#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SLC25A34	284723	mdanderson.org	37	1	16062988	16062988	+	Missense_Mutation	SNP	C	C	T	rs546244503		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:16062988C>T	ENST00000294454.5	+	1	89	c.8C>T	c.(7-9)aCg>aTg	p.T3M	RP11-288I21.1_ENST00000453804.1_RNA	NM_207348.1	NP_997231.1	Q6PIV7	S2534_HUMAN	solute carrier family 25, member 34	3					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|endometrium(3)|large_intestine(1)|lung(2)|skin(1)	9		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCCATGGAGACGGTGCCCCCA	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		17342	0.0		0.0	False		,,,				2504	0.001				p.T3M													.	.			0			c.C8T												6.0	6.0	6.0					1																	16062988		2088	4115	6203	SO:0001583	missense	284723	exon1			TGGAGACGGTGCC	BC027998	CCDS162.1	1p36.13	2013-05-22			ENSG00000162461	ENSG00000162461		"""Solute carriers"""	27653	protein-coding gene	gene with protein product		610817					Standard	NM_207348		Approved	DKFZp781A10161	uc001axb.1	Q6PIV7	OTTHUMG00000003063	ENST00000294454.5:c.8C>T	1.37:g.16062988C>T	ENSP00000294454:p.Thr3Met		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	22	0.14	3	NM_207348	0		0	Q68DV0	Missense_Mutation	SNP	ENST00000294454.5	37	CCDS162.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.245482	0.22796	.	.	ENSG00000162461	ENST00000294454	T	0.78246	-1.16	3.93	2.99	0.34606	Mitochondrial carrier domain (1);	0.602094	0.17423	N	0.174758	T	0.56171	0.1967	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.12156	0.007	T	0.49934	-0.8886	10	0.54805	T	0.06	.	6.7832	0.23659	0.0:0.8643:0.0:0.1357	.	3	Q6PIV7	S2534_HUMAN	M	3	ENSP00000294454:T3M	ENSP00000294454:T3M	T	+	2	0	SLC25A34	15935575	0.000000	0.05858	0.404000	0.26397	0.019000	0.09904	0.318000	0.19504	0.939000	0.37446	0.462000	0.41574	ACG			0.677	SLC25A34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008467.1		NM_207348	
SZRD1	26099	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	16719757	16719757	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:16719757G>T	ENST00000401088.4	+	3	311	c.136G>T	c.(136-138)Gtg>Ttg	p.V46L	SZRD1_ENST00000471507.1_Missense_Mutation_p.V45L|SZRD1_ENST00000401089.3_Missense_Mutation_p.V27L|SPATA21_ENST00000466212.1_5'Flank|SZRD1_ENST00000375590.3_Missense_Mutation_p.V26L|SZRD1_ENST00000492354.1_Missense_Mutation_p.V26L|SZRD1_ENST00000472461.1_3'UTR	NM_001114600.1|NM_001271869.1	NP_001108072.1|NP_001258798.1	Q7Z422	SZRD1_HUMAN	SUZ RNA binding domain containing 1	46	SUZ. {ECO:0000255|PROSITE- ProRule:PRU01009}.																AGTGCCCATTGTGATTCAGGA	0.567																																					p.V46L													.	SZRD1	1		0			c.G136T												112.0	117.0	116.0					1																	16719757		2024	4160	6184	SO:0001583	missense	26099	exon3			CCCATTGTGATTC	BC010631	CCDS44065.1, CCDS60000.1	1p36.13	2012-07-23	2012-07-23	2012-07-23	ENSG00000055070	ENSG00000055070			30232	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 144"""	C1orf144		12761501	Standard	NM_001114600		Approved	DKFZp566C0424	uc001aym.5	Q7Z422	OTTHUMG00000002217	ENST00000401088.4:c.136G>T	1.37:g.16719757G>T	ENSP00000383866:p.Val46Leu		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	158	0.04	7	NM_001114600	113	0.00	0	A8MXJ2|C9K0U0|Q7Z424|Q8IVM2|Q8TBV3|Q9Y403	Missense_Mutation	SNP	ENST00000401088.4	37	CCDS44065.1	.	.	.	.	.	.	.	.	.	.	G	33	5.213115	0.95069	.	.	ENSG00000055070	ENST00000401088;ENST00000471507;ENST00000401089;ENST00000434120;ENST00000375590;ENST00000492354	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.77512	0.4141	M	0.68952	2.095	0.80722	D	1	D;P;P;D	0.67145	0.99;0.953;0.94;0.996	D;D;B;D	0.76071	0.986;0.935;0.415;0.987	T	0.77900	-0.2415	9	0.46703	T	0.11	-14.0142	17.5072	0.87749	0.0:0.0:1.0:0.0	.	26;46;26;27	F8WEE8;Q7Z422;Q7Z422-2;Q7Z422-4	.;CA144_HUMAN;.;.	L	46;45;27;46;26;26	.	ENSP00000364740:V26L	V	+	1	0	C1orf144	16592344	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.008000	0.76341	2.438000	0.82558	0.655000	0.94253	GTG			0.567	SZRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000006283.2		NM_015609	
FAM43B	163933	mdanderson.org	37	1	20880251	20880251	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:20880251G>T	ENST00000332947.4	+	1	1320	c.785G>T	c.(784-786)aGc>aTc	p.S262I		NM_207334.2	NP_997217.1	Q6ZT52	FA43B_HUMAN	family with sequence similarity 43, member B	262										large_intestine(1)|lung(2)	3		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00979)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.000399)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		CGCCTCAGCAGCATCCaggag	0.761																																					p.S262I													.	.			0			c.G785T												4.0	5.0	4.0					1																	20880251		1801	3643	5444	SO:0001583	missense	163933	exon1			TCAGCAGCATCCA	AK126900	CCDS209.1	1p36.12	2014-08-14			ENSG00000183114	ENSG00000183114			31791	protein-coding gene	gene with protein product						21461611	Standard	NM_207334		Approved	FLJ44952	uc001bdj.3	Q6ZT52	OTTHUMG00000057491	ENST00000332947.4:c.785G>T	1.37:g.20880251G>T	ENSP00000331397:p.Ser262Ile		Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	12	0.25	3	NM_207334	0		0	A5PKT8|A5PL01	Missense_Mutation	SNP	ENST00000332947.4	37	CCDS209.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.589235	0.46110	.	.	ENSG00000183114	ENST00000332947	.	.	.	3.53	3.53	0.40419	.	0.281842	0.26248	U	0.025472	T	0.43166	0.1235	L	0.38175	1.15	0.43476	D	0.99569	P	0.43701	0.815	B	0.42625	0.393	T	0.45614	-0.9249	9	0.87932	D	0	.	8.9493	0.35779	0.0:0.23:0.77:0.0	.	262	Q6ZT52	FA43B_HUMAN	I	262	.	ENSP00000331397:S262I	S	+	2	0	FAM43B	20752838	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.358000	0.59442	1.522000	0.49001	0.313000	0.20887	AGC			0.761	FAM43B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127759.1		NM_207334	
KIF17	57576	mdanderson.org	37	1	20996952	20996952	+	Missense_Mutation	SNP	G	G	T	rs376988005		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:20996952G>T	ENST00000247986.2	-	13	3065	c.2755C>A	c.(2755-2757)Cgc>Agc	p.R919S	KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000375044.1_Missense_Mutation_p.R819S|KIF17_ENST00000400463.3_Missense_Mutation_p.R918S			Q9P2E2	KIF17_HUMAN	kinesin family member 17	919					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GAGGTTTTGCGGGCTGGTTTG	0.602																																					p.R919S													.	.			0			c.C2755A												98.0	89.0	92.0					1																	20996952		2203	4300	6503	SO:0001583	missense	57576	exon13			TTTTGCGGGCTGG	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2755C>A	1.37:g.20996952G>T	ENSP00000247986:p.Arg919Ser		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_020816	40	0.00	0	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.302237	0.23736	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.73258	-0.73;-0.6;-0.59	5.32	3.25	0.37280	.	0.351548	0.14876	U	0.293242	T	0.68100	0.2964	L	0.55481	1.735	0.21861	N	0.999502	P;P;B	0.38827	0.517;0.649;0.376	B;P;B	0.45099	0.279;0.469;0.129	T	0.57136	-0.7863	10	0.34782	T	0.22	.	7.8194	0.29280	0.0913:0.0:0.7091:0.1995	.	919;918;919	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	S	819;918;919;300	ENSP00000364184:R819S;ENSP00000383311:R918S;ENSP00000247986:R919S	ENSP00000247986:R919S	R	-	1	0	KIF17	20869539	0.063000	0.20901	0.777000	0.31699	0.286000	0.27126	0.798000	0.27014	1.252000	0.44001	-0.126000	0.14955	CGC			0.602	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276995.1		NM_020816	
ZBTB8OS	339487	broad.mit.edu	37	1	33099658	33099658	+	Silent	SNP	T	T	C			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:33099658T>C	ENST00000468695.1	-	3	192	c.174A>G	c.(172-174)ggA>ggG	p.G58G	ZBTB8OS_ENST00000341885.5_Intron|ZBTB8OS_ENST00000373501.2_Silent_p.G46G|ZBTB8OS_ENST00000492007.1_Intron	NM_178547.2	NP_848642.1	Q8IWT0	ARCH_HUMAN	zinc finger and BTB domain containing 8 opposite strand	46					tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	extracellular vesicular exosome (GO:0070062)|tRNA-splicing ligase complex (GO:0072669)	metal ion binding (GO:0046872)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCAGAGTATCTCCCCATGCGT	0.408																																					p.G58G													.	ZBTB8OS	9		0			c.A174G												106.0	94.0	98.0					1																	33099658		2203	4300	6503	SO:0001819	synonymous_variant	339487	exon3			AGTATCTCCCCAT	AY151084	CCDS365.1	1p35.1	2010-09-30			ENSG00000176261	ENSG00000176261			24094	protein-coding gene	gene with protein product	"""archease"""	615891				12477932	Standard	NM_178547		Approved	ARCH	uc001bvp.3	Q8IWT0	OTTHUMG00000007856	ENST00000468695.1:c.174A>G	1.37:g.33099658T>C			Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	171	0.02	3	NM_178547	216	0.00	0	Q5TGK5|Q6PDA1|Q8IWS9|Q8NEV6|Q8NEV7	Silent	SNP	ENST00000468695.1	37	CCDS365.1	.	.	.	.	.	.	.	.	.	.	T	10.64	1.407922	0.25378	.	.	ENSG00000176261	ENST00000436661	.	.	.	5.35	-0.0126	0.13988	.	.	.	.	.	T	0.42223	0.1193	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23619	-1.0183	4	.	.	.	-26.2759	2.1445	0.03783	0.1278:0.1453:0.1329:0.5939	.	.	.	.	G	57	.	.	R	-	1	2	ZBTB8OS	32872245	0.981000	0.34729	0.953000	0.39169	0.992000	0.81027	0.095000	0.15127	0.089000	0.17243	0.459000	0.35465	AGA			0.408	ZBTB8OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021669.3		NM_178547	
EVA1B	55194	mdanderson.org	37	1	36788239	36788239	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:36788239G>T	ENST00000270824.1	-	3	446	c.155C>A	c.(154-156)tCg>tAg	p.S52*	SH3D21_ENST00000474766.1_3'UTR|RP11-268J15.5_ENST00000373137.2_5'Flank|EVA1B_ENST00000490466.1_5'UTR	NM_018166.1	NP_060636.1	Q9NVM1	EVA1B_HUMAN	eva-1 homolog B (C. elegans)	52						integral component of membrane (GO:0016021)											gggcgcccACGAGATGCTGAT	0.731																																					p.S52X													.	.			0			c.C155A												2.0	2.0	2.0					1																	36788239		1298	2784	4082	SO:0001587	stop_gained	55194	exon3			GCCCACGAGATGC	AK001509	CCDS406.1	1p34.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000142694	ENSG00000142694			25558	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 78"", ""family with sequence similarity 176, member B"""	C1orf78, FAM176B		14702039	Standard	XM_005270998		Approved	FLJ10647	uc001caj.1	Q9NVM1	OTTHUMG00000007867	ENST00000270824.1:c.155C>A	1.37:g.36788239G>T	ENSP00000270824:p.Ser52*		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_018166	68	0.00	0	D3DPS7	Nonsense_Mutation	SNP	ENST00000270824.1	37	CCDS406.1	.	.	.	.	.	.	.	.	.	.	G	38	7.023416	0.98010	.	.	ENSG00000142694	ENST00000270824	.	.	.	4.79	4.79	0.61399	.	0.058243	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.1724	16.3993	0.83633	0.0:0.0:1.0:0.0	.	.	.	.	X	52	.	ENSP00000270824:S52X	S	-	2	0	FAM176B	36560826	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.803000	0.85983	2.194000	0.70268	0.462000	0.41574	TCG			0.731	EVA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021689.1		NM_018166	
SZT2	23334	bcgsc.ca;mdanderson.org	37	1	43906994	43906994	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:43906994G>A	ENST00000562955.1	+	52	7283	c.7283G>A	c.(7282-7284)cGg>cAg	p.R2428Q	SZT2_ENST00000372442.1_Missense_Mutation_p.R1586Q	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2485					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GAGAGTGTTCGGACTCCTGGT	0.582																																					p.R2428Q													.	SZT2	383		0			c.G7283A												72.0	76.0	75.0					1																	43906994		2203	4300	6503	SO:0001583	missense	23334	exon52			GTGTTCGGACTCC	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7283G>A	1.37:g.43906994G>A	ENSP00000457168:p.Arg2428Gln		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_1	93	0.05	5	NM_015284	48	0.00	0	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408179	0.62399	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.41	5.41	0.78517	.	0.137001	0.51477	D	0.000086	T	0.20495	0.0493	L	0.29908	0.895	0.21950	N	0.999455	B	0.34181	0.44	B	0.19148	0.024	T	0.14200	-1.0481	9	0.29301	T	0.29	.	8.2513	0.31724	0.1706:0.0:0.8294:0.0	.	2428	Q5T011-5	.	Q	1586	.	ENSP00000361519:R1586Q	R	+	2	0	SZT2	43679581	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.320000	0.51991	2.708000	0.92522	0.591000	0.81541	CGG			0.582	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019517.3		NM_015284	
CHI3L1	1116	bcgsc.ca	37	1	203148983	203148983	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:203148983G>T	ENST00000255409.3	-	9	1042	c.917C>A	c.(916-918)gCc>gAc	p.A306D		NM_001276.2	NP_001267.2	P36222	CH3L1_HUMAN	chitinase 3-like 1 (cartilage glycoprotein-39)	306					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to tumor necrosis factor (GO:0071356)|chitin catabolic process (GO:0006032)|inflammatory response (GO:0006954)|interleukin-8 secretion (GO:0072606)|lung development (GO:0030324)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase B signaling (GO:0051897)|response to interleukin-1 (GO:0070555)|response to interleukin-6 (GO:0070741)|response to mechanical stimulus (GO:0009612)|response to tumor necrosis factor (GO:0034612)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|extracellular matrix structural constituent (GO:0005201)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|skin(1)	18						ATGGACTGTGGCTCCGCGGAG	0.577																																					p.A306D													.	CHI3L1	51		0			c.C917A												135.0	116.0	123.0					1																	203148983		2203	4300	6503	SO:0001583	missense	1116	exon9			ACTGTGGCTCCGC	BC008568	CCDS1435.1	1q32.1	2008-02-05			ENSG00000133048	ENSG00000133048			1932	protein-coding gene	gene with protein product		601525				8245017, 9244440	Standard	NM_001276		Approved	GP39, YKL40	uc001gzi.2	P36222	OTTHUMG00000042122	ENST00000255409.3:c.917C>A	1.37:g.203148983G>T	ENSP00000255409:p.Ala306Asp		Somatic	88	0.0113636364	1		WXS	Illumina HiSeq	Phase_1	86	0.06	5	NM_001276	1	0.00	0	B2R7B0|P30923|Q8IVA4|Q96HI7	Missense_Mutation	SNP	ENST00000255409.3	37	CCDS1435.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.0|24.0	4.486567|4.486567	0.84854|0.84854	.|.	.|.	ENSG00000133048|ENSG00000133048	ENST00000255409|ENST00000404436	T|.	0.47869|.	0.83|.	4.73|4.73	4.73|4.73	0.59995|0.59995	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, superfamily (1);|.	0.000000|.	0.51477|.	D|.	0.000091|.	T|T	0.80182|0.80182	0.4576|0.4576	M|M	0.88512|0.88512	2.96|2.96	0.49582|0.49582	D|D	0.999801|0.999801	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.99;1.0|.	D|D	0.84027|0.84027	0.0357|0.0357	10|5	0.87932|.	D|.	0|.	-26.5402|-26.5402	15.206|15.206	0.73180|0.73180	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	42;306|.	B3KTE6;P36222|.	.;CH3L1_HUMAN|.	D|R	306|74	ENSP00000255409:A306D|.	ENSP00000255409:A306D|.	A|S	-|-	2|3	0|2	CHI3L1|CHI3L1	201415606|201415606	1.000000|1.000000	0.71417|0.71417	0.532000|0.532000	0.27989|0.27989	0.876000|0.876000	0.50452|0.50452	2.944000|2.944000	0.49034|0.49034	2.161000|2.161000	0.67846|0.67846	0.313000|0.313000	0.20887|0.20887	GCC|AGC			0.577	CHI3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000100265.1		NM_001276	
TAF5L	27097	broad.mit.edu	37	1	229737976	229737976	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:229737976C>T	ENST00000366676.1	-	3	937	c.938G>A	c.(937-939)cGc>cAc	p.R313H	TAF5L_ENST00000258281.2_Missense_Mutation_p.R313H|TAF5L_ENST00000366675.3_Missense_Mutation_p.R313H			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	313					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				CAAATGGATGCGGGACACGTC	0.443																																					p.R313H													.	TAF5L	76		0			c.G938A												77.0	70.0	72.0					1																	229737976		2203	4300	6503	SO:0001583	missense	27097	exon4			TGGATGCGGGACA	AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.938G>A	1.37:g.229737976C>T	ENSP00000355636:p.Arg313His		Somatic	194	0.0051546392	1		WXS	Illumina HiSeq	Phase_I	222	0.02	5	NM_001025247	46	0.00	0	Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	ENST00000366676.1	37	CCDS1581.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.375029	0.42105	.	.	ENSG00000135801	ENST00000366676;ENST00000258281;ENST00000366675	T;T;T	0.59364	0.27;0.27;0.91	5.79	5.79	0.91817	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.253488	0.44688	N	0.000431	T	0.55016	0.1894	L	0.46741	1.465	0.41904	D	0.990432	B;B	0.14805	0.011;0.006	B;B	0.09377	0.004;0.001	T	0.47824	-0.9087	10	0.40728	T	0.16	-23.4756	20.0291	0.97531	0.0:1.0:0.0:0.0	.	313;313	O75529-2;O75529	.;TAF5L_HUMAN	H	313	ENSP00000355636:R313H;ENSP00000258281:R313H;ENSP00000355635:R313H	ENSP00000258281:R313H	R	-	2	0	TAF5L	227804599	0.993000	0.37304	0.999000	0.59377	0.999000	0.98932	1.083000	0.30815	2.738000	0.93877	0.650000	0.86243	CGC			0.443	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095229.1		NM_014409	
EDARADD	128178	mdanderson.org	37	1	236631562	236631562	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr1:236631562G>T	ENST00000334232.4	+	5	418	c.251G>T	c.(250-252)gGa>gTa	p.G84V	EDARADD_ENST00000359362.5_Missense_Mutation_p.G74V	NM_145861.2	NP_665860.2	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain	84					cell differentiation (GO:0030154)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|stomach(1)	12	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GATAGCACTGGAGATCCTCTT	0.383																																					p.G84V													.	.			0			c.G251T												141.0	147.0	145.0					1																	236631562		2203	4300	6503	SO:0001583	missense	128178	exon5			GCACTGGAGATCC	AY028914	CCDS1610.1, CCDS31065.1	1q42.3	2013-05-22			ENSG00000186197	ENSG00000186197			14341	protein-coding gene	gene with protein product		606603				11780064	Standard	NM_145861		Approved		uc001hxu.1	Q8WWZ3	OTTHUMG00000039954	ENST00000334232.4:c.251G>T	1.37:g.236631562G>T	ENSP00000335076:p.Gly84Val		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	93	0.05	5	NM_145861	0		0	A2VCK5|A8K7B5|B1AL54|B9ZVW5|Q5VYJ7	Missense_Mutation	SNP	ENST00000334232.4	37	CCDS1610.1	.	.	.	.	.	.	.	.	.	.	g	6.760	0.509168	0.12883	.	.	ENSG00000186197	ENST00000439430;ENST00000334232;ENST00000359362	T;T;T	0.80393	0.89;-0.79;-1.37	5.17	0.964	0.19655	.	1.201560	0.06408	U	0.719981	T	0.74535	0.3729	L	0.56769	1.78	0.23882	N	0.996575	B;B	0.20052	0.041;0.012	B;B	0.18263	0.021;0.021	T	0.54227	-0.8325	10	0.30078	T	0.28	.	4.9558	0.14038	0.3461:0.1455:0.5084:0.0	.	74;84	A8K7B5;Q8WWZ3	.;EDAD_HUMAN	V	62;84;74	ENSP00000405815:G62V;ENSP00000335076:G84V;ENSP00000352320:G74V	ENSP00000335076:G84V	G	+	2	0	EDARADD	234698185	1.000000	0.71417	0.170000	0.22879	0.635000	0.38103	1.408000	0.34668	-0.082000	0.12640	-0.264000	0.10439	GGA			0.383	EDARADD-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000096368.1		NM_145861	
EPC1	80314	broad.mit.edu	37	10	32575641	32575641	+	Silent	SNP	G	G	T	rs143299306		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr10:32575641G>T	ENST00000263062.8	-	9	1641	c.1372C>A	c.(1372-1374)Cgg>Agg	p.R458R	EPC1_ENST00000319778.6_Silent_p.R458R|EPC1_ENST00000375110.2_Silent_p.R408R	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	458					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				CGCCCAACCCGTCTTCGTGCA	0.433																																					p.R458R													.	EPC1	74		0			c.C1372A												103.0	89.0	94.0					10																	32575641		2203	4300	6503	SO:0001819	synonymous_variant	80314	exon9			CAACCCGTCTTCG	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1372C>A	10.37:g.32575641G>T			Somatic	121	0.0082644628	1		WXS	Illumina HiSeq	Phase_I	120	0.03	4	NM_001272004	28	0.00	0	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Silent	SNP	ENST00000263062.8	37	CCDS7172.1																																																																																					0.433	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000047484.1			
RP11-508N22.8	0	broad.mit.edu	37	10	38468803	38468803	+	RNA	DEL	T	T	-	rs201338016	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr10:38468803delT	ENST00000423162.1	+	0	368				RP11-508N22.9_ENST00000419779.1_lincRNA																							AGAAGTGACCTTTTTTTTCAT	0.259													|||unknown(NO_COVERAGE)	333	0.0664936	0.0741	0.0648	5008	,	,		14415	0.0437		0.0865	False		,,,				2504	0.0603				.													.	.			0			.																																											0	.			GTGACCTTTTTTT																													10.37:g.38468803delT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.67	4	.	0		0		RNA	DEL	ENST00000423162.1	37																																																																																						0.259	RP11-508N22.8-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000047629.1			
FAM21A	387680	broad.mit.edu	37	10	51826259	51826259	+	5'Flank	DEL	A	A	-	rs368712005		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr10:51826259delA	ENST00000282633.5	+	0	0				FAM21A_ENST00000351071.6_5'Flank|FAM21A_ENST00000314664.7_5'Flank|RP11-324H6.5_ENST00000456967.1_RNA	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A						retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						TAACAAAAGCAAAAAAAAAAA	0.333																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			AAAAGCAAAAAAA	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225		10.37:g.51826259delA	Exception_encountered		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0	A2A3S2|A2A3U6|Q6DHY0	RNA	DEL	ENST00000282633.5	37	CCDS41527.1																																																																																					0.333	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276917.2		NM_001005751	
CCAR1	55749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70525822	70525822	+	Missense_Mutation	SNP	G	G	C			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr10:70525822G>C	ENST00000265872.6	+	17	2403	c.2284G>C	c.(2284-2286)Gaa>Caa	p.E762Q	CCAR1_ENST00000543719.1_Missense_Mutation_p.E747Q|CCAR1_ENST00000535016.1_Missense_Mutation_p.E747Q	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	762	Glu-rich.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)	p.E762Q(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						GGATAATAAAGAACATTCATT	0.323																																					p.E762Q													CCAR1,NS,carcinoma,0,1	CCAR1	0	1	1	Substitution - Missense(1)	lung(1)	c.G2284C												83.0	80.0	81.0					10																	70525822		2203	4300	6503	SO:0001583	missense	55749	exon17			AATAAAGAACATT	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.2284G>C	10.37:g.70525822G>C	ENSP00000265872:p.Glu762Gln		Somatic	89	0	0		WXS	Illumina HiSeq	.	86	0.08	7	NM_018237	128	0.29	37	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.75|19.75	3.885635|3.885635	0.72410|0.72410	.|.	.|.	ENSG00000060339|ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012|ENST00000543706	T;T;T;T;T;T|.	0.19394|.	2.15;2.15;2.15;2.15;2.15;2.15|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.81678|0.81678	0.4873|0.4873	M|M	0.81682|0.81682	2.555|2.555	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	0.989;0.993;1.0|.	D;D;D|.	0.87578|.	0.979;0.979;0.998|.	T|T	0.82321|0.82321	-0.0515|-0.0515	10|5	0.54805|.	T|.	0.06|.	-21.4383|-21.4383	19.181|19.181	0.93623|0.93623	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	747;762;736|.	Q8IX12-2;Q8IX12;F5H2E6|.	.;CCAR1_HUMAN;.|.	Q|T	762;747;747;747;736;567|131	ENSP00000265872:E762Q;ENSP00000441820:E747Q;ENSP00000445254:E747Q;ENSP00000439252:E747Q;ENSP00000438610:E736Q;ENSP00000439642:E567Q|.	ENSP00000265872:E762Q|.	E|R	+|+	1|2	0|0	CCAR1|CCAR1	70195828|70195828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.668000|9.668000	0.98619|0.98619	2.531000|2.531000	0.85337|0.85337	0.561000|0.561000	0.74099|0.74099	GAA|AGA			0.323	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048356.2		NM_018237	
PIPSL	266971	broad.mit.edu	37	10	95718361	95718361	+	RNA	DEL	T	T	-	rs113072949		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr10:95718361delT	ENST00000480546.1	-	0	2936					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ttttcttttcttttctttctt	0.343																																					.													.	.			0			.																																											0	.			CTTTTCTTTTCTT	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95718361delT			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	11	0.36	4	.	0		0	Q6NUK8	RNA	DEL	ENST00000480546.1	37																																																																																						0.343	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene		OTTHUMT00000351483.1		NR_002319	
KRTAP5-5	439915	mdanderson.org	37	11	1651203	1651203	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr11:1651203T>C	ENST00000399676.2	+	1	171	c.133T>C	c.(133-135)Tgt>Cgt	p.C45R		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	45						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggaggctgtgggggctg	0.711																																					p.C45R													.	.			0			c.T133C												13.0	21.0	19.0					11																	1651203		1930	3898	5828	SO:0001583	missense	439915	exon1			GGAGGCTGTGGGG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.133T>C	11.37:g.1651203T>C	ENSP00000382584:p.Cys45Arg		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	51	0.12	6	NM_001001480	0		0	A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	CCDS41592.1	.	.	.	.	.	.	.	.	.	.	T	4.119	0.020218	0.08006	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01287	5.05	2.61	2.61	0.31194	.	.	.	.	.	T	0.02380	0.0073	M	0.72118	2.19	0.20074	N	0.999931	B	0.15141	0.012	B	0.17722	0.019	T	0.38286	-0.9668	9	0.25751	T	0.34	.	8.6776	0.34189	0.0:0.0:0.0:1.0	.	45	Q701N2	KRA55_HUMAN	R	45;43	ENSP00000382584:C45R	ENSP00000382584:C45R	C	+	1	0	KRTAP5-5	1607779	0.074000	0.21230	0.879000	0.34478	0.185000	0.23345	0.401000	0.20948	0.943000	0.37553	0.317000	0.21355	TGT			0.711	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127919.1			
BDNF	627	hgsc.bcm.edu	37	11	27681201	27681201	+	5'UTR	SNP	C	C	T	rs182322619|rs200712840|rs202011320		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr11:27681201C>T	ENST00000525528.1	-	0	4				BDNF_ENST00000395980.2_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000418212.1_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000314915.6_Intron|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000584049.1_Intron|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000395983.3_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000438929.1_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000533131.1_Intron|BDNF_ENST00000395978.3_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000532997.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						tgtgtgcgcgcgcgcgtgtgC	0.433																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	497258	.			TGCGCGCGCGCGT	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1090G>A	11.37:g.27681201C>T			Somatic	114	0	0		WXS	Illumina HiSeq	.	94	0.09	8	.	0		0	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																					0.433	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388135.1		NM_170735	
DEPDC7	91614	broad.mit.edu	37	11	33047234	33047234	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr11:33047234G>T	ENST00000241051.3	+	2	195	c.103G>T	c.(103-105)Gcc>Tcc	p.A35S	DEPDC7_ENST00000311388.3_Missense_Mutation_p.A26S	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	35					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						GCCATTTGGAGCCACGTATGT	0.393																																					p.A35S													.	DEPDC7	94		0			c.G103T												112.0	104.0	106.0					11																	33047234		1914	4131	6045	SO:0001583	missense	91614	exon2			TTTGGAGCCACGT		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.103G>T	11.37:g.33047234G>T	ENSP00000241051:p.Ala35Ser		Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	182	0.03	5	NM_001077242	30	0.00	0	G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	37	CCDS41632.1	.	.	.	.	.	.	.	.	.	.	G	34	5.334345	0.95758	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	T;T	0.30714	1.56;1.52	6.04	6.04	0.98038	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.58566	0.2131	M	0.70275	2.135	0.80722	D	1	D;P;D;D	0.76494	0.99;0.849;0.98;0.999	D;B;P;D	0.80764	0.958;0.223;0.778;0.994	T	0.55786	-0.8086	10	0.59425	D	0.04	-7.0445	20.5792	0.99380	0.0:0.0:1.0:0.0	.	35;35;26;35	B4DJ78;B4DH51;G5E941;Q96QD5	.;.;.;DEPD7_HUMAN	S	35;26	ENSP00000241051:A35S;ENSP00000308971:A26S	ENSP00000241051:A35S	A	+	1	0	DEPDC7	33003810	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.873000	0.98535	0.561000	0.74099	GCC			0.393	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388655.1		NM_139160	
SLC35C1	55343	mdanderson.org	37	11	45827629	45827629	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr11:45827629G>T	ENST00000314134.3	+	1	1673	c.277G>T	c.(277-279)Gct>Tct	p.A93S	SLC35C1_ENST00000456334.1_Missense_Mutation_p.A80S|SLC35C1_ENST00000442528.2_Missense_Mutation_p.A80S	NM_018389.4	NP_060859.4	Q96A29	FUCT1_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C1	93					carbohydrate transport (GO:0008643)|lipid glycosylation (GO:0030259)|negative regulation of Notch signaling pathway (GO:0045746)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				GBM - Glioblastoma multiforme(35;0.227)		AGGCCTCAGCGCTCTGGCCGC	0.667																																					p.A93S													.	.			0			c.G277T												72.0	62.0	65.0					11																	45827629		2203	4299	6502	SO:0001583	missense	55343	exon1			CTCAGCGCTCTGG		CCDS7914.1, CCDS44575.1	11p11.2	2014-09-17	2013-07-17			ENSG00000181830		"""Solute carriers"""	20197	protein-coding gene	gene with protein product		605881	"""solute carrier family 35, member C1"""			11326279, 11326280	Standard	NM_018389		Approved	FUCT1, FLJ11320	uc010rgm.2	Q96A29		ENST00000314134.3:c.277G>T	11.37:g.45827629G>T	ENSP00000313318:p.Ala93Ser		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_018389	13	0.00	0	B2RDB2|Q9BV76|Q9NUJ8	Missense_Mutation	SNP	ENST00000314134.3	37	CCDS7914.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347528	0.24426	.	.	ENSG00000181830	ENST00000442528;ENST00000456334;ENST00000314134;ENST00000530471;ENST00000540685	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	4.45	-8.9	0.00782	Drug/metabolite transporter (1);	0.700955	0.13944	N	0.351962	T	0.20495	0.0493	N	0.04724	-0.175	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11966	-1.0566	10	0.22109	T	0.4	0.0102	7.6213	0.28187	0.687:0.1256:0.1139:0.0735	.	93	Q96A29	FUCT1_HUMAN	S	80;80;93;80;93	ENSP00000412408:A80S;ENSP00000399779:A80S;ENSP00000313318:A93S;ENSP00000432669:A80S	ENSP00000313318:A93S	A	+	1	0	SLC35C1	45784205	0.020000	0.18652	0.002000	0.10522	0.578000	0.36192	-0.343000	0.07791	-2.193000	0.00754	-1.031000	0.02408	GCT			0.667	SLC35C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390139.1		NM_018389	
DDIAS	220042	hgsc.bcm.edu;mdanderson.org	37	11	82639955	82639955	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr11:82639955G>T	ENST00000533655.1	+	4	462	c.250G>T	c.(250-252)Ggt>Tgt	p.G84C	C11orf82_ENST00000524921.1_Missense_Mutation_p.G84C|C11orf82_ENST00000533750.1_3'UTR|C11orf82_ENST00000329143.3_Intron|C11orf82_ENST00000525361.1_Missense_Mutation_p.G84C|C11orf82_ENST00000430323.2_Missense_Mutation_p.G84C|C11orf82_ENST00000525388.1_Missense_Mutation_p.G84C|C11orf82_ENST00000528759.1_Intron	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		84					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						TACATTTTTTGGTCTTACTGC	0.328																																					p.G84C													.	.			0			c.G250T												120.0	119.0	120.0					11																	82639955		2203	4300	6503	SO:0001583	missense	220042	exon4			TTTTTTGGTCTTA																												ENST00000533655.1:c.250G>T	11.37:g.82639955G>T	ENSP00000435421:p.Gly84Cys		Somatic	81	0	0		WXS	Illumina HiSeq	.	82	0.05	4	NM_145018	13	0.00	0	Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	37	CCDS8263.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578058	0.86645	.	.	ENSG00000165490	ENST00000524921;ENST00000525361;ENST00000430323;ENST00000533655;ENST00000532764;ENST00000525388;ENST00000528262	T;T	0.70045	-0.45;-0.45	5.75	5.75	0.90469	Nucleic acid-binding, OB-fold-like (1);Replication factor A, C-terminal (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	D	0.83580	0.5285	M	0.81239	2.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83410	0.0027	9	.	.	.	-20.5449	19.9399	0.97155	0.0:0.0:1.0:0.0	.	84;84	Q8IXT1-2;Q8IXT1	.;NOXIN_HUMAN	C	84;84;84;84;145;84;84	ENSP00000414687:G84C;ENSP00000435421:G84C	.	G	+	1	0	C11orf82	82317603	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.119000	0.77145	2.701000	0.92244	0.557000	0.71058	GGT			0.328	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391936.1			
PGR	5241	mdanderson.org	37	11	100998763	100998763	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr11:100998763A>G	ENST00000325455.5	-	1	2492	c.1039T>C	c.(1039-1041)Tgt>Cgt	p.C347R	PGR_ENST00000263463.5_Missense_Mutation_p.C347R|PGR_ENST00000534013.1_Intron	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	347	Modulating, Pro-Rich.		C -> S (in dbSNP:rs11571147).		cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	GACGAGGCACAGGGTGAACTC	0.687																																					p.C347R	Pancreas(124;2271 2354 21954 22882)												.	.			0			c.T1039C												16.0	21.0	19.0					11																	100998763		2097	4168	6265	SO:0001583	missense	5241	exon1			AGGCACAGGGTGA	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.1039T>C	11.37:g.100998763A>G	ENSP00000325120:p.Cys347Arg		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	30	0.13	4	NM_000926	0		0	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	A	4.790	0.146822	0.09134	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	T;T	0.05996	3.36;3.36	3.84	1.42	0.22433	.	0.814196	0.09945	N	0.735394	T	0.03477	0.0100	N	0.08118	0	0.26185	N	0.979669	B;B	0.20780	0.0;0.048	B;B	0.21917	0.0;0.037	T	0.41787	-0.9489	10	0.59425	D	0.04	.	4.5042	0.11879	0.5994:0.1874:0.2131:0.0	.	347;347	Q8TDS3;P06401	.;PRGR_HUMAN	R	347	ENSP00000325120:C347R;ENSP00000263463:C347R	ENSP00000263463:C347R	C	-	1	0	PGR	100503973	0.986000	0.35501	0.797000	0.32132	0.023000	0.10783	0.575000	0.23729	0.548000	0.28955	0.459000	0.35465	TGT			0.687	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394934.1			
DDX10	1662	broad.mit.edu	37	11	108712092	108712092	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr11:108712092G>T	ENST00000322536.3	+	15	2265	c.2136G>T	c.(2134-2136)gaG>gaT	p.E712D	DDX10_ENST00000526794.1_Missense_Mutation_p.E712D	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	712					metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		AGGATGCTGAGGAAGATGATG	0.403			T	NUP98	AML*																																p.E712D				Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	.	DDX10	70		0			c.G2136T												93.0	90.0	91.0					11																	108712092		2201	4298	6499	SO:0001583	missense	1662	exon15			TGCTGAGGAAGAT	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.2136G>T	11.37:g.108712092G>T	ENSP00000314348:p.Glu712Asp		Somatic	227	0	0		WXS	Illumina HiSeq	Phase_I	239	0.03	6	NM_004398	78	0.00	0	B2RCQ3|Q5BJD8	Missense_Mutation	SNP	ENST00000322536.3	37	CCDS8342.1	.	.	.	.	.	.	.	.	.	.	G	5.805	0.332891	0.11013	.	.	ENSG00000178105	ENST00000322536;ENST00000456020;ENST00000526794	T;T	0.45668	0.89;0.9	4.84	3.86	0.44501	.	0.278792	0.28192	N	0.016245	T	0.31358	0.0794	L	0.52126	1.63	0.34510	D	0.707012	B;B	0.14012	0.009;0.005	B;B	0.14578	0.011;0.007	T	0.26849	-1.0091	10	0.12430	T	0.62	-18.1854	8.035	0.30486	0.0:0.2788:0.5603:0.1609	.	712;712	Q13206;E9PIF2	DDX10_HUMAN;.	D	712;618;712	ENSP00000314348:E712D;ENSP00000432032:E712D	ENSP00000314348:E712D	E	+	3	2	DDX10	108217302	0.964000	0.33143	0.966000	0.40874	0.062000	0.15995	-0.059000	0.11731	2.398000	0.81561	0.650000	0.86243	GAG			0.403	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390343.1		NM_004398	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12R	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,+1,25136	KRAS_ENST00000256078	1	25136	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34C	GRCh37	CM076251	KRAS	M	rs121913530							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CGCCACCAGCTCC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	12.37:g.25398285C>G	ENSP00000256078:p.Gly12Arg		Somatic	210	0	0		WXS	Illumina HiSeq	.	336	0.36	122	NM_004985	22	0.59	13	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
TIMELESS	8914	broad.mit.edu	37	12	56827600	56827600	+	Missense_Mutation	SNP	T	T	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr12:56827600T>G	ENST00000553532.1	-	3	358	c.208A>C	c.(208-210)Acc>Ccc	p.T70P	TIMELESS_ENST00000554616.1_Missense_Mutation_p.T70P|TIMELESS_ENST00000229201.4_Missense_Mutation_p.T70P					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						TGGTGCTGGGTGAGGATGGGC	0.547																																					p.T70P													.	TIMELESS	107		0			c.A208C												121.0	121.0	121.0					12																	56827600		2203	4300	6503	SO:0001583	missense	8914	exon3			GCTGGGTGAGGAT	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.208A>C	12.37:g.56827600T>G	ENSP00000450607:p.Thr70Pro		Somatic	62	0.1935483871	12		WXS	Illumina HiSeq	Phase_I	78	0.28	22	NM_003920	39	0.03	1		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.868487	0.51588	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.67523	-0.24;-0.24;-0.27	5.31	4.17	0.49024	Timeless protein (1);	0.238103	0.42420	D	0.000713	T	0.50120	0.1597	N	0.24115	0.695	0.35185	D	0.772867	P;P	0.43477	0.771;0.808	B;B	0.41571	0.246;0.36	T	0.57808	-0.7747	10	0.31617	T	0.26	-5.6698	8.2465	0.31691	0.0:0.1631:0.0:0.8369	.	70;70	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	P	70	ENSP00000229201:T70P;ENSP00000450607:T70P;ENSP00000450848:T70P	ENSP00000229201:T70P	T	-	1	0	TIMELESS	55113867	0.210000	0.23517	0.988000	0.46212	0.995000	0.86356	0.985000	0.29578	0.980000	0.38523	0.528000	0.53228	ACC			0.547	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000409771.1		NM_003920	
NDUFA4L2	56901	mdanderson.org	37	12	57629360	57629360	+	Silent	SNP	G	G	T	rs139105980		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr12:57629360G>T	ENST00000554503.1	-	4	502	c.250C>A	c.(250-252)Cgg>Agg	p.R84R	NDUFA4L2_ENST00000556732.1_3'UTR|NDUFA4L2_ENST00000393825.1_Silent_p.R84R			Q9NRX3	NUA4L_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2	84										lung(1)|prostate(1)	2						AAGTCTGGCCGGTCCTTCTTC	0.582																																					p.R84R													.	.			0			c.C250A												78.0	88.0	85.0					12																	57629360		2203	4300	6503	SO:0001819	synonymous_variant	56901	exon5			CTGGCCGGTCCTT	BC011910	CCDS8935.1	12q13.3	2014-05-29			ENSG00000185633	ENSG00000185633			29836	protein-coding gene	gene with protein product							Standard	NM_020142		Approved	NUOMS, FLJ26118	uc001sno.3	Q9NRX3	OTTHUMG00000171275	ENST00000554503.1:c.250C>A	12.37:g.57629360G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_020142	25	0.00	0	Q6IAH9	Silent	SNP	ENST00000554503.1	37	CCDS8935.1																																																																																					0.582	NDUFA4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412744.1		NM_020142	
ACAD10	80724	mdanderson.org	37	12	112182447	112182447	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr12:112182447G>T	ENST00000313698.4	+	13	1870	c.1715G>T	c.(1714-1716)gGg>gTg	p.G572V	ACAD10_ENST00000455480.2_Splice_Site_p.G603V|ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000392636.2_Splice_Site_p.G174V|ACAD10_ENST00000549590.1_Splice_Site_p.G572V	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	572						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TTCTGCTTAGGGCAAGCAAGC	0.463																																					p.G603V													.	.			0			c.G1808T												85.0	87.0	86.0					12																	112182447		2203	4300	6503	SO:0001630	splice_region_variant	80724	exon14			GCTTAGGGCAAGC	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1715-1G>T	12.37:g.112182447G>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001136538	20	0.00	0	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676974	0.68042	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698;ENST00000507683	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	5.65	4.76	0.60689	.	0.052084	0.85682	D	0.000000	T	0.66742	0.2820	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.995;0.981	T	0.77584	-0.2533	10	0.87932	D	0	.	13.6618	0.62372	0.0762:0.0:0.9238:0.0	.	603;572;572	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	V	174;572;572;603;572;153	ENSP00000376411:G174V;ENSP00000446959:G572V;ENSP00000389813:G603V;ENSP00000325137:G572V	ENSP00000325137:G572V	G	+	2	0	ACAD10	110666830	1.000000	0.71417	0.954000	0.39281	0.603000	0.37013	4.761000	0.62243	1.389000	0.46526	0.655000	0.94253	GGG			0.463	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368307.1		NM_025247	Missense_Mutation
RASAL1	8437	mdanderson.org	37	12	113565955	113565955	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr12:113565955G>T	ENST00000261729.5	-	4	466	c.151C>A	c.(151-153)Ccc>Acc	p.P51T	RASAL1_ENST00000548055.1_Missense_Mutation_p.P51T|RASAL1_ENST00000446861.3_Missense_Mutation_p.P51T|RASAL1_ENST00000546530.1_Missense_Mutation_p.P51T|RASAL1_ENST00000418411.2_5'UTR			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	51	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CCCCAGAAGGGGCCCAGGCTC	0.627																																					p.P51T													.	.			0			c.C151A												154.0	156.0	155.0					12																	113565955		2203	4300	6503	SO:0001583	missense	8437	exon4			AGAAGGGGCCCAG	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.151C>A	12.37:g.113565955G>T	ENSP00000261729:p.Pro51Thr		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001193520	1	0.00	0	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722563	0.89298	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82	5.12	5.12	0.69794	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.97698	0.9245	H	0.99404	4.55	0.50467	D	0.999873	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.99761	1.1021	10	0.87932	D	0	.	17.315	0.87221	0.0:0.0:1.0:0.0	.	51;51;51;63;51;51;51	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	T	51	ENSP00000450244:P51T;ENSP00000261729:P51T;ENSP00000395920:P51T;ENSP00000448510:P51T	ENSP00000261729:P51T	P	-	1	0	RASAL1	112050338	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.924000	0.92827	2.394000	0.81467	0.491000	0.48974	CCC			0.627	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000405522.2		NM_004658	
NCOR2	9612	mdanderson.org	37	12	124831293	124831293	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr12:124831293G>T	ENST00000405201.1	-	31	4176	c.4176C>A	c.(4174-4176)gaC>gaA	p.D1392E	NCOR2_ENST00000397355.1_Missense_Mutation_p.D1383E|NCOR2_ENST00000404621.1_Missense_Mutation_p.D1382E|NCOR2_ENST00000404121.2_Missense_Mutation_p.D953E|NCOR2_ENST00000356219.3_Missense_Mutation_p.D1399E|NCOR2_ENST00000429285.2_Missense_Mutation_p.D1382E			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1400	Poly-Pro.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CCTCGGTCAGGTCCCGTGAGG	0.706																																					p.D1392E													.	.			0			c.C4176A												8.0	12.0	11.0					12																	124831293		1927	4070	5997	SO:0001583	missense	9612	exon33			GGTCAGGTCCCGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.4176C>A	12.37:g.124831293G>T	ENSP00000384018:p.Asp1392Glu		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_006312	11	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	G	13.21	2.168354	0.38315	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.5	5.45	3.61	0.41365	.	0.254906	0.39615	N	0.001319	T	0.38348	0.1037	N	0.08118	0	0.24160	N	0.995669	D;D;D	0.71674	0.997;0.994;0.998	P;D;P	0.72625	0.81;0.978;0.875	T	0.12863	-1.0531	10	0.45353	T	0.12	-47.9871	7.4056	0.26989	0.1452:0.1386:0.7162:0.0	.	1382;1383;1392	C9J0Q5;C9J239;C9JFD3	.;.;.	E	1392;1382;1399;1383;1391;953;1382;1400	ENSP00000384018:D1392E;ENSP00000384202:D1382E;ENSP00000348551:D1399E;ENSP00000380513:D1383E;ENSP00000385618:D953E;ENSP00000400281:D1382E;ENSP00000402808:D1400E	ENSP00000348551:D1399E	D	-	3	2	NCOR2	123397246	1.000000	0.71417	0.999000	0.59377	0.408000	0.30992	4.163000	0.58183	0.662000	0.31006	0.491000	0.48974	GAC			0.706	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
GUCY1B2	2974	mdanderson.org	37	13	51600936	51600936	+	RNA	SNP	G	G	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr13:51600936G>A	ENST00000493639.2	-	0	692				RNA5SP29_ENST00000410988.1_RNA	NR_003923.2		O75343	GCYB2_HUMAN	guanylate cyclase 1, soluble, beta 2 (pseudogene)						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)										CTTGAGGAAAGCTGCCTGGAG	0.473																																					.													.	.			0			.												94.0	78.0	83.0					13																	51600936		692	1591	2283			2974	.			AGGAAAGCTGCCT	AF038499		13q14.3	2012-04-19	2012-04-19		ENSG00000123201	ENSG00000123201	4.6.1.2		4686	pseudogene	pseudogene		603695	"""guanylate cyclase 1, soluble, beta 2"""			9889008, 10449911	Standard	NR_003923		Approved	GC-SB2	uc010tgo.2	O75343	OTTHUMG00000016940		13.37:g.51600936G>A			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	.	0		0	Q9NZ64	RNA	SNP	ENST00000493639.2	37																																																																																						0.473	GUCY1B2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000045014.3			
METTL3	56339	mdanderson.org	37	14	21971825	21971825	+	Silent	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr14:21971825G>T	ENST00000298717.4	-	2	451	c.300C>A	c.(298-300)atC>atA	p.I100I	METTL3_ENST00000538267.1_Silent_p.I100I	NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	100					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		TGGCAAGACAGATGGACACAG	0.468																																					p.I100I													.	.			0			c.C300A												164.0	143.0	150.0					14																	21971825		2203	4300	6503	SO:0001819	synonymous_variant	56339	exon2			AAGACAGATGGAC	AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.300C>A	14.37:g.21971825G>T			Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	118	0.04	5	NM_019852	61	0.00	0	O14736|Q86V05|Q9HB32	Silent	SNP	ENST00000298717.4	37	CCDS32044.1																																																																																					0.468	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401227.1		NM_019852	
DHRS4L2	317749	mdanderson.org	37	14	24458223	24458223	+	Missense_Mutation	SNP	A	A	G	rs139671977	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr14:24458223A>G	ENST00000335125.6	+	1	193	c.67A>G	c.(67-69)Agg>Ggg	p.R23G	DHRS4L2_ENST00000543805.1_Intron|DHRS4L2_ENST00000558753.1_Missense_Mutation_p.R23G|DHRS4L2_ENST00000545240.1_Missense_Mutation_p.R23G|DHRS4L2_ENST00000382755.4_Missense_Mutation_p.R21G|DHRS4L2_ENST00000537912.1_Missense_Mutation_p.R23G|DHRS4L2_ENST00000534993.1_Intron|DHRS4L2_ENST00000397071.1_Missense_Mutation_p.R23G	NM_198083.3	NP_932349.2	Q6PKH6	DR4L2_HUMAN	dehydrogenase/reductase (SDR family) member 4 like 2	21						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.R23G(1)		breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	10				GBM - Glioblastoma multiforme(265;0.00962)		GGCCAGCTCCAGGATGACCCG	0.642													N|||	2	0.000399361	0.0	0.0014	5008	,	,		16658	0.001		0.0	False		,,,				2504	0.0				p.R23G													DHRS4L2,trunk,malignant_melanoma,0,1	DHRS4L2	0	1	1	Substitution - Missense(1)	skin(1)	c.A67G							G	,,,GLY/ARG	2,4398	800.5+/-415.6	0,2,2198	55.0	55.0	55.0		,,,67	1.9	0.6	14	dbSNP_134	55	0,8600		0,0,4300	no	intron,intron,intron,missense	DHRS4L2	NM_001193635.1,NM_001193636.1,NM_001193637.1,NM_198083.3	,,,125	0,2,6498	GG,GA,AA		0.0,0.0455,0.0154	,,,	,,,23/233	24458223	2,12998	2200	4300	6500	SO:0001583	missense	317749	exon1			AGCTCCAGGATGA		CCDS9606.2, CCDS73621.1	14q11.2	2011-09-14			ENSG00000187630	ENSG00000187630	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	19731	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 3"""	615196					Standard	NM_001193635		Approved	SDR25C3	uc001wlf.3	Q6PKH6	OTTHUMG00000028778	ENST00000335125.6:c.67A>G	14.37:g.24458223A>G	ENSP00000334801:p.Arg23Gly		Somatic	47	0.0212765957	1		WXS	Illumina HiSeq	Phase_I	43	0.12	5	NM_198083	9	0.00	0	Q3YLD4	Missense_Mutation	SNP	ENST00000335125.6	37	CCDS9606.2	.	.	.	.	.	.	.	.	.	.	G	0.068	-1.209452	0.01568	4.55E-4	0.0	ENSG00000187630	ENST00000397071;ENST00000335125;ENST00000537912;ENST00000545240;ENST00000382755	T;D;T;T;D	0.83250	1.7;-1.68;1.84;2.48;-1.7	2.83	1.92	0.25849	NAD(P)-binding domain (1);	0.695612	0.13571	N	0.378044	T	0.52948	0.1766	N	0.02247	-0.625	0.22253	N	0.999255	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.47420	-0.9119	10	0.02654	T	1	.	4.3802	0.11290	0.1379:0.2326:0.6296:0.0	.	23;21	F6TD35;Q6PKH6	.;DR4L2_HUMAN	G	23;23;23;23;21	ENSP00000380261:R23G;ENSP00000334801:R23G;ENSP00000439942:R23G;ENSP00000437883:R23G;ENSP00000372203:R21G	ENSP00000334801:R23G	R	+	1	2	DHRS4L2	23528063	0.007000	0.16637	0.591000	0.28745	0.071000	0.16799	0.456000	0.21859	0.096000	0.17463	-2.119000	0.00349	AGG	0		0.642	DHRS4L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000071858.4			
DDHD1	80821	broad.mit.edu	37	14	53522376	53522376	+	Splice_Site	SNP	A	A	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr14:53522376A>G	ENST00000323669.5	-	10	2245		c.e10+1		DDHD1_ENST00000395606.1_Splice_Site|DDHD1_ENST00000555621.1_5'Flank|DDHD1_ENST00000357758.3_Splice_Site	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1						cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					AAGAGAAATTACCTAATATGC	0.393																																					.													.	DDHD1	202		0			c.2266+2T>C												131.0	134.0	133.0					14																	53522376		2203	4300	6503	SO:0001630	splice_region_variant	0	exon12			GAAATTACCTAAT	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.2245+1T>C	14.37:g.53522376A>G			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	68	0.12	8	NM_001160147	0		0	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Splice_Site	SNP	ENST00000323669.5	37	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.878388	0.33162	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4473	0.83942	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DDHD1	52592126	1.000000	0.71417	0.998000	0.56505	0.008000	0.06430	9.313000	0.96297	2.281000	0.76405	0.533000	0.62120	.			0.393	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000276901.1			Intron
YLPM1	56252	hgsc.bcm.edu;mdanderson.org	37	14	75265422	75265422	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr14:75265422G>T	ENST00000325680.7	+	5	3546	c.3422G>T	c.(3421-3423)aGc>aTc	p.S1141I	YLPM1_ENST00000238571.3_Missense_Mutation_p.S946I|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	946	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		AGAGCTGGGAGCAGGGAGAGA	0.592																																					p.S1141I													.	.			0			c.G3422T												43.0	48.0	47.0					14																	75265422		1896	4116	6012	SO:0001583	missense	56252	exon5			CTGGGAGCAGGGA	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3422G>T	14.37:g.75265422G>T	ENSP00000324463:p.Ser1141Ile		Somatic	101	0	0		WXS	Illumina HiSeq	.	123	0.04	5	NM_019589	23	0.00	0	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.776060	0.49786	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.78	4.89	0.63831	.	0.065308	0.64402	D	0.000004	T	0.74650	0.3744	M	0.65498	2.005	0.37878	D	0.930303	D	0.57571	0.98	P	0.57846	0.828	T	0.81081	-0.1094	9	0.87932	D	0	-6.7636	16.9664	0.86287	0.0:0.1276:0.8724:0.0	.	1141	P49750-4	.	I	1141;946;854	.	ENSP00000238571:S946I	S	+	2	0	YLPM1	74335175	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.827000	0.62723	1.444000	0.47605	0.643000	0.83706	AGC			0.592	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404451.1		NM_019589	
NRXN3	9369	hgsc.bcm.edu	37	14	79746680	79746680	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr14:79746680G>T	ENST00000557594.1	+	1	999	c.46G>T	c.(46-48)Gcc>Tcc	p.A16S	NRXN3_ENST00000281127.7_Missense_Mutation_p.A16S|NRXN3_ENST00000428277.2_Missense_Mutation_p.A16S|NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000554719.1_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	16					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCGCCGGCCGGCCTGGACGCT	0.582																																					p.A16S													.	.			0			c.G46T												149.0	146.0	147.0					14																	79746680		2203	4300	6503	SO:0001583	missense	9369	exon1			CGGCCGGCCTGGA	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.46G>T	14.37:g.79746680G>T	ENSP00000451672:p.Ala16Ser		Somatic	66	0	0		WXS	Illumina HiSeq	.	84	0.05	4	NM_138970	0		0	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	37		.	.	.	.	.	.	.	.	.	.	G	15.37	2.812921	0.50527	.	.	ENSG00000021645	ENST00000557594;ENST00000281127;ENST00000428277	T;T;T	0.35421	1.44;1.51;1.31	5.58	4.63	0.57726	.	.	.	.	.	T	0.33147	0.0853	N	0.03608	-0.345	0.80722	D	1	B;P;P	0.41597	0.116;0.756;0.643	B;P;P	0.60173	0.071;0.87;0.745	T	0.25745	-1.0123	8	.	.	.	.	14.3577	0.66748	0.0:0.1476:0.8524:0.0	.	16;16;16	Q9HDB5-4;Q9HDB5-2;Q9HDB5	.;.;NRX3B_HUMAN	S	16	ENSP00000451672:A16S;ENSP00000281127:A16S;ENSP00000394426:A16S	.	A	+	1	0	NRXN3	78816433	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.193000	0.50997	2.647000	0.89833	0.558000	0.71614	GCC			0.582	NRXN3-004	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000413790.1		NM_001105250	
RP11-467N20.5	0	bcgsc.ca	37	15	23407031	23407031	+	Missense_Mutation	SNP	T	T	C	rs376343793		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr15:23407031T>C	ENST00000558241.1	-	8	1895	c.1805A>G	c.(1804-1806)aAg>aGg	p.K602R																	endometrium(1)	1						ctcctcctgcttccacatctt	0.557																																					.													.	.			0			.																																									SO:0001583	missense	0	.			TCCTGCTTCCACA																												ENST00000558241.1:c.1805A>G	15.37:g.23407031T>C	ENSP00000453436:p.Lys602Arg		Somatic	247	0.024291498	6		WXS	Illumina HiSeq	Phase_1	274	0.06	17	.	0		0		Missense_Mutation	SNP	ENST00000558241.1	37																																																																																						0.557	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000415942.1			
KIF7	374654	mdanderson.org	37	15	90174728	90174728	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr15:90174728C>A	ENST00000394412.3	-	15	3185	c.3109G>T	c.(3109-3111)Gag>Tag	p.E1037*	KIF7_ENST00000558928.1_5'Flank	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1037					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CAGGGTACCTCGGGGGACAGC	0.672																																					p.E1037X													.	.			0			c.G3109T												26.0	25.0	25.0					15																	90174728		2194	4284	6478	SO:0001587	stop_gained	374654	exon15			GTACCTCGGGGGA	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3109G>T	15.37:g.90174728C>A	ENSP00000377934:p.Glu1037*		Somatic	45	0.0222222222	1		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_198525	50	0.00	0	Q3SXY0|Q6UXE9|Q8IW72	Nonsense_Mutation	SNP	ENST00000394412.3	37	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	C	38	7.064260	0.98036	.	.	ENSG00000166813	ENST00000394412	.	.	.	4.67	4.67	0.58626	.	0.048232	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	17.5841	0.87976	0.0:1.0:0.0:0.0	.	.	.	.	X	1037	.	ENSP00000377934:E1037X	E	-	1	0	KIF7	87975732	1.000000	0.71417	0.994000	0.49952	0.297000	0.27493	7.348000	0.79366	2.138000	0.66242	0.462000	0.41574	GAG			0.672	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347782.1		NM_198525	
HMOX2	3163	hgsc.bcm.edu;mdanderson.org	37	16	4555575	4555575	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr16:4555575A>G	ENST00000570646.1	+	2	655	c.50A>G	c.(49-51)aAg>aGg	p.K17R	HMOX2_ENST00000406590.2_Missense_Mutation_p.K17R|HMOX2_ENST00000414777.1_Missense_Mutation_p.K17R|HMOX2_ENST00000398595.3_Missense_Mutation_p.K17R|HMOX2_ENST00000458134.3_Missense_Mutation_p.K17R|HMOX2_ENST00000575120.1_Intron|HMOX2_ENST00000219700.6_Missense_Mutation_p.K17R	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	17					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						TCAGAAAAAAAGAACTCTGGG	0.572																																					p.K17R													HMOX2,colon,carcinoma,-1,1	HMOX2	-1	1	0			c.A50G												77.0	73.0	74.0					16																	4555575		2197	4296	6493	SO:0001583	missense	3163	exon2			AAAAAAAGAACTC		CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.50A>G	16.37:g.4555575A>G	ENSP00000459214:p.Lys17Arg		Somatic	41	0.0243902439	1		WXS	Illumina HiSeq	.	44	0.07	3	NM_001127205	159	0.00	0	A8MT35|D3DUD5|I3L430|O60605	Missense_Mutation	SNP	ENST00000570646.1	37	CCDS10517.1	.	.	.	.	.	.	.	.	.	.	A	4.970	0.180107	0.09443	.	.	ENSG00000103415	ENST00000406590;ENST00000458134;ENST00000219700;ENST00000414777;ENST00000398595	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	5.74	2.18	0.27775	.	0.959677	0.08723	N	0.903174	T	0.13798	0.0334	N	0.17082	0.46	0.20873	N	0.999839	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38178	-0.9673	10	0.19147	T	0.46	-9.8086	4.7863	0.13227	0.6728:0.1596:0.1675:0.0	.	17;17	B3KSE0;P30519	.;HMOX2_HUMAN	R	17	ENSP00000385100:K17R;ENSP00000394103:K17R;ENSP00000219700:K17R;ENSP00000391637:K17R;ENSP00000381595:K17R	ENSP00000219700:K17R	K	+	2	0	HMOX2	4495576	0.004000	0.15560	0.196000	0.23383	0.087000	0.18053	0.465000	0.22004	0.094000	0.17404	0.528000	0.53228	AAG			0.572	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251636.2			
ARHGAP17	55114	mdanderson.org	37	16	24958877	24958877	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr16:24958877G>T	ENST00000289968.6	-	14	1236	c.1167C>A	c.(1165-1167)agC>agA	p.S389R	ARHGAP17_ENST00000303665.5_Missense_Mutation_p.S389R|ARHGAP17_ENST00000441763.2_3'UTR	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	389	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		TATTCACATCGCTGGTCTGAG	0.428																																					p.S389R													.	.			0			c.C1167A												138.0	121.0	127.0					16																	24958877		2197	4300	6497	SO:0001583	missense	55114	exon14			CACATCGCTGGTC	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1167C>A	16.37:g.24958877G>T	ENSP00000289968:p.Ser389Arg		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_018054	33	0.00	0	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881634	0.72294	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000455311	T;T	0.24151	1.87;1.87	5.9	-8.89	0.00785	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.52532	D	0.000078	T	0.44498	0.1296	M	0.78223	2.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71111	-0.4687	10	0.52906	T	0.07	.	16.9313	0.86190	0.4058:0.0:0.5942:0.0	.	389;389	Q68EM7-2;Q68EM7	.;RHG17_HUMAN	R	389	ENSP00000289968:S389R;ENSP00000303130:S389R	ENSP00000289968:S389R	S	-	3	2	ARHGAP17	24866378	0.163000	0.22920	0.232000	0.24009	0.982000	0.71751	-0.269000	0.08596	-2.309000	0.00651	-0.312000	0.09012	AGC			0.428	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436548.3		NM_018054	
CES3	23491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67006271	67006271	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr16:67006271C>T	ENST00000303334.4	+	11	1375	c.1304C>T	c.(1303-1305)cCt>cTt	p.P435L	CES3_ENST00000543856.1_Missense_Mutation_p.P74L|CES3_ENST00000394037.1_Missense_Mutation_p.P435L	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	435						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		TCTGGAAGCCCTGTCTTTTTC	0.493																																					p.P435L													.	.			0			c.C1304T												297.0	307.0	304.0					16																	67006271		2200	4300	6500	SO:0001583	missense	23491	exon11			GAAGCCCTGTCTT	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1304C>T	16.37:g.67006271C>T	ENSP00000304782:p.Pro435Leu		Somatic	182	0	0		WXS	Illumina HiSeq	.	154	0.14	21	NM_024922	8	0.25	2	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	37	CCDS10826.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658040	0.88154	.	.	ENSG00000172828	ENST00000303334;ENST00000394037;ENST00000543856	T;T;T	0.13538	2.58;2.58;2.58	5.13	5.13	0.70059	Carboxylesterase, type B (1);	0.456574	0.16502	N	0.211590	T	0.43456	0.1248	M	0.89715	3.055	0.46203	D	0.998929	D;P	0.56035	0.974;0.828	P;P	0.58928	0.848;0.821	T	0.52946	-0.8507	10	0.87932	D	0	.	17.3363	0.87282	0.0:1.0:0.0:0.0	.	74;435	F5H242;Q6UWW8	.;EST3_HUMAN	L	435;435;74	ENSP00000304782:P435L;ENSP00000377602:P435L;ENSP00000445559:P74L	ENSP00000304782:P435L	P	+	2	0	CES3	65563772	0.641000	0.27251	0.005000	0.12908	0.099000	0.18886	6.909000	0.75735	2.395000	0.81488	0.579000	0.79373	CCT			0.493	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000268848.1		NM_024922	
KIAA0513	9764	mdanderson.org	37	16	85101005	85101005	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr16:85101005G>T	ENST00000566428.1	+	2	959	c.328G>T	c.(328-330)Ggg>Tgg	p.G110W	KIAA0513_ENST00000258180.3_Splice_Site_p.G110W|KIAA0513_ENST00000538274.1_Splice_Site_p.G110W|KIAA0513_ENST00000567328.1_Splice_Site_p.G110W			O60268	K0513_HUMAN	KIAA0513	110						cytoplasm (GO:0005737)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(9)|pancreas(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.234)		CTTCTCTGGAGGGTAAGGGGC	0.627																																					p.G110W													.	.			0			c.G328T												43.0	33.0	36.0					16																	85101005		2193	4288	6481	SO:0001630	splice_region_variant	9764	exon2			TCTGGAGGGTAAG	AB011085	CCDS32499.1, CCDS67091.1, CCDS73919.1	16q24.1	2012-11-29			ENSG00000135709	ENSG00000135709			29058	protein-coding gene	gene with protein product		611675				9628581	Standard	XM_005256265		Approved		uc002fiu.3	O60268	OTTHUMG00000176597	ENST00000566428.1:c.329+1G>T	16.37:g.85101005G>T			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_014732	31	0.00	0	B4DSS5|D3DUM2|Q8N6G0	Missense_Mutation	SNP	ENST00000566428.1	37	CCDS32499.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355021	0.61293	.	.	ENSG00000135709	ENST00000538274;ENST00000258180	T;T	0.35605	1.3;1.3	4.68	4.68	0.58851	.	0.358456	0.31177	N	0.008105	T	0.42899	0.1223	L	0.60455	1.87	0.46631	D	0.999132	P;P	0.47484	0.896;0.89	P;B	0.45610	0.487;0.293	T	0.48768	-0.9006	10	0.66056	D	0.02	-26.6945	16.5569	0.84487	0.0:0.0:1.0:0.0	.	110;110	B4DSS5;O60268	.;K0513_HUMAN	W	110	ENSP00000446439:G110W;ENSP00000258180:G110W	ENSP00000258180:G110W	G	+	1	0	KIAA0513	83658506	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	2.789000	0.47813	2.304000	0.77564	0.655000	0.94253	GGG			0.627	KIAA0513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000432736.1		NM_014732	Missense_Mutation
CCDC144B	284047	broad.mit.edu	37	17	18498258	18498258	+	RNA	DEL	T	T	-	rs200281535	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr17:18498258delT	ENST00000442583.1	-	0	783							Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						TATTTCTCCATTTTTTTTGTA	0.284													|||unknown(NO_COVERAGE)	62	0.0123802	0.0393	0.0101	5008	,	,		17530	0.0		0.002	False		,,,				2504	0.001				.													.	CCDC144B	106		0			.																																											0	.			TCTCCATTTTTTT	AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18498258delT			Somatic	274	0	0		WXS	Illumina HiSeq	Phase_I	320	0.03	8	.	0		0	Q6P5Q3|Q8N200	RNA	DEL	ENST00000442583.1	37																																																																																						0.284	CCDC144B-006	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000132102.1		NM_182568	
GRB7	2886	mdanderson.org	37	17	37903138	37903138	+	Silent	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr17:37903138G>T	ENST00000309156.4	+	15	1844	c.1587G>T	c.(1585-1587)cgG>cgT	p.R529R	GRB7_ENST00000394211.3_Silent_p.R529R|GRB7_ENST00000394204.1_3'UTR|GRB7_ENST00000394209.2_Silent_p.R529R|GRB7_ENST00000445327.2_Silent_p.R552R|GRB7_ENST00000309185.3_3'UTR	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	529					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCTGCACGCGGGTGGCCCTCT	0.687																																					p.R552R													.	.			0			c.G1656T												61.0	48.0	52.0					17																	37903138		2203	4300	6503	SO:0001819	synonymous_variant	2886	exon15			CACGCGGGTGGCC	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.1587G>T	17.37:g.37903138G>T			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	17	0.18	3	NM_001242442	97	0.00	0	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Silent	SNP	ENST00000309156.4	37	CCDS11345.1																																																																																					0.687	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257024.2		NM_005310	
IGFBP4	3487	mdanderson.org	37	17	38600240	38600240	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr17:38600240G>T	ENST00000269593.4	+	1	528	c.253G>T	c.(253-255)Ggg>Tgg	p.G85W	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	85	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CCCGCCCCGAGGGGTGGAGAA	0.692																																					p.G85W	GBM(160;940 3581 26177)												.	.			0			c.G253T												9.0	7.0	8.0					17																	38600240		2060	4031	6091	SO:0001583	missense	3487	exon1			CCCCGAGGGGTGG	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.253G>T	17.37:g.38600240G>T	ENSP00000269593:p.Gly85Trp		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_001552	159	0.00	0	A0N9W2|B4E351|Q5U012|Q9UCL6	Missense_Mutation	SNP	ENST00000269593.4	37	CCDS11367.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337195	0.81911	.	.	ENSG00000141753	ENST00000269593	T	0.66995	-0.24	5.16	4.19	0.49359	Insulin-like growth factor-binding protein, IGFBP (2);Growth factor, receptor (1);	0.133232	0.49305	D	0.000146	D	0.85039	0.5606	M	0.91612	3.225	0.45272	D	0.998273	D	0.89917	1.0	D	0.83275	0.996	D	0.88761	0.3257	10	0.87932	D	0	-4.005	15.3533	0.74405	0.0:0.1405:0.8595:0.0	.	85	P22692	IBP4_HUMAN	W	85	ENSP00000269593:G85W	ENSP00000269593:G85W	G	+	1	0	IGFBP4	35853766	1.000000	0.71417	0.732000	0.30844	0.991000	0.79684	7.686000	0.84128	1.172000	0.42781	0.591000	0.81541	GGG			0.692	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257134.1		NM_001552	
CDC27	996	hgsc.bcm.edu	37	17	45216150	45216150	+	Silent	SNP	T	T	C			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr17:45216150T>C	ENST00000066544.3	-	13	1752	c.1659A>G	c.(1657-1659)tcA>tcG	p.S553S	CDC27_ENST00000527547.1_Silent_p.S552S|CDC27_ENST00000446365.2_Silent_p.S492S|CDC27_ENST00000531206.1_Silent_p.S559S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	553					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTGACAGAACTGAAAGAGCAA	0.353																																					p.S559S													CDC27_ENST00000531206,NS,carcinoma,0,2	CDC27_ENST00000531206	0	2	0			c.A1677G												46.0	51.0	49.0					17																	45216150		2202	4299	6501	SO:0001819	synonymous_variant	996	exon13			CAGAACTGAAAGA	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1659A>G	17.37:g.45216150T>C			Somatic	71	0.014084507	1		WXS	Illumina HiSeq	.	79	0.06	5	NM_001114091	285	0.00	0	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																					0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			
PHOSPHO1	162466	mdanderson.org	37	17	47301674	47301674	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr17:47301674G>T	ENST00000310544.4	-	3	865	c.738C>A	c.(736-738)agC>agA	p.S246R	PHOSPHO1_ENST00000514112.1_Missense_Mutation_p.S271R|PHOSPHO1_ENST00000413580.1_Missense_Mutation_p.S271R			Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1	246					bone mineralization involved in bone maturation (GO:0035630)|dephosphorylation (GO:0016311)|endochondral ossification (GO:0001958)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of bone mineralization (GO:0030500)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|phosphocholine phosphatase activity (GO:0052731)|phosphoethanolamine phosphatase activity (GO:0052732)|pyrophosphatase activity (GO:0016462)							Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	AGGGCACCACGCTGGCGCGGA	0.706																																					p.S271R													.	.			0			c.C813A												8.0	9.0	9.0					17																	47301674		2164	4231	6395	SO:0001583	missense	162466	exon3			CACCACGCTGGCG	AJ457189	CCDS11547.1, CCDS45726.1	17q21.32	2008-05-02				ENSG00000173868			16815	protein-coding gene	gene with protein product						12464021	Standard	NM_178500		Approved		uc010wlv.1	Q8TCT1		ENST00000310544.4:c.738C>A	17.37:g.47301674G>T	ENSP00000311925:p.Ser246Arg		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_001143804	1	0.00	0	E9PAM0|Q17RU6	Missense_Mutation	SNP	ENST00000310544.4	37	CCDS11547.1	.	.	.	.	.	.	.	.	.	.	G	6.352	0.433076	0.12045	.	.	ENSG00000173868	ENST00000310544;ENST00000413580;ENST00000514112	T;T;T	0.44881	0.91;0.91;0.91	5.3	-0.143	0.13444	HAD-like domain (1);	1.239060	0.05094	N	0.485724	T	0.30885	0.0779	L	0.35341	1.055	0.26807	N	0.969088	B;B	0.18461	0.028;0.0	B;B	0.26416	0.069;0.002	T	0.24476	-1.0159	10	0.17832	T	0.49	.	5.6016	0.17357	0.2729:0.2388:0.4883:0.0	.	246;271	Q8TCT1;E9PAM0	PHOP1_HUMAN;.	R	246;271;271	ENSP00000311925:S246R;ENSP00000406909:S271R;ENSP00000427694:S271R	ENSP00000311925:S246R	S	-	3	2	PHOSPHO1	44656673	0.015000	0.18098	0.227000	0.23927	0.166000	0.22503	-0.043000	0.12043	-0.208000	0.10171	-1.101000	0.02118	AGC			0.706	PHOSPHO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364467.2			
SLC39A11	201266	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	70645032	70645032	+	Missense_Mutation	SNP	G	G	C	rs61736066	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr17:70645032G>C	ENST00000542342.2	-	9	948	c.860C>G	c.(859-861)gCt>gGt	p.A287G	SLC39A11_ENST00000255559.3_Missense_Mutation_p.A280G|SLC39A11_ENST00000579988.1_5'UTR	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	287					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						GATGGGCTCAGCCAGCACCAC	0.607																																					p.A287G	NSCLC(95;736 1527 12296 39625 41839)												.	.			0			c.C860G												62.0	57.0	59.0					17																	70645032		2203	4300	6503	SO:0001583	missense	201266	exon9			GGCTCAGCCAGCA	AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.860C>G	17.37:g.70645032G>C	ENSP00000445829:p.Ala287Gly		Somatic	68	0	0		WXS	Illumina HiSeq	.	61	0.10	6	NM_001159770	23	0.22	5	B2R8H7|Q8WZ81	Missense_Mutation	SNP	ENST00000542342.2	37	CCDS54160.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855987	0.91355	.	.	ENSG00000133195	ENST00000542342;ENST00000255559	T;T	0.51574	0.7;0.7	5.5	4.5	0.54988	.	0.125962	0.52532	D	0.000072	T	0.66446	0.2790	M	0.76433	2.335	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.72338	0.977;0.931	T	0.65389	-0.6180	10	0.25751	T	0.34	.	15.3722	0.74573	0.0:0.0:0.8594:0.1406	.	287;280	Q8N1S5;Q8N1S5-2	S39AB_HUMAN;.	G	287;280	ENSP00000445829:A287G;ENSP00000255559:A280G	ENSP00000255559:A280G	A	-	2	0	SLC39A11	68156627	1.000000	0.71417	0.831000	0.32960	0.996000	0.88848	8.972000	0.93424	1.258000	0.44101	0.655000	0.94253	GCT			0.607	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000441442.1			
MYOM1	8736	mdanderson.org	37	18	3083876	3083876	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr18:3083876G>T	ENST00000356443.4	-	33	4728	c.4395C>A	c.(4393-4395)gaC>gaA	p.D1465E	MYOM1_ENST00000261606.7_Missense_Mutation_p.D1369E|MYOM1_ENST00000400569.3_Missense_Mutation_p.D1465E	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1465					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GGATTTTCAGGTCTGTAGCAG	0.428																																					p.D1465E													.	.			0			c.C4395A												100.0	91.0	94.0					18																	3083876		1874	4113	5987	SO:0001583	missense	8736	exon33			TTTCAGGTCTGTA	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4395C>A	18.37:g.3083876G>T	ENSP00000348821:p.Asp1465Glu		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	74	0.05	4	NM_003803	0		0	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	G	3.244	-0.154760	0.06544	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.47177	0.99;0.96;0.85	5.84	1.69	0.24217	.	0.272836	0.42053	D	0.000765	T	0.15305	0.0369	N	0.01705	-0.755	0.36943	D	0.892471	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.13335	-1.0513	10	0.07813	T	0.8	.	5.6075	0.17387	0.3063:0.0:0.4849:0.2088	.	1369;1465	P52179-2;P52179	.;MYOM1_HUMAN	E	1465;1465;1369	ENSP00000348821:D1465E;ENSP00000383413:D1465E;ENSP00000261606:D1369E	ENSP00000261606:D1369E	D	-	3	2	MYOM1	3073876	0.799000	0.28903	1.000000	0.80357	0.997000	0.91878	-0.075000	0.11431	0.391000	0.25143	0.655000	0.94253	GAC			0.428	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000441037.2		NM_003803	
ZFR2	23217	mdanderson.org	37	19	3806039	3806039	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:3806039G>T	ENST00000262961.4	-	19	2738	c.2728C>A	c.(2728-2730)Cgc>Agc	p.R910S		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	910	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TTCCGGAAGCGGGCCCCCAGC	0.716																																					p.R910S													.	.			0			c.C2728A												7.0	9.0	9.0					19																	3806039		1876	4042	5918	SO:0001583	missense	23217	exon19			GGAAGCGGGCCCC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.2728C>A	19.37:g.3806039G>T	ENSP00000262961:p.Arg910Ser		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_015174	0		0		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563570	0.45694	.	.	ENSG00000105278	ENST00000262961	T	0.07216	3.21	3.04	0.746	0.18365	.	0.082725	0.46442	U	0.000281	T	0.04048	0.0113	L	0.31926	0.97	0.42535	D	0.993058	P	0.38827	0.649	B	0.29598	0.104	T	0.53265	-0.8463	10	0.21540	T	0.41	.	4.2602	0.10737	0.1398:0.2384:0.6217:0.0	.	910	Q9UPR6	ZFR2_HUMAN	S	910	ENSP00000262961:R910S	ENSP00000262961:R910S	R	-	1	0	ZFR2	3757039	0.963000	0.33076	0.005000	0.12908	0.002000	0.02628	1.885000	0.39678	0.145000	0.18977	-1.054000	0.02325	CGC			0.716	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453648.2		NM_015174	
PNPLA6	10908	mdanderson.org	37	19	7615966	7615966	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:7615966G>T	ENST00000221249.6	+	20	2471	c.2040G>T	c.(2038-2040)ttG>ttT	p.L680F	PNPLA6_ENST00000545201.2_Missense_Mutation_p.L654F|PNPLA6_ENST00000600737.1_Missense_Mutation_p.L719F|PNPLA6_ENST00000414982.3_Missense_Mutation_p.L728F|PNPLA6_ENST00000450331.3_Missense_Mutation_p.L680F	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	719					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						AGGGCACCTTGGGTCACATCA	0.736																																					p.L728F													.	.			0			c.G2184T												5.0	5.0	5.0					19																	7615966		2004	3891	5895	SO:0001583	missense	10908	exon19			CACCTTGGGTCAC	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2040G>T	19.37:g.7615966G>T	ENSP00000221249:p.Leu680Phe		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	50	0.08	4	NM_001166111	60	0.00	0	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.424103	0.43020	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	4.98	-0.213	0.13165	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000002	T	0.25568	0.0622	N	0.05510	-0.035	0.58432	D	0.999996	D;D;D;B	0.54397	0.966;0.958;0.958;0.166	P;P;P;B	0.61397	0.888;0.885;0.862;0.168	T	0.13575	-1.0504	10	0.06891	T	0.86	.	8.5896	0.33679	0.3932:0.0:0.6068:0.0	.	719;654;719;680	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	F	680;654;728;680	ENSP00000221249:L680F;ENSP00000443323:L654F;ENSP00000407509:L728F;ENSP00000394348:L680F	ENSP00000221249:L680F	L	+	3	2	PNPLA6	7521966	0.757000	0.28394	0.957000	0.39632	0.987000	0.75469	-0.132000	0.10467	0.018000	0.15052	0.591000	0.81541	TTG			0.736	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459275.1		NM_006702	
MUC16	94025	broad.mit.edu	37	19	9008299	9008299	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:9008299G>T	ENST00000397910.4	-	41	39456	c.39253C>A	c.(39253-39255)Cac>Aac	p.H13085N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13087	SEA 7. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTAAGGTGGTGGGTGCAGATG	0.562																																					p.H13085N													.	MUC16	4315		0			c.C39253A												127.0	116.0	119.0					19																	9008299		1956	4167	6123	SO:0001583	missense	94025	exon41			GGTGGTGGGTGCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39253C>A	19.37:g.9008299G>T	ENSP00000381008:p.His13085Asn		Somatic	137	0.0072992701	1		WXS	Illumina HiSeq	Phase_I	151	0.03	5	NM_024690	0		0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	4.711	0.132187	0.08981	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.38240	1.15	2.04	-3.75	0.04372	.	.	.	.	.	T	0.37865	0.1019	M	0.85197	2.74	.	.	.	B	0.21309	0.054	B	0.17098	0.017	T	0.39702	-0.9601	8	0.87932	D	0	-2.0807	7.3389	0.26625	0.4814:0.0:0.5186:0.0	.	13085	B5ME49	.	N	13085;238	ENSP00000381008:H13085N	ENSP00000381008:H13085N	H	-	1	0	MUC16	8869299	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.614000	0.05604	-1.131000	0.02910	0.195000	0.17529	CAC			0.562	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402806.1		NM_024690	
OR7G1	125962	mdanderson.org	37	19	9226017	9226017	+	Nonsense_Mutation	SNP	C	C	T	rs2217657	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:9226017C>T	ENST00000541538.1	-	1	422	c.423G>A	c.(421-423)tgG>tgA	p.W141*	OR7G1_ENST00000293614.1_Nonsense_Mutation_p.W141*	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	141			W -> C (in dbSNP:rs2217657).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						TCAGCAAGCCCCAGAAATGGA	0.493																																					p.W141X													OR7G1,NS,carcinoma,0,3	OR7G1	0	3	0			c.G423A												82.0	86.0	85.0					19																	9226017		2203	4300	6503	SO:0001587	stop_gained	125962	exon1			CAAGCCCCAGAAA		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.423G>A	19.37:g.9226017C>T	ENSP00000444134:p.Trp141*		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	120	0.03	3	NM_001005192	0		0	Q6IFJ5|Q96RA1	Nonsense_Mutation	SNP	ENST00000541538.1	37	CCDS32898.2	.	.	.	.	.	.	.	.	.	.	a	19.75	3.886066	0.72410	.	.	ENSG00000161807	ENST00000293614;ENST00000541538	.	.	.	3.78	1.58	0.23477	.	0.000000	0.41938	U	0.000781	.	.	.	.	.	.	0.09310	P	0.99999999753731	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	5.2712	0.15627	0.6745:0.1497:0.1759:0.0	.	.	.	.	X	141	.	ENSP00000293614:W141X	W	-	3	0	OR7G1	9087017	0.000000	0.05858	0.008000	0.14137	0.003000	0.03518	-0.383000	0.07398	-0.132000	0.11557	-2.681000	0.00142	TGG			0.493	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397912.1			
ANKLE1	126549	broad.mit.edu	37	19	17397498	17397501	+	3'UTR	DEL	TGTT	TGTT	-	rs71180380|rs563327402|rs534658778|rs1465582	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	TGTT	TGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:17397498_17397501delTGTT	ENST00000394458.3	+	0	2261_2264				ANKLE1_ENST00000594072.1_3'UTR|ANKLE1_ENST00000598347.1_Frame_Shift_Del_p.CL590fs|ANKLE1_ENST00000404085.1_3'UTR	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtgtttgtgtgtgtg	0.529																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTGTTTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TGTT>-	19.37:g.17397498_17397501delTGTT			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	9	0.89	8	.	4	0.00	0	A8VU82|Q8N8J8	Frame_Shift_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.529	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
ZNF30	90075	broad.mit.edu;mdanderson.org	37	19	35424555	35424555	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:35424555G>T	ENST00000601142.1	+	4	421	c.184G>T	c.(184-186)Gtg>Ttg	p.V62L	ZNF30_ENST00000426813.2_5'UTR|ZNF30_ENST00000595818.1_3'UTR|ZNF30_ENST00000439785.1_Missense_Mutation_p.V63L|ZNF30_ENST00000303586.7_Missense_Mutation_p.V63L|ZNF30_ENST00000601957.1_Missense_Mutation_p.V62L			P17039	ZNF30_HUMAN	zinc finger protein 30	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		TAAACCACATGTGATCGCCTT	0.408																																					p.V63L													.	ZNF30	44		0			c.G187T												90.0	81.0	84.0					19																	35424555		1970	4170	6140	SO:0001583	missense	90075	exon4			CCACATGTGATCG	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.184G>T	19.37:g.35424555G>T	ENSP00000469954:p.Val62Leu		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	128	0.04	5	NM_001099438	7	0.00	0	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	37	CCDS46045.1	.	.	.	.	.	.	.	.	.	.	G	9.697	1.153455	0.21371	.	.	ENSG00000168661	ENST00000439785;ENST00000303586	T	0.00745	5.75	1.52	1.52	0.23074	Krueppel-associated box (3);	.	.	.	.	T	0.00637	0.0021	N	0.25332	0.735	0.33890	D	0.637259	B;B	0.28584	0.216;0.002	B;B	0.20384	0.029;0.004	T	0.48570	-0.9024	9	0.26408	T	0.33	.	6.4749	0.22031	0.0:0.0:1.0:0.0	.	63;62	P17039-2;P17039	.;ZNF30_HUMAN	L	63;62	ENSP00000403441:V63L	ENSP00000303889:V62L	V	+	1	0	ZNF30	40116395	0.032000	0.19561	0.301000	0.25044	0.514000	0.34195	-0.041000	0.12084	1.149000	0.42402	0.514000	0.50259	GTG			0.408	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000464432.1		NM_194325	
ZNF540	163255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38103317	38103317	+	Missense_Mutation	SNP	G	G	C			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:38103317G>C	ENST00000592533.1	+	5	1468	c.1136G>C	c.(1135-1137)gGt>gCt	p.G379A	ZNF540_ENST00000316433.4_Missense_Mutation_p.G379A|ZNF540_ENST00000589117.1_Missense_Mutation_p.G347A|ZNF540_ENST00000343599.5_Missense_Mutation_p.G379A	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	379					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACTCATGCAGGTAAGAAACCT	0.368																																					p.G379A													ZNF540,NS,carcinoma,+1,1	ZNF540	1	1	0			c.G1136C												84.0	83.0	83.0					19																	38103317		2203	4300	6503	SO:0001583	missense	163255	exon5			ATGCAGGTAAGAA	AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1136G>C	19.37:g.38103317G>C	ENSP00000466274:p.Gly379Ala		Somatic	83	0	0		WXS	Illumina HiSeq	.	117	0.12	14	NM_152606	29	0.31	9	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	ENST00000592533.1	37	CCDS12506.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.317231	0.81469	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.26373	1.74	2.39	2.39	0.29439	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42743	0.1216	M	0.72479	2.2	0.29575	N	0.849606	D;D	0.65815	0.993;0.995	P;P	0.57057	0.715;0.812	T	0.41124	-0.9526	9	0.87932	D	0	.	11.8424	0.52361	0.0:0.0:1.0:0.0	.	347;379	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	A	379;347	ENSP00000324598:G379A	ENSP00000324598:G379A	G	+	2	0	ZNF540	42795157	0.055000	0.20627	0.006000	0.13384	0.983000	0.72400	1.322000	0.33689	1.313000	0.45069	0.305000	0.20034	GGT			0.368	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000459481.1		NM_152606	
RYR1	6261	broad.mit.edu	37	19	38964342	38964342	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:38964342G>T	ENST00000359596.3	+	28	4091	c.4091G>T	c.(4090-4092)gGg>gTg	p.G1364V	RYR1_ENST00000360985.3_Missense_Mutation_p.G1364V|RYR1_ENST00000355481.4_Missense_Mutation_p.G1364V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1364	6 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCGCAGGCGGGGGGAGAGGCG	0.677																																					p.G1364V													.	RYR1	708		0			c.G4091T												2.0	3.0	3.0					19																	38964342		1628	3200	4828	SO:0001583	missense	6261	exon28			AGGCGGGGGGAGA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.4091G>T	19.37:g.38964342G>T	ENSP00000352608:p.Gly1364Val		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	102	0.03	3	NM_001042723	0		0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	8.835	0.940870	0.18281	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96522	-4.04;-4.04;-4.04	5.05	3.94	0.45596	B30.2/SPRY domain (1);	.	.	.	.	D	0.88243	0.6384	N	0.08118	0	0.47407	D	0.999414	B;B	0.33637	0.42;0.063	B;B	0.29176	0.099;0.04	D	0.86083	0.1545	9	0.16420	T	0.52	.	10.6106	0.45419	0.0:0.1951:0.8049:0.0	.	1364;1364	P21817-2;P21817	.;RYR1_HUMAN	V	1364	ENSP00000352608:G1364V;ENSP00000347667:G1364V;ENSP00000354254:G1364V	ENSP00000347667:G1364V	G	+	2	0	RYR1	43656182	1.000000	0.71417	0.987000	0.45799	0.070000	0.16714	2.469000	0.45110	2.340000	0.79590	0.448000	0.29417	GGG			0.677	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000462137.1			
GYS1	2997	mdanderson.org	37	19	49488754	49488754	+	Missense_Mutation	SNP	C	C	T	rs372637032		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:49488754C>T	ENST00000323798.3	-	5	983	c.787G>A	c.(787-789)Gcc>Acc	p.A263T	GYS1_ENST00000544287.1_Intron|GYS1_ENST00000457974.1_5'Flank|GYS1_ENST00000541188.1_Missense_Mutation_p.A183T|GYS1_ENST00000540532.1_Missense_Mutation_p.A183T|GYS1_ENST00000263276.6_Missense_Mutation_p.A199T	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	263					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GCCTCGATGGCGGTGATCTGG	0.582																																					p.A263T													.	.			0			c.G787A							C	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	125.0	96.0	106.0		595,787	3.7	0.9	19		106	0,8600		0,0,4300	no	missense,missense	GYS1	NM_001161587.1,NM_002103.4	58,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	199/674,263/738	49488754	1,13005	2203	4300	6503	SO:0001583	missense	2997	exon5			CGATGGCGGTGAT		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.787G>A	19.37:g.49488754C>T	ENSP00000317904:p.Ala263Thr		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_002103	22	0.00	0	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318009	0.81469	2.27E-4	0.0	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000540532	T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25	4.75	3.7	0.42460	.	0.049737	0.85682	D	0.000000	T	0.80909	0.4714	M	0.87971	2.92	0.54753	D	0.999983	D;P;P	0.56746	0.977;0.657;0.923	B;B;B	0.43728	0.429;0.152;0.332	D	0.84500	0.0616	10	0.72032	D	0.01	-15.4563	13.0761	0.59087	0.0:0.8371:0.1629:0.0	.	183;199;263	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	T	263;199;183;183	ENSP00000317904:A263T;ENSP00000263276:A199T;ENSP00000437922:A183T;ENSP00000445197:A183T	ENSP00000263276:A199T	A	-	1	0	GYS1	54180566	1.000000	0.71417	0.899000	0.35326	0.920000	0.55202	5.829000	0.69316	1.119000	0.41883	0.455000	0.32223	GCC			0.582	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319791.1		NM_002103	
ZNF615	284370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52496353	52496353	+	Missense_Mutation	SNP	T	T	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:52496353T>G	ENST00000602063.1	-	6	2325	c.1976A>C	c.(1975-1977)aAa>aCa	p.K659T	ZNF615_ENST00000594083.1_Missense_Mutation_p.K670T|ZNF615_ENST00000376716.5_Missense_Mutation_p.K659T|ZNF615_ENST00000598071.1_Missense_Mutation_p.K670T|ZNF615_ENST00000391795.3_Missense_Mutation_p.K664T			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	659					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CAAAGAGAATTTTCCACATTC	0.398																																					p.K670T													.	.			0			c.A2009C												155.0	154.0	154.0					19																	52496353		2203	4300	6503	SO:0001583	missense	284370	exon7			GAGAATTTTCCAC	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1976A>C	19.37:g.52496353T>G	ENSP00000473089:p.Lys659Thr		Somatic	154	0	0		WXS	Illumina HiSeq	.	189	0.13	24	NM_001199324	12	0.00	0	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	ENST00000602063.1	37	CCDS12846.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963819	0.53507	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.21932	1.98;1.98	3.14	3.14	0.36123	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42381	0.1200	M	0.85373	2.75	0.24786	N	0.992781	D;D;D;D	0.60160	0.987;0.984;0.984;0.987	P;P;P;P	0.60415	0.874;0.801;0.801;0.874	T	0.23904	-1.0175	9	0.87932	D	0	.	6.5405	0.22377	0.0:0.1221:0.0:0.8779	.	664;666;670;659	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	T	659;669;664;613	ENSP00000365906:K659T;ENSP00000375672:K664T	ENSP00000347019:K669T	K	-	2	0	ZNF615	57188165	0.929000	0.31497	0.848000	0.33437	0.988000	0.76386	1.040000	0.30278	1.431000	0.47355	0.533000	0.62120	AAA			0.398	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462391.1		NM_198480	
ZNF525	170958	broad.mit.edu	37	19	53879109	53879109	+	Silent	SNP	G	G	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr19:53879109G>A	ENST00000475179.1	+	3	216	c.102G>A	c.(100-102)agG>agA	p.R34R	ZNF525_ENST00000474037.1_Silent_p.R34R|ZNF525_ENST00000467003.1_5'UTR|ZNF525_ENST00000593918.1_Silent_p.R34R|ZNF525_ENST00000491101.1_Silent_p.R34R			Q8N782	ZN525_HUMAN	zinc finger protein 525	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R34R(6)		endometrium(3)|kidney(3)|lung(3)	9						CTCTATACAGGGACGTGATGC	0.473																																					.													.	ZNF525	35		6	Substitution - coding silent(6)	kidney(6)	.																																									SO:0001819	synonymous_variant	170958	.			ATACAGGGACGTG	AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000475179.1:c.102G>A	19.37:g.53879109G>A			Somatic	62	0.0161290323	1		WXS	Illumina HiSeq	Phase_I	46	0.11	5	.	13	0.00	0	Q8TF23	Silent	SNP	ENST00000475179.1	37																																																																																						0.473	ZNF525-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000350553.1		NR_003699	
HTRA2	27429	broad.mit.edu	37	2	74757212	74757212	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr2:74757212A>G	ENST00000258080.3	+	1	709	c.79A>G	c.(79-81)Agg>Ggg	p.R27G	AUP1_ENST00000377526.3_5'Flank|HTRA2_ENST00000352222.3_Missense_Mutation_p.R27G|HTRA2_ENST00000467961.1_Intron	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	27					adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						TCGCTGGGGGAGGAGACCCCG	0.711																																					p.R27G													.	HTRA2	22		0			c.A79G												14.0	20.0	18.0					2																	74757212		2148	4221	6369	SO:0001583	missense	27429	exon1			TGGGGGAGGAGAC		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.79A>G	2.37:g.74757212A>G	ENSP00000258080:p.Arg27Gly		Somatic	80	0.0625	5		WXS	Illumina HiSeq	Phase_I	130	0.08	11	NM_013247	12	0.00	0	Q9HBZ4|Q9P0Y3|Q9P0Y4	Missense_Mutation	SNP	ENST00000258080.3	37	CCDS1951.1	.	.	.	.	.	.	.	.	.	.	a	9.801	1.180553	0.21787	.	.	ENSG00000115317	ENST00000258080;ENST00000352222;ENST00000437202	T;T;T	0.16743	2.32;2.32;2.32	5.0	3.85	0.44370	.	1.020890	0.07806	N	0.957260	T	0.09862	0.0242	N	0.08118	0	0.09310	N	1	B;B;B;B	0.18310	0.016;0.027;0.027;0.016	B;B;B;B	0.19391	0.011;0.025;0.025;0.007	T	0.13150	-1.0520	10	0.87932	D	0	-0.6842	5.819	0.18516	0.8099:0.0:0.1901:0.0	.	27;27;27;27	A8K7G2;O43464-3;O43464-2;O43464	.;.;.;HTRA2_HUMAN	G	27;27;14	ENSP00000258080:R27G;ENSP00000312893:R27G;ENSP00000399166:R14G	ENSP00000258080:R27G	R	+	1	2	HTRA2	74610720	0.000000	0.05858	0.377000	0.26055	0.257000	0.26127	0.640000	0.24705	2.013000	0.59113	0.375000	0.23000	AGG			0.711	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252219.2		NM_013247	
HK2	3099	broad.mit.edu	37	2	75105841	75105841	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr2:75105841G>A	ENST00000290573.2	+	9	1658	c.1058G>A	c.(1057-1059)cGt>cAt	p.R353H	HK2_ENST00000409174.1_Missense_Mutation_p.R325H	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	353	Hexokinase type-2 1.|Regulatory.		R -> C (in dbSNP:rs61748096). {ECO:0000269|PubMed:7883120}.		apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						CGGAAGGCCCGTGAGGTCCTG	0.632																																					p.R353H													.	HK2	85		0			c.G1058A												34.0	26.0	29.0					2																	75105841		2199	4297	6496	SO:0001583	missense	3099	exon9			AGGCCCGTGAGGT		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.1058G>A	2.37:g.75105841G>A	ENSP00000290573:p.Arg353His		Somatic	298	0	0		WXS	Illumina HiSeq	Phase_I	381	0.01	4	NM_000189	4	0.00	0	D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	37	CCDS1956.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782262	0.31502	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96651	-4.08;-4.08	4.65	-3.72	0.04411	Hexokinase, C-terminal (1);	0.722806	0.14247	N	0.331688	D	0.91078	0.7192	L	0.55834	1.745	0.09310	N	1	B	0.27656	0.184	B	0.27076	0.076	T	0.81217	-0.1033	10	0.13108	T	0.6	-1.6936	4.6862	0.12758	0.5194:0.0:0.2105:0.2701	.	353	P52789	HXK2_HUMAN	H	353;353;325	ENSP00000290573:R353H;ENSP00000387140:R325H	ENSP00000290573:R353H	R	+	2	0	HK2	74959349	0.000000	0.05858	0.043000	0.18650	0.971000	0.66376	0.535000	0.23114	-0.466000	0.06943	0.655000	0.94253	CGT			0.632	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252238.2		NM_000189	
AC027612.3	0	broad.mit.edu	37	2	91887904	91887905	+	RNA	INS	-	-	T	rs374250838|rs373336109|rs369805878|rs199562278	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr2:91887904_91887905insT	ENST00000436174.1	-	0	540																											AGCTATTTTCCATTTTTTTTTT	0.292																																					.													.	.			0			.																																											0	.			ATTTTCCATTTTT																													2.37:g.91887904_91887905insT			Somatic	170	0.0235294118	4		WXS	Illumina HiSeq	Phase_I	168	0.06	10	.	0		0		RNA	INS	ENST00000436174.1	37																																																																																						0.292	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338339.1			
SAP130	79595	mdanderson.org	37	2	128770644	128770644	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr2:128770644G>T	ENST00000259235.3	-	6	911	c.782C>A	c.(781-783)gCt>gAt	p.A261D	SAP130_ENST00000259234.6_Missense_Mutation_p.A235D|SAP130_ENST00000357702.5_Missense_Mutation_p.A261D	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	261					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TGCTGGCTGAGCAGTAGCAGC	0.517																																					p.A261D													.	.			0			c.C782A												90.0	83.0	85.0					2																	128770644		2203	4300	6503	SO:0001583	missense	79595	exon6			GGCTGAGCAGTAG	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.782C>A	2.37:g.128770644G>T	ENSP00000259235:p.Ala261Asp		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	81	0.06	5	NM_001145928	51	0.00	0	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	37	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466463	0.63625	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234;ENST00000424298	.	.	.	5.56	5.56	0.83823	.	0.094335	0.64402	D	0.000001	T	0.58148	0.2102	N	0.19112	0.55	0.54753	D	0.999989	P;D;P	0.61697	0.902;0.99;0.952	P;P;P	0.58780	0.602;0.845;0.677	T	0.50988	-0.8762	9	0.13108	T	0.6	-16.0534	19.5058	0.95114	0.0:0.0:1.0:0.0	.	261;235;261	B7ZLM3;Q96DP1;Q9H0E3	.;.;SP130_HUMAN	D	261;261;235;235	.	ENSP00000259234:A235D	A	-	2	0	SAP130	128487114	1.000000	0.71417	0.400000	0.26346	0.961000	0.63080	4.630000	0.61297	2.611000	0.88343	0.561000	0.74099	GCT			0.517	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000254436.3		NM_024545	
TANK	10010	broad.mit.edu	37	2	162087512	162087512	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr2:162087512C>T	ENST00000392749.2	+	7	790	c.551C>T	c.(550-552)aCg>aTg	p.T184M	TANK_ENST00000402568.1_Intron|AC009299.2_ENST00000421122.2_RNA|TANK_ENST00000259075.2_Missense_Mutation_p.T184M|AC009299.2_ENST00000445372.1_RNA|TANK_ENST00000406287.1_Intron|TANK_ENST00000405852.1_Missense_Mutation_p.T184M	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	184	TRAF family member interaction.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						ATACAGTGTACGGATAAAACA	0.408																																					p.T184M													.	TANK	35		0			c.C551T												49.0	46.0	47.0					2																	162087512		2203	4300	6503	SO:0001583	missense	10010	exon7			AGTGTACGGATAA	U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.551C>T	2.37:g.162087512C>T	ENSP00000376505:p.Thr184Met		Somatic	285	0	0		WXS	Illumina HiSeq	Phase_I	240	0.03	6	NM_004180	40	0.00	0	D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	ENST00000392749.2	37	CCDS2215.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943267	0.73672	.	.	ENSG00000136560	ENST00000259075;ENST00000392749;ENST00000429217;ENST00000405852;ENST00000437623	T;T;T;T	0.57107	1.55;1.55;1.14;0.42	5.78	5.78	0.91487	Tbk1/Ikki binding domain (1);	0.000000	0.85682	D	0.000000	T	0.72851	0.3512	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73519	-0.3957	10	0.87932	D	0	-7.9361	19.3632	0.94451	0.0:1.0:0.0:0.0	.	184	Q92844	TANK_HUMAN	M	184;184;185;184;75	ENSP00000259075:T184M;ENSP00000376505:T184M;ENSP00000385487:T184M;ENSP00000412556:T75M	ENSP00000259075:T184M	T	+	2	0	TANK	161795758	1.000000	0.71417	0.973000	0.42090	0.992000	0.81027	6.113000	0.71553	2.894000	0.99253	0.591000	0.81541	ACG			0.408	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324232.1		NM_133484	
CCDC173	129881	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	170537595	170537595	+	Silent	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr2:170537595G>T	ENST00000447353.1	-	2	321	c.216C>A	c.(214-216)ctC>ctA	p.L72L		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	72																	TTTCTGCACGGAGGCATGCTG	0.428																																					p.L72L													.	.			0			c.C216A												209.0	205.0	207.0					2																	170537595		2019	4178	6197	SO:0001819	synonymous_variant	129881	exon2			TGCACGGAGGCAT	BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.216C>A	2.37:g.170537595G>T			Somatic	170	0	0		WXS	Illumina HiSeq	.	178	0.04	8	NM_001085447	1	0.00	0	Q6PJF6	Silent	SNP	ENST00000447353.1	37	CCDS46445.1																																																																																					0.428	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333954.2		NM_001085447	
OBSL1	23363	mdanderson.org	37	2	220430190	220430190	+	Silent	SNP	G	G	T	rs199883250		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr2:220430190G>T	ENST00000404537.1	-	6	2237	c.2181C>A	c.(2179-2181)acC>acA	p.T727T	OBSL1_ENST00000373876.1_Silent_p.T727T|OBSL1_ENST00000603926.1_Silent_p.T727T|OBSL1_ENST00000373873.4_Silent_p.T727T|OBSL1_ENST00000265318.4_Silent_p.T727T|OBSL1_ENST00000289656.3_Silent_p.T314T	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	727	Ig-like 5.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		AGGTTGTGAAGGTCAACGACA	0.602											OREG0003987	type=REGULATORY REGION|Gene=BC061909|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T727T													.	.			0			c.C2181A												98.0	98.0	98.0					2																	220430190		2062	4205	6267	SO:0001819	synonymous_variant	23363	exon6			TGTGAAGGTCAAC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2181C>A	2.37:g.220430190G>T			Somatic	45	0	0	2266	WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001173431	87	0.00	0	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	ENST00000404537.1	37	CCDS46520.1																																																																																			0.001		0.602	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322012.1			
ZNF341	84905	mdanderson.org	37	20	32379155	32379155	+	Silent	SNP	G	G	T	rs548375525		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr20:32379155G>T	ENST00000375200.1	+	15	2762	c.2397G>T	c.(2395-2397)gcG>gcT	p.A799A	RP4-553F4.6_ENST00000423074.1_RNA|ZNF341_ENST00000342427.2_Silent_p.A792A|RP4-553F4.6_ENST00000443171.1_RNA|RP4-553F4.6_ENST00000439444.1_RNA	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	799					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A792A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						AGCCGGACGCGGTGCTGTCCA	0.701																																					p.A792A													ZNF341,bladder,carcinoma,0,1	ZNF341	0	1	1	Substitution - coding silent(1)	urinary_tract(1)	c.G2376T												35.0	37.0	36.0					20																	32379155		2201	4299	6500	SO:0001819	synonymous_variant	84905	exon15			GGACGCGGTGCTG	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.2397G>T	20.37:g.32379155G>T			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_032819	16	0.00	0	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Silent	SNP	ENST00000375200.1	37																																																																																						0.701	ZNF341-201	KNOWN	basic	protein_coding	protein_coding					
MYH7B	57644	mdanderson.org	37	20	33584173	33584173	+	Missense_Mutation	SNP	G	G	T	rs566478593		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr20:33584173G>T	ENST00000262873.7	+	27	3186	c.3094G>T	c.(3094-3096)Gct>Tct	p.A1032S		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	990						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGAAGAGATGGCTGCGCTGGA	0.662																																					p.A1032S													.	.			0			c.G3094T												18.0	21.0	20.0					20																	33584173		2192	4297	6489	SO:0001583	missense	57644	exon29			GAGATGGCTGCGC	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3094G>T	20.37:g.33584173G>T	ENSP00000262873:p.Ala1032Ser		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_020884	0		0	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268556	0.59540	.	.	ENSG00000078814	ENST00000262873	D	0.83075	-1.68	4.51	4.51	0.55191	.	0.000000	0.34386	N	0.004002	T	0.78489	0.4291	L	0.45352	1.415	0.51012	D	0.999903	B	0.23540	0.087	B	0.18561	0.022	T	0.75388	-0.3335	10	0.41790	T	0.15	.	17.8258	0.88665	0.0:0.0:1.0:0.0	.	990	A7E2Y1	MYH7B_HUMAN	S	1032	ENSP00000262873:A1032S	ENSP00000262873:A1032S	A	+	1	0	MYH7B	33047834	1.000000	0.71417	0.993000	0.49108	0.905000	0.53344	6.507000	0.73717	2.523000	0.85059	0.655000	0.94253	GCT			0.662	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000078833.2		NM_020884	
NFATC2	4773	bcgsc.ca	37	20	50140461	50140461	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr20:50140461A>G	ENST00000396009.3	-	2	538	c.319T>C	c.(319-321)Tcg>Ccg	p.S107P	NFATC2_ENST00000414705.1_Missense_Mutation_p.S87P|NFATC2_ENST00000609943.1_Missense_Mutation_p.S87P|NFATC2_ENST00000371564.3_Missense_Mutation_p.S107P|NFATC2_ENST00000610033.1_Intron|NFATC2_ENST00000609507.1_Intron	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	107					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CTCAGGCCCGAGGCCCCTGCT	0.687																																					p.S107P													NFATC2,NS,carcinoma,+2,1	NFATC2	112	1	0			c.T319C												30.0	35.0	33.0					20																	50140461		2192	4280	6472	SO:0001583	missense	4773	exon2			GGCCCGAGGCCCC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.319T>C	20.37:g.50140461A>G	ENSP00000379330:p.Ser107Pro		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_1	69	0.06	4	NM_012340	0		0	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.899578	0.00517	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.78481	-1.18;-1.18;-1.18	5.7	3.43	0.39272	.	0.204155	0.42420	D	0.000712	T	0.51075	0.1653	N	0.11064	0.09	0.27407	N	0.954675	B;B;B;B	0.13145	0.002;0.002;0.007;0.003	B;B;B;B	0.11329	0.003;0.004;0.006;0.004	T	0.41106	-0.9527	10	0.02654	T	1	-7.1738	6.4075	0.21672	0.7273:0.1341:0.1386:0.0	.	87;87;107;107	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	P	107;107;87	ENSP00000360619:S107P;ENSP00000379330:S107P;ENSP00000396471:S87P	ENSP00000360619:S107P	S	-	1	0	NFATC2	49573868	1.000000	0.71417	0.992000	0.48379	0.168000	0.22595	3.589000	0.53972	0.429000	0.26202	-0.648000	0.03929	TCG			0.687	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079730.2		NM_012340	
AP003900.6	0	bcgsc.ca	37	21	11180933	11180933	+	lincRNA	SNP	A	A	C	rs79885392	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr21:11180933A>C	ENST00000603265.1	+	0	231																											CAGGTTTACAAGTTTTTCATT	0.473																																					.													.	.			0			.																																											54053	.			TTTACAAGTTTTT																													21.37:g.11180933A>C			Somatic	100	0.01	1		WXS	Illumina HiSeq	Phase_1	114	0.08	9	.	0		0		RNA	SNP	ENST00000603265.1	37																																																																																						0.473	AP003900.6-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000469752.1			
LSS	4047	mdanderson.org	37	21	47642609	47642609	+	Silent	SNP	G	G	T	rs11558754	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr21:47642609G>T	ENST00000397728.3	-	4	441	c.363C>A	c.(361-363)gcC>gcA	p.A121A	LSS_ENST00000464357.1_5'UTR|LSS_ENST00000522411.1_Silent_p.A121A|AP001469.5_ENST00000418029.1_RNA|LSS_ENST00000457828.2_Silent_p.A41A|LSS_ENST00000356396.4_Silent_p.A121A	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	121					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					CTCTGTATCCGGCTGGCAGAG	0.607																																					p.A121A	Pancreas(114;955 2313 34923 50507)												.	.			0			c.C363A												128.0	100.0	109.0					21																	47642609		2203	4300	6503	SO:0001819	synonymous_variant	4047	exon4			GTATCCGGCTGGC	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.363C>A	21.37:g.47642609G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001145436	13	0.00	0	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Silent	SNP	ENST00000397728.3	37	CCDS13733.1																																																																																					0.607	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207274.2			
CABIN1	23523	mdanderson.org	37	22	24445671	24445671	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr22:24445671G>T	ENST00000398319.2	+	7	1030	c.645G>T	c.(643-645)atG>atT	p.M215I	CABIN1_ENST00000405822.2_Missense_Mutation_p.M215I|CABIN1_ENST00000263119.5_Missense_Mutation_p.M215I	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	215					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CTCTCAGAATGTTCCTCAAAT	0.532																																					p.M215I													.	.			0			c.G645T												99.0	93.0	95.0					22																	24445671		2203	4300	6503	SO:0001583	missense	23523	exon7			CAGAATGTTCCTC	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.645G>T	22.37:g.24445671G>T	ENSP00000381364:p.Met215Ile		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001201429	10	0.00	0	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.683203	0.47991	.	.	ENSG00000099991	ENST00000454754;ENST00000263119;ENST00000405822;ENST00000445422;ENST00000398319;ENST00000536026	T;T;T;T;T	0.62498	0.48;0.12;0.02;0.48;0.12	5.39	5.39	0.77823	.	0.036191	0.85682	N	0.000000	T	0.56247	0.1972	L	0.39898	1.24	0.80722	D	1	B;B;B;B	0.27068	0.034;0.167;0.054;0.112	B;B;B;B	0.28011	0.014;0.085;0.031;0.042	T	0.50591	-0.8810	10	0.27082	T	0.32	.	18.5963	0.91230	0.0:0.0:1.0:0.0	.	170;215;215;215	C9J068;F5H5W5;G5E9F3;Q9Y6J0	.;.;.;CABIN_HUMAN	I	170;215;215;170;215;215	ENSP00000394209:M170I;ENSP00000263119:M215I;ENSP00000384694:M215I;ENSP00000412389:M170I;ENSP00000381364:M215I	ENSP00000263119:M215I	M	+	3	0	CABIN1	22775671	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	9.726000	0.98782	2.722000	0.93159	0.496000	0.49642	ATG			0.532	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320161.2		NM_012295	
HORMAD2	150280	mdanderson.org	37	22	30572077	30572077	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr22:30572077G>T	ENST00000336726.6	+	11	1200	c.845G>T	c.(844-846)aGt>aTt	p.S282I	HORMAD2_ENST00000403975.1_Missense_Mutation_p.S282I	NM_152510.2	NP_689723.1	Q8N7B1	HORM2_HUMAN	HORMA domain containing 2	282					meiotic nuclear division (GO:0007126)|meiotic sister chromatid cohesion (GO:0051177)	chromosome (GO:0005694)|nucleus (GO:0005634)				large_intestine(1)|lung(1)	2			Epithelial(10;0.125)			TTTGTGTGCAGTCAGCAAAGT	0.403																																					p.S282I													.	.			0			c.G845T												80.0	81.0	80.0					22																	30572077		1881	4117	5998	SO:0001583	missense	150280	exon11			TGTGCAGTCAGCA	AK098703	CCDS46683.1	22q12.2	2014-01-21			ENSG00000176635	ENSG00000176635			28383	protein-coding gene	gene with protein product						12477932	Standard	NM_152510		Approved	MGC26710, CT46.2	uc003agy.3	Q8N7B1	OTTHUMG00000150881	ENST00000336726.6:c.845G>T	22.37:g.30572077G>T	ENSP00000336984:p.Ser282Ile		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_152510	0		0	B5MEB2|Q8NHR2	Missense_Mutation	SNP	ENST00000336726.6	37	CCDS46683.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305344	0.23736	.	.	ENSG00000176635	ENST00000336726;ENST00000403975;ENST00000481990	T;T	0.33216	1.42;1.42	5.86	2.6	0.31112	.	0.796730	0.11879	N	0.520681	T	0.15478	0.0373	N	0.12182	0.205	0.23016	N	0.998426	B	0.12013	0.005	B	0.12156	0.007	T	0.19943	-1.0290	10	0.36615	T	0.2	-0.056	4.6985	0.12815	0.1766:0.0:0.6435:0.1799	.	282	Q8N7B1	HORM2_HUMAN	I	282;282;22	ENSP00000336984:S282I;ENSP00000385055:S282I	ENSP00000336984:S282I	S	+	2	0	HORMAD2	28902077	0.971000	0.33674	0.822000	0.32727	0.986000	0.74619	1.069000	0.30641	0.775000	0.33450	-0.157000	0.13467	AGT			0.403	HORMAD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320416.2		NM_152510	
SLC16A8	23539	mdanderson.org	37	22	38477003	38477003	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr22:38477003C>T	ENST00000320521.5	-	4	1150	c.1042G>A	c.(1042-1044)Gcc>Acc	p.A348T	SLC16A8_ENST00000469516.1_Intron	NM_013356.2	NP_037488.2	O95907	MOT3_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 8	348					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|lactate transmembrane transport (GO:0035873)|lactate transport (GO:0015727)|leukocyte migration (GO:0050900)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			kidney(1)|large_intestine(1)|prostate(1)	3	Melanoma(58;0.045)				Pyruvic acid(DB00119)	ACGCAGAAGGCGACGAGGGCG	0.706																																					p.A348T													.	.			0			c.G1042A												11.0	12.0	12.0					22																	38477003		2144	4202	6346	SO:0001583	missense	23539	exon4			AGAAGGCGACGAG	AF132610	CCDS13966.1	22q12.3-q13.2	2013-07-18	2013-07-18		ENSG00000100156	ENSG00000100156		"""Solute carriers"""	16270	protein-coding gene	gene with protein product	"""monocarboxylate transporter 3"""	610409	"""solute carrier 16 (monocarboxylic acid transporters), member 8"""			10493836	Standard	NM_013356		Approved	MCT3, REMP	uc003auu.3	O95907	OTTHUMG00000151196	ENST00000320521.5:c.1042G>A	22.37:g.38477003C>T	ENSP00000321735:p.Ala348Thr		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_013356	0		0	Q9UBE2	Missense_Mutation	SNP	ENST00000320521.5	37	CCDS13966.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.626469	0.28978	.	.	ENSG00000100156	ENST00000320521	T	0.52526	0.66	3.09	0.785	0.18584	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.737052	0.11999	N	0.509060	T	0.33440	0.0863	L	0.28192	0.835	0.26442	N	0.975752	D	0.53151	0.958	P	0.45998	0.5	T	0.16276	-1.0408	10	0.51188	T	0.08	.	3.568	0.07907	0.1541:0.4431:0.3021:0.1007	.	348	O95907	MOT3_HUMAN	T	348	ENSP00000321735:A348T	ENSP00000321735:A348T	A	-	1	0	SLC16A8	36806949	0.995000	0.38212	0.220000	0.23810	0.364000	0.29643	1.423000	0.34837	0.124000	0.18369	0.313000	0.20887	GCC			0.706	SLC16A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321724.1		NM_013356	
HESX1	8820	broad.mit.edu	37	3	57232488	57232488	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr3:57232488G>T	ENST00000295934.3	-	3	426	c.390C>A	c.(388-390)aaC>aaA	p.N130K	HESX1_ENST00000473921.1_Intron	NM_003865.2	NP_003856.1	Q9UBX0	HESX1_HUMAN	HESX homeobox 1	130					brain development (GO:0007420)|forebrain morphogenesis (GO:0048853)|negative regulation of transcription, DNA-templated (GO:0045892)|nose development (GO:0043584)|otic vesicle formation (GO:0030916)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0109)|Kidney(284;0.0126)		CAGGATAGCAGTTTACTCTAA	0.289																																					p.N130K	Esophageal Squamous(84;267 1272 9034 48993 52677)												.	HESX1	26		0			c.C390A												45.0	47.0	47.0					3																	57232488		2202	4285	6487	SO:0001583	missense	8820	exon3			ATAGCAGTTTACT	AF059734	CCDS2881.1	3p14.3	2014-06-16	2007-02-16		ENSG00000163666	ENSG00000163666		"""Homeoboxes / PRD class"""	4877	protein-coding gene	gene with protein product		601802	"""homeobox, ES cell expressed 1"""			9373136, 9620767, 7876132	Standard	NM_003865		Approved	RPX, ANF	uc003din.4	Q9UBX0	OTTHUMG00000158597	ENST00000295934.3:c.390C>A	3.37:g.57232488G>T	ENSP00000295934:p.Asn130Lys		Somatic	256	0	0		WXS	Illumina HiSeq	Phase_I	253	0.02	6	NM_003865	9	0.00	0	Q52LC5|Q99667	Missense_Mutation	SNP	ENST00000295934.3	37	CCDS2881.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.183536	0.57800	.	.	ENSG00000163666	ENST00000295934	D	0.96300	-3.97	5.61	2.85	0.33270	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96734	0.8934	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95227	0.8339	10	0.59425	D	0.04	-20.2374	9.0885	0.36596	0.2811:0.0:0.7189:0.0	.	130	Q9UBX0	HESX1_HUMAN	K	130	ENSP00000295934:N130K	ENSP00000295934:N130K	N	-	3	2	HESX1	57207528	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.551000	0.45820	0.311000	0.23014	-0.237000	0.12165	AAC			0.289	HESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351430.2			
ACAD11	84129	mdanderson.org	37	3	132277850	132277850	+	Missense_Mutation	SNP	G	G	A	rs200376706	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr3:132277850G>A	ENST00000264990.6	-	20	3279	c.2308C>T	c.(2308-2310)Cgg>Tgg	p.R770W	ACAD11_ENST00000355458.3_Missense_Mutation_p.R666W|ACAD11_ENST00000545291.1_Missense_Mutation_p.R295W	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	770					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						GCTTGGTCCCGCAGCTCCATT	0.463													G|||	2	0.000399361	0.0	0.0	5008	,	,		18874	0.002		0.0	False		,,,				2504	0.0				p.R770W													ACAD11,NS,carcinoma,0,1	ACAD11	0	1	0			c.C2308T												128.0	114.0	119.0					3																	132277850		2203	4299	6502	SO:0001583	missense	84129	exon20			GGTCCCGCAGCTC	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.2308C>T	3.37:g.132277850G>A	ENSP00000264990:p.Arg770Trp		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	112	0.05	6	NM_032169	211	0.00	0	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	ENST00000264990.6	37	CCDS3074.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	7.504	0.653178	0.14580	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000545291	D;D;D	0.96300	-3.97;-3.97;-3.97	5.28	2.49	0.30216	Acyl-CoA dehydrogenase/oxidase C-terminal (2);	.	.	.	.	D	0.94479	0.8223	M	0.82823	2.61	0.09310	N	0.999999	B	0.14438	0.01	B	0.08055	0.003	D	0.88080	0.2806	9	0.62326	D	0.03	.	1.5586	0.02589	0.1585:0.1589:0.4014:0.2811	.	770	Q709F0	ACD11_HUMAN	W	666;770;295	ENSP00000347636:R666W;ENSP00000264990:R770W;ENSP00000446263:R295W	ENSP00000264990:R770W	R	-	1	2	ACAD11	133760540	0.003000	0.15002	0.038000	0.18304	0.020000	0.10135	1.442000	0.35046	0.212000	0.20703	0.655000	0.94253	CGG	0		0.463	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357279.2		NM_032169	
CRMP1	1400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	5837737	5837737	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr4:5837737G>A	ENST00000397890.2	-	11	1400	c.1186C>T	c.(1186-1188)Cca>Tca	p.P396S	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Missense_Mutation_p.P510S|CRMP1_ENST00000512574.1_Missense_Mutation_p.P394S	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	396					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTTTCCTTGGGTACAGGTTA	0.527																																					p.P510S													.	.			0			c.C1528T												144.0	132.0	136.0					4																	5837737		2203	4300	6503	SO:0001583	missense	1400	exon11			TCCTTGGGTACAG	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1186C>T	4.37:g.5837737G>A	ENSP00000380987:p.Pro396Ser		Somatic	154	0	0		WXS	Illumina HiSeq	.	142	0.17	24	NM_001014809	13	0.15	2	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	ENST00000397890.2	37	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.597390	0.87055	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.89746	-2.56;-2.56;-2.56	4.33	4.33	0.51752	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.96399	0.8825	H	0.97732	4.065	0.80722	D	1	D;D;D;P	0.67145	0.988;0.996;0.988;0.946	D;D;D;P	0.71414	0.973;0.963;0.963;0.755	D	0.97902	1.0303	10	0.87932	D	0	-23.8091	16.3427	0.83092	0.0:0.0:1.0:0.0	.	510;394;396;333	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	S	510;396;396;394	ENSP00000321606:P510S;ENSP00000380987:P396S;ENSP00000425742:P394S	ENSP00000321606:P510S	P	-	1	0	CRMP1	5888638	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.213000	0.95133	2.418000	0.82041	0.508000	0.49915	CCA			0.527	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358871.1		NM_001313	
DNAH5	1767	broad.mit.edu	37	5	13830171	13830171	+	Silent	SNP	C	C	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr5:13830171C>G	ENST00000265104.4	-	37	6317	c.6213G>C	c.(6211-6213)gtG>gtC	p.V2071V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2071	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGTTCATAGTCACATTATCTC	0.388									Kartagener syndrome																												p.V2071V													.	DNAH5	868		0			c.G6213C												89.0	87.0	87.0					5																	13830171		2203	4300	6503	SO:0001819	synonymous_variant	1767	exon37	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CATAGTCACATTA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6213G>C	5.37:g.13830171C>G			Somatic	326	0.0030674847	1		WXS	Illumina HiSeq	Phase_I	281	0.01	4	NM_001369	0		0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																					0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207057.2		NM_001369	
BASP1	10409	mdanderson.org	37	5	17275706	17275706	+	Silent	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr5:17275706G>T	ENST00000322611.3	+	2	641	c.381G>T	c.(379-381)gcG>gcT	p.A127A		NM_001271606.1|NM_006317.3	NP_001258535.1|NP_006308.3	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein 1	127					diaphragm development (GO:0060539)|glomerular visceral epithelial cell differentiation (GO:0072112)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchyme development (GO:0072075)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of heart growth (GO:0060421)|positive regulation of metanephric ureteric bud development (GO:2001076)|substantia nigra development (GO:0021762)|thorax and anterior abdomen determination (GO:0007356)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(8)	9						Aggccgccgcggccccggccg	0.776																																					p.A127A													.	.			0			c.G381T												1.0	2.0	1.0					5																	17275706		1089	2424	3513	SO:0001819	synonymous_variant	10409	exon2			CGCCGCGGCCCCG	AF039656	CCDS3888.1	5p15.1	2010-12-03			ENSG00000176788	ENSG00000176788			957	protein-coding gene	gene with protein product		605940				9310187, 9749536	Standard	NM_001271606		Approved	NAP-22, NAP22, CAP23, CAP-23	uc031siz.1	P80723	OTTHUMG00000131061	ENST00000322611.3:c.381G>T	5.37:g.17275706G>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_006317	4	0.00	0	B4DJA8|D3DTD5|O43596|Q5U0S0|Q9BWA5	Silent	SNP	ENST00000322611.3	37	CCDS3888.1																																																																																					0.776	BASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253716.2			
MEGF10	84466	mdanderson.org	37	5	126792994	126792994	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr5:126792994G>T	ENST00000274473.6	+	26	3674	c.3407G>T	c.(3406-3408)aGc>aTc	p.S1136I	MEGF10_ENST00000503335.2_Missense_Mutation_p.S1136I	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1136	Necessary for formation of large intracellular vacuoles.|Ser-rich.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		agcaacagcagcagcagcagT	0.507																																					p.S1136I													.	.			0			c.G3407T												67.0	56.0	60.0					5																	126792994		2203	4300	6503	SO:0001583	missense	84466	exon25			ACAGCAGCAGCAG	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3407G>T	5.37:g.126792994G>T	ENSP00000274473:p.Ser1136Ile		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001256545	0		0	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609030	0.28623	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.80393	-1.37;-1.37	5.28	4.42	0.53409	.	0.497156	0.18042	N	0.153577	T	0.62454	0.2429	N	0.08118	0	0.24991	N	0.991536	B	0.12013	0.005	B	0.09377	0.004	T	0.56902	-0.7902	10	0.72032	D	0.01	-2.4345	8.6505	0.34031	0.1387:0.0:0.7358:0.1255	.	1136	Q96KG7	MEG10_HUMAN	I	1136	ENSP00000423354:S1136I;ENSP00000274473:S1136I	ENSP00000274473:S1136I	S	+	2	0	MEGF10	126820893	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	0.923000	0.28757	1.562000	0.49601	0.650000	0.86243	AGC			0.507	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250973.2		NM_032446	
PCDHA13	56136	mdanderson.org	37	5	140263827	140263827	+	Silent	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr5:140263827G>T	ENST00000289272.2	+	1	1974	c.1974G>T	c.(1972-1974)gcG>gcT	p.A658A	PCDHA13_ENST00000409494.1_Silent_p.A658A|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	658	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAGCCCGCGCTGACGGCCA	0.697																																					p.A658A	Melanoma(147;1739 1852 5500 27947 37288)												.	.			0			c.G1974T												53.0	53.0	53.0					5																	140263827		2203	4298	6501	SO:0001819	synonymous_variant	56136	exon1			GCCCGCGCTGACG	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1974G>T	5.37:g.140263827G>T			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_031865	0		0	O75277	Silent	SNP	ENST00000289272.2	37	CCDS4240.1																																																																																					0.697	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335000.1		NM_018904	
FAF2	23197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	175875462	175875462	+	Silent	SNP	G	G	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr5:175875462G>A	ENST00000261942.6	+	1	107	c.54G>A	c.(52-54)ctG>ctA	p.L18L		NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2	18	UBA.				lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						AGAAGCTGCTGCAGTTTCAGG	0.627																																					p.L18L													.	.			0			c.G54A												38.0	37.0	37.0					5																	175875462		2195	4294	6489	SO:0001819	synonymous_variant	23197	exon1			GCTGCTGCAGTTT	BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.54G>A	5.37:g.175875462G>A			Somatic	77	0	0		WXS	Illumina HiSeq	.	68	0.25	17	NM_014613	13	0.54	7	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Silent	SNP	ENST00000261942.6	37	CCDS34296.1																																																																																					0.627	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372194.1		NM_014613	
BTN2A2	10385	hgsc.bcm.edu	37	6	26384092	26384092	+	Missense_Mutation	SNP	C	C	T	rs546542545		TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr6:26384092C>T	ENST00000356709.4	+	2	154	c.43C>T	c.(43-45)Ctc>Ttc	p.L15F	BTN2A2_ENST00000432533.2_Missense_Mutation_p.L15F|BTN2A2_ENST00000416795.2_Missense_Mutation_p.L15F|BTN2A2_ENST00000469230.1_Missense_Mutation_p.L15F|BTN2A2_ENST00000352867.2_Missense_Mutation_p.L15F|BTN2A2_ENST00000482536.1_Missense_Mutation_p.L15F	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	15					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						GCCAGCCTCcctcctcctcct	0.587																																					p.L15F													BTN2A2_ENST00000432533,bladder,carcinoma,-1,2	BTN2A2_ENST00000432533	-1	2	0			c.C43T												191.0	138.0	156.0					6																	26384092		2203	4300	6503	SO:0001583	missense	10385	exon2			GCCTCCCTCCTCC	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.43C>T	6.37:g.26384092C>T	ENSP00000349143:p.Leu15Phe		Somatic	87	0.0229885057	2		WXS	Illumina HiSeq	.	120	0.06	7	NM_181531	16	0.00	0	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	ENST00000356709.4	37	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	c	14.03	2.412871	0.42817	.	.	ENSG00000124508	ENST00000469230;ENST00000356709;ENST00000352867;ENST00000493275;ENST00000472507;ENST00000482536;ENST00000432533;ENST00000416795;ENST00000494184;ENST00000483410	T;T;T;T;T;T;D;T;T;T	0.90444	3.76;1.1;0.43;4.24;3.36;-0.21;-2.67;1.1;2.29;3.8	2.01	1.1	0.20463	.	0.656368	0.12607	N	0.454165	T	0.62085	0.2399	N	0.08118	0	0.21675	N	0.999591	B;B;B;B;B;B	0.24132	0.003;0.008;0.098;0.014;0.003;0.003	B;B;B;B;B;B	0.15052	0.002;0.003;0.012;0.006;0.002;0.002	T	0.57562	-0.7790	10	0.87932	D	0	.	4.8159	0.13367	0.0:0.8071:0.0:0.1929	.	15;15;15;15;15;15	E9PH07;B4DQ01;B4E3J1;Q8WVV5-2;A6NM84;Q8WVV5	.;.;.;.;.;BT2A2_HUMAN	F	15	ENSP00000417472:L15F;ENSP00000349143:L15F;ENSP00000337117:L15F;ENSP00000418857:L15F;ENSP00000419226:L15F;ENSP00000419451:L15F;ENSP00000394241:L15F;ENSP00000399308:L15F;ENSP00000417511:L15F;ENSP00000418176:L15F	ENSP00000337117:L15F	L	+	1	0	BTN2A2	26492071	0.000000	0.05858	0.368000	0.25939	0.580000	0.36256	-0.390000	0.07332	0.383000	0.24910	0.298000	0.19748	CTC			0.587	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040117.1			
MOCS1	4337	mdanderson.org	37	6	39881102	39881102	+	Missense_Mutation	SNP	A	A	G	rs7762875	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr6:39881102A>G	ENST00000340692.5	-	6	719	c.716T>C	c.(715-717)cTc>cCc	p.L239P	MOCS1_ENST00000432280.2_Missense_Mutation_p.L210P|MOCS1_ENST00000425303.2_Missense_Mutation_p.L239P|MOCS1_ENST00000373186.4_Missense_Mutation_p.L239P|MOCS1_ENST00000308559.7_Missense_Mutation_p.L239P|MOCS1_ENST00000373188.2_Missense_Mutation_p.L239P|MOCS1_ENST00000373175.4_Missense_Mutation_p.L210P|MOCS1_ENST00000373195.3_Missense_Mutation_p.L152P			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	239	Molybdenum cofactor biosynthesis protein A.			L -> H (in Ref. 2; AAB87523). {ECO:0000305}.	Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					ATCCAGGGGGAGGCCCTCAGT	0.582																																					p.L239P	NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)												.	.			0			c.T716C												105.0	92.0	97.0					6																	39881102		2203	4300	6503	SO:0001583	missense	4337	exon6			AGGGGGAGGCCCT	AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.716T>C	6.37:g.39881102A>G	ENSP00000344794:p.Leu239Pro		Somatic	107	0.0093457944	1		WXS	Illumina HiSeq	Phase_I	93	0.05	5	NM_001075098	15	0.00	0	B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	ENST00000340692.5	37		.	.	.	.	.	.	.	.	.	.	A	12.01	1.810691	0.32053	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000373195;ENST00000340692;ENST00000425303;ENST00000432280	T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	4.68	4.68	0.58851	Elongator protein 3/MiaB/NifB (1);Aldolase-type TIM barrel (1);	0.143616	0.47455	D	0.000232	T	0.28433	0.0703	L	0.48935	1.535	0.58432	D	0.999998	D;P;P;P;P	0.53312	0.959;0.823;0.932;0.886;0.713	P;P;B;P;P	0.49561	0.615;0.477;0.411;0.615;0.477	T	0.08066	-1.0740	9	.	.	.	-20.4487	8.3884	0.32514	0.6999:0.0:0.0:0.3001	.	239;239;239;239;239	Q9NZB8-2;Q9NZB8-5;Q9NZB8;Q9NZB8-8;Q9NZB8-6	.;.;MOCS1_HUMAN;.;.	P	239;239;210;239;152;239;239;210	ENSP00000362282:L239P;ENSP00000309843:L239P;ENSP00000362270:L210P;ENSP00000362284:L239P;ENSP00000362291:L152P;ENSP00000344794:L239P;ENSP00000416478:L239P;ENSP00000410809:L210P	.	L	-	2	0	MOCS1	39989080	1.000000	0.71417	0.977000	0.42913	0.097000	0.18754	4.363000	0.59473	1.760000	0.52011	0.533000	0.62120	CTC			0.582	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000040476.2		NM_005943	
TTK	7272	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	80747723	80747723	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr6:80747723G>A	ENST00000369798.2	+	18	2200	c.2089G>A	c.(2089-2091)Gat>Aat	p.D697N	TTK_ENST00000509894.1_Missense_Mutation_p.D696N|TTK_ENST00000230510.3_Missense_Mutation_p.D696N	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	697	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.D681Y(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AGCAATCAAAGATATGTCTTC	0.333																																					p.D697N													TTK,NS,NS,0,1	TTK	0	1	1	Substitution - Missense(1)	pancreas(1)	c.G2089A												59.0	58.0	58.0					6																	80747723		2203	4298	6501	SO:0001583	missense	7272	exon18			ATCAAAGATATGT		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2089G>A	6.37:g.80747723G>A	ENSP00000358813:p.Asp697Asn		Somatic	225	0.0088888889	2		WXS	Illumina HiSeq	.	218	0.09	19	NM_003318	230	0.29	66	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432389	0.62844	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.73363	-0.74;-0.74;-0.74	5.77	4.0	0.46444	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.11131	0.1	0.80722	D	1	D;D	0.65815	0.995;0.987	D;P	0.68039	0.955;0.908	T	0.71537	-0.4563	10	0.59425	D	0.04	.	11.8763	0.52550	0.141:0.0:0.859:0.0	.	697;696	P33981;A8K8U5	TTK_HUMAN;.	N	696;696;697	ENSP00000422936:D696N;ENSP00000230510:D696N;ENSP00000358813:D697N	ENSP00000230510:D696N	D	+	1	0	TTK	80804442	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.909000	0.92647	0.906000	0.36621	0.655000	0.94253	GAT			0.333	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000041316.2			
Unknown	0	bcgsc.ca	37	7	55004383	55004383	+	IGR	SNP	C	C	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr7:55004383C>T								SNORA73 (70666 upstream) : EGFR (82330 downstream)																							ACCTAGTGACCATTCCAGATA	0.423																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AGTGACCATTCCA																													7.37:g.55004383C>T			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_1	68	0.09	6	.	0		0		RNA	SNP		37																																																																																					0	0.423										
CUX1	1523	broad.mit.edu	37	7	101882800	101882800	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr7:101882800G>T	ENST00000292535.7	+	23	3861	c.3823G>T	c.(3823-3825)Gaa>Taa	p.E1275*	CUX1_ENST00000546411.2_Nonsense_Mutation_p.E1173*|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000549414.2_Nonsense_Mutation_p.E1253*|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000550008.2_Nonsense_Mutation_p.E1219*|CUX1_ENST00000425244.2_Intron|AC005088.1_ENST00000580604.1_RNA|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000360264.3_Nonsense_Mutation_p.E1286*|CUX1_ENST00000556210.1_Nonsense_Mutation_p.E1117*|CUX1_ENST00000437600.4_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1275					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AAAAACCATCGAAGACCTCGC	0.597																																					p.E1286X													.	CUX1	253		0			c.G3856T												129.0	127.0	128.0					7																	101882800		2203	4300	6503	SO:0001587	stop_gained	1523	exon23			ACCATCGAAGACC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3823G>T	7.37:g.101882800G>T	ENSP00000292535:p.Glu1275*		Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	244	0.03	7	NM_001202543	21	0.00	0	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Nonsense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	G	42	9.174002	0.99089	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.4455	18.3291	0.90262	0.0:0.0:1.0:0.0	.	.	.	.	X	1286;1275;1253;1219;1173;1117	.	ENSP00000292535:E1275X	E	+	1	0	CUX1	101669520	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.749000	0.98871	2.324000	0.78689	0.655000	0.94253	GAA			0.597	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000347535.1		NM_001913	
KLHDC10	23008	mdanderson.org	37	7	129710491	129710491	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr7:129710491C>T	ENST00000335420.5	+	1	142	c.8C>T	c.(7-9)gCc>gTc	p.A3V		NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	3						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						GTCATGTCGGCCGCCCAgggc	0.756																																					p.A3V													.	.			0			c.C8T												3.0	4.0	4.0					7																	129710491		1624	3484	5108	SO:0001583	missense	23008	exon1			TGTCGGCCGCCCA		CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.8C>T	7.37:g.129710491C>T	ENSP00000334140:p.Ala3Val		Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_014997	0		0	Q86Y99|Q92554	Missense_Mutation	SNP	ENST00000335420.5	37	CCDS5815.1	.	.	.	.	.	.	.	.	.	.	C	31	5.061436	0.93846	.	.	ENSG00000128607	ENST00000335420;ENST00000463413	T;T	0.31247	2.78;1.5	5.52	5.52	0.82312	.	0.237546	0.28322	N	0.015777	T	0.20007	0.0481	N	0.08118	0	0.31773	N	0.631874	P	0.41232	0.743	B	0.40534	0.332	T	0.15838	-1.0423	10	0.59425	D	0.04	-4.9525	14.9142	0.70781	0.0:1.0:0.0:0.0	.	3	Q6PID8	KLD10_HUMAN	V	3	ENSP00000334140:A3V;ENSP00000420083:A3V	ENSP00000334140:A3V	A	+	2	0	KLHDC10	129497727	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.424000	0.52764	2.579000	0.87056	0.591000	0.81541	GCC			0.756	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349347.2			
Unknown	0	bcgsc.ca	37	8	13880458	13880458	+	IGR	SNP	A	A	T	rs148780946	byFrequency	TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr8:13880458A>T								RP11-480O10.1 (173840 upstream) : SGCZ (66914 downstream)																							TTTGGAACTGATTTTTTGTTC	0.368																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GAACTGATTTTTT																													8.37:g.13880458A>T			Somatic	154	0.0064935065	1		WXS	Illumina HiSeq	Phase_1	175	0.25	43	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.368										
MTFR1	9650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	66605961	66605961	+	Missense_Mutation	SNP	C	C	A			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr8:66605961C>A	ENST00000262146.4	+	4	374	c.248C>A	c.(247-249)gCc>gAc	p.A83D	MTFR1_ENST00000517944.1_3'UTR|MTFR1_ENST00000458689.2_Missense_Mutation_p.A50D	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	83					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			GGATGGGTAGCCAAAGAAGAA	0.408																																					p.A83D													.	.			0			c.C248A												97.0	85.0	89.0					8																	66605961		2203	4300	6503	SO:0001583	missense	9650	exon4			GGGTAGCCAAAGA		CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.248C>A	8.37:g.66605961C>A	ENSP00000262146:p.Ala83Asp		Somatic	135	0	0		WXS	Illumina HiSeq	.	204	0.25	52	NM_014637	125	0.36	45	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	ENST00000262146.4	37	CCDS6182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.58|16.58	3.163108|3.163108	0.57476|0.57476	.|.	.|.	ENSG00000066855|ENSG00000066855	ENST00000262146;ENST00000458689|ENST00000518800	T;T|.	0.55052|.	0.54;0.54|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.046760|.	0.85682|.	D|.	0.000000|.	T|T	0.69441|0.69441	0.3111|0.3111	L|L	0.52573|0.52573	1.65|1.65	0.51233|0.51233	D|D	0.999915|0.999915	B;P;D|.	0.76494|.	0.211;0.837;0.999|.	B;P;D|.	0.79784|.	0.208;0.532;0.993|.	T|T	0.65319|0.65319	-0.6197|-0.6197	9|5	.|.	.|.	.|.	-3.5701|-3.5701	16.8389|16.8389	0.85963|0.85963	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	83;50;83|.	B4E3G8;E7EP84;Q15390|.	.;.;MTFR1_HUMAN|.	D|T	83;50|41	ENSP00000262146:A83D;ENSP00000391502:A50D|.	.|.	A|P	+|+	2|1	0|0	MTFR1|MTFR1	66768515|66768515	0.994000|0.994000	0.37717|0.37717	0.994000|0.994000	0.49952|0.49952	0.260000|0.260000	0.26232|0.26232	4.100000|4.100000	0.57762|0.57762	2.747000|2.747000	0.94245|0.94245	0.585000|0.585000	0.79938|0.79938	GCC|CCA			0.408	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378894.1		NM_014637	
ESRP1	54845	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	95655639	95655639	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr8:95655639A>G	ENST00000433389.2	+	3	560	c.370A>G	c.(370-372)Aag>Gag	p.K124E	ESRP1_ENST00000358397.5_Missense_Mutation_p.K124E|ESRP1_ENST00000454170.2_Missense_Mutation_p.K124E|ESRP1_ENST00000423620.2_Missense_Mutation_p.K124E	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	124					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TGAGGCTTCCAAGAAGGTAAG	0.433																																					p.K124E													.	ESRP1	148		0			c.A370G												69.0	66.0	67.0					8																	95655639		1870	4103	5973	SO:0001583	missense	54845	exon3			GCTTCCAAGAAGG	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.370A>G	8.37:g.95655639A>G	ENSP00000405738:p.Lys124Glu		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	74	0.08	6	NM_001122827	28	0.21	6	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.156745	0.78114	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.89	5.89	0.94794	Ribonuclease H-like (1);	0.084182	0.85682	D	0.000000	T	0.50548	0.1622	L	0.50333	1.59	0.50467	D	0.999877	P;P;P;P;P	0.45902	0.855;0.696;0.791;0.868;0.82	P;B;B;P;P	0.50405	0.64;0.356;0.297;0.492;0.496	T	0.48864	-0.8997	10	0.51188	T	0.08	-18.9006	16.3158	0.82923	1.0:0.0:0.0:0.0	.	124;124;124;124;124	Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.;.;.;.;ESRP1_HUMAN	E	124	ENSP00000407349:K124E;ENSP00000405738:K124E;ENSP00000351168:K124E;ENSP00000402766:K124E	ENSP00000351168:K124E	K	+	1	0	ESRP1	95724815	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.152000	0.89638	2.254000	0.74563	0.533000	0.62120	AAG			0.433	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379326.1		NM_017697	
GDF6	392255	broad.mit.edu	37	8	97157410	97157411	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr8:97157410_97157411delCG	ENST00000287020.5	-	2	847_848	c.748_749delCG	c.(748-750)cggfs	p.R250fs		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	250					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					CTGGGGTCCCCGCGCGCGCGCC	0.757																																					p.250_250del													.	GDF6	57		0			c.748_749del									3,1577		1,1,788						0.6	0.0			2	16,3758		3,10,1874	no	frameshift	GDF6	NM_001001557.2		4,11,2662	A1A1,A1R,RR		0.424,0.1899,0.3549				19,5335				SO:0001589	frameshift_variant	392255	exon2			GGTCCCCGCGCGC		CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.748_749delCG	8.37:g.97157418_97157419delCG	ENSP00000287020:p.Arg250fs		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	NM_001001557	0		0	Q6PI58	Frame_Shift_Del	DEL	ENST00000287020.5	37	CCDS34926.1																																																																																					0.757	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379862.2		NM_001001557	
KCNS2	3788	mdanderson.org	37	8	99441319	99441319	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr8:99441319G>T	ENST00000287042.4	+	2	1462	c.1112G>T	c.(1111-1113)aGt>aTt	p.S371I	KCNS2_ENST00000521839.1_Missense_Mutation_p.S371I	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	371					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			GCTACCGTCAGTATGACCACA	0.612																																					p.S371I	Pancreas(138;844 2489 9202 24627)												.	.			0			c.G1112T												85.0	79.0	81.0					8																	99441319		2203	4300	6503	SO:0001583	missense	3788	exon2			CCGTCAGTATGAC	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.1112G>T	8.37:g.99441319G>T	ENSP00000287042:p.Ser371Ile		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_020697	0		0	A8KAN1	Missense_Mutation	SNP	ENST00000287042.4	37	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129493	0.77549	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	D;D	0.97598	-4.45;-4.45	6.07	6.07	0.98685	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98934	0.9638	M	0.92738	3.34	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.99150	1.0858	10	0.87932	D	0	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	371	Q9ULS6	KCNS2_HUMAN	I	371	ENSP00000287042:S371I;ENSP00000430712:S371I	ENSP00000287042:S371I	S	+	2	0	KCNS2	99510495	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	AGT			0.612	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103134.1		NM_020697	
SHB	6461	mdanderson.org	37	9	38068265	38068265	+	Silent	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr9:38068265G>T	ENST00000377707.3	-	1	943	c.378C>A	c.(376-378)cgC>cgA	p.R126R	SHB_ENST00000377700.4_Silent_p.R126R|RP11-613M10.9_ENST00000540557.1_Silent_p.R126R	NM_003028.2	NP_003019.2	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein B	126	Mediates interaction with LAT, PTK2/FAK1, JAK1 and JAK3.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(4)|lung(1)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)	11		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		CCGAGAAGGCGCGCTGGACCC	0.766																																					p.R126R													.	.			0			c.C378A												2.0	2.0	2.0					9																	38068265		1171	2841	4012	SO:0001819	synonymous_variant	6461	exon1			GAAGGCGCGCTGG		CCDS43806.1	9p13.2	2013-09-23	2005-05-24		ENSG00000107338	ENSG00000107338		"""SH2 domain containing"""	10838	protein-coding gene	gene with protein product		600314	"""SHB adaptor protein (a Src homology 2 protein)"", ""SHB (Src homology 2 domain containing) adaptor protein B"""			7713524	Standard	NM_003028		Approved		uc004aax.3	Q15464	OTTHUMG00000019936	ENST00000377707.3:c.378C>A	9.37:g.38068265G>T			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_003028	1	0.00	0	B9EGM0|D3DRQ5|Q504U5|Q5VUM8	Silent	SNP	ENST00000377707.3	37	CCDS43806.1																																																																																					0.766	SHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052490.1			
TMC1	117531	broad.mit.edu	37	9	75420368	75420368	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr9:75420368G>T	ENST00000297784.5	+	18	2177	c.1637G>T	c.(1636-1638)aGg>aTg	p.R546M	TMC1_ENST00000340019.3_Missense_Mutation_p.R546M|TMC1_ENST00000486417.1_3'UTR|TMC1_ENST00000396237.3_Missense_Mutation_p.R546M	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	546					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						GACTTTCTAAGGGCATGTTTT	0.363																																					p.R546M	Pancreas(75;173 1345 14232 34245 43413)												.	TMC1	87		0			c.G1637T												272.0	265.0	267.0					9																	75420368		2203	4300	6503	SO:0001583	missense	117531	exon18			TTCTAAGGGCATG	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1637G>T	9.37:g.75420368G>T	ENSP00000297784:p.Arg546Met		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	146	0.03	5	NM_138691	4	0.00	0	A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	37	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921709	0.73213	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.70164	-0.46;-0.46;-0.46	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.82838	0.5124	M	0.89287	3.02	0.31064	N	0.713748	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.79108	0.986;0.986;0.992	D	0.84882	0.0831	10	0.87932	D	0	-20.6799	10.6389	0.45582	0.1416:0.0:0.8584:0.0	.	513;513;546	A5D8Y1;A4FUA6;Q8TDI8	.;.;TMC1_HUMAN	M	546;546;513;513;513;540;546	ENSP00000297784:R546M;ENSP00000341433:R546M;ENSP00000379538:R546M	ENSP00000297784:R546M	R	+	2	0	TMC1	74610188	0.998000	0.40836	0.841000	0.33234	0.874000	0.50279	6.355000	0.73041	2.809000	0.96659	0.467000	0.42956	AGG			0.363	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052655.1			
SYK	6850	broad.mit.edu	37	9	93637110	93637110	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr9:93637110A>G	ENST00000375754.4	+	9	1308	c.1160A>G	c.(1159-1161)aAg>aGg	p.K387R	SYK_ENST00000375746.1_Missense_Mutation_p.K387R|SYK_ENST00000375747.1_Missense_Mutation_p.K364R|SYK_ENST00000375751.4_Missense_Mutation_p.K364R	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	387	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						ACTGTGAAAAAGGGCTACTAC	0.473			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																p.K387R				Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	SYK,rectum,carcinoma,-1,1	SYK	132	1	0			c.A1160G												104.0	111.0	109.0					9																	93637110		2203	4300	6503	SO:0001583	missense	6850	exon9			TGAAAAAGGGCTA	L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.1160A>G	9.37:g.93637110A>G	ENSP00000364907:p.Lys387Arg		Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_I	103	0.04	4	NM_003177	14	0.00	0		Missense_Mutation	SNP	ENST00000375754.4	37	CCDS6688.1	.	.	.	.	.	.	.	.	.	.	A	11.74	1.727334	0.30593	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	4.29	3.16	0.36331	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.181985	0.47455	D	0.000235	T	0.41073	0.1143	N	0.12961	0.28	0.49389	D	0.999789	B;B	0.19073	0.005;0.033	B;B	0.24394	0.02;0.053	T	0.21449	-1.0245	10	0.17832	T	0.49	.	10.1865	0.43000	0.9166:0.0:0.0834:0.0	.	364;387	P43405-2;P43405	.;KSYK_HUMAN	R	387;364;364;387	ENSP00000364907:K387R;ENSP00000364904:K364R;ENSP00000364899:K364R;ENSP00000364898:K387R	ENSP00000364898:K387R	K	+	2	0	SYK	92676931	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.598000	0.61069	1.934000	0.56057	0.533000	0.62120	AAG			0.473	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000053018.1			
LAMC3	10319	mdanderson.org	37	9	133884953	133884953	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chr9:133884953G>T	ENST00000361069.4	+	1	485	c.352G>T	c.(352-354)Gtc>Ttc	p.V118F	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	118	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCCCACCTCGGTCAACATCAC	0.682																																					p.V118F													.	.			0			c.G352T												15.0	10.0	12.0					9																	133884953		2156	4253	6409	SO:0001583	missense	10319	exon1			ACCTCGGTCAACA	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.352G>T	9.37:g.133884953G>T	ENSP00000354360:p.Val118Phe		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	47	0.09	4	NM_006059	7	0.00	0	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734754	0.69189	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.81078	-1.45	3.64	3.64	0.41730	Laminin, N-terminal (3);	0.000000	0.64402	D	0.000001	D	0.91314	0.7261	H	0.95950	3.745	0.53005	D	0.999963	D	0.76494	0.999	D	0.72075	0.976	D	0.91805	0.5455	10	0.87932	D	0	.	8.4018	0.32590	0.1122:0.0:0.8877:0.0	.	118	Q9Y6N6	LAMC3_HUMAN	F	118	ENSP00000354360:V118F	ENSP00000325873:V118F	V	+	1	0	LAMC3	132874774	0.997000	0.39634	0.999000	0.59377	0.547000	0.35210	2.554000	0.45845	1.551000	0.49450	0.313000	0.20887	GTC			0.682	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054717.3		NM_006059	
KLHL34	257240	mdanderson.org	37	X	21675219	21675219	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chrX:21675219C>T	ENST00000379499.2	-	1	1229	c.688G>A	c.(688-690)Gcc>Acc	p.A230T		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	230	BACK.					extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						AGTACGTCGGCGGGAACCAGG	0.662																																					p.A230T													.	.			0			c.G688A												18.0	16.0	17.0					X																	21675219		2198	4287	6485	SO:0001583	missense	257240	exon1			CGTCGGCGGGAAC	AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.688G>A	X.37:g.21675219C>T	ENSP00000368813:p.Ala230Thr		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_153270	0		0		Missense_Mutation	SNP	ENST00000379499.2	37	CCDS14199.1	.	.	.	.	.	.	.	.	.	.	C	1.782	-0.481753	0.04383	.	.	ENSG00000185915	ENST00000379499	T	0.68903	-0.36	4.65	1.67	0.24075	BTB/Kelch-associated (2);	0.472426	0.21996	N	0.066066	T	0.52661	0.1748	L	0.50333	1.59	0.09310	N	1	P	0.43412	0.806	B	0.33620	0.167	T	0.44682	-0.9312	10	0.41790	T	0.15	.	10.2094	0.43132	0.0:0.5608:0.3557:0.0835	.	230	Q8N239	KLH34_HUMAN	T	230	ENSP00000368813:A230T	ENSP00000368813:A230T	A	-	1	0	KLHL34	21585140	0.025000	0.19082	0.001000	0.08648	0.027000	0.11550	0.865000	0.27940	0.391000	0.25143	0.422000	0.28245	GCC			0.662	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056022.1		NM_153270	
PCYT1B	9468	mdanderson.org	37	X	24605360	24605360	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chrX:24605360G>T	ENST00000379144.2	-	5	693	c.563C>A	c.(562-564)gCa>gAa	p.A188E	PCYT1B_ENST00000356768.4_Missense_Mutation_p.A188E|PCYT1B_ENST00000379145.1_Missense_Mutation_p.A170E	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	188					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	TGCCTCACCTGCTTCCTTTAT	0.453																																					p.A188E													.	.			0			c.C563A												144.0	100.0	115.0					X																	24605360		2203	4300	6503	SO:0001583	missense	9468	exon5			TCACCTGCTTCCT	AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.563C>A	X.37:g.24605360G>T	ENSP00000368439:p.Ala188Glu		Somatic	29	0.0344827586	1		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001163265	0		0	A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	ENST00000379144.2	37	CCDS14213.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125635	0.56721	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.96774	-4.12;-4.12;-4.12	5.16	5.16	0.70880	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.93291	0.7862	L	0.39633	1.23	0.80722	D	1	B;B;P	0.35155	0.004;0.019;0.487	B;B;B	0.32393	0.018;0.021;0.145	D	0.92284	0.5836	10	0.26408	T	0.33	0.4578	17.8036	0.88595	0.0:0.0:1.0:0.0	.	188;170;188	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	E	170;188;188	ENSP00000368440:A170E;ENSP00000368439:A188E;ENSP00000349211:A188E	ENSP00000349211:A188E	A	-	2	0	PCYT1B	24515281	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.263000	0.95617	2.392000	0.81423	0.523000	0.50628	GCA			0.453	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056103.1		NM_004845	
RGAG1	57529	hgsc.bcm.edu;mdanderson.org	37	X	109694020	109694020	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chrX:109694020G>T	ENST00000465301.2	+	3	421	c.175G>T	c.(175-177)Gga>Tga	p.G59*	RGAG1_ENST00000540313.1_Nonsense_Mutation_p.G59*	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	59										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CTCAGACCCTGGAGGGACATC	0.493											OREG0019909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G59X													.	.			0			c.G175T												239.0	200.0	213.0					X																	109694020		2203	4300	6503	SO:0001587	stop_gained	57529	exon3			GACCCTGGAGGGA	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.175G>T	X.37:g.109694020G>T	ENSP00000419786:p.Gly59*		Somatic	94	0	0	1421	WXS	Illumina HiSeq	.	102	0.05	5	NM_020769	1	0.00	0	Q9P2M8	Nonsense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210791	0.39102	.	.	ENSG00000243978	ENST00000520821;ENST00000465301;ENST00000540313;ENST00000540483	.	.	.	4.16	4.16	0.48862	.	0.451157	0.16490	N	0.212145	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.7272	10.762	0.46270	0.0:0.0:1.0:0.0	.	.	.	.	X	59	.	.	G	+	1	0	RGAG1	109580676	0.998000	0.40836	0.255000	0.24374	0.134000	0.20937	3.210000	0.51129	2.302000	0.77476	0.600000	0.82982	GGA			0.493	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057906.2		NM_020769	
TKTL1	8277	broad.mit.edu;mdanderson.org	37	X	153540936	153540936	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AC-01A-11D-A435-10	TCGA-VF-A8AC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89c25d23-5322-45d9-9ac6-b3c110504481	47b52d7b-baa4-46ba-ac7c-c6cc2deaaaf7	g.chrX:153540936G>T	ENST00000369915.3	+	6	865	c.676G>T	c.(676-678)Gag>Tag	p.E226*	TKTL1_ENST00000369912.2_Nonsense_Mutation_p.E170*|TKTL1_ENST00000217905.7_Intron	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	226					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TACAGGTATTGAGGATGCAGA	0.403																																					p.E226X													.	TKTL1	61		0			c.G676T												102.0	87.0	92.0					X																	153540936		2203	4300	6503	SO:0001587	stop_gained	8277	exon6			GGTATTGAGGATG	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.676G>T	X.37:g.153540936G>T	ENSP00000358931:p.Glu226*		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	80	0.06	5	NM_012253	8	0.00	0	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Nonsense_Mutation	SNP	ENST00000369915.3	37	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952870	0.92660	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000369912	.	.	.	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-35.3718	15.1868	0.73009	0.0:0.0:1.0:0.0	.	.	.	.	X	226;170;170	.	ENSP00000358928:E170X	E	+	1	0	TKTL1	153194130	1.000000	0.71417	0.619000	0.29118	0.377000	0.30045	7.315000	0.78998	2.089000	0.63090	0.411000	0.27672	GAG			0.403	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058923.1		NM_012253	
