#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MIB2	142678	mdanderson.org	37	1	1562341	1562341	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr1:1562341C>T	ENST00000357210.4	+	10	1592	c.1376C>T	c.(1375-1377)gCc>gTc	p.A459V	MIB2_ENST00000504599.1_Missense_Mutation_p.A415V|MIB2_ENST00000378708.1_Missense_Mutation_p.A365V|MIB2_ENST00000520777.1_Missense_Mutation_p.A512V|MIB2_ENST00000505820.2_Missense_Mutation_p.A516V|MIB2_ENST00000360522.4_Missense_Mutation_p.A424V|MIB2_ENST00000355826.5_Missense_Mutation_p.A502V|MIB2_ENST00000378710.3_Missense_Mutation_p.A423V|MIB2_ENST00000518681.1_Missense_Mutation_p.A451V|MIB2_ENST00000378712.1_Missense_Mutation_p.A336V	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	459					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GAGGAGGATGCCAACCTGGAC	0.667																																					p.A516V													.	.			0			c.C1547T												32.0	37.0	35.0					1																	1562341		2139	4232	6371	SO:0001583	missense	142678	exon10			AGGATGCCAACCT	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.1376C>T	1.37:g.1562341C>T	ENSP00000349741:p.Ala459Val		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_080875	26	0.00	0	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Missense_Mutation	SNP	ENST00000357210.4	37		.	.	.	.	.	.	.	.	.	.	C	25.7	4.665519	0.88251	.	.	ENSG00000197530	ENST00000520777;ENST00000357210;ENST00000360522;ENST00000378710;ENST00000355826;ENST00000518681;ENST00000505820;ENST00000378712;ENST00000504599;ENST00000378708	T;T;T;T;T;T;T;T;T;T	0.67698	1.23;1.25;1.29;1.25;1.23;1.23;1.22;-0.28;1.24;1.25	4.59	4.59	0.56863	.	0.055265	0.64402	D	0.000001	T	0.70413	0.3221	L	0.50333	1.59	0.58432	D	0.999994	P;P;P;B;P;D;P	0.54047	0.58;0.892;0.848;0.444;0.939;0.964;0.63	P;P;P;B;P;P;B	0.51170	0.559;0.459;0.521;0.356;0.556;0.661;0.341	T	0.74822	-0.3534	10	0.62326	D	0.03	-4.2661	16.3867	0.83507	0.0:1.0:0.0:0.0	.	424;365;336;451;512;445;459	Q96AX9-5;F2Z2L2;B3KXY1;E9PHQ1;E9PGU1;Q96AX9-2;Q96AX9	.;.;.;.;.;.;MIB2_HUMAN	V	512;459;424;423;502;451;516;336;415;365	ENSP00000428660:A512V;ENSP00000349741:A459V;ENSP00000353713:A424V;ENSP00000367982:A423V;ENSP00000348081:A502V;ENSP00000428264:A451V;ENSP00000426103:A516V;ENSP00000367984:A336V;ENSP00000426128:A415V;ENSP00000367980:A365V	ENSP00000348081:A502V	A	+	2	0	MIB2	1552204	1.000000	0.71417	0.954000	0.39281	0.782000	0.44232	4.547000	0.60712	2.093000	0.63338	0.455000	0.32223	GCC			0.667	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_080875	
HSPG2	3339	mdanderson.org	37	1	22202511	22202511	+	Missense_Mutation	SNP	G	G	T	rs377016014		TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr1:22202511G>T	ENST00000374695.3	-	24	3107	c.3028C>A	c.(3028-3030)Cgc>Agc	p.R1010S		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1010	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACTGTGAAGCGCAGCTCTCCT	0.607																																					p.R1010S													HSPG2,NS,carcinoma,+1,1	HSPG2	1	1	0			c.C3028A												43.0	48.0	47.0					1																	22202511		2203	4300	6503	SO:0001583	missense	3339	exon24			TGAAGCGCAGCTC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3028C>A	1.37:g.22202511G>T	ENSP00000363827:p.Arg1010Ser		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_005529	0		0	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049245	0.55218	.	.	ENSG00000142798	ENST00000374695	T	0.34072	1.38	5.51	4.54	0.55810	Laminin B type IV (2);Laminin B, subgroup (1);	0.181461	0.26995	N	0.021453	T	0.38241	0.1033	L	0.41236	1.265	0.35079	D	0.763245	P	0.48503	0.911	P	0.48840	0.592	T	0.53401	-0.8444	10	0.72032	D	0.01	.	12.8054	0.57610	0.0:0.0:0.8357:0.1642	.	1010	P98160	PGBM_HUMAN	S	1010	ENSP00000363827:R1010S	ENSP00000363827:R1010S	R	-	1	0	HSPG2	22075098	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.645000	0.46621	2.586000	0.87340	0.561000	0.74099	CGC			0.607	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007598.1		NM_005529	
AIM1L	55057	mdanderson.org	37	1	26669371	26669371	+	5'UTR	SNP	C	C	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr1:26669371C>A	ENST00000308182.5	-	0	372				AIM1L_ENST00000527815.1_Missense_Mutation_p.W152C			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like								carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		CGTACAGCACCCAGCTGTGGG	0.597																																					p.W1026C													.	.			0			c.G3078T												58.0	55.0	56.0					1																	26669371		692	1591	2283	SO:0001623	5_prime_UTR_variant	55057	exon5			CAGCACCCAGCTG			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.-58G>T	1.37:g.26669371C>A			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001039775	0		0	B2RNG3|Q5T137|Q5T150	Missense_Mutation	SNP	ENST00000308182.5	37		.	.	.	.	.	.	.	.	.	.	C	20.4	3.981457	0.74474	.	.	ENSG00000176092	ENST00000527815	D	0.85702	-2.02	5.43	5.43	0.79202	.	.	.	.	.	D	0.94235	0.8149	M	0.92026	3.265	0.80722	D	1	.	.	.	.	.	.	D	0.95161	0.8281	7	0.87932	D	0	.	18.8456	0.92205	0.0:1.0:0.0:0.0	.	.	.	.	C	152	ENSP00000433931:W152C	ENSP00000433931:W152C	W	-	3	0	AIM1L	26541958	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	6.668000	0.74457	2.571000	0.86741	0.563000	0.77884	TGG			0.597	AIM1L-201	KNOWN	basic	protein_coding	protein_coding				NM_001039775.2	
MANEAL	149175	mdanderson.org	37	1	38260364	38260364	+	Silent	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr1:38260364G>T	ENST00000373045.6	+	1	891	c.510G>T	c.(508-510)gtG>gtT	p.V170V	MANEAL_ENST00000525897.1_5'Flank|MANEAL_ENST00000329006.5_5'Flank|MANEAL_ENST00000397631.3_Silent_p.V170V	NM_001113482.1	NP_001106954.1	Q5VSG8	MANEL_HUMAN	mannosidase, endo-alpha-like	170						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|liver(1)|lung(1)|prostate(3)	7	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ACCCCGAAGTGCTGCGGGAGC	0.716																																					p.V170V													.	.			0			c.G510T												15.0	18.0	17.0					1																	38260364		1702	3883	5585	SO:0001819	synonymous_variant	149175	exon1			CGAAGTGCTGCGG	AK055996	CCDS426.1, CCDS44110.1, CCDS44111.1	1p34.3	2008-02-05			ENSG00000185090	ENSG00000185090			26452	protein-coding gene	gene with protein product							Standard	NM_152496		Approved	FLJ31434	uc001cby.2	Q5VSG8	OTTHUMG00000004317	ENST00000373045.6:c.510G>T	1.37:g.38260364G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001113482	4	0.00	0	Q6DD86|Q6P497|Q8N5P8|Q96G55|Q96N42	Silent	SNP	ENST00000373045.6	37	CCDS44110.1																																																																																					0.716	MANEAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012469.2		NM_152496	
ANKRD35	148741	hgsc.bcm.edu;broad.mit.edu	37	1	145561847	145561847	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr1:145561847delC	ENST00000355594.4	+	10	1622	c.1535delC	c.(1534-1536)gctfs	p.A512fs		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	512										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCCCGGGGGGCTTTGTCAAGA	0.632																																					p.A512fs	Melanoma(9;127 754 22988 51047)												.	ANKRD35	96		0			c.1534delG												86.0	102.0	97.0					1																	145561847		2202	4299	6501	SO:0001589	frameshift_variant	148741	exon10			GGGGGGCTTTGTC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1535delC	1.37:g.145561847delC	ENSP00000347802:p.Ala512fs		Somatic	184	0	0		WXS	Illumina HiSeq	.	160	0.07	11	NM_144698	0		0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Frame_Shift_Del	DEL	ENST00000355594.4	37	CCDS919.1																																																																																					0.632	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000038515.1		NM_144698	
OR10K1	391109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158435624	158435624	+	Silent	SNP	C	C	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr1:158435624C>A	ENST00000289451.2	+	1	353	c.273C>A	c.(271-273)acC>acA	p.T91T		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T91T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					AGAAGAAGACCATTTCTTTCC	0.483																																					p.T91T													OR10K1,NS,carcinoma,0,1	OR10K1	0	1	1	Substitution - coding silent(1)	lung(1)	c.C273A												192.0	187.0	189.0					1																	158435624		2203	4298	6501	SO:0001819	synonymous_variant	391109	exon1			GAAGACCATTTCT	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.273C>A	1.37:g.158435624C>A			Somatic	175	0	0		WXS	Illumina HiSeq	.	174	0.06	11	NM_001004473	0		0	Q6IFS2	Silent	SNP	ENST00000289451.2	37	CCDS30897.1																																																																																					0.483	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046367.1			
CEP170	9859	broad.mit.edu;mdanderson.org	37	1	243354757	243354757	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr1:243354757G>A	ENST00000366542.1	-	8	722	c.671C>T	c.(670-672)gCa>gTa	p.A224V	CEP170_ENST00000366544.1_Missense_Mutation_p.A224V|CEP170_ENST00000366543.1_Missense_Mutation_p.A224V	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	224						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			ATTTGCAGCTGCAGATTGTTC	0.383																																					p.A224V													.	CEP170	153		0			c.C671T												12.0	9.0	10.0					1																	243354757		1693	3874	5567	SO:0001583	missense	9859	exon8			GCAGCTGCAGATT	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.671C>T	1.37:g.243354757G>A	ENSP00000355500:p.Ala224Val		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	46	0.09	4	NM_001042405	2	0.00	0	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	37	CCDS44339.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.69|15.69	2.907963|2.907963	0.52333|0.52333	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543;ENST00000424081|ENST00000336415	T;T;T|.	0.30981|.	1.51;1.51;1.51|.	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	0.336411|.	0.30850|.	N|.	0.008751|.	T|.	0.67021|.	0.2849|.	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	D;B;P|.	0.55385|.	0.971;0.07;0.893|.	P;B;B|.	0.56042|.	0.79;0.038;0.256|.	T|.	0.64127|.	-0.6480|.	10|.	0.39692|.	T|.	0.17|.	-11.1195|-11.1195	18.1223|18.1223	0.89576|0.89576	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	224;224;224|.	Q5SW79-3;Q5SW79-2;Q5SW79|.	.;.;CE170_HUMAN|.	V|X	224;224;224;122|126	ENSP00000355500:A224V;ENSP00000355502:A224V;ENSP00000355501:A224V|.	ENSP00000355500:A224V|.	A|Q	-|-	2|1	0|0	CEP170|CEP170	241421380|241421380	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.942000|4.942000	0.63547|0.63547	2.282000|2.282000	0.76494|0.76494	0.455000|0.455000	0.32223|0.32223	GCA|CAG			0.383	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096178.2		NM_014812	
ADARB2	105	hgsc.bcm.edu	37	10	1578004	1578004	+	Intron	SNP	T	T	C			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr10:1578004T>C	ENST00000381312.1	-	2	426				ADARB2-AS1_ENST00000381301.3_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)						mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GGCCCTGAGTTCCCTTGCCCC	0.622																																					.													.	.			0			.																																									SO:0001627	intron_variant	642394	.			CTGAGTTCCCTTG	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.101-156649A>G	10.37:g.1578004T>C			Somatic	104	0	0		WXS	Illumina HiSeq	.	137	0.04	6	.	0		0	B2RPJ5|Q5VUT6|Q5VW42	RNA	SNP	ENST00000381312.1	37	CCDS7058.1																																																																																					0.622	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046426.1		NM_018702	
NPFFR1	64106	mdanderson.org	37	10	72015064	72015064	+	Silent	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr10:72015064C>T	ENST00000277942.6	-	4	941	c.942G>A	c.(940-942)gcG>gcA	p.A314A		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	314					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						CCAGCCAGTGCGCGAAGGGGA	0.672																																					p.A314A													.	.			0			c.G942A																																									SO:0001819	synonymous_variant	64106	exon4			CCAGTGCGCGAAG	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.942G>A	10.37:g.72015064C>T			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_022146	0		0	A2RRF0|Q8NGR0|Q96RN3	Silent	SNP	ENST00000277942.6	37	CCDS53539.1																																																																																					0.672	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048504.2		NM_022146	
PDCD11	22984	broad.mit.edu	37	10	105174894	105174894	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr10:105174894G>T	ENST00000369797.3	+	12	1598	c.1504G>T	c.(1504-1506)Gag>Tag	p.E502*		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	502	S1 motif 5. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CATCGGGGATGAGGTCAAGTG	0.542																																					p.E502X													.	PDCD11	160		0			c.G1504T												73.0	68.0	69.0					10																	105174894		2203	4300	6503	SO:0001587	stop_gained	22984	exon12			GGGGATGAGGTCA	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1504G>T	10.37:g.105174894G>T	ENSP00000358812:p.Glu502*		Somatic	330	0	0		WXS	Illumina HiSeq	Phase_I	286	0.02	6	NM_014976	5	0.00	0	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Nonsense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669271	0.88348	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	.	.	.	5.35	5.35	0.76521	.	0.049934	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-34.0646	8.6349	0.33941	0.0759:0.0:0.7717:0.1525	.	.	.	.	X	502	.	ENSP00000358812:E502X	E	+	1	0	PDCD11	105164884	1.000000	0.71417	0.989000	0.46669	0.064000	0.16182	4.487000	0.60293	2.681000	0.91329	0.643000	0.83706	GAG			0.542	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050151.1			
DUSP5	1847	hgsc.bcm.edu	37	10	112270021	112270021	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr10:112270021G>T	ENST00000369583.3	+	4	1276	c.992G>T	c.(991-993)gGg>gTg	p.G331V	DUSP5_ENST00000468749.1_3'UTR	NM_004419.3	NP_004410.3	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	331	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			kidney(2)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	13		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		TCCTGCCAAGGGGAGGCAGCA	0.617																																					p.G331V													.	.			0			c.G992T												39.0	39.0	39.0					10																	112270021		2203	4300	6503	SO:0001583	missense	1847	exon4			GCCAAGGGGAGGC	U16996	CCDS7566.1	10q25	2011-06-09			ENSG00000138166	ENSG00000138166		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3071	protein-coding gene	gene with protein product		603069				7806236	Standard	NM_004419		Approved	HVH3	uc001kzd.3	Q16690	OTTHUMG00000019040	ENST00000369583.3:c.992G>T	10.37:g.112270021G>T	ENSP00000358596:p.Gly331Val		Somatic	113	0	0		WXS	Illumina HiSeq	.	90	0.06	5	NM_004419	15	0.00	0	Q12997|Q5T603	Missense_Mutation	SNP	ENST00000369583.3	37	CCDS7566.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.491555	0.26774	.	.	ENSG00000138166	ENST00000369583	T	0.28666	1.6	5.86	5.86	0.93980	.	0.325307	0.36338	N	0.002644	T	0.11495	0.0280	N	0.00841	-1.15	0.47374	D	0.999407	P	0.35077	0.483	B	0.30251	0.113	T	0.31503	-0.9941	10	0.41790	T	0.15	.	16.2737	0.82632	0.0:0.1323:0.8677:0.0	.	331	Q16690	DUS5_HUMAN	V	331	ENSP00000358596:G331V	ENSP00000358596:G331V	G	+	2	0	DUSP5	112260011	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	4.333000	0.59285	2.778000	0.95560	0.655000	0.94253	GGG			0.617	DUSP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050333.1		NM_004419	
NRAP	4892	hgsc.bcm.edu	37	10	115356933	115356933	+	Missense_Mutation	SNP	C	C	T	rs373953176		TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr10:115356933C>T	ENST00000359988.3	-	37	4587	c.4343G>A	c.(4342-4344)cGt>cAt	p.R1448H	NRAP_ENST00000369360.3_Missense_Mutation_p.R1421H|NRAP_ENST00000360478.3_Missense_Mutation_p.R1413H|NRAP_ENST00000369358.4_Missense_Mutation_p.R1456H	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGGTTTTTTACGGTACTTGGT	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		21521	0.0		0.0	False		,,,				2504	0.001				p.R1448H													NRAP,uveal_tract,malignant_melanoma,-1,1	NRAP	-1	1	0			c.G4343A							C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	274.0	248.0	257.0		4238,4343	6.0	1.0	10		257	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	NRAP	NM_006175.3,NM_198060.2	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	1413/1696,1448/1731	115356933	2,13004	2203	4300	6503	SO:0001583	missense	4892	exon37			TTTTTACGGTACT		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.4343G>A	10.37:g.115356933C>T	ENSP00000353078:p.Arg1448His		Somatic	99	0	0		WXS	Illumina HiSeq	.	85	0.05	4	NM_001261463	0		0		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	33	5.221215	0.95139	0.0	2.33E-4	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350	T;T;T;T	0.24151	2.17;2.24;1.95;1.87	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.58250	0.2109	M	0.84156	2.68	0.58432	D	0.999999	B;D;D;D	0.89917	0.414;1.0;1.0;1.0	B;D;D;D	0.76071	0.125;0.97;0.987;0.97	T	0.60596	-0.7232	10	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	606;1448;1413;1448	B1ANW7;A0AVL2;Q86VF7-4;Q86VF7	.;.;.;NRAP_HUMAN	H	1456;1421;1448;1413;606	ENSP00000358365:R1456H;ENSP00000358367:R1421H;ENSP00000353078:R1448H;ENSP00000353666:R1413H	ENSP00000353078:R1448H	R	-	2	0	NRAP	115346923	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	5.631000	0.67812	2.840000	0.97914	0.655000	0.94253	CGT			0.448	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050425.2		NM_006175	
PHF21A	51317	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46001326	46001326	+	Silent	SNP	G	G	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr11:46001326G>A	ENST00000418153.2	-	6	544	c.345C>T	c.(343-345)aaC>aaT	p.N115N	PHF21A_ENST00000323180.6_Silent_p.N115N|PHF21A_ENST00000257821.4_Silent_p.N115N			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	115					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						AAGCAGTCAGGTTGGGAGAGg	0.498																																					p.N115N													.	PHF21A	107		0			c.C345T												218.0	177.0	191.0					11																	46001326		2202	4299	6501	SO:0001819	synonymous_variant	51317	exon6			AGTCAGGTTGGGA	AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.345C>T	11.37:g.46001326G>A			Somatic	119	0.0168067227	2		WXS	Illumina HiSeq	Phase_I	96	0.18	17	NM_016621	7	0.43	3	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Silent	SNP	ENST00000418153.2	37	CCDS44578.1																																																																																					0.498	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000392583.1		NM_016621	
DAK	26007	mdanderson.org	37	11	61113960	61113960	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr11:61113960G>T	ENST00000394900.3	+	18	1942	c.1713G>T	c.(1711-1713)gaG>gaT	p.E571D	CYB561A3_ENST00000540317.1_5'Flank	NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	571	DhaL. {ECO:0000255|PROSITE- ProRule:PRU00813}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						CCATCTTGGAGGTCTTGCAGA	0.617																																					p.E571D													.	.			0			c.G1713T												83.0	93.0	90.0					11																	61113960		2203	4299	6502	SO:0001583	missense	26007	exon18			CTTGGAGGTCTTG		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.1713G>T	11.37:g.61113960G>T	ENSP00000378360:p.Glu571Asp		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_015533	44	0.00	0	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291167	0.40494	.	.	ENSG00000149476	ENST00000394900	T	0.32023	1.47	5.67	4.76	0.60689	Dak phosphatase (2);	0.097975	0.64402	D	0.000001	T	0.14614	0.0353	N	0.05050	-0.12	0.41956	D	0.990681	B	0.25235	0.121	B	0.26416	0.069	T	0.11941	-1.0567	10	0.17369	T	0.5	.	10.1208	0.42618	0.1532:0.0:0.8468:0.0	.	571	Q3LXA3	DHAK_HUMAN	D	571	ENSP00000378360:E571D	ENSP00000378360:E571D	E	+	3	2	DAK	60870536	1.000000	0.71417	0.987000	0.45799	0.754000	0.42855	1.416000	0.34759	1.413000	0.46997	0.561000	0.74099	GAG			0.617	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394425.4		NM_015533	
NXF1	10482	broad.mit.edu;mdanderson.org	37	11	62568854	62568854	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr11:62568854G>T	ENST00000532297.1	-	9	1374	c.745C>A	c.(745-747)Cgc>Agc	p.R249S	NXF1_ENST00000439713.2_Missense_Mutation_p.R249S|NXF1_ENST00000294172.2_Missense_Mutation_p.R249S|NXF1_ENST00000531709.2_Missense_Mutation_p.R249S|NXF1_ENST00000531131.1_Missense_Mutation_p.R112S			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	249					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAGCTTCTGCGATTCAGGACA	0.507																																					p.R249S													NXF1,mucosal,malignant_melanoma,0,1	NXF1	67	1	0			c.C745A												84.0	72.0	76.0					11																	62568854		2201	4299	6500	SO:0001583	missense	10482	exon8			TTCTGCGATTCAG	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.745C>A	11.37:g.62568854G>T	ENSP00000436679:p.Arg249Ser		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_006362	44	0.00	0	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730571	0.69074	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875;ENST00000439713	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.76800	0.4038	M	0.90252	3.1	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.982;0.992;0.982	D;P;P;P	0.79784	0.993;0.738;0.511;0.472	T	0.76231	-0.3035	10	0.19590	T	0.45	-13.1382	11.4713	0.50270	0.0:0.0:0.8203:0.1796	.	112;292;262;249	B4E227;E9PIN3;Q59E96;Q9UBU9	.;.;.;NXF1_HUMAN	S	249;249;292;249	ENSP00000294172:R249S;ENSP00000436679:R249S;ENSP00000435742:R292S;ENSP00000408864:R249S	ENSP00000294172:R249S	R	-	1	0	NXF1	62325430	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	3.695000	0.54749	2.466000	0.83321	0.655000	0.94253	CGC			0.507	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395365.2		NM_006362	
LRP5	4041	mdanderson.org	37	11	68115598	68115598	+	Silent	SNP	G	G	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr11:68115598G>A	ENST00000294304.7	+	2	481	c.375G>A	c.(373-375)acG>acA	p.T125T		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	125	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGTACTGGACGGACTCAGAGA	0.647																																					p.T125T													.	.			0			c.G375A												114.0	103.0	107.0					11																	68115598		2200	4294	6494	SO:0001819	synonymous_variant	4041	exon2			CTGGACGGACTCA	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.375G>A	11.37:g.68115598G>A			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_002335	0		0	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1																																																																																					0.647	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395088.1		NM_002335	
FUT4	2526	mdanderson.org	37	11	94278020	94278020	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr11:94278020G>T	ENST00000358752.2	+	1	1004	c.721G>T	c.(721-723)Gac>Tac	p.D241Y	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_002033.3	NP_002024.1	P22083	FUT4_HUMAN	fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)	241					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	cell periphery (GO:0071944)|cell surface (GO:0009986)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(2)|endometrium(2)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCACCACCGCGACCTCGTGAA	0.706																																					p.D241Y													.	.			0			c.G721T												8.0	9.0	8.0					11																	94278020		1867	3743	5610	SO:0001583	missense	2526	exon1			CACCGCGACCTCG		CCDS8301.1	11q21	2013-02-26			ENSG00000196371	ENSG00000196371		"""CD molecules"", ""Fucosyltransferases"""	4015	protein-coding gene	gene with protein product	"""ELAM ligand fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	104230		CD15, FCT3A, ELFT		1702034	Standard	NM_002033		Approved	FUC-TIV	uc001pez.3	P22083	OTTHUMG00000167795	ENST00000358752.2:c.721G>T	11.37:g.94278020G>T	ENSP00000351602:p.Asp241Tyr		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_002033	4	0.00	0	B2RMS0	Missense_Mutation	SNP	ENST00000358752.2	37	CCDS8301.1	.	.	.	.	.	.	.	.	.	.	g	18.16	3.562180	0.65538	.	.	ENSG00000196371	ENST00000358752	T	0.28069	1.63	4.4	2.46	0.29980	.	0.059107	0.64402	D	0.000004	T	0.54854	0.1884	M	0.86268	2.805	0.47308	D	0.999387	D	0.89917	1.0	D	0.87578	0.998	T	0.58875	-0.7559	10	0.87932	D	0	.	9.0459	0.36347	0.0837:0.1499:0.7664:0.0	.	241	P22083	FUT4_HUMAN	Y	241	ENSP00000351602:D241Y	ENSP00000351602:D241Y	D	+	1	0	FUT4	93917668	0.991000	0.36638	0.986000	0.45419	0.615000	0.37417	4.307000	0.59123	0.944000	0.37579	0.442000	0.29010	GAC			0.706	FUT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396327.2		NM_002033	
TRAPPC4	51399	mdanderson.org	37	11	118889660	118889660	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr11:118889660G>T	ENST00000533632.1	+	1	519	c.155G>T	c.(154-156)gGc>gTc	p.G52V	TRAPPC4_ENST00000528230.1_Missense_Mutation_p.G52V|MIR3656_ENST00000577421.1_RNA|TRAPPC4_ENST00000359005.4_Missense_Mutation_p.G52V|TRAPPC4_ENST00000434101.2_Missense_Mutation_p.G52V|TRAPPC4_ENST00000525303.1_Missense_Mutation_p.G52V|RPS25_ENST00000527673.1_5'Flank|RPS25_ENST00000528547.1_5'Flank|TRAPPC4_ENST00000533058.1_Missense_Mutation_p.G52V	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4	52					dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		GTTGCTTTCGGCCAGCGGGAC	0.637																																					p.G52V													.	.			0			c.G155T												65.0	63.0	64.0					11																	118889660		2200	4295	6495	SO:0001583	missense	51399	exon1			CTTTCGGCCAGCG	AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296		ENST00000533632.1:c.155G>T	11.37:g.118889660G>T	ENSP00000436005:p.Gly52Val		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_016146	154	0.00	0	A8K3A5|B4DME1	Missense_Mutation	SNP	ENST00000533632.1	37	CCDS8407.1	.	.	.	.	.	.	.	.	.	.	G	36	5.767352	0.96914	.	.	ENSG00000196655	ENST00000533632;ENST00000528230;ENST00000525303;ENST00000434101;ENST00000359005;ENST00000533058	D;D;D;T;T;T	0.85955	-2.05;-1.67;-1.65;0.63;0.2;0.16	5.86	5.86	0.93980	Longin-like (1);	0.000000	0.85682	D	0.000000	D	0.93318	0.7870	M	0.83774	2.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	D	0.93486	0.6831	10	0.87932	D	0	-14.3606	19.79	0.96453	0.0:0.0:1.0:0.0	.	52;52;52;52	B4DF86;B4DME1;Q9Y296;B4DF36	.;.;TPPC4_HUMAN;.	V	52	ENSP00000436005:G52V;ENSP00000436827:G52V;ENSP00000435339:G52V;ENSP00000405033:G52V;ENSP00000351896:G52V;ENSP00000432920:G52V	ENSP00000351896:G52V	G	+	2	0	TRAPPC4	118394870	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.426000	0.97469	2.784000	0.95788	0.655000	0.94253	GGC			0.637	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389332.1		NM_016146	
ROBO3	64221	mdanderson.org	37	11	124749826	124749826	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr11:124749826C>T	ENST00000397801.1	+	26	4132	c.3940C>T	c.(3940-3942)Cgg>Tgg	p.R1314W	ROBO3_ENST00000538940.1_Missense_Mutation_p.R1292W|ROBO3_ENST00000543966.1_Missense_Mutation_p.R77W|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1314					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GGCAGCCCAGCGGGTGCTCCA	0.682																																					p.R1314W													ROBO3_ENST00000397801,mouth,carcinoma,-1,1	ROBO3_ENST00000397801	-1	1	0			c.C3940T												10.0	13.0	12.0					11																	124749826		1996	4151	6147	SO:0001583	missense	64221	exon26			GCCCAGCGGGTGC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.3940C>T	11.37:g.124749826C>T	ENSP00000380903:p.Arg1314Trp		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_022370	12	0.00	0		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	C	6.756	0.508387	0.12883	.	.	ENSG00000154134	ENST00000397801;ENST00000538940;ENST00000543966	T;T;T	0.66460	-0.21;-0.2;0.73	5.5	0.12	0.14691	.	0.942806	0.08692	N	0.907749	T	0.55257	0.1909	L	0.46157	1.445	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.46816	-0.9164	10	0.56958	D	0.05	.	4.5745	0.12226	0.3925:0.4088:0.1268:0.0719	.	1314	Q96MS0	ROBO3_HUMAN	W	1314;1292;77	ENSP00000380903:R1314W;ENSP00000441797:R1292W;ENSP00000438799:R77W	ENSP00000380903:R1314W	R	+	1	2	ROBO3	124255036	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-0.993000	0.03720	-0.233000	0.09797	-0.122000	0.15005	CGG			0.682	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387091.1		XM_370663	
TAS2R43	259289	hgsc.bcm.edu	37	12	11243716	11243716	+	IGR	SNP	T	T	C	rs199540487		TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr12:11243716T>C	ENST00000531678.1	-	0	1027				PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		cacacacacatatatatatat	0.274																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CACACATATATAT	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537			12.37:g.11243716T>C			Somatic	6	0	0		WXS	Illumina HiSeq	.	9	0.44	4	.	0		0	P59546|Q645X4	RNA	SNP	ENST00000531678.1	37	CCDS53749.1																																																																																					0.274	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383561.1		NM_176884	
ETV6	2120	mdanderson.org	37	12	11905470	11905470	+	Silent	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr12:11905470G>T	ENST00000396373.4	+	2	394	c.120G>T	c.(118-120)gcG>gcT	p.A40A	ETV6_ENST00000544715.1_3'UTR	NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	40	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				TGCCTCGAGCGCTCAGGATGG	0.577			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																p.A40A				Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	.	.			0			c.G120T												66.0	60.0	62.0					12																	11905470		2203	4300	6503	SO:0001819	synonymous_variant	2120	exon2			TCGAGCGCTCAGG	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.120G>T	12.37:g.11905470G>T			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001987	1	0.00	0	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Silent	SNP	ENST00000396373.4	37	CCDS8643.1																																																																																					0.577	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400130.2		NM_001987	
DENND5B	160518	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	31632964	31632964	+	Missense_Mutation	SNP	T	T	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr12:31632964T>A	ENST00000389082.5	-	3	727	c.463A>T	c.(463-465)Atg>Ttg	p.M155L	DENND5B_ENST00000306833.6_Missense_Mutation_p.M190L|DENND5B_ENST00000354285.4_Missense_Mutation_p.M177L|DENND5B_ENST00000536562.1_Missense_Mutation_p.M190L|DENND5B_ENST00000545147.1_Intron	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	155					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AATGAGTCCATACTGCAGGAA	0.428																																					p.M155L													DENND5B,NS,carcinoma,+2,1	DENND5B	2	1	0			c.A463T												130.0	125.0	127.0					12																	31632964		2062	4212	6274	SO:0001583	missense	160518	exon3			AGTCCATACTGCA	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.463A>T	12.37:g.31632964T>A	ENSP00000373734:p.Met155Leu		Somatic	183	0	0		WXS	Illumina HiSeq	.	168	0.04	7	NM_144973	1	1.00	1	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	T	10.88	1.474369	0.26423	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	T;T;T;T;T	0.06687	3.83;3.93;3.93;3.3;3.27	4.65	3.44	0.39384	.	0.296795	0.34002	N	0.004351	T	0.05456	0.0144	N	0.16478	0.41	0.48696	D	0.99969	B;B;B;B;B	0.09022	0.001;0.001;0.002;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.002;0.001;0.002	T	0.38045	-0.9679	10	0.27785	T	0.31	-16.9074	11.5123	0.50500	0.0:0.0:0.1495:0.8505	.	190;77;177;155;190	Q6ZUT9-2;Q6ZUT9-3;Q6ZUT9-4;Q6ZUT9;G3V1S3	.;.;.;DEN5B_HUMAN;.	L	155;190;190;177;107	ENSP00000373734:M155L;ENSP00000306482:M190L;ENSP00000444889:M190L;ENSP00000346238:M177L;ENSP00000442938:M107L	ENSP00000306482:M190L	M	-	1	0	DENND5B	31524231	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	2.750000	0.47500	1.955000	0.56771	0.533000	0.62120	ATG			0.428	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402040.1		NM_144973	
RAPGEF3	10411	mdanderson.org	37	12	48141538	48141538	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr12:48141538C>T	ENST00000449771.2	-	14	1518	c.1430G>A	c.(1429-1431)gGc>gAc	p.G477D	RAPGEF3_ENST00000171000.4_Missense_Mutation_p.G435D|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.G435D|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.G435D|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.G435D|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.G477D|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.G477D			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	477	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		GAGCATGGAGCCATACAGGGC	0.662																																					p.G477D													.	.			0			c.G1430A												38.0	39.0	39.0					12																	48141538		2203	4300	6503	SO:0001583	missense	10411	exon14			ATGGAGCCATACA	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.1430G>A	12.37:g.48141538C>T	ENSP00000395708:p.Gly477Asp		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_001098531	1	0.00	0	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360929	0.41801	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358	T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53	4.99	3.15	0.36227	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.174971	0.48767	D	0.000176	T	0.29061	0.0722	L	0.54323	1.7	0.26197	N	0.979502	B	0.16396	0.017	B	0.25614	0.062	T	0.26950	-1.0088	10	0.59425	D	0.04	.	9.0975	0.36647	0.1466:0.7757:0.0:0.0778	.	477	O95398	RPGF3_HUMAN	D	435;477;124;435;435;435;477;489;435;477	ENSP00000384521:G435D;ENSP00000395708:G477D;ENSP00000448619:G435D;ENSP00000171000:G435D;ENSP00000373864:G477D;ENSP00000448480:G435D;ENSP00000378764:G477D	ENSP00000171000:G435D	G	-	2	0	RAPGEF3	46427805	1.000000	0.71417	0.542000	0.28115	0.924000	0.55760	4.233000	0.58651	0.805000	0.34159	-0.182000	0.12963	GGC			0.662	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257848.1		NM_006105	
RARG	5916	ucsc.edu	37	12	53609563	53609563	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr12:53609563C>T	ENST00000425354.2	-	4	687	c.200G>A	c.(199-201)aGc>aAc	p.S67N	RARG_ENST00000394426.1_Missense_Mutation_p.S67N|RARG_ENST00000543762.1_Intron|RARG_ENST00000543726.1_Intron|RARG_ENST00000327550.3_5'UTR|RARG_ENST00000338561.5_Missense_Mutation_p.S56N	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	67	Modulating.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	TGAGCTGGTGCTCTGTGTCTC	0.617																																					p.S67N													.	RARG	53		0			c.G200A												68.0	56.0	60.0					12																	53609563		2203	4300	6503	SO:0001583	missense	5916	exon4			CTGGTGCTCTGTG	M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.200G>A	12.37:g.53609563C>T	ENSP00000388510:p.Ser67Asn		Somatic	34	0	0		WXS	Illumina HiSeq		38	0.11	4	NM_000966	4	0.00	0	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	ENST00000425354.2	37	CCDS8850.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.3|22.3	4.267755|4.267755	0.80469|0.80469	.|.	.|.	ENSG00000172819|ENSG00000172819	ENST00000550265|ENST00000425354;ENST00000394426;ENST00000338561	.|D;D;D	.|0.92099	.|-2.97;-2.97;-2.9	4.29|4.29	4.29|4.29	0.51040|0.51040	.|.	.|0.044661	.|0.85682	.|D	.|0.000000	D|D	0.92067|0.92067	0.7486|0.7486	M|M	0.74467|0.74467	2.265|2.265	0.80722|0.80722	D|D	1|1	P|B;P	0.37330|0.36753	0.59|0.376;0.568	B|B;B	0.35413|0.39339	0.202|0.104;0.297	D|D	0.92979|0.92979	0.6404|0.6404	8|10	0.21540|0.56958	T|D	0.41|0.05	.|.	16.0377|16.0377	0.80642|0.80642	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	95|67;56	F8VR45|P13631;F1D8P1	.|RARG_HUMAN;.	T|N	95|67;67;56	.|ENSP00000388510:S67N;ENSP00000377947:S67N;ENSP00000343698:S56N	ENSP00000446565:A95T|ENSP00000343698:S56N	A|S	-|-	1|2	0|0	RARG|RARG	51895830|51895830	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	4.673000|4.673000	0.61604|0.61604	2.385000|2.385000	0.81259|0.81259	0.467000|0.467000	0.42956|0.42956	GCA|AGC			0.617	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000109404.2		NM_000966	
DLGAP5	9787	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	55655696	55655696	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr14:55655696G>T	ENST00000247191.2	-	2	418	c.202C>A	c.(202-204)Caa>Aaa	p.Q68K	DLGAP5_ENST00000395425.2_Missense_Mutation_p.Q68K	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	68					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						ACAAGCCCTTGAGATGTCTCA	0.343																																					p.Q68K													.	.			0			c.C202A												115.0	113.0	114.0					14																	55655696		2203	4299	6502	SO:0001583	missense	9787	exon2			GCCCTTGAGATGT	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.202C>A	14.37:g.55655696G>T	ENSP00000247191:p.Gln68Lys		Somatic	228	0	0		WXS	Illumina HiSeq	.	232	0.05	12	NM_014750	11	0.27	3	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	ENST00000247191.2	37	CCDS9723.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508175	0.44660	.	.	ENSG00000126787	ENST00000395425;ENST00000247191;ENST00000557645;ENST00000554067	T;T;T;T	0.44083	2.31;2.31;2.31;0.93	5.71	3.69	0.42338	.	0.795201	0.11661	N	0.541805	T	0.47060	0.1425	M	0.70595	2.14	0.24585	N	0.993859	P;P	0.49961	0.93;0.846	P;P	0.44422	0.449;0.449	T	0.38585	-0.9654	10	0.25751	T	0.34	.	14.3911	0.66978	0.0:0.539:0.461:0.0	.	68;68	A8MTM6;Q15398	.;DLGP5_HUMAN	K	68	ENSP00000378815:Q68K;ENSP00000247191:Q68K;ENSP00000451747:Q68K;ENSP00000452168:Q68K	ENSP00000247191:Q68K	Q	-	1	0	DLGAP5	54725449	0.852000	0.29690	0.687000	0.30102	0.587000	0.36485	1.682000	0.37628	1.491000	0.48482	0.655000	0.94253	CAA			0.343	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276908.2		NM_014750	
PSMC1	5700	mdanderson.org	37	14	90726472	90726472	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr14:90726472A>G	ENST00000261303.8	+	3	174	c.71A>G	c.(70-72)aAa>aGa	p.K24R	PSMC1_ENST00000543772.2_Intron	NM_002802.2	NP_002793.2	P62191	PRS4_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 1	24					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|upper_aerodigestive_tract(2)	6		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		AAGAAAAAGAAATATGAACCT	0.368																																					p.K24R													.	.			0			c.A71G												64.0	73.0	70.0					14																	90726472		2203	4300	6503	SO:0001583	missense	5700	exon3			AAAAGAAATATGA	L02426	CCDS32139.1	14q32.11	2010-04-21			ENSG00000100764	ENSG00000100764		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9547	protein-coding gene	gene with protein product		602706				9473509	Standard	NM_002802		Approved	S4, p56	uc001xyf.3	P62191		ENST00000261303.8:c.71A>G	14.37:g.90726472A>G	ENSP00000261303:p.Lys24Arg		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_002802	6	0.00	0	B4DR63|P49014|Q03527|Q6IAW0|Q6NW36|Q96AZ3	Missense_Mutation	SNP	ENST00000261303.8	37	CCDS32139.1	.	.	.	.	.	.	.	.	.	.	A	17.27	3.347257	0.61183	.	.	ENSG00000100764	ENST00000261303	D	0.94966	-3.57	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.93575	0.7949	M	0.64170	1.965	0.80722	D	1	P	0.34587	0.458	B	0.39152	0.292	D	0.93095	0.6503	10	0.42905	T	0.14	-26.0009	14.9883	0.71365	1.0:0.0:0.0:0.0	.	24	P62191	PRS4_HUMAN	R	24	ENSP00000261303:K24R	ENSP00000261303:K24R	K	+	2	0	PSMC1	89796225	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.025000	0.93694	2.194000	0.70268	0.533000	0.62120	AAA			0.368	PSMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411253.1		NM_002802	
UNC79	57578	broad.mit.edu	37	14	94079317	94079317	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr14:94079317G>T	ENST00000393151.2	+	27	3929	c.3929G>T	c.(3928-3930)cGa>cTa	p.R1310L	UNC79_ENST00000555664.1_Missense_Mutation_p.R1310L|UNC79_ENST00000553484.1_Missense_Mutation_p.R1332L|UNC79_ENST00000256339.4_Missense_Mutation_p.R1133L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1310					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACGGTCAAGCGACACCTGTAC	0.483																																					p.R1133L													UNC79,NS,carcinoma,+1,2	UNC79	366	2	0			c.G3398T												140.0	116.0	124.0					14																	94079317		2203	4300	6503	SO:0001583	missense	57578	exon27			TCAAGCGACACCT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3929G>T	14.37:g.94079317G>T	ENSP00000376858:p.Arg1310Leu		Somatic	182	0.0054945055	1		WXS	Illumina HiSeq	Phase_I	151	0.02	3	NM_020818	0		0	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	G	34	5.361657	0.95877	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.23950	1.92;1.88;1.88;1.92	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.48447	0.1500	L	0.52011	1.625	0.53005	D	0.999963	D	0.69078	0.997	D	0.75484	0.986	T	0.43814	-0.9368	10	0.87932	D	0	-18.4984	19.5316	0.95231	0.0:0.0:1.0:0.0	.	1332	C9JQL1	.	L	1133;1310;1332;1310;1332	ENSP00000256339:R1133L;ENSP00000450868:R1310L;ENSP00000451360:R1332L;ENSP00000376858:R1310L	ENSP00000256339:R1133L	R	+	2	0	KIAA1409	93149070	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.617000	0.88574	0.650000	0.86243	CGA			0.483	UNC79-006	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000412766.1		XM_028395	
IGHV2-70	28454	bcgsc.ca	37	14	107179022	107179022	+	RNA	SNP	C	C	T	rs2157615	byFrequency	TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr14:107179022C>T	ENST00000390634.2	-	0	230									immunoglobulin heavy variable 2-70																		CACACACATTCCACTAGTGCT	0.547																																					.													.	.			0			.							C		1,4135		0,1,2067	100.0	80.0	87.0			0.6	0.0	14	dbSNP_96	87	33,8311		1,31,4140	no	intergenic				1,32,6207	TT,TC,CC		0.3955,0.0242,0.2724			107179022	34,12446	2068	4172	6240			28454	.			CACATTCCACTAG	L21969		14q32.33	2012-02-08			ENSG00000211974	ENSG00000211974		"""Immunoglobulins / IGH locus"""	5577	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151870		14.37:g.107179022C>T			Somatic	399	0.0100250627	4		WXS	Illumina HiSeq	Phase_1	326	0.03	11	.	101	0.16	16		RNA	SNP	ENST00000390634.2	37																																																																																						0.547	IGHV2-70-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000324215.1	rescued with RNA-seq	NG_001019	
RP11-467N20.5	0	broad.mit.edu	37	15	23407139	23407140	+	Frame_Shift_Ins	INS	-	-	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr15:23407139_23407140insT	ENST00000558241.1	-	8	1786_1787	c.1696_1697insA	c.(1696-1698)tggfs	p.W566fs																	endometrium(1)	1						ctcctgcctccacatcttatcc	0.564																																					.													.	.			0			.																																									SO:0001589	frameshift_variant	0	.			TGCCTCCACATCT																												ENST00000558241.1:c.1696_1697insA	15.37:g.23407139_23407140insT	ENSP00000453436:p.Trp566fs		Somatic	688	0	0		WXS	Illumina HiSeq	Phase_I	656	0.04	24	.	0		0		Frame_Shift_Ins	INS	ENST00000558241.1	37																																																																																						0.564	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000415942.1			
WDR76	79968	broad.mit.edu	37	15	44134649	44134649	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr15:44134649G>T	ENST00000263795.6	+	6	839	c.769G>T	c.(769-771)Gaa>Taa	p.E257*	WDR76_ENST00000381246.2_Nonsense_Mutation_p.E193*	NM_001167941.1|NM_024908.3	NP_001161413.1|NP_079184.2	Q9H967	WDR76_HUMAN	WD repeat domain 76	257										breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)	20		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		AATGACTTCTGAAAATCAAGA	0.398											OREG0003949	type=REGULATORY REGION|Gene=AK124169|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.E257X													.	WDR76	34		0			c.G769T												71.0	73.0	72.0					15																	44134649		2198	4298	6496	SO:0001587	stop_gained	79968	exon6			ACTTCTGAAAATC	AK023035	CCDS10106.1, CCDS53938.1	15q15.3	2013-01-09			ENSG00000092470	ENSG00000092470		"""WD repeat domain containing"""	25773	protein-coding gene	gene with protein product						12860291	Standard	NM_024908		Approved	FLJ12973	uc001zti.2	Q9H967	OTTHUMG00000060143	ENST00000263795.6:c.769G>T	15.37:g.44134649G>T	ENSP00000263795:p.Glu257*		Somatic	453	0.0022075055	1	921	WXS	Illumina HiSeq	Phase_I	465	0.02	7	NM_024908	4	0.00	0	A0MNP5|Q05CI4	Nonsense_Mutation	SNP	ENST00000263795.6	37	CCDS10106.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673147	0.47781	.	.	ENSG00000092470	ENST00000263795;ENST00000381246;ENST00000452115	.	.	.	5.49	3.51	0.40186	.	0.362944	0.30575	N	0.009324	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-16.2829	6.2272	0.20714	0.0935:0.0:0.7235:0.183	.	.	.	.	X	257;193;193	.	ENSP00000263795:E257X	E	+	1	0	WDR76	41921941	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	2.108000	0.41854	1.307000	0.44944	-0.253000	0.11424	GAA			0.398	WDR76-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000133482.2		NM_024908	
USP3	9960	broad.mit.edu	37	15	63852125	63852125	+	Silent	SNP	A	A	G			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr15:63852125A>G	ENST00000380324.3	+	7	732	c.603A>G	c.(601-603)gcA>gcG	p.A201A	USP3-AS1_ENST00000560350.1_RNA|USP3-AS1_ENST00000559357.1_RNA|USP3-AS1_ENST00000559861.1_RNA|USP3_ENST00000559711.1_Silent_p.A112A|USP3_ENST00000558285.1_Silent_p.A184A|USP3_ENST00000536001.1_Intron|USP3_ENST00000268049.7_Silent_p.A179A|USP3_ENST00000539772.1_Intron|USP3_ENST00000540797.1_Silent_p.A157A	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	201	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		GGAAAACAGCAGGAAGGCGGA	0.388																																					p.A201A													.	USP3	37		0			c.A603G												98.0	91.0	93.0					15																	63852125		2203	4300	6503	SO:0001819	synonymous_variant	9960	exon7			AACAGCAGGAAGG	AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.603A>G	15.37:g.63852125A>G			Somatic	269	0	0		WXS	Illumina HiSeq	Phase_I	300	0.01	4	NM_006537	4	0.00	0	B4DVU5|F5H1A6|Q8WVD0	Silent	SNP	ENST00000380324.3	37	CCDS32265.1																																																																																					0.388	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000417773.1			
IFT140	9742	broad.mit.edu	37	16	1574556	1574556	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr16:1574556G>T	ENST00000426508.2	-	24	3501	c.3138C>A	c.(3136-3138)tgC>tgA	p.C1046*	IFT140_ENST00000361339.5_Nonsense_Mutation_p.C240*	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1046					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				GTGGTACCTTGCACAGGCGGA	0.637																																					p.C1046X													.	IFT140	128		0			c.C3138A												28.0	34.0	32.0					16																	1574556		2199	4300	6499	SO:0001587	stop_gained	9742	exon24			TACCTTGCACAGG	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.3138C>A	16.37:g.1574556G>T	ENSP00000406012:p.Cys1046*		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	52	0.08	4	NM_014714	0		0	A2A2A8|D3DU75|O60332|Q9UG52	Nonsense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	G	39	7.795833	0.98495	.	.	ENSG00000187535	ENST00000397417;ENST00000361339;ENST00000426508	.	.	.	5.27	1.72	0.24424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	12.3262	0.55011	0.2783:0.0:0.7217:0.0	.	.	.	.	X	1046;240;1046	.	ENSP00000354895:C240X	C	-	3	2	IFT140	1514557	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	1.186000	0.32078	0.626000	0.30322	-0.266000	0.10368	TGC			0.637	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250438.2		NM_014714	
KATNB1	10300	mdanderson.org	37	16	57787863	57787863	+	Missense_Mutation	SNP	C	C	T	rs143811277		TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr16:57787863C>T	ENST00000379661.3	+	13	1576	c.1184C>T	c.(1183-1185)aCg>aTg	p.T395M		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				GCAGGTCGGACGCCACCCCGG	0.677																																					p.T395M													KATNB1,rectum,carcinoma,0,1	KATNB1	0	1	0			c.C1184T							C	MET/THR	2,4394	4.2+/-10.8	0,2,2196	62.0	55.0	57.0		1184	4.8	1.0	16	dbSNP_134	57	0,8600		0,0,4300	yes	missense	KATNB1	NM_005886.2	81	0,2,6496	TT,TC,CC		0.0,0.0455,0.0154	probably-damaging	395/656	57787863	2,12994	2198	4300	6498	SO:0001583	missense	10300	exon13			GTCGGACGCCACC	AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.1184C>T	16.37:g.57787863C>T	ENSP00000368982:p.Thr395Met		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	55	0.07	4	NM_005886	38	0.00	0		Missense_Mutation	SNP	ENST00000379661.3	37	CCDS10788.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417642	0.83449	4.55E-4	0.0	ENSG00000140854	ENST00000379661	T	0.56275	0.47	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.71821	0.3385	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.76102	-0.3082	10	0.87932	D	0	5.7195	16.4232	0.83773	0.0:1.0:0.0:0.0	.	395	Q9BVA0	KTNB1_HUMAN	M	395	ENSP00000368982:T395M	ENSP00000368982:T395M	T	+	2	0	KATNB1	56345364	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	5.634000	0.67833	2.216000	0.71823	0.313000	0.20887	ACG	0		0.677	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257343.3			
PSKH1	5681	bcgsc.ca	37	16	67942635	67942635	+	5'UTR	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr16:67942635G>T	ENST00000291041.5	+	0	153					NM_006742.2	NP_006733.1	P11801	KPSH1_HUMAN	protein serine kinase H1							cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|pancreas(1)	12		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		CGCTGGAGAGGATGCCCTCGT	0.592																																					.													.	PSKH1	28		0			.												55.0	49.0	51.0					16																	67942635		2198	4300	6498	SO:0001623	5_prime_UTR_variant	5681	.			GGAGAGGATGCCC	M14504	CCDS10851.1	16q22.1	2008-02-05			ENSG00000159792	ENSG00000159792			9529	protein-coding gene	gene with protein product		177015				8268911	Standard	NM_006742		Approved		uc002euv.3	P11801	OTTHUMG00000137548	ENST00000291041.5:c.-18G>T	16.37:g.67942635G>T			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_1	73	0.07	5	.	4	0.00	0	Q9NY19	Missense_Mutation	SNP	ENST00000291041.5	37	CCDS10851.1																																																																																					0.592	PSKH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268882.3		NM_006742	
MLYCD	23417	broad.mit.edu	37	16	83949014	83949014	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr16:83949014T>C	ENST00000262430.4	+	5	1421	c.1402T>C	c.(1402-1404)Tac>Cac	p.Y468H	RP11-505K9.4_ENST00000566309.1_Intron|RP11-505K9.4_ENST00000561562.1_Intron	NM_012213.2	NP_036345.2	O95822	DCMC_HUMAN	malonyl-CoA decarboxylase	468	Catalytic domain.				acetyl-CoA biosynthetic process (GO:0006085)|cellular lipid metabolic process (GO:0044255)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA catabolic process (GO:2001294)|positive regulation of fatty acid oxidation (GO:0046321)|regulation of glucose metabolic process (GO:0010906)|response to ischemia (GO:0002931)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	malonyl-CoA decarboxylase activity (GO:0050080)|receptor binding (GO:0005102)			NS(1)|biliary_tract(1)|breast(1)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						CAGCACCTCCTACCTCGGCTC	0.577																																					p.Y468H													.	MLYCD	27		0			c.T1402C												30.0	33.0	32.0					16																	83949014		1979	4163	6142	SO:0001583	missense	23417	exon5			ACCTCCTACCTCG	AF153679	CCDS42206.1	16q24	2009-02-04				ENSG00000103150			7150	protein-coding gene	gene with protein product		606761				10455107, 9869665	Standard	NM_012213		Approved	MCD, hMCD	uc002fgz.3	O95822		ENST00000262430.4:c.1402T>C	16.37:g.83949014T>C	ENSP00000262430:p.Tyr468His		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	98	0.04	4	NM_012213	14	0.00	0	Q9UNU5|Q9Y3F2	Missense_Mutation	SNP	ENST00000262430.4	37	CCDS42206.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.284662	0.80803	.	.	ENSG00000103150	ENST00000262430	D	0.97731	-4.51	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.98416	0.9473	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99560	1.0968	10	0.87932	D	0	-32.2263	13.9448	0.64077	0.0:0.0:0.0:1.0	.	468	O95822	DCMC_HUMAN	H	468	ENSP00000262430:Y468H	ENSP00000262430:Y468H	Y	+	1	0	MLYCD	82506515	1.000000	0.71417	0.996000	0.52242	0.889000	0.51656	7.514000	0.81750	1.962000	0.57031	0.459000	0.35465	TAC			0.577	MLYCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433009.1		NM_012213	
PIEZO1	9780	mdanderson.org	37	16	88788277	88788277	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr16:88788277G>A	ENST00000301015.9	-	37	5399	c.5153C>T	c.(5152-5154)gCc>gTc	p.A1718V	RP5-1142A6.9_ENST00000564984.1_RNA|PIEZO1_ENST00000327397.7_5'Flank	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1718					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CGACAGCATGGCCCACAGGAA	0.687																																					p.A1718V													.	.			0			c.C5153T												43.0	62.0	56.0					16																	88788277		692	1589	2281	SO:0001583	missense	9780	exon37			AGCATGGCCCACA	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.5153C>T	16.37:g.88788277G>A	ENSP00000301015:p.Ala1718Val		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001142864	9	0.00	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.934454	0.92458	.	.	ENSG00000103335	ENST00000301015	T	0.26373	1.74	4.84	4.84	0.62591	.	0.054604	0.64402	D	0.000001	T	0.54127	0.1839	M	0.85197	2.74	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.61028	-0.7145	10	0.72032	D	0.01	-30.1374	13.6325	0.62204	0.0:0.1558:0.8442:0.0	.	1718	Q92508	PIEZ1_HUMAN	V	1718	ENSP00000301015:A1718V	ENSP00000301015:A1718V	A	-	2	0	FAM38A	87315778	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.028000	0.76470	2.395000	0.81488	0.561000	0.74099	GCC			0.687	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000345699.4		NM_014745	
FAM101B	359845	broad.mit.edu	37	17	295726	295726	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:295726G>T	ENST00000329099.4	-	1	4	c.5C>A	c.(4-6)cCa>cAa	p.P2Q		NM_182705.2	NP_874364.1	Q8N5W9	F101B_HUMAN	family with sequence similarity 101, member B	72					actin cytoskeleton organization (GO:0030036)|epithelial to mesenchymal transition (GO:0001837)	actin cytoskeleton (GO:0015629)	filamin binding (GO:0031005)			breast(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)|urinary_tract(1)	13		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		GAGAGACGCTGGACTCTTCAA	0.463																																					.													.	FAM101B	19		0			.												11.0	13.0	12.0					17																	295726		1960	4078	6038	SO:0001583	missense	359845	.			GACGCTGGACTCT			17p13	2008-10-23			ENSG00000183688	ENSG00000183688			28705	protein-coding gene	gene with protein product		615928				12477932	Standard	NM_182705		Approved	MGC45871	uc002frj.3	Q8N5W9	OTTHUMG00000132483	ENST00000329099.4:c.5C>A	17.37:g.295726G>T	ENSP00000331915:p.Pro2Gln		Somatic	438	0.00456621	2		WXS	Illumina HiSeq	Phase_I	372	0.01	4	.	2	0.00	0		Missense_Mutation	SNP	ENST00000329099.4	37		.	.	.	.	.	.	.	.	.	.	G	22.4	4.291206	0.80914	.	.	ENSG00000183688	ENST00000329099	.	.	.	5.05	4.02	0.46733	.	0.818740	0.11119	N	0.597618	T	0.40297	0.1111	N	0.14661	0.345	.	.	.	P	0.41131	0.739	P	0.46237	0.508	T	0.53535	-0.8425	8	0.87932	D	0	-10.598	12.0214	0.53346	0.0:0.1743:0.8257:0.0	.	72	Q8N5W9	F101B_HUMAN	Q	2	.	ENSP00000331915:P2Q	P	-	2	0	FAM101B	295954	1.000000	0.71417	0.962000	0.40283	0.608000	0.37181	3.622000	0.54217	2.336000	0.79503	0.650000	0.86243	CCA			0.463	FAM101B-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000255652.1		NM_182705	
DNAH9	1770	mdanderson.org	37	17	11502151	11502151	+	Silent	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:11502151G>T	ENST00000262442.4	+	1	404	c.336G>T	c.(334-336)ggG>ggT	p.G112G	DNAH9_ENST00000454412.2_Silent_p.G112G|DNAH9_ENST00000579828.1_Silent_p.G112G	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	112	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGCCTCCAGGGCCCGACAGCT	0.701																																					p.G112G													.	.			0			c.G336T												3.0	3.0	3.0					17																	11502151		1794	3739	5533	SO:0001819	synonymous_variant	1770	exon1			TCCAGGGCCCGAC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.336G>T	17.37:g.11502151G>T			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_001372	0		0	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																					0.701	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252756.2		NM_001372	
TVP23C	201158	bcgsc.ca	37	17	15441469	15441469	+	Intron	SNP	C	C	T	rs568909748	byFrequency	TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:15441469C>T	ENST00000225576.3	-	5	558				TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000583206.1_5'Flank|TVP23C_ENST00000584811.1_Splice_Site|TVP23C_ENST00000438826.3_Splice_Site|TVP23C_ENST00000428082.2_Splice_Site|TVP23C_ENST00000519970.1_Intron	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											TCCAGTGTTCCGCAAAAGACA	0.393													c|||	3	0.000599042	0.0015	0.0	5008	,	,		17476	0.001		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001627	intron_variant	201158	.			GTGTTCCGCAAAA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+7629G>A	17.37:g.15441469C>T			Somatic	444	0.0157657658	7		WXS	Illumina HiSeq	Phase_1	417	0.03	11	.	0		0	Q3LIC7	Splice_Site	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	c	13.58	2.280351	0.40294	.	.	ENSG00000175106	ENST00000438826	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0583	0.25111	0.0:0.1033:0.0:0.8967	.	.	.	.	.	-1	.	.	.	-	.	.	FAM18B2	15382194	1.000000	0.71417	0.996000	0.52242	0.698000	0.40448	1.919000	0.40015	0.852000	0.35287	-0.352000	0.07741	.			0.393	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
FLJ36000	284124	broad.mit.edu	37	17	21911343	21911346	+	lincRNA	DEL	GTTT	GTTT	-	rs201038669	byFrequency	TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	GTTT	GTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:21911343_21911346delGTTT	ENST00000581223.2	+	0	2068_2071					NR_027084.1																						ctctctGTCGGTTTGTTTGTGTCC	0.456														173	0.0345447	0.0151	0.0216	5008	,	,		21291	0.003		0.0487	False		,,,				2504	0.0879				.													.	.			0			.																																											0	.			CTGTCGGTTTGTT																													17.37:g.21911347_21911350delGTTT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0		RNA	DEL	ENST00000581223.2	37																																																																																						0.456	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000451067.1			
AP2B1	163	mdanderson.org	37	17	33984625	33984625	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:33984625G>T	ENST00000262325.7	+	14	2357	c.1804G>T	c.(1804-1806)Gca>Tca	p.A602S	AP2B1_ENST00000537622.2_Missense_Mutation_p.A602S|AP2B1_ENST00000592545.1_Missense_Mutation_p.A564S|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000538556.1_Missense_Mutation_p.A545S|AP2B1_ENST00000312678.8_Missense_Mutation_p.A602S|AP2B1_ENST00000589344.1_Missense_Mutation_p.A602S	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	602	Pro-rich (stalk region).				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TAGCACTGATGCAGGTGACAG	0.428																																					p.A602S													.	.			0			c.G1804T												99.0	84.0	89.0					17																	33984625		2203	4300	6503	SO:0001583	missense	163	exon14			ACTGATGCAGGTG	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.1804G>T	17.37:g.33984625G>T	ENSP00000262325:p.Ala602Ser		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	92	0.05	5	NM_001030006	34	0.00	0	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398681	0.25205	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.36340	1.54;1.5;1.26;1.5	5.99	5.99	0.97316	.	0.155815	0.64402	D	0.000014	T	0.19886	0.0478	N	0.11284	0.12	0.80722	D	1	B;B;B;B	0.18741	0.03;0.0;0.0;0.0	B;B;B;B	0.18871	0.023;0.0;0.0;0.001	T	0.14090	-1.0485	10	0.13470	T	0.59	0.0711	12.7288	0.57187	0.0741:0.0:0.9259:0.0	.	339;564;602;602	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	S	602;602;545;602;339	ENSP00000262325:A602S;ENSP00000314414:A602S;ENSP00000440563:A545S;ENSP00000437413:A602S	ENSP00000262325:A602S	A	+	1	0	AP2B1	31008738	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.001000	0.63946	2.840000	0.97914	0.655000	0.94253	GCA			0.428	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000448969.1			
CD300C	10871	mdanderson.org	37	17	72537829	72537829	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:72537829G>T	ENST00000330793.1	-	4	934	c.574C>A	c.(574-576)Ctg>Atg	p.L192M		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	192					cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						AGCAGGGGCAGCTCCAAGAGG	0.612																																					p.L192M	Esophageal Squamous(66;421 1121 20537 25337 27468)												.	.			0			c.C574A												98.0	77.0	84.0					17																	72537829		2203	4300	6503	SO:0001583	missense	10871	exon4			GGGGCAGCTCCAA	BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.574C>A	17.37:g.72537829G>T	ENSP00000329507:p.Leu192Met		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_006678	6	0.00	0		Missense_Mutation	SNP	ENST00000330793.1	37	CCDS11701.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726574	0.48833	.	.	ENSG00000167850	ENST00000330793	T	0.04015	3.73	4.74	-1.17	0.09648	.	0.428687	0.16874	N	0.195993	T	0.08088	0.0202	L	0.37697	1.125	0.21697	N	0.999589	D	0.71674	0.998	D	0.64506	0.926	T	0.22103	-1.0226	10	0.48119	T	0.1	.	3.8162	0.08817	0.1218:0.3962:0.3708:0.1112	.	192	Q08708	CLM6_HUMAN	M	192	ENSP00000329507:L192M	ENSP00000329507:L192M	L	-	1	2	CD300C	70049424	0.673000	0.27539	0.979000	0.43373	0.565000	0.35776	-0.379000	0.07437	-0.017000	0.14103	0.586000	0.80456	CTG			0.612	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000145084.1		NM_006678	
ICT1	3396	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	73016470	73016470	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:73016470C>T	ENST00000301585.5	+	4	359	c.346C>T	c.(346-348)Cgg>Tgg	p.R116W		NM_001545.1	NP_001536.1	Q14197	ICT1_HUMAN	immature colon carcinoma transcript 1	116					mitochondrial translational termination (GO:0070126)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	aminoacyl-tRNA hydrolase activity (GO:0004045)|translation release factor activity, codon nonspecific (GO:0016150)	p.R116R(1)		NS(1)|central_nervous_system(1)|lung(2)|ovary(1)|urinary_tract(1)	6	all_lung(278;0.226)					GGAGCCCGTGCGGCAGAAGAT	0.512																																					p.R116W													ICT1,medulla,primitive_neuroectodermal_tumour-medulloblastoma,0,1	ICT1	0	1	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C346T												51.0	51.0	51.0					17																	73016470		2203	4300	6503	SO:0001583	missense	3396	exon4			CCCGTGCGGCAGA	X81788	CCDS11711.1	17q25	2014-02-12				ENSG00000167862			5359	protein-coding gene	gene with protein product		603000				8575443, 20186120	Standard	NM_001545		Approved	DS-1	uc002jmm.3	Q14197		ENST00000301585.5:c.346C>T	17.37:g.73016470C>T	ENSP00000301585:p.Arg116Trp		Somatic	166	0	0		WXS	Illumina HiSeq	.	149	0.07	10	NM_001545	68	0.10	7	B2RAD1|Q53HM7|Q53Y11	Missense_Mutation	SNP	ENST00000301585.5	37	CCDS11711.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838771	0.51057	.	.	ENSG00000167862	ENST00000301585	T	0.38077	1.16	5.91	2.79	0.32731	Peptide chain release factor class I/class II (1);	0.057749	0.64402	D	0.000002	T	0.64057	0.2564	M	0.87038	2.855	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.70710	-0.4797	10	0.87932	D	0	-27.1497	14.6031	0.68456	0.5181:0.4819:0.0:0.0	.	116	Q14197	ICT1_HUMAN	W	116	ENSP00000301585:R116W	ENSP00000301585:R116W	R	+	1	2	ICT1	70528065	1.000000	0.71417	0.992000	0.48379	0.237000	0.25408	1.220000	0.32491	0.378000	0.24764	-0.953000	0.02652	CGG			0.512	ICT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445314.1		NM_001545	
TRIM65	201292	mdanderson.org	37	17	73888874	73888874	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr17:73888874G>T	ENST00000269383.3	-	2	537	c.472C>A	c.(472-474)Cag>Aag	p.Q158K		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	158						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCTAGTAGCTGGCCTTCGGCC	0.667																																					p.Q158K													.	.			0			c.C472A												49.0	44.0	45.0					17																	73888874		2203	4300	6503	SO:0001583	missense	201292	exon2			GTAGCTGGCCTTC	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.472C>A	17.37:g.73888874G>T	ENSP00000269383:p.Gln158Lys		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	28	0.14	4	NM_001256124	8	0.00	0	Q4G0F0|Q6DKJ6|Q9BRP6	Missense_Mutation	SNP	ENST00000269383.3	37	CCDS11732.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.22|10.22	1.290055|1.290055	0.23478|0.23478	.|.	.|.	ENSG00000141569|ENSG00000141569	ENST00000540128|ENST00000269383	.|T	.|0.55052	.|0.54	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	.|0.000000	.|0.44285	.|D	.|0.000466	T|T	0.30008|0.30008	0.0751|0.0751	N|N	0.08118|0.08118	0|0	0.27946|0.27946	N|N	0.937347|0.937347	.|B	.|0.17667	.|0.023	.|B	.|0.24974	.|0.057	T|T	0.08953|0.08953	-1.0697|-1.0697	5|10	.|0.06099	.|T	.|0.92	.|.	13.6113|13.6113	0.62080|0.62080	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|158	.|Q6PJ69	.|TRI65_HUMAN	Q|K	149|158	.|ENSP00000269383:Q158K	.|ENSP00000269383:Q158K	P|Q	-|-	2|1	0|0	TRIM65|TRIM65	71400469|71400469	0.916000|0.916000	0.31088|0.31088	0.933000|0.933000	0.37362|0.37362	0.016000|0.016000	0.09150|0.09150	2.301000|2.301000	0.43628|0.43628	2.358000|2.358000	0.79984|0.79984	0.556000|0.556000	0.70494|0.70494	CCA|CAG			0.667	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255170.2		NM_173547	
AP3D1	8943	broad.mit.edu	37	19	2116651	2116651	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:2116651G>T	ENST00000345016.5	-	17	2185	c.1954C>A	c.(1954-1956)Cgt>Agt	p.R652S	AP3D1_ENST00000350812.6_Missense_Mutation_p.R483S|AP3D1_ENST00000355272.6_Missense_Mutation_p.R652S|AP3D1_ENST00000356926.4_Missense_Mutation_p.R561S	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	652					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCTTGGGACGCCGCTGCTCC	0.692																																					p.R652S													AP3D1,NS,carcinoma,+1,1	AP3D1	81	1	0			c.C1954A												24.0	26.0	26.0					19																	2116651		2107	4226	6333	SO:0001583	missense	8943	exon17			TGGGACGCCGCTG	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1954C>A	19.37:g.2116651G>T	ENSP00000344055:p.Arg652Ser		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	83	0.05	4	NM_001261826	26	0.00	0	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	G	4.477	0.088375	0.08583	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.62232	2.31;0.04;1.68;0.04	5.16	4.09	0.47781	.	0.297579	0.41396	D	0.000892	T	0.32675	0.0837	N	0.01352	-0.895	0.21473	N	0.999672	B;B;B	0.20780	0.002;0.016;0.048	B;B;B	0.28849	0.006;0.055;0.095	T	0.18335	-1.0340	10	0.07175	T	0.84	-1.9319	14.5289	0.67909	0.0:0.1475:0.8525:0.0	.	652;652;561	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	S	561;652;652;652;483	ENSP00000349398:R561S;ENSP00000344055:R652S;ENSP00000347416:R652S;ENSP00000342321:R483S	ENSP00000341579:R652S	R	-	1	0	AP3D1	2067651	1.000000	0.71417	0.010000	0.14722	0.086000	0.17979	7.845000	0.86875	1.127000	0.42034	0.561000	0.74099	CGT			0.692	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000450912.1			
TMIGD2	126259	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	4292623	4292623	+	Silent	SNP	T	T	C			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:4292623T>C	ENST00000301272.2	-	5	867	c.822A>G	c.(820-822)aaA>aaG	p.K274K	TMIGD2_ENST00000600349.1_Silent_p.K102K|TMIGD2_ENST00000595645.1_Silent_p.K270K|TMIGD2_ENST00000600114.1_Silent_p.K154K	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	274	Pro-rich.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGGAACCCTTTTGGCCTCG	0.642																																					p.K274K													.	.			0			c.A822G												91.0	102.0	98.0					19																	4292623		2203	4300	6503	SO:0001819	synonymous_variant	126259	exon5			GAACCCTTTTGGC	BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.822A>G	19.37:g.4292623T>C			Somatic	81	0	0		WXS	Illumina HiSeq	.	93	0.04	4	NM_144615	16	0.00	0	Q6UW59	Silent	SNP	ENST00000301272.2	37	CCDS12126.1																																																																																					0.642	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000458088.1		NM_144615	
PTPRS	5802	broad.mit.edu	37	19	5212058	5212058	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:5212058G>T	ENST00000587303.1	-	31	5072	c.4973C>A	c.(4972-4974)gCa>gAa	p.A1658E	PTPRS_ENST00000353284.2_Missense_Mutation_p.A1211E|PTPRS_ENST00000357368.4_Missense_Mutation_p.A1658E|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000592099.1_Missense_Mutation_p.A1211E|PTPRS_ENST00000262963.6_Missense_Mutation_p.A1638E|PTPRS_ENST00000372412.4_Missense_Mutation_p.A1659E|PTPRS_ENST00000588012.1_Missense_Mutation_p.A1620E|PTPRS_ENST00000348075.2_Missense_Mutation_p.A1620E			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1658					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GAGGCTGCGTGCGGGCACTTC	0.627																																					p.A1658E													.	PTPRS	169		0			c.C4973A												62.0	57.0	59.0					19																	5212058		2203	4300	6503	SO:0001583	missense	5802	exon32			CTGCGTGCGGGCA	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4973C>A	19.37:g.5212058G>T	ENSP00000467537:p.Ala1658Glu		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_002850	13	0.00	0	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541823	0.45280	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	2.47	2.47	0.30058	.	0.170258	0.36815	U	0.002395	T	0.62258	0.2413	M	0.92367	3.3	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.995;0.999;0.997;0.998;0.998	T	0.74080	-0.3780	10	0.87932	D	0	.	13.3072	0.60359	0.0:0.0:1.0:0.0	.	1240;1211;1215;1620;1658;1253	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	E	1253;1659;1658;1658;1649;1638;1620;1240;1215;1211	ENSP00000361489:A1659E;ENSP00000349932:A1658E;ENSP00000262963:A1638E;ENSP00000269907:A1620E;ENSP00000327313:A1211E	ENSP00000262963:A1638E	A	-	2	0	PTPRS	5163058	1.000000	0.71417	0.048000	0.18961	0.053000	0.15095	9.493000	0.97960	1.399000	0.46721	0.478000	0.44815	GCA			0.627	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000450762.2			
EVI5L	115704	mdanderson.org	37	19	7927945	7927945	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:7927945G>T	ENST00000270530.4	+	17	2198	c.2002G>T	c.(2002-2004)Gag>Tag	p.E668*	EVI5L_ENST00000538904.2_Nonsense_Mutation_p.E679*	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	668					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						TGCCGAGCTGGAGATCCAGGT	0.761																																					p.E679X													.	.			0			c.G2035T												6.0	6.0	6.0					19																	7927945		2071	4088	6159	SO:0001587	stop_gained	115704	exon17			GAGCTGGAGATCC	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.2002G>T	19.37:g.7927945G>T	ENSP00000270530:p.Glu668*		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_001159944	14	0.00	0	B9A6I9	Nonsense_Mutation	SNP	ENST00000270530.4	37	CCDS12188.1	.	.	.	.	.	.	.	.	.	.	G	39	7.361871	0.98235	.	.	ENSG00000142459	ENST00000270530;ENST00000538904	.	.	.	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-17.695	15.567	0.76300	0.0:0.0:1.0:0.0	.	.	.	.	X	668;679	.	ENSP00000270530:E668X	E	+	1	0	EVI5L	7833945	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	8.619000	0.90938	2.278000	0.76064	0.484000	0.47621	GAG			0.761	EVI5L-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000461347.1		NM_145245	
CCDC105	126402	mdanderson.org	37	19	15122038	15122038	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:15122038G>T	ENST00000292574.3	+	1	483	c.401G>T	c.(400-402)cGc>cTc	p.R134L	SLC1A6_ENST00000430939.2_5'Flank	NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	134						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CGTGGAGCGCGCCTCACCGCC	0.741																																					p.R134L													.	.			0			c.G401T												4.0	5.0	5.0					19																	15122038		1965	3775	5740	SO:0001583	missense	126402	exon1			GAGCGCGCCTCAC	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.401G>T	19.37:g.15122038G>T	ENSP00000292574:p.Arg134Leu		Somatic	35	0.0285714286	1		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_173482	0		0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291135	0.80914	.	.	ENSG00000160994	ENST00000292574	T	0.41400	1.0	3.77	3.77	0.43336	.	0.000000	0.47093	D	0.000258	T	0.59756	0.2217	M	0.67953	2.075	0.34957	D	0.751797	D	0.89917	1.0	D	0.87578	0.998	T	0.71958	-0.4435	10	0.72032	D	0.01	-14.7466	11.103	0.48186	0.0:0.0:1.0:0.0	.	134	Q8IYK2	CC105_HUMAN	L	134	ENSP00000292574:R134L	ENSP00000292574:R134L	R	+	2	0	CCDC105	14983038	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.434000	0.52841	1.644000	0.50603	0.462000	0.41574	CGC			0.741	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466293.1		NM_173482	
FAM187B	148109	mdanderson.org	37	19	35719549	35719549	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:35719549G>T	ENST00000324675.3	-	1	83	c.35C>A	c.(34-36)gCt>gAt	p.A12D		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	12						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						TGCCGGGGCAGCAAAGTGGAG	0.577																																					p.A12D													.	.			0			c.C35A												28.0	32.0	31.0					19																	35719549		2203	4298	6501	SO:0001583	missense	148109	exon1			GGGGCAGCAAAGT	AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.35C>A	19.37:g.35719549G>T	ENSP00000323355:p.Ala12Asp		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_152481	0		0	Q8N7G6	Missense_Mutation	SNP	ENST00000324675.3	37	CCDS12448.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750100	0.49257	.	.	ENSG00000177558	ENST00000324675	T	0.27256	1.68	4.77	2.56	0.30785	.	0.890112	0.09577	N	0.783357	T	0.32615	0.0835	L	0.27053	0.805	0.09310	N	1	D	0.71674	0.998	D	0.64410	0.925	T	0.15578	-1.0432	10	0.72032	D	0.01	-5.2482	6.4391	0.21839	0.0994:0.185:0.7156:0.0	.	12	Q17R55	F187B_HUMAN	D	12	ENSP00000323355:A12D	ENSP00000323355:A12D	A	-	2	0	FAM187B	40411389	0.004000	0.15560	0.001000	0.08648	0.017000	0.09413	1.400000	0.34577	0.697000	0.31718	0.585000	0.79938	GCT			0.577	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378854.1		NM_152481	
TMEM147	10430	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36038332	36038332	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:36038332G>T	ENST00000222284.5	+	7	803	c.658G>T	c.(658-660)Gtc>Ttc	p.V220F	AD000090.2_ENST00000590717.1_RNA|TMEM147_ENST00000392204.2_Missense_Mutation_p.V171F|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000444728.1_RNA	NM_032635.3	NP_116024.1	Q9BVK8	TM147_HUMAN	transmembrane protein 147	220						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TGTCGCCGTTGTCAATGTGCA	0.542																																					p.V220F													.	TMEM147	13		0			c.G658T												65.0	47.0	53.0					19																	36038332		2203	4300	6503	SO:0001583	missense	10430	exon7			GCCGTTGTCAATG	BC001118	CCDS12466.1, CCDS56091.1	19q13.12	2010-08-13			ENSG00000105677	ENSG00000105677			30414	protein-coding gene	gene with protein product		613585				20538592	Standard	NM_032635		Approved	NIFIE14, MGC1936	uc002oaj.2	Q9BVK8	OTTHUMG00000048105	ENST00000222284.5:c.658G>T	19.37:g.36038332G>T	ENSP00000222284:p.Val220Phe		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	72	0.08	6	NM_032635	347	0.28	97	A8MWW0|O75790	Missense_Mutation	SNP	ENST00000222284.5	37	CCDS12466.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114992	0.77210	.	.	ENSG00000105677	ENST00000392204;ENST00000222284	T;T	0.51574	0.7;0.7	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.64103	0.2568	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;0.978	D;P	0.83275	0.996;0.694	T	0.63528	-0.6617	10	0.62326	D	0.03	.	17.6113	0.88054	0.0:0.0:1.0:0.0	.	171;220	A8MWW0;Q9BVK8	.;TM147_HUMAN	F	171;220	ENSP00000376040:V171F;ENSP00000222284:V220F	ENSP00000222284:V220F	V	+	1	0	TMEM147	40730172	1.000000	0.71417	0.975000	0.42487	0.928000	0.56348	5.040000	0.64191	2.771000	0.95319	0.591000	0.81541	GTC			0.542	TMEM147-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109469.2		NM_032635	
ZNF585A	199704	broad.mit.edu	37	19	37643731	37643731	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:37643731G>T	ENST00000356958.4	-	5	1328	c.1070C>A	c.(1069-1071)aCt>aAt	p.T357N	ZNF585A_ENST00000355533.2_Missense_Mutation_p.T302N|ZNF585A_ENST00000292841.5_Missense_Mutation_p.T302N|ZNF585A_ENST00000392157.2_Missense_Mutation_p.T302N|ZNF585A_ENST00000588723.1_Intron			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCCACACTCAGTACATATGGA	0.408																																					p.T302N													.	ZNF585A	117		0			c.C905A												108.0	105.0	106.0					19																	37643731		2203	4300	6503	SO:0001583	missense	199704	exon6			CACTCAGTACATA	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1070C>A	19.37:g.37643731G>T	ENSP00000349440:p.Thr357Asn		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	144	0.03	5	NM_199126	0		0	Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	37		.	.	.	.	.	.	.	.	.	.	G	0.001	-2.883977	0.00061	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157;ENST00000355533	T;T;T;T	0.07444	3.19;3.19;3.19;5.46	3.13	0.555	0.17247	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.420757	0.17554	N	0.170062	T	0.03011	0.0089	N	0.04768	-0.165	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.46484	-0.9188	10	0.02654	T	1	.	8.8285	0.35069	0.0:0.0:0.6088:0.3912	.	357	Q6P3V2	Z585A_HUMAN	N	357;302;302;302	ENSP00000349440:T357N;ENSP00000292841:T302N;ENSP00000375998:T302N;ENSP00000347724:T302N	ENSP00000292841:T302N	T	-	2	0	ZNF585A	42335571	0.000000	0.05858	0.373000	0.26003	0.075000	0.17131	-6.266000	0.00073	0.592000	0.29728	0.561000	0.74099	ACT			0.408	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000457980.2		NM_152655	
PSG6	5675	mdanderson.org	37	19	43411800	43411800	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:43411800C>A	ENST00000292125.2	-	4	957	c.913G>T	c.(913-915)Gga>Tga	p.G305*	PSG6_ENST00000402603.4_Intron|PSG6_ENST00000187910.2_Nonsense_Mutation_p.G305*	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	305	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				TGATAGGGTCCTGTTTCATTT	0.507																																					p.G305X													.	.			0			c.G913T												171.0	163.0	165.0					19																	43411800		2202	4295	6497	SO:0001587	stop_gained	5675	exon4			AGGGTCCTGTTTC		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.913G>T	19.37:g.43411800C>A	ENSP00000292125:p.Gly305*		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	66	0.06	4	NM_002782	0		0	O75244|Q15224|Q15235|Q549K1	Nonsense_Mutation	SNP	ENST00000292125.2	37	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	15.86	2.957815	0.53400	.	.	ENSG00000170848	ENST00000187910;ENST00000292125	.	.	.	1.42	1.42	0.22433	.	.	.	.	.	.	.	.	.	.	.	0.19575	N	0.999968	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.2927	0.21069	0.0:1.0:0.0:0.0	.	.	.	.	X	305	.	ENSP00000187910:G305X	G	-	1	0	PSG6	48103640	0.006000	0.16342	0.300000	0.25030	0.079000	0.17450	1.877000	0.39598	0.792000	0.33850	0.134000	0.15878	GGA			0.507	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000321436.1		NM_002782	
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56223293	56223293	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr19:56223293C>T	ENST00000332836.2	-	8	2743	c.2716G>A	c.(2716-2718)Gcc>Acc	p.A906T	CTD-2611O12.7_ENST00000597680.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	906						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGTGCTGCGGCGATGTCGTCG	0.567																																					p.A906T													.	.			0			c.G2716A												92.0	77.0	82.0					19																	56223293		2202	4299	6501	SO:0001583	missense	338321	exon8			CTGCGGCGATGTC	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2716G>A	19.37:g.56223293C>T	ENSP00000331857:p.Ala906Thr		Somatic	147	0	0		WXS	Illumina HiSeq	.	128	0.06	8	NM_176820	486	0.19	93	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829220	0.50845	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.41400	1.0	3.24	2.18	0.27775	.	.	.	.	.	T	0.51568	0.1682	L	0.57536	1.79	0.09310	N	1	D	0.71674	0.998	P	0.59115	0.852	T	0.32955	-0.9887	9	0.62326	D	0.03	.	7.7766	0.29041	0.2493:0.7507:0.0:0.0	.	906	Q7RTR0	NALP9_HUMAN	T	906	ENSP00000331857:A906T	ENSP00000331857:A906T	A	-	1	0	NLRP9	60915105	0.005000	0.15991	0.063000	0.19743	0.023000	0.10783	-0.133000	0.10451	0.936000	0.37367	0.655000	0.94253	GCC			0.567	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453653.1		NM_176820	
ANKRD36C	400986	broad.mit.edu	37	2	96643928	96643928	+	Missense_Mutation	SNP	T	T	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr2:96643928T>A	ENST00000456556.1	-	6	825	c.741A>T	c.(739-741)gaA>gaT	p.E247D				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	247							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						CATAAATTAGTTCAAAAATGC	0.234																																					.													.	.			0			.																																									SO:0001583	missense	400986	.			AATTAGTTCAAAA	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.741A>T	2.37:g.96643928T>A	ENSP00000403302:p.Glu247Asp		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	62	0.08	5	.	0		0	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	t	3.969	-0.008849	0.07727	.	.	ENSG00000174501	ENST00000456556	T	0.54479	0.57	1.26	1.26	0.21427	.	.	.	.	.	T	0.21881	0.0527	N	0.02539	-0.55	0.09310	N	1	.	.	.	.	.	.	T	0.15665	-1.0429	7	0.27082	T	0.32	.	4.7512	0.13061	0.0:0.0:0.0:1.0	.	.	.	.	D	247	ENSP00000403302:E247D	ENSP00000403302:E247D	E	-	3	2	AC073995.2	96007655	0.007000	0.16637	0.015000	0.15790	0.008000	0.06430	1.196000	0.32198	0.854000	0.35336	0.147000	0.16070	GAA			0.234	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000338799.2		NM_001010914	
ANKRD36B	57730	broad.mit.edu	37	2	98192550	98192550	+	RNA	DEL	T	T	-	rs370632971|rs67020980		TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr2:98192550delT	ENST00000443455.1	-	0	874							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		CATGTGACTATTAAAAAAATA	0.184																																					.													.	.			0			.																																											57730	.			TGACTATTAAAAA	AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98192550delT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	10	0.40	4	.	0		0	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	DEL	ENST00000443455.1	37																																																																																						0.184	ANKRD36B-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000328967.2		NM_025190	
CPS1	1373	broad.mit.edu	37	2	211507237	211507237	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr2:211507237G>T	ENST00000233072.5	+	25	3185	c.2989G>T	c.(2989-2991)Gtc>Ttc	p.V997F	CPS1_ENST00000430249.2_Missense_Mutation_p.V1003F|CPS1_ENST00000451903.2_Missense_Mutation_p.V546F|CPS1_ENST00000497121.1_3'UTR	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	997					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTGGTGTGCTGTCTCTAGTAT	0.453																																					p.V1003F													.	CPS1	485		0			c.G3007T												158.0	142.0	147.0					2																	211507237		2203	4300	6503	SO:0001583	missense	1373	exon26			TGTGCTGTCTCTA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2989G>T	2.37:g.211507237G>T	ENSP00000233072:p.Val997Phe		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	163	0.03	5	NM_001122633	3	0.00	0	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	33	5.276682	0.95459	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.98105	-4.72;-4.72;-4.72	6.16	6.16	0.99307	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99438	0.9801	H	0.99225	4.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98117	1.0423	10	0.72032	D	0.01	-11.3824	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1007;997	Q59HF8;P31327	.;CPSM_HUMAN	F	1003;1005;997;546	ENSP00000402608:V1003F;ENSP00000233072:V997F;ENSP00000406136:V546F	ENSP00000233072:V997F	V	+	1	0	CPS1	211215482	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.110000	0.94302	2.937000	0.99478	0.650000	0.86243	GTC			0.453	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256569.5			
SNED1	25992	mdanderson.org	37	2	241979822	241979822	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr2:241979822G>T	ENST00000310397.8	+	8	1265	c.1265G>T	c.(1264-1266)tGt>tTt	p.C422F	AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000342631.6_Missense_Mutation_p.C422F|SNED1_ENST00000401884.1_Missense_Mutation_p.C422F|SNED1_ENST00000405547.3_Missense_Mutation_p.C422F	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	422	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GGACTTCGCTGTGAGACAGGT	0.582																																					p.C422F													.	.			0			c.G1265T												48.0	52.0	51.0					2																	241979822		2083	4199	6282	SO:0001583	missense	25992	exon8			TTCGCTGTGAGAC	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.1265G>T	2.37:g.241979822G>T	ENSP00000308893:p.Cys422Phe		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001080437	0		0	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.70|11.70	1.717025|1.717025	0.30413|0.30413	.|.	.|.	ENSG00000162804|ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631;ENST00000420591|ENST00000431690	D;D;D;D;T|.	0.96265|.	-3.96;-3.96;-3.96;-3.96;-1.43|.	4.67|4.67	3.79|3.79	0.43588|0.43588	EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.64402|.	D|.	0.000018|.	D|D	0.91023|0.91023	0.7176|0.7176	H|H	0.99877|0.99877	4.88|4.88	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.93213|0.93213	0.6602|0.6602	10|5	0.87932|.	D|.	0|.	.|.	12.3049|12.3049	0.54895|0.54895	0.0839:0.0:0.9161:0.0|0.0839:0.0:0.9161:0.0	.|.	422|.	Q8TER0|.	SNED1_HUMAN|.	F|L	422;422;422;422;60|80	ENSP00000384871:C422F;ENSP00000386007:C422F;ENSP00000308893:C422F;ENSP00000342992:C422F;ENSP00000394324:C60F|.	ENSP00000308893:C422F|.	C|V	+|+	2|1	0|0	SNED1|SNED1	241628495|241628495	1.000000|1.000000	0.71417|0.71417	0.112000|0.112000	0.21494|0.21494	0.005000|0.005000	0.04900|0.04900	8.615000|8.615000	0.90920|0.90920	0.943000|0.943000	0.37553|0.37553	-0.218000|-0.218000	0.12543|0.12543	TGT|GTG			0.582	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323935.2		XM_059482	
NCOA6	23054	broad.mit.edu	37	20	33345723	33345723	+	Silent	SNP	C	C	T	rs546356291	byFrequency	TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr20:33345723C>T	ENST00000374796.2	-	8	3398	c.828G>A	c.(826-828)caG>caA	p.Q276Q	NCOA6_ENST00000359003.2_Silent_p.Q276Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	276	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgttgttgctgctgctgct	0.537													C|||	3	0.000599042	0.0	0.0	5008	,	,		18338	0.002		0.0	False		,,,				2504	0.001				p.Q276Q													.	NCOA6	219		0			c.G828A												93.0	71.0	78.0					20																	33345723		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			TTGTTGCTGCTGC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.828G>A	20.37:g.33345723C>T			Somatic	81	0.024691358	2		WXS	Illumina HiSeq	Phase_I	82	0.06	5	NM_014071	0		0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																					0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078811.2		NM_014071	
COL9A3	1299	mdanderson.org	37	20	61461161	61461161	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr20:61461161G>A	ENST00000343916.3	+	22	1154	c.1151G>A	c.(1150-1152)cGg>cAg	p.R384Q		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	384	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					GCTGGCCACCGGGGCTCAGCG	0.662																																					p.R384Q													.	.			0			c.G1151A												24.0	25.0	25.0					20																	61461161		2175	4279	6454	SO:0001583	missense	1299	exon22			GCCACCGGGGCTC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1151G>A	20.37:g.61461161G>A	ENSP00000341640:p.Arg384Gln		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001853	6	0.00	0	Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	37	CCDS13505.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853197	0.71719	.	.	ENSG00000092758	ENST00000343916	D	0.93307	-3.2	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.93141	0.7816	L	0.31578	0.945	0.49389	D	0.999781	D	0.71674	0.998	D	0.79108	0.992	D	0.90266	0.4304	10	0.16420	T	0.52	.	13.4919	0.61399	0.0:0.0:1.0:0.0	.	384	Q14050	CO9A3_HUMAN	Q	384	ENSP00000341640:R384Q	ENSP00000341640:R384Q	R	+	2	0	COL9A3	60931606	0.524000	0.26282	1.000000	0.80357	0.501000	0.33797	1.655000	0.37345	2.326000	0.78906	0.462000	0.41574	CGG			0.662	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080071.2		NM_001853	
IGSF11	152404	broad.mit.edu	37	3	118623632	118623632	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr3:118623632G>T	ENST00000393775.2	-	6	1022	c.717C>A	c.(715-717)aaC>aaA	p.N239K	IGSF11_ENST00000491903.1_Intron|IGSF11_ENST00000441144.2_Missense_Mutation_p.N214K|IGSF11_ENST00000489689.1_Missense_Mutation_p.N215K|IGSF11_ENST00000425327.2_Missense_Mutation_p.N238K|IGSF11_ENST00000354673.2_Missense_Mutation_p.N238K	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	239					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTAGTCCAATGTTCCTGGGCT	0.353																																					p.N239K													.	IGSF11	122		0			c.C717A												95.0	108.0	103.0					3																	118623632		2200	4300	6500	SO:0001583	missense	152404	exon6			TCCAATGTTCCTG	AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.717C>A	3.37:g.118623632G>T	ENSP00000377370:p.Asn239Lys		Somatic	389	0	0		WXS	Illumina HiSeq	Phase_I	341	0.01	4	NM_001015887	0		0	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Missense_Mutation	SNP	ENST00000393775.2	37	CCDS46891.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945627	0.34377	.	.	ENSG00000144847	ENST00000425327;ENST00000393775;ENST00000489689;ENST00000354673;ENST00000441144	T;T;D;T;D	0.84873	-0.99;-1.2;-1.91;-0.99;-1.8	5.52	3.71	0.42584	.	0.154637	0.64402	D	0.000001	T	0.66858	0.2832	N	0.08118	0	0.22500	N	0.999048	B;B;B;B	0.20164	0.01;0.034;0.042;0.02	B;B;B;B	0.21917	0.022;0.022;0.037;0.016	T	0.51309	-0.8722	10	0.11485	T	0.65	.	8.921	0.35612	0.2864:0.0:0.7136:0.0	.	214;238;215;239	Q5DX21-3;Q5DX21-2;C9JMW0;Q5DX21	.;.;.;IGS11_HUMAN	K	238;239;215;238;214	ENSP00000406092:N238K;ENSP00000377370:N239K;ENSP00000420486:N215K;ENSP00000346700:N238K;ENSP00000401240:N214K	ENSP00000346700:N238K	N	-	3	2	IGSF11	120106322	0.954000	0.32549	0.982000	0.44146	0.993000	0.82548	0.333000	0.19768	1.579000	0.49836	0.655000	0.94253	AAC			0.353	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355075.2			
MFSD7	84179	mdanderson.org	37	4	676590	676590	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr4:676590T>C	ENST00000404286.2	-	9	1259	c.1244A>G	c.(1243-1245)gAg>gGg	p.E415G	MFSD7_ENST00000322224.4_Missense_Mutation_p.E414G|MFSD7_ENST00000515118.1_Missense_Mutation_p.E318G|MFSD7_ENST00000347950.5_Missense_Mutation_p.E296G|MFSD7_ENST00000503156.1_Missense_Mutation_p.E350G	NM_032219.2	NP_115595.2	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing 7	415					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				cervix(1)|kidney(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	11						AAGTGGATCCTCCCCCTGCTG	0.617																																					p.E414G													.	.			0			c.A1241G												57.0	47.0	51.0					4																	676590		2200	4296	6496	SO:0001583	missense	84179	exon9			GGATCCTCCCCCT	AK025922	CCDS3338.1, CCDS75086.1	4p16.3	2013-05-22			ENSG00000169026	ENSG00000169026		"""Solute carriers"""	26177	protein-coding gene	gene with protein product						12975309	Standard	XM_005272295		Approved	FLJ22269, LP2561	uc003gax.3	Q6UXD7	OTTHUMG00000119001	ENST00000404286.2:c.1244A>G	4.37:g.676590T>C	ENSP00000384616:p.Glu415Gly		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_032219	12	0.00	0	A8K7J5|Q6XYD4|Q8N6H1|Q9H6H6	Missense_Mutation	SNP	ENST00000404286.2	37		.	.	.	.	.	.	.	.	.	.	T	9.179	1.022985	0.19433	.	.	ENSG00000169026	ENST00000347950;ENST00000322224;ENST00000404286;ENST00000515118;ENST00000503156	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	4.22	4.22	0.49857	Major facilitator superfamily domain, general substrate transporter (1);	0.320149	0.25735	N	0.028648	T	0.23289	0.0563	L	0.44542	1.39	0.22827	N	0.99868	B;B;B;B;B	0.31968	0.349;0.071;0.068;0.002;0.015	B;B;B;B;B	0.27380	0.079;0.014;0.03;0.005;0.005	T	0.13202	-1.0518	10	0.34782	T	0.22	-21.1029	9.9195	0.41455	0.0:0.0:0.0:1.0	.	350;318;296;415;414	D6RIZ6;D6R9R0;Q6UXD7-3;Q6UXD7;Q6UXD7-2	.;.;.;MFSD7_HUMAN;.	G	296;414;415;318;350	ENSP00000307545:E296G;ENSP00000320234:E414G;ENSP00000384616:E415G;ENSP00000423204:E318G;ENSP00000425753:E350G	ENSP00000320234:E414G	E	-	2	0	MFSD7	666590	0.043000	0.20138	0.416000	0.26546	0.074000	0.17049	1.500000	0.35682	1.898000	0.54952	0.456000	0.33151	GAG			0.617	MFSD7-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000358585.1		NM_032219	
RBM46	166863	broad.mit.edu	37	4	155720331	155720331	+	Silent	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr4:155720331C>T	ENST00000281722.3	+	4	1252	c.1017C>T	c.(1015-1017)agC>agT	p.S339S	RBM46_ENST00000510397.1_Silent_p.S339S|RBM46_ENST00000514866.1_Silent_p.S339S	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	339							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				AAGAAGAGAGCCACCCAAAAA	0.418																																					p.S339S													.	RBM46	76		0			c.C1017T												70.0	75.0	73.0					4																	155720331		2203	4300	6503	SO:0001819	synonymous_variant	166863	exon4			AGAGAGCCACCCA	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.1017C>T	4.37:g.155720331C>T			Somatic	291	0.0034364261	1		WXS	Illumina HiSeq	Phase_I	254	0.02	5	NM_144979	3	0.00	0	B3KWU8|B4DZ27	Silent	SNP	ENST00000281722.3	37	CCDS3790.1																																																																																					0.418	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365259.1		NM_144979	
PRRC2A	7916	mdanderson.org	37	6	31595777	31595777	+	Missense_Mutation	SNP	C	C	T	rs375038051|rs149965706	byFrequency	TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr6:31595777C>T	ENST00000376033.2	+	12	1760	c.1526C>T	c.(1525-1527)gCt>gTt	p.A509V	PRRC2A_ENST00000376007.4_Missense_Mutation_p.A509V	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	509	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GCAGAGCCTGCTGCCCCACCT	0.617																																					p.A509V													.	.			0			c.C1526T												114.0	108.0	110.0					6																	31595777		1511	2709	4220	SO:0001583	missense	7916	exon12			AGCCTGCTGCCCC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1526C>T	6.37:g.31595777C>T	ENSP00000365201:p.Ala509Val		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_004638	14	0.00	0	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.679282	0.29783	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.03745	3.82;3.82	4.6	3.73	0.42828	.	0.129296	0.35646	N	0.003080	T	0.01029	0.0034	N	0.14661	0.345	0.31410	N	0.675618	B	0.02656	0.0	B	0.01281	0.0	T	0.43718	-0.9374	10	0.87932	D	0	-0.8032	10.5385	0.45018	0.0:0.9048:0.0:0.0952	.	509	P48634	PRC2A_HUMAN	V	509;498;509;509	ENSP00000365175:A509V;ENSP00000365201:A509V	ENSP00000365175:A509V	A	+	2	0	PRRC2A	31703756	0.936000	0.31750	0.989000	0.46669	0.911000	0.54048	1.632000	0.37102	1.305000	0.44909	0.549000	0.68633	GCT			0.617	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259319.1		NM_080686	
BEND3	57673	mdanderson.org	37	6	107390550	107390550	+	Silent	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr6:107390550G>T	ENST00000369042.1	-	4	2035	c.1845C>A	c.(1843-1845)cgC>cgA	p.R615R	BEND3_ENST00000429433.2_Silent_p.R615R			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	615	BEN 3. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						GCACGTAGTGGCGGATGAGCT	0.647																																					p.R615R													.	.			0			c.C1845A												21.0	23.0	22.0					6																	107390550		2202	4298	6500	SO:0001819	synonymous_variant	57673	exon5			GTAGTGGCGGATG	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.1845C>A	6.37:g.107390550G>T			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001080450	4	0.00	0	A2RRH2|Q9HCL9	Silent	SNP	ENST00000369042.1	37	CCDS34507.1																																																																																					0.647	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041686.1		NM_020913	
GPC2	221914	mdanderson.org	37	7	99769823	99769823	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr7:99769823C>T	ENST00000292377.2	-	6	1077	c.910G>A	c.(910-912)Gct>Act	p.A304T	GPC2_ENST00000471050.1_5'UTR	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	304					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGCTTATCAGCCAGGATCAGG	0.517																																					p.A304T													.	.			0			c.G910A												53.0	49.0	50.0					7																	99769823		2203	4300	6503	SO:0001583	missense	221914	exon6			TATCAGCCAGGAT	BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.910G>A	7.37:g.99769823C>T	ENSP00000292377:p.Ala304Thr		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_152742	26	0.00	0	A4D2A7	Missense_Mutation	SNP	ENST00000292377.2	37	CCDS5689.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715163	0.68844	.	.	ENSG00000213420	ENST00000292377	T	0.57436	0.4	5.1	4.16	0.48862	.	0.363033	0.28921	N	0.013719	T	0.50240	0.1604	L	0.52011	1.625	0.42256	D	0.991998	D	0.53619	0.961	P	0.48270	0.572	T	0.42189	-0.9466	10	0.20519	T	0.43	-13.4473	12.023	0.53354	0.1736:0.8264:0.0:0.0	.	304	Q8N158	GPC2_HUMAN	T	304	ENSP00000292377:A304T	ENSP00000292377:A304T	A	-	1	0	GPC2	99607759	1.000000	0.71417	0.879000	0.34478	0.787000	0.44495	3.598000	0.54038	2.357000	0.79964	0.484000	0.47621	GCT			0.517	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337556.1		NM_152742	
GIGYF1	64599	mdanderson.org	37	7	100279560	100279560	+	Silent	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr7:100279560G>T	ENST00000275732.5	-	23	4191	c.2982C>A	c.(2980-2982)acC>acA	p.T994T	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	994					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GGCCGAGTTTGGTGCTGTGGT	0.677																																					p.T994T													.	.			0			c.C2982A												31.0	30.0	30.0					7																	100279560		2203	4300	6503	SO:0001819	synonymous_variant	64599	exon23			GAGTTTGGTGCTG	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.2982C>A	7.37:g.100279560G>T			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_022574	120	0.00	0	Q6Y7W7|Q8WZ38	Silent	SNP	ENST00000275732.5	37	CCDS34708.1																																																																																					0.677	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347205.2		NM_022574	
FAM185A	222234	broad.mit.edu	37	7	102401776	102401776	+	Silent	SNP	T	T	G			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr7:102401776T>G	ENST00000413034.2	+	4	711	c.711T>G	c.(709-711)ggT>ggG	p.G237G	FAM185A_ENST00000481697.1_3'UTR|FAM185A_ENST00000409231.3_Silent_p.G120G	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	237										kidney(1)	1						CCGAAGATGGTTTGCTGAAAG	0.383																																					p.G237G													.	FAM185A	10		0			c.T711G												207.0	168.0	180.0					7																	102401776		692	1591	2283	SO:0001819	synonymous_variant	222234	exon4			AGATGGTTTGCTG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.711T>G	7.37:g.102401776T>G			Somatic	432	0.0023148148	1		WXS	Illumina HiSeq	Phase_I	457	0.01	5	NM_001145268	3	0.00	0	A8MUR7|B4DQD3|C9IZ91	Silent	SNP	ENST00000413034.2	37	CCDS47676.1																																																																																					0.383	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349482.1		NM_001145268	
KCND2	3751	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	120385930	120385930	+	Missense_Mutation	SNP	C	C	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr7:120385930C>A	ENST00000331113.4	+	5	2529	c.1564C>A	c.(1564-1566)Caa>Aaa	p.Q522K	RP4-797C5.2_ENST00000450480.1_RNA	NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	522					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	ACTGTCTTCACAACAAGGAGT	0.438																																					p.Q522K													.	KCND2	194		0			c.C1564A												144.0	121.0	129.0					7																	120385930		2203	4300	6503	SO:0001583	missense	3751	exon5			TCTTCACAACAAG	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1564C>A	7.37:g.120385930C>A	ENSP00000333496:p.Gln522Lys		Somatic	240	0.0041666667	1		WXS	Illumina HiSeq	Phase_I	235	0.09	22	NM_012281	0		0	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.57|12.57	1.976715|1.976715	0.34848|0.34848	.|.	.|.	ENSG00000184408|ENSG00000184408	ENST00000425288|ENST00000331113	.|D	.|0.82711	.|-1.64	5.43|5.43	5.43|5.43	0.79202|0.79202	.|Potassium channel, voltage dependent, Kv4, C-terminal (1);	.|0.466098	.|0.23435	.|N	.|0.048204	D|D	0.82527|0.82527	0.5056|0.5056	L|L	0.49126|0.49126	1.545|1.545	0.47214|0.47214	D|D	0.99935|0.99935	.|B	.|0.29341	.|0.242	.|B	.|0.36766	.|0.232	T|T	0.78137|0.78137	-0.2321|-0.2321	5|9	.|.	.|.	.|.	.|.	19.2489|19.2489	0.93914|0.93914	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|522	.|Q9NZV8	.|KCND2_HUMAN	Q|K	107|522	.|ENSP00000333496:Q522K	.|.	H|Q	+|+	3|1	2|0	KCND2|KCND2	120173166|120173166	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	3.273000|3.273000	0.51623|0.51623	2.549000|2.549000	0.85964|0.85964	0.313000|0.313000	0.20887|0.20887	CAC|CAA			0.438	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346996.1		NM_012281	
SGK223	157285	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	8234017	8234017	+	Silent	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr8:8234017C>T	ENST00000520004.1	-	3	2166	c.1902G>A	c.(1900-1902)caG>caA	p.Q634Q	SGK223_ENST00000330777.4_Silent_p.Q634Q			Q86YV5	SG223_HUMAN		636							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CTATCCGGCACTGACGACTCC	0.602																																					p.Q634Q	GBM(34;731 755 10259 33573 33867)												.	.			0			c.G1902A												63.0	71.0	69.0					8																	8234017		1933	4133	6066	SO:0001819	synonymous_variant	0	exon2			CCGGCACTGACGA																												ENST00000520004.1:c.1902G>A	8.37:g.8234017C>T			Somatic	135	0	0		WXS	Illumina HiSeq	.	151	0.07	10	NM_001080826	1	0.00	0	Q8N3N5	Silent	SNP	ENST00000520004.1	37	CCDS43706.1																																																																																					0.602	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374864.1			
RP1L1	94137	bcgsc.ca	37	8	10465990	10465990	+	Missense_Mutation	SNP	T	T	C	rs200622636	byFrequency	TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr8:10465990T>C	ENST00000382483.3	-	4	5841	c.5618A>G	c.(5617-5619)gAt>gGt	p.D1873G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1953					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGCCTCTACATCTTCTGACTC	0.617													T|||	208	0.0415335	0.0068	0.0562	5008	,	,		15764	0.0188		0.0845	False		,,,				2504	0.0573				p.D1873G													.	RP1L1	453		0			c.A5618G												162.0	175.0	171.0					8																	10465990		1917	4128	6045	SO:0001583	missense	94137	exon4			TCTACATCTTCTG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5618A>G	8.37:g.10465990T>C	ENSP00000371923:p.Asp1873Gly		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_1	87	0.16	14	NM_178857	0		0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	T	1.367	-0.587110	0.03827	.	.	ENSG00000183638	ENST00000382483	T	0.07567	3.18	1.24	-2.47	0.06442	.	.	.	.	.	T	0.02380	0.0073	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45833	-0.9234	9	0.21540	T	0.41	.	3.4646	0.07545	0.0:0.5294:0.2597:0.211	.	1873	A6NKC6	.	G	1873	ENSP00000371923:D1873G	ENSP00000371923:D1873G	D	-	2	0	RP1L1	10503400	0.001000	0.12720	0.015000	0.15790	0.046000	0.14306	0.311000	0.19380	-0.308000	0.08792	-0.769000	0.03391	GAT			0.617	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375673.1			
PDE7A	5150	broad.mit.edu	37	8	66695027	66695027	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr8:66695027G>T	ENST00000401827.3	-	2	633	c.190C>A	c.(190-192)Cgt>Agt	p.R64S	PDE7A_ENST00000396642.3_Missense_Mutation_p.R64S|PDE7A_ENST00000379419.4_Missense_Mutation_p.R38S	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	64					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	CCTAGCATACGAATGTATAAT	0.284																																					p.R64S													.	PDE7A	78		0			c.C190A												44.0	44.0	44.0					8																	66695027		2203	4298	6501	SO:0001583	missense	5150	exon2			GCATACGAATGTA	L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.190C>A	8.37:g.66695027G>T	ENSP00000385632:p.Arg64Ser		Somatic	324	0.0030864198	1		WXS	Illumina HiSeq	Phase_I	377	0.02	6	NM_001242318	2	0.00	0	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Missense_Mutation	SNP	ENST00000401827.3	37	CCDS56538.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687689	0.68157	.	.	ENSG00000205268	ENST00000401827;ENST00000379419;ENST00000396642;ENST00000523253	T;T;T;T	0.76968	-1.06;-0.5;-1.06;0.86	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.76870	0.4048	L	0.59436	1.845	0.52501	D	0.999957	P;P;P	0.40230	0.586;0.708;0.632	B;B;B	0.38655	0.197;0.184;0.278	T	0.79897	-0.1609	10	0.66056	D	0.02	.	18.256	0.90020	0.0:0.0:1.0:0.0	.	64;64;38	Q13946-3;Q13946;Q13946-2	.;PDE7A_HUMAN;.	S	64;38;64;38	ENSP00000385632:R64S;ENSP00000368730:R38S;ENSP00000379881:R64S;ENSP00000430262:R38S	ENSP00000368730:R38S	R	-	1	0	PDE7A	66857581	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.033000	0.88852	2.610000	0.88304	0.555000	0.69702	CGT			0.284	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378905.1			
CRH	1392	mdanderson.org	37	8	67089599	67089599	+	Silent	SNP	C	C	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr8:67089599C>T	ENST00000276571.3	-	2	560	c.114G>A	c.(112-114)ccG>ccA	p.P38P		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	38					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	GAGGGTGCTGCGGCGCCTGCC	0.731											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P38P													.	.			0			c.G114A												2.0	3.0	3.0					8																	67089599		1588	3461	5049	SO:0001819	synonymous_variant	1392	exon2			GTGCTGCGGCGCC		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.114G>A	8.37:g.67089599C>T			Somatic	12	0	0	1096	WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_000756	0		0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																					0.731	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378926.1		NM_000756	
FAM122A	116224	mdanderson.org	37	9	71395191	71395191	+	Missense_Mutation	SNP	C	C	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr9:71395191C>A	ENST00000394264.3	+	1	228	c.111C>A	c.(109-111)agC>agA	p.S37R	PIP5K1B_ENST00000541509.1_Intron|PIP5K1B_ENST00000265382.3_Intron	NM_138333.3	NP_612206.3	Q96E09	F122A_HUMAN	family with sequence similarity 122A	37										endometrium(1)|lung(2)	3						GGTCTAACAGCGCCCCCCTGA	0.726																																					p.S37R													.	.			0			c.C111A												8.0	11.0	10.0					9																	71395191		2109	4171	6280	SO:0001583	missense	116224	exon1			TAACAGCGCCCCC	AK126379	CCDS6623.1	9q21.13	2011-02-10	2006-07-11	2006-07-11	ENSG00000187866	ENSG00000187866			23490	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 42"""	C9orf42		12477932	Standard	NM_138333		Approved	MGC17347	uc004agw.1	Q96E09	OTTHUMG00000019971	ENST00000394264.3:c.111C>A	9.37:g.71395191C>A	ENSP00000377807:p.Ser37Arg		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_138333	9	0.00	0		Missense_Mutation	SNP	ENST00000394264.3	37	CCDS6623.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082729	0.76528	.	.	ENSG00000187866	ENST00000394264;ENST00000377279	T	0.57752	0.38	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.73760	0.3628	M	0.84326	2.69	0.39392	D	0.966447	D	0.76494	0.999	D	0.79784	0.993	T	0.78534	-0.2167	10	0.66056	D	0.02	0.0485	14.5215	0.67853	0.0:1.0:0.0:0.0	.	37	Q96E09	F122A_HUMAN	R	37	ENSP00000377807:S37R	ENSP00000366492:S37R	S	+	3	2	FAM122A	70585011	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.466000	0.35310	2.584000	0.87258	0.563000	0.77884	AGC			0.726	FAM122A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052556.1		NM_138333	
C9orf57	138240	mdanderson.org	37	9	74667321	74667321	+	Missense_Mutation	SNP	C	C	T	rs372012691		TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr9:74667321C>T	ENST00000377024.3	-	5	472	c.377G>A	c.(376-378)tGc>tAc	p.C126Y	C9orf57_ENST00000424431.2_Missense_Mutation_p.C92Y	NM_001128618.1	NP_001122090.1	Q5W0N0	CI057_HUMAN	chromosome 9 open reading frame 57	126						integral component of membrane (GO:0016021)		p.C126Y(2)		endometrium(1)	1						GTTCTTTGTGCAGCCTTTGAC	0.438																																					p.C126Y													C9orf57_ENST00000377024,NS,carcinoma,0,2	C9orf57_ENST00000377024	0	2	2	Substitution - Missense(2)	endometrium(2)	c.G377A												203.0	166.0	177.0					9																	74667321		692	1591	2283	SO:0001583	missense	138240	exon5			TTTGTGCAGCCTT	BC036255	CCDS47980.1	9q21.2	2012-03-15			ENSG00000204669	ENSG00000204669			27037	protein-coding gene	gene with protein product						12477932	Standard	NM_001128618		Approved		uc004aip.3	Q5W0N0	OTTHUMG00000020003	ENST00000377024.3:c.377G>A	9.37:g.74667321C>T	ENSP00000366223:p.Cys126Tyr		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	95	0.05	5	NM_001128618	0		0	A1L456	Missense_Mutation	SNP	ENST00000377024.3	37	CCDS47980.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733546	0.48939	.	.	ENSG00000204669	ENST00000377024;ENST00000424431	D;D	0.87334	-2.24;-2.24	4.78	4.78	0.61160	.	0.000000	0.39146	N	0.001448	D	0.88340	0.6410	N	0.24115	0.695	0.35799	D	0.82302	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91353	0.5106	10	0.87932	D	0	-14.3907	13.5057	0.61483	0.0:1.0:0.0:0.0	.	92;126	A1L456;Q5W0N0	.;CI057_HUMAN	Y	126;92	ENSP00000366223:C126Y;ENSP00000412956:C92Y	ENSP00000366223:C126Y	C	-	2	0	C9orf57	73857141	1.000000	0.71417	1.000000	0.80357	0.306000	0.27790	3.137000	0.50562	2.648000	0.89879	0.551000	0.68910	TGC			0.438	C9orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052631.1		NM_001128618	
ZNF883	169834	broad.mit.edu	37	9	115760275	115760276	+	lincRNA	DEL	TT	TT	-			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr9:115760275_115760276delTT	ENST00000427548.1	-	0	1537_1538							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GTATGGACTCTTTGATGCTGAA	0.361																																					p.88_89del													.	.			0			c.264_265del																																											169834	exon5			GGACTCTTTGATG	AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115760275_115760276delTT			Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	136	0.07	9	NM_001101338	4	0.00	0		RNA	DEL	ENST00000427548.1	37																																																																																						0.361	ZNF883-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000053704.1		NM_001101338	
NTNG2	84628	broad.mit.edu	37	9	135073687	135073687	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr9:135073687G>A	ENST00000393229.3	+	3	1324	c.548G>A	c.(547-549)cGc>cAc	p.R183H	NTNG2_ENST00000393228.4_Missense_Mutation_p.R183H|NTNG2_ENST00000372179.3_Missense_Mutation_p.R183H|NTNG2_ENST00000360670.3_Missense_Mutation_p.R183H	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	183	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		CGCCGGGCCCGCGACATGTCA	0.672																																					p.R183H													NTNG2,NS,carcinoma,-1,1	NTNG2	66	1	0			c.G548A												28.0	24.0	25.0					9																	135073687		2196	4287	6483	SO:0001583	missense	84628	exon3			GGGCCCGCGACAT	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.548G>A	9.37:g.135073687G>A	ENSP00000376921:p.Arg183His		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	64	0.05	3	NM_032536	1	0.00	0	Q5JUJ2|Q6UXY0|Q96JH0	Missense_Mutation	SNP	ENST00000393229.3	37	CCDS6946.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243855	0.79912	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670;ENST00000372179	T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92	5.22	5.22	0.72569	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	L	0.31065	0.9	0.49130	D	0.999756	D	0.69078	0.997	P	0.50934	0.654	T	0.66392	-0.5935	10	0.15066	T	0.55	.	17.7699	0.88489	0.0:0.0:1.0:0.0	.	183	Q96CW9	NTNG2_HUMAN	H	183	ENSP00000376921:R183H;ENSP00000376920:R183H;ENSP00000353888:R183H;ENSP00000361252:R183H	ENSP00000353888:R183H	R	+	2	0	NTNG2	134063508	1.000000	0.71417	0.986000	0.45419	0.851000	0.48451	3.967000	0.56802	2.417000	0.82017	0.561000	0.74099	CGC			0.672	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000054779.1		NM_032536	
NOTCH1	4851	mdanderson.org	37	9	139412617	139412617	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chr9:139412617G>T	ENST00000277541.6	-	7	1302	c.1227C>A	c.(1225-1227)tgC>tgA	p.C409*	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	409	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CGTCCTGGCTGCAGGCCGGGC	0.657			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.C409X				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	.			0			c.C1227A												42.0	47.0	46.0					9																	139412617		2046	4191	6237	SO:0001587	stop_gained	4851	exon7			CTGGCTGCAGGCC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1227C>A	9.37:g.139412617G>T	ENSP00000277541:p.Cys409*		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_017617	0		0	Q59ED8|Q5SXM3	Nonsense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	38	7.189338	0.98125	.	.	ENSG00000148400	ENST00000277541	.	.	.	4.82	3.92	0.45320	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2138	0.54394	0.0838:0.0:0.9162:0.0	.	.	.	.	X	409	.	ENSP00000277541:C409X	C	-	3	2	NOTCH1	138532438	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.060000	0.41394	1.018000	0.39521	0.514000	0.50259	TGC			0.657	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055087.1		NM_017617	
MT-ND1	4535	hgsc.bcm.edu	37	M	754	754	+	5'Flank	SNP	A	A	G			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chrM:754A>G	ENST00000361390.2	+	0	0				MT-TF_ENST00000387314.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCAAAAGGGACAAGCATCAAG	0.458																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			GGAACAAGCATCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.754A>G	Exception_encountered		Somatic	234	0	0		WXS	Illumina HiSeq	.	278	0.44	123	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.458	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
NUDT10	170685	broad.mit.edu	37	X	51076095	51076095	+	Missense_Mutation	SNP	C	C	A			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chrX:51076095C>A	ENST00000376006.3	+	2	498	c.278C>A	c.(277-279)aCg>aAg	p.T93K	NUDT10_ENST00000356450.2_Missense_Mutation_p.T93K	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	0					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.T93M(1)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					AAGCACAGAACGTACGTGTAT	0.572																																					p.T93K	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28		1	Substitution - Missense(1)	endometrium(1)	c.C278A												95.0	88.0	90.0					X																	51076095		2203	4300	6503	SO:0001583	missense	170685	exon2			ACAGAACGTACGT	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.278C>A	X.37:g.51076095C>A	ENSP00000365174:p.Thr93Lys		Somatic	331	0.003021148	1		WXS	Illumina HiSeq	Phase_I	358	0.02	6	NM_153183	8	0.00	0	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000376006.3	37	CCDS35278.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933408	0.73442	.	.	ENSG00000122824	ENST00000376006;ENST00000356450	T;T	0.09073	3.02;3.02	3.14	2.25	0.28309	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	M	0.81341	2.54	0.44985	D	0.998007	D	0.89917	1.0	D	0.91635	0.999	T	0.36311	-0.9753	9	0.87932	D	0	-8.9853	9.3281	0.38005	0.0:0.7823:0.2177:0.0	.	93	Q8NFP7	NUD10_HUMAN	K	93	ENSP00000365174:T93K;ENSP00000348831:T93K	ENSP00000348831:T93K	T	+	2	0	NUDT10	51092835	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	7.043000	0.76572	0.510000	0.28216	0.429000	0.28392	ACG			0.572	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056578.1		NM_153183	
ZNF711	7552	mdanderson.org	37	X	84510318	84510318	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AE-01A-11D-A435-10	TCGA-VF-A8AE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd37d4b1-1965-4ebc-8f2b-dca4866f2253	f62cd451-1502-489e-b70d-1fbff4f809d1	g.chrX:84510318G>T	ENST00000373165.3	+	4	439	c.133G>T	c.(133-135)Gtt>Ttt	p.V45F	ZNF711_ENST00000542798.1_5'Flank|ZNF711_ENST00000276123.3_Missense_Mutation_p.V45F|ZNF711_ENST00000395402.1_Missense_Mutation_p.V23F|ZNF711_ENST00000360700.4_Missense_Mutation_p.V45F	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	45					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TGTTGTTTCAGTTCCTGAAGC	0.378																																					p.V45F													.	.			0			c.G133T												215.0	162.0	180.0					X																	84510318		2203	4300	6503	SO:0001583	missense	7552	exon4			GTTTCAGTTCCTG	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.133G>T	X.37:g.84510318G>T	ENSP00000362260:p.Val45Phe		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	126	0.04	5	NM_021998	0		0	B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.304042	0.81136	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700	T;T;T;T	0.15718	2.59;2.4;2.4;2.56	4.94	4.94	0.65067	.	0.000000	0.39341	N	0.001398	T	0.41971	0.1182	M	0.68593	2.085	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.78314	0.991;0.987	T	0.40059	-0.9583	10	0.87932	D	0	-8.5782	17.3849	0.87413	0.0:0.0:1.0:0.0	.	45;45	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	F	23;45;45;45	ENSP00000378798:V23F;ENSP00000362260:V45F;ENSP00000276123:V45F;ENSP00000353922:V45F	ENSP00000276123:V45F	V	+	1	0	ZNF711	84396974	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.230000	0.95299	2.029000	0.59856	0.550000	0.68814	GTT			0.378	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057388.2		NM_021998	
