0.35632	0.4035:0.3834:0.2131:0.0	.	.	.	.	S	265	.	.	W	-	2	0	ACTR8	53880333	0.991000	0.36638	1.000000	0.80357	0.998000	0.95712	0.365000	0.20348	0.247000	0.21414	0.655000	0.94253	TGG			0.512	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350562.2		NM_022899	
IMPG2	50939	mdanderson.org	37	3	100963001	100963001	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr3:100963001G>T	ENST00000193391.7	-	13	2361	c.2174C>A	c.(2173-2175)aCa>aAa	p.T725K		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	725					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TGCTACAGATGTCAGTATAAG	0.438																																					p.T725K													.	.			0			c.C2174A												81.0	68.0	72.0					3																	100963001		2203	4300	6503	SO:0001583	missense	50939	exon13			ACAGATGTCAGTA	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2174C>A	3.37:g.100963001G>T	ENSP00000193391:p.Thr725Lys		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	75	0.05	4	NM_016247	0		0	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	G	1.017	-0.686200	0.03328	.	.	ENSG00000081148	ENST00000193391	T	0.22945	1.93	4.74	2.78	0.32641	.	0.431414	0.22309	N	0.061742	T	0.13457	0.0326	N	0.24115	0.695	0.09310	N	1	B;B	0.33694	0.421;0.421	B;B	0.27500	0.08;0.056	T	0.16988	-1.0384	10	0.23302	T	0.38	-0.0206	8.9804	0.35961	0.0803:0.0:0.774:0.1457	.	725;725	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	K	725	ENSP00000193391:T725K	ENSP00000193391:T725K	T	-	2	0	IMPG2	102445691	0.011000	0.17503	0.005000	0.12908	0.265000	0.26407	0.718000	0.25866	1.330000	0.45394	0.561000	0.74099	ACA			0.438	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353256.3			
KLF3	51274	mdanderson.org	37	4	38696516	38696516	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr4:38696516G>T	ENST00000261438.5	+	5	1150	c.845G>T	c.(844-846)aGa>aTa	p.R282I		NM_016531.5	NP_057615.3	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	282					cellular response to peptide (GO:1901653)|multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18						GCACACAGAAGAACACACACA	0.408																																					p.R282I													.	.			0			c.G845T												104.0	92.0	96.0					4																	38696516		2203	4300	6503	SO:0001583	missense	51274	exon5			ACAGAAGAACACA	AF285837	CCDS3444.1	4p16.1-p15.2	2013-01-08			ENSG00000109787	ENSG00000109787		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16516	protein-coding gene	gene with protein product	"""basic Kruppel-like factor"""	609392				18391014	Standard	NM_016531		Approved	BKLF	uc003gth.4	P57682	OTTHUMG00000097821	ENST00000261438.5:c.845G>T	4.37:g.38696516G>T	ENSP00000261438:p.Arg282Ile		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_016531	16	0.00	0	Q6PIR1|Q86TN0|Q9P2X6	Missense_Mutation	SNP	ENST00000261438.5	37	CCDS3444.1	.	.	.	.	.	.	.	.	.	.	G	34	5.374294	0.95923	.	.	ENSG00000109787	ENST00000261438	T	0.24908	1.83	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.56891	0.2016	M	0.77313	2.365	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.55866	-0.8073	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	282	P57682	KLF3_HUMAN	I	282	ENSP00000261438:R282I	ENSP00000261438:R282I	R	+	2	0	KLF3	38372911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	AGA			0.408	KLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215093.2			
FRAS1	80144	mdanderson.org	37	4	79284686	79284686	+	Silent	SNP	G	G	A			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr4:79284686G>A	ENST00000325942.6	+	21	2882	c.2442G>A	c.(2440-2442)caG>caA	p.Q814Q	FRAS1_ENST00000264895.6_Silent_p.Q814Q	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	814					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACCTGTGCCAGCACTGTGCAG	0.587																																					p.Q814Q													.	.			0			c.G2442A												40.0	40.0	40.0					4																	79284686		2117	4242	6359	SO:0001819	synonymous_variant	80144	exon21			GTGCCAGCACTGT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.2442G>A	4.37:g.79284686G>A			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_025074	1	0.00	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	CCDS54772.1																																																																																					0.587	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000362706.2			
MAML3	55534	hgsc.bcm.edu	37	4	140811125	140811125	+	Missense_Mutation	SNP	G	G	T	rs62344940		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr4:140811125G>T	ENST00000509479.2	-	2	2321	c.1465C>A	c.(1465-1467)Caa>Aaa	p.Q489K	MAML3_ENST00000398940.1_Missense_Mutation_p.Q28K|MAML3_ENST00000327122.5_Missense_Mutation_p.Q333K	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					tgctgctgttgctgttgctgt	0.552																																					p.Q489K													MAML3_ENST00000509479,colon,carcinoma,+2,2	MAML3_ENST00000509479	2	2	0			c.C1465A												17.0	20.0	19.0					4																	140811125		2194	4294	6488	SO:0001583	missense	55534	exon2			GCTGTTGCTGTTG	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1465C>A	4.37:g.140811125G>T	ENSP00000421180:p.Gln489Lys		Somatic	68	0.0294117647	2		WXS	Illumina HiSeq	.	52	0.15	8	NM_018717	4	0.00	0		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	G	3.000	-0.206260	0.06180	.	.	ENSG00000196782	ENST00000509479;ENST00000327122;ENST00000398940	T;T	0.76448	0.83;-1.02	2.61	2.61	0.31194	.	0.000000	0.64402	D	0.000001	T	0.66607	0.2806	N	0.08118	0	0.31344	N	0.683255	P	0.43392	0.805	P	0.59424	0.857	T	0.64106	-0.6485	10	0.05436	T	0.98	.	8.8799	0.35367	0.0:0.0:1.0:0.0	rs62344940	489	Q96JK9	MAML3_HUMAN	K	489;333;28	ENSP00000421180:Q489K;ENSP00000313316:Q333K	ENSP00000313316:Q333K	Q	-	1	0	MAML3	141030575	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	3.291000	0.51764	1.788000	0.52465	0.484000	0.47621	CAA			0.552	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364934.2			
GAB1	2549	mdanderson.org	37	4	144378923	144378923	+	Intron	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr4:144378923G>T	ENST00000262994.4	+	7	1887				GAB1_ENST00000505913.1_Intron|GAB1_ENST00000262995.4_Splice_Site	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1						activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					AGAAGAAAGGGTATGTACTTT	0.338																																					.													.	.			0			c.1675+1G>T												60.0	54.0	56.0					4																	144378923		2203	4300	6503	SO:0001627	intron_variant	2549	exon7			GAAAGGGTATGTA	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1586-1615G>T	4.37:g.144378923G>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_207123	0		0	A8K152|Q4W5G2|Q6P1W2	Splice_Site	SNP	ENST00000262994.4	37	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302895	0.81136	.	.	ENSG00000109458	ENST00000262995	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4037	0.90526	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GAB1	144598373	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.199000	0.95003	2.345000	0.79718	0.655000	0.94253	.			0.338	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000364998.1		NM_002039	
CLCN3	1182	mdanderson.org	37	4	170557224	170557224	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr4:170557224G>T	ENST00000513761.1	+	2	704	c.145G>T	c.(145-147)Ggt>Tgt	p.G49C	CLCN3_ENST00000504131.2_Start_Codon_SNP_p.M1I|CLCN3_ENST00000347613.4_Missense_Mutation_p.G49C|CLCN3_ENST00000506924.1_3'UTR|CLCN3_ENST00000360642.3_Missense_Mutation_p.G49C	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	49					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TTTATTAGATGGTGACACTGC	0.333																																					p.G49C													.	.			0			c.G145T												108.0	104.0	106.0					4																	170557224		2203	4300	6503	SO:0001583	missense	1182	exon2			TTAGATGGTGACA	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.145G>T	4.37:g.170557224G>T	ENSP00000424603:p.Gly49Cys		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001243372	9	0.00	0	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	37	CCDS34101.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.57|14.57	2.574668|2.574668	0.45902|0.45902	.|.	.|.	ENSG00000109572|ENSG00000109572	ENST00000511092;ENST00000513761;ENST00000347613;ENST00000360642;ENST00000512813;ENST00000538301|ENST00000504131	D;D;D;D;D|D	0.91631|0.88124	-2.88;-2.47;-2.49;-2.45;-2.41|-2.34	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.359480|.	0.31031|.	N|.	0.008385|.	T|T	0.79678|0.79678	0.4487|0.4487	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	D;D;D|B	0.65815|0.17038	0.97;0.97;0.995|0.02	P;P;P|B	0.55303|0.12156	0.502;0.619;0.773|0.007	T|T	0.73285|0.73285	-0.4031|-0.4031	10|9	0.56958|0.39692	D|T	0.05|0.17	-9.7539|-9.7539	19.2378|19.2378	0.93867|0.93867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	49;49;49|1	B7Z932;P51790;P51790-2|B9EGJ9	.;CLCN3_HUMAN;.|.	C|I	49|1	ENSP00000425160:G49C;ENSP00000424603:G49C;ENSP00000261514:G49C;ENSP00000353857:G49C;ENSP00000425823:G49C|ENSP00000424540:M1I	ENSP00000261514:G49C|ENSP00000424540:M1I	G|M	+|+	1|3	0|0	CLCN3|CLCN3	170793799|170793799	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	9.160000|9.160000	0.94734|0.94734	2.622000|2.622000	0.88805|0.88805	0.563000|0.563000	0.77884|0.77884	GGT|ATG			0.333	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000363210.2			
GALNT7	51809	mdanderson.org	37	4	174169131	174169131	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr4:174169131G>T	ENST00000265000.4	+	2	210	c.127G>T	c.(127-129)Gaa>Taa	p.E43*	GALNT7_ENST00000512285.1_Splice_Site_p.E43*	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	43					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTTTGTATAGGAAGACAGAGA	0.483																																					p.E43X													.	.			0			c.G127T												48.0	47.0	47.0					4																	174169131		2203	4300	6503	SO:0001630	splice_region_variant	51809	exon2			GTATAGGAAGACA	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.127-1G>T	4.37:g.174169131G>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_017423	24	0.00	0	B3KQU3|Q7Z5W7|Q9UJ28	Nonsense_Mutation	SNP	ENST00000265000.4	37	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	G	35	5.437148	0.96168	.	.	ENSG00000109586	ENST00000265000;ENST00000512285	.	.	.	5.7	5.7	0.88788	.	2.038100	0.02546	N	0.095138	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4362	0.94796	0.0:0.0:1.0:0.0	.	.	.	.	X	43	.	.	E	+	1	0	GALNT7	174405706	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.136000	0.58004	2.683000	0.91414	0.655000	0.94253	GAA			0.483	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362456.2		NM_017423	Nonsense_Mutation
TRIP13	9319	mdanderson.org	37	5	893132	893132	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr5:893132G>T	ENST00000166345.3	+	1	375	c.19G>T	c.(19-21)Gac>Tac	p.D7Y	BRD9_ENST00000467963.1_5'Flank|BRD9_ENST00000435709.2_5'Flank|BRD9_ENST00000483173.1_5'Flank	NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	7					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			GGCCGTGGGCGACCTGAAGCA	0.726																																					p.D7Y													.	.			0			c.G19T												14.0	14.0	14.0					5																	893132		2163	4268	6431	SO:0001583	missense	9319	exon1			GTGGGCGACCTGA	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.19G>T	5.37:g.893132G>T	ENSP00000166345:p.Asp7Tyr		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001166260	45	0.00	0	C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	ENST00000166345.3	37	CCDS3858.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321123	0.41096	.	.	ENSG00000071539	ENST00000166345;ENST00000354240	D	0.95171	-3.63	3.93	3.93	0.45458	.	0.366479	0.27113	N	0.020867	D	0.88470	0.6445	N	0.22421	0.69	0.45676	D	0.998593	P	0.44090	0.826	B	0.35510	0.204	D	0.90106	0.4188	10	0.72032	D	0.01	-3.8916	14.5079	0.67764	0.0:0.0:1.0:0.0	.	7	Q15645	PCH2_HUMAN	Y	7	ENSP00000166345:D7Y	ENSP00000166345:D7Y	D	+	1	0	TRIP13	946132	0.843000	0.29541	1.000000	0.80357	0.642000	0.38348	4.395000	0.59678	1.737000	0.51674	0.297000	0.19635	GAC			0.726	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206721.2		NM_004237	
SPZ1	84654	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79616895	79616895	+	Silent	SNP	C	C	G	rs536377169	byFrequency	TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr5:79616895C>G	ENST00000296739.4	+	1	1106	c.861C>G	c.(859-861)gtC>gtG	p.V287V		NM_032567.3	NP_115956.3	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	287					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(5)|large_intestine(4)|lung(12)|ovary(1)|skin(2)	26		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		ATAATGGAGTCGGTTTCCAAA	0.413																																					p.V287V													.	SPZ1	60		0			c.C861G												96.0	92.0	93.0					5																	79616895		1853	4098	5951	SO:0001819	synonymous_variant	84654	exon1			TGGAGTCGGTTTC		CCDS43336.1	5q14.1	2014-06-13				ENSG00000164299			30721	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 148"""					11165476, 12778315, 15226296, 15829580, 15899793	Standard	NM_032567		Approved	NYD-TSP1, FLJ25709, PPP1R148	uc003kgn.3	Q9BXG8		ENST00000296739.4:c.861C>G	5.37:g.79616895C>G			Somatic	232	0.0129310345	3		WXS	Illumina HiSeq	Phase_I	327	0.27	88	NM_032567	5	0.40	2	B2RA21|Q8N4P1|Q8N7E9	Silent	SNP	ENST00000296739.4	37	CCDS43336.1																																																																																					0.413	SPZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369322.1		NM_032567	
UNC5A	90249	broad.mit.edu	37	5	176295152	176295152	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr5:176295152G>T	ENST00000329542.4	+	3	588	c.314G>T	c.(313-315)cGc>cTc	p.R105L	UNC5A_ENST00000261961.3_Missense_Mutation_p.R65L	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	105	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGGAGGTCCGCATTAATGTC	0.642																																					p.R105L													.	UNC5A	76		0			c.G314T												118.0	114.0	115.0					5																	176295152		2203	4300	6503	SO:0001583	missense	90249	exon3			AGGTCCGCATTAA	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.314G>T	5.37:g.176295152G>T	ENSP00000332737:p.Arg105Leu		Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	159	0.04	6	NM_133369	2	0.00	0	B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	37	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	G	9.014	0.983164	0.18889	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	T;T	0.20463	2.07;2.07	5.13	4.25	0.50352	Immunoglobulin-like fold (1);	0.083387	0.53938	D	0.000048	T	0.21387	0.0515	L	0.40543	1.245	0.30070	N	0.810151	P;B;P	0.45126	0.658;0.051;0.851	B;B;P	0.47299	0.343;0.051;0.543	T	0.04915	-1.0918	10	0.27785	T	0.31	-29.9644	9.5531	0.39321	0.1643:0.0:0.8357:0.0	.	65;105;105	Q6ZN44-3;Q6ZN44;Q6ZN44-2	.;UNC5A_HUMAN;.	L	105;65	ENSP00000332737:R105L;ENSP00000261961:R65L	ENSP00000261961:R65L	R	+	2	0	UNC5A	176227758	0.974000	0.33945	0.933000	0.37362	0.168000	0.22595	2.983000	0.49345	1.148000	0.42385	0.491000	0.48974	CGC			0.642	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372166.1		XM_030300	
UBR2	23304	broad.mit.edu	37	6	42615876	42615876	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr6:42615876G>T	ENST00000372899.1	+	22	2688	c.2430G>T	c.(2428-2430)atG>atT	p.M810I	UBR2_ENST00000372901.1_Missense_Mutation_p.M810I|UBR2_ENST00000372883.3_Missense_Mutation_p.M314I	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	810					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AGACTGGCATGGAGAGTGTAA	0.358																																					p.M810I													.	UBR2	134		0			c.G2430T												274.0	243.0	254.0					6																	42615876		2203	4300	6503	SO:0001583	missense	23304	exon22			TGGCATGGAGAGT	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2430G>T	6.37:g.42615876G>T	ENSP00000361990:p.Met810Ile		Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	299	0.01	4	NM_015255	42	0.00	0	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199192	0.79015	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.48201	0.82;0.82;0.82	5.83	5.83	0.93111	.	0.042773	0.85682	D	0.000000	T	0.24812	0.0602	N	0.17379	0.485	0.80722	D	1	P;B	0.38827	0.649;0.01	B;B	0.36567	0.228;0.017	T	0.08868	-1.0701	10	0.45353	T	0.12	-35.5827	20.126	0.97982	0.0:0.0:1.0:0.0	.	810;810	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	I	810;810;314	ENSP00000361990:M810I;ENSP00000361992:M810I;ENSP00000361974:M314I	ENSP00000361974:M314I	M	+	3	0	UBR2	42723854	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.209000	0.95087	2.749000	0.94314	0.655000	0.94253	ATG			0.358	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040558.2		NM_015255	
GRID2IP	392862	mdanderson.org	37	7	6590901	6590901	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr7:6590901G>T	ENST00000457091.2	-	1	166	c.167C>A	c.(166-168)gCg>gAg	p.A56E		NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	56	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						ACCGCCCACCGCCAGCCCCTC	0.751																																					p.A56E													.	.			0			c.C167A												5.0	7.0	7.0					7																	6590901		662	1556	2218	SO:0001583	missense	392862	exon1			CCCACCGCCAGCC		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.167C>A	7.37:g.6590901G>T	ENSP00000397351:p.Ala56Glu		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_001145118	0		0		Missense_Mutation	SNP	ENST00000457091.2	37	CCDS47537.1	.	.	.	.	.	.	.	.	.	.	G	5.961	0.361216	0.11296	.	.	ENSG00000215045	ENST00000457091	T	0.26957	1.7	4.54	3.65	0.41850	PDZ/DHR/GLGF (4);	0.209095	0.18249	U	0.147014	T	0.15955	0.0384	N	0.11789	0.175	0.09310	N	1	P	0.35208	0.49	B	0.38156	0.266	T	0.14868	-1.0457	10	0.33940	T	0.23	.	10.6572	0.45682	0.096:0.0:0.904:0.0	.	56	A4D2P6	GRD2I_HUMAN	E	56	ENSP00000397351:A56E	ENSP00000397351:A56E	A	-	2	0	GRID2IP	6557426	0.984000	0.35163	0.051000	0.19133	0.094000	0.18550	4.744000	0.62118	1.041000	0.40125	-0.391000	0.06502	GCG			0.751	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340534.1		XM_294249	
LINC00174	285908	mdanderson.org	37	7	65842187	65842187	+	lincRNA	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr7:65842187G>T	ENST00000421767.1	-	0	3545					NR_026873.1				long intergenic non-protein coding RNA 174																		AGAGGCCGCTGGCAGGCAGGA	0.751																																					.													.	.			0			.												2.0	3.0	3.0					7																	65842187		1583	3419	5002			285908	.			GCCGCTGGCAGGC	AK091213		7q11.21	2013-12-05	2013-12-05	2013-12-05	ENSG00000179406	ENSG00000179406		"""Long non-coding RNAs"""	27788	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 174"""	NCRNA00174			Standard	NR_026873		Approved		uc003tux.4		OTTHUMG00000156590		7.37:g.65842187G>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	.	4	0.00	0		RNA	SNP	ENST00000421767.1	37																																																																																						0.751	LINC00174-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000344721.1		NR_026873	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82582694	82582694	+	Missense_Mutation	SNP	T	T	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr7:82582694T>G	ENST00000333891.9	-	5	7912	c.7575A>C	c.(7573-7575)aaA>aaC	p.K2525N	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.K2525N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.K2525K(2)|p.K2456K(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TATCTGTTGGTTTTTGTGTAG	0.433																																					p.K2525N													Q9Y6V0-3,rectum,carcinoma,0,3	Q9Y6V0-3	0	3	3	Substitution - coding silent(3)	large_intestine(3)	c.A7575C												107.0	104.0	105.0					7																	82582694		1922	4131	6053	SO:0001583	missense	27445	exon5			TGTTGGTTTTTGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7575A>C	7.37:g.82582694T>G	ENSP00000334319:p.Lys2525Asn		Somatic	100	0	0		WXS	Illumina HiSeq	.	110	0.30	33	NM_014510	0		0		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	5.801	0.332093	0.10956	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17854	2.26;2.25	4.66	0.812	0.18744	.	.	.	.	.	T	0.19805	0.0476	L	0.47716	1.5	0.80722	D	1	P;P	0.48016	0.904;0.904	P;P	0.48227	0.571;0.571	T	0.03034	-1.1080	9	0.87932	D	0	.	9.2895	0.37778	0.0:0.3259:0.0:0.6741	.	2525;2525	Q9Y6V0-5;Q9Y6V0-6	.;.	N	2456;2525;2525	ENSP00000334319:K2525N;ENSP00000388393:K2525N	ENSP00000334319:K2525N	K	-	3	2	PCLO	82420630	0.998000	0.40836	0.989000	0.46669	0.808000	0.45660	0.953000	0.29162	0.182000	0.20032	0.397000	0.26171	AAA			0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337368.5		NM_014510	
SSPO	23145	mdanderson.org	37	7	149483303	149483303	+	RNA	SNP	G	G	T			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr7:149483303G>T	ENST00000378016.2	+	0	3371							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)	p.W374L(1)				Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACCCTGCTCTGGGATGGAGAT	0.637																																					p.W1124L													Q76B61_HUMAN,colon,carcinoma,-1,2	Q76B61_HUMAN	-1	2	1	Substitution - Missense(1)	large_intestine(1)	c.G3371T												29.0	34.0	33.0					7																	149483303		2133	4222	6355			23145	exon23			TGCTCTGGGATGG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149483303G>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_198455	0		0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																						0.637	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
ADAMDEC1	27299	broad.mit.edu	37	8	24256526	24256526	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr8:24256526A>G	ENST00000256412.4	+	9	1122	c.902A>G	c.(901-903)aAg>aGg	p.K301R	RP11-624C23.1_ENST00000519689.1_RNA|ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.K222R|RP11-624C23.1_ENST00000523578.1_RNA|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.K222R	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	301	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		CTGGGGAAAAAGATCCACGAC	0.512																																					p.K301R	Ovarian(147;687 1849 3699 25981 31337)												.	ADAMDEC1	69		0			c.A902G												94.0	83.0	87.0					8																	24256526		2203	4300	6503	SO:0001583	missense	27299	exon9			GGAAAAAGATCCA	Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.902A>G	8.37:g.24256526A>G	ENSP00000256412:p.Lys301Arg		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	173	0.02	4	NM_014479	2	0.00	0	B7ZAK5	Missense_Mutation	SNP	ENST00000256412.4	37	CCDS6044.1	.	.	.	.	.	.	.	.	.	.	A	10.80	1.452705	0.26074	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.64438	-0.1;-0.1;-0.1	5.88	1.26	0.21427	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.263595	0.33023	N	0.005363	T	0.56587	0.1995	L	0.45352	1.415	0.09310	N	1	B	0.28512	0.214	P	0.48982	0.597	T	0.52139	-0.8615	10	0.05620	T	0.96	-7.9251	3.1732	0.06560	0.5029:0.0:0.3057:0.1914	.	301	O15204	ADEC1_HUMAN	R	301;222;222	ENSP00000256412:K301R;ENSP00000442592:K222R;ENSP00000428993:K222R	ENSP00000256412:K301R	K	+	2	0	ADAMDEC1	24312471	0.000000	0.05858	0.019000	0.16419	0.440000	0.31957	-0.750000	0.04808	-0.039000	0.13602	0.533000	0.62120	AAG			0.512	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215149.2		NM_014479	
ADAM2	2515	broad.mit.edu	37	8	39678591	39678591	+	Missense_Mutation	SNP	G	G	T	rs553158681		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr8:39678591G>T	ENST00000265708.4	-	6	546	c.443C>A	c.(442-444)gCa>gAa	p.A148E	ADAM2_ENST00000379853.2_Missense_Mutation_p.A148E|ADAM2_ENST00000521880.1_Missense_Mutation_p.A148E|ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000347580.4_Missense_Mutation_p.A148E	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	148					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GGAAACATCTGCTTTCTTATG	0.348																																					p.A148E													.	ADAM2	124		0			c.C443A												80.0	80.0	80.0					8																	39678591		2203	4297	6500	SO:0001583	missense	2515	exon6			ACATCTGCTTTCT	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.443C>A	8.37:g.39678591G>T	ENSP00000265708:p.Ala148Glu		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	273	0.02	6	NM_001464	0		0	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	G	0.345	-0.948041	0.02304	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.02158	5.02;4.42;5.25;5.22	5.47	-0.0675	0.13760	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	0.09310	N	1	B;B;B;B	0.12013	0.003;0.005;0.005;0.003	B;B;B;B	0.20577	0.009;0.021;0.03;0.009	T	0.49854	-0.8895	8	.	.	.	.	8.7807	0.34789	0.0732:0.0:0.4287:0.4982	.	148;148;148;148	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	E	148	ENSP00000343854:A148E;ENSP00000369182:A148E;ENSP00000265708:A148E;ENSP00000429352:A148E	.	A	-	2	0	ADAM2	39797748	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.049000	0.14099	-0.352000	0.08237	0.655000	0.94253	GCA			0.348	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376926.1		NM_001464	
PKHD1L1	93035	broad.mit.edu	37	8	110422126	110422126	+	Silent	SNP	T	T	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr8:110422126T>C	ENST00000378402.5	+	19	2108	c.2004T>C	c.(2002-2004)acT>acC	p.T668T		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	668					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGGTTAGCACTAAGTGTCCAC	0.303										HNSCC(38;0.096)																											p.T668T													.	PKHD1L1	522		0			c.T2004C												68.0	65.0	66.0					8																	110422126		1809	4070	5879	SO:0001819	synonymous_variant	93035	exon19			TAGCACTAAGTGT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2004T>C	8.37:g.110422126T>C			Somatic	254	0	0		WXS	Illumina HiSeq	Phase_I	511	0.01	4	NM_177531	0		0	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																					0.303	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381017.1		NM_177531	
BNC2	54796	mdanderson.org	37	9	16419625	16419625	+	Missense_Mutation	SNP	G	G	T	rs370046975		TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr9:16419625G>T	ENST00000380672.4	-	7	2719	c.2662C>A	c.(2662-2664)Cat>Aat	p.H888N	BNC2_ENST00000545497.1_Missense_Mutation_p.H793N|BNC2_ENST00000380667.2_Missense_Mutation_p.H821N	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		AGTTTACGATGTAGGTTTATG	0.478																																					p.H888N													.	.			0			c.C2662A												52.0	59.0	57.0					9																	16419625		2154	4230	6384	SO:0001583	missense	54796	exon7			TACGATGTAGGTT	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.2662C>A	9.37:g.16419625G>T	ENSP00000370047:p.His888Asn		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_017637	25	0.00	0		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506139	0.64410	.	.	ENSG00000173068	ENST00000380672;ENST00000380667;ENST00000545497	T;T;T	0.49432	0.92;0.82;0.78	5.59	5.59	0.84812	Zinc finger, C2H2-like (1);	0.047036	0.85682	D	0.000000	T	0.71584	0.3357	M	0.79926	2.475	0.80722	D	1	B;D;D	0.63880	0.13;0.981;0.993	B;D;D	0.70935	0.075;0.954;0.971	T	0.72740	-0.4202	10	0.51188	T	0.08	-11.3203	19.6005	0.95560	0.0:0.0:1.0:0.0	.	793;888;653	F5H586;Q6ZN30;D3DRJ1	.;BNC2_HUMAN;.	N	888;821;793	ENSP00000370047:H888N;ENSP00000370042:H821N;ENSP00000444640:H793N	ENSP00000370042:H821N	H	-	1	0	BNC2	16409625	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.634000	0.89283	0.655000	0.94253	CAT			0.478	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000216901.5		NM_017637	
MLLT3	4300	hgsc.bcm.edu;broad.mit.edu	37	9	20414311	20414313	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chr9:20414311_20414313delCTG	ENST00000380338.4	-	5	817_819	c.531_533delCAG	c.(529-534)agcagt>agt	p.177_178SS>S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_In_Frame_Del_p.174_175SS>S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	177	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		gctgctgctactgctgctgctgc	0.532			T	MLL	ALL																																p.178_178del				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,caecum,carcinoma,0,1	MLLT3	125		0			c.532_534del																																									SO:0001651	inframe_deletion	4300	exon5			CTGCTACTGCTGC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.531_533delCAG	9.37:g.20414320_20414322delCTG	ENSP00000369695:p.Ser190del		Somatic	75	0	0		WXS	Illumina HiSeq	.	89	0.20	18	NM_004529	3	0.00	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	In_Frame_Del	DEL	ENST00000380338.4	37	CCDS6494.1																																																																																					0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051872.1		NM_004529	
ZBED1	9189	broad.mit.edu	37	X	2406764	2406764	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84Y-01A-11D-A435-10	TCGA-SN-A84Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4995d11c-703d-4935-94e7-2e26ace5db9d	7490b22b-54bc-46e3-8148-e25debbab990	g.chrX:2406764T>C	ENST00000381223.4	-	2	2200	c.1997A>G	c.(1996-1998)gAg>gGg	p.E666G	ZBED1_ENST00000381222.2_Missense_Mutation_p.E666G|DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000515319.1_Intron|ZBED1_ENST00000381218.3_Missense_Mutation_p.E666G	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	666					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGGCCCCACTCCCCCTCGTC	0.647																																					p.E666G													.	ZBED1	64		0			c.A1997G												123.0	117.0	119.0					X																	2406764		2203	4296	6499	SO:0001583	missense	9189	exon2			CCCCACTCCCCCT	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.1997A>G	X.37:g.2406764T>C	ENSP00000370621:p.Glu666Gly		Somatic	331	0.0090634441	3		WXS	Illumina HiSeq	Phase_I	251	0.06	14	NM_001171135	61	0.00	0	Q96BY4	Missense_Mutation	SNP	ENST00000381223.4	37	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	T	10.23	1.293964	0.23564	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218	.	.	.	2.93	2.93	0.34026	.	0.000000	0.41396	U	0.000900	T	0.63260	0.2496	.	.	.	0.09310	N	1	D	0.71674	0.998	D	0.70227	0.968	T	0.54695	-0.8255	8	0.62326	D	0.03	.	10.5576	0.45127	0.0:0.0:0.0:1.0	.	666	O96006	ZBED1_HUMAN	G	666	.	ENSP00000370616:E666G	E	-	2	0	ZBED1	2416764	0.998000	0.40836	0.762000	0.31397	0.518000	0.34316	2.741000	0.47426	0.886000	0.36113	0.347000	0.21830	GAG			0.647	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000144310.3		NM_004729	
