#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ACOT7	11332	mdanderson.org	37	1	6324673	6324673	+	Missense_Mutation	SNP	G	G	T	rs139667005		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:6324673G>T	ENST00000377855.2	-	9	1273	c.1127C>A	c.(1126-1128)gCg>gAg	p.A376E	ACOT7_ENST00000377842.3_Missense_Mutation_p.A325E|ACOT7_ENST00000361521.4_Missense_Mutation_p.A366E|ACOT7_ENST00000608083.1_Missense_Mutation_p.A334E|ACOT7_ENST00000545482.1_Missense_Mutation_p.A261E|ACOT7_ENST00000377845.3_Missense_Mutation_p.A346E	NM_181864.2	NP_863654.1	O00154	BACH_HUMAN	acyl-CoA thioesterase 7	376					coenzyme A biosynthetic process (GO:0015937)|fatty acid catabolic process (GO:0009062)|long-chain fatty-acyl-CoA catabolic process (GO:0036116)|medium-chain fatty acid biosynthetic process (GO:0051792)|medium-chain fatty-acyl-CoA catabolic process (GO:0036114)|palmitic acid biosynthetic process (GO:1900535)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)	carboxylic ester hydrolase activity (GO:0052689)|fatty-acyl-CoA binding (GO:0000062)|long-chain fatty acyl-CoA binding (GO:0036042)|palmitoyl-CoA hydrolase activity (GO:0016290)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	16	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		CTGAGGCTCCGCGTGGCCCTG	0.622																																					p.A376E	GBM(74;673 1226 4974 11850 13190)												.	ACOT7	71		0			c.C1127A												159.0	113.0	128.0					1																	6324673		2200	4299	6499	SO:0001583	missense	11332	exon9			GGCTCCGCGTGGC	AB074417	CCDS65.1, CCDS66.1, CCDS67.1, CCDS30573.1	1p36	2008-08-14			ENSG00000097021	ENSG00000097021		"""Acyl CoA thioesterases"""	24157	protein-coding gene	gene with protein product	"""brain acyl CoA hydrolase"""	602587				10578051, 16103133, 16940157	Standard	XM_005263427		Approved	BACH, ACH1, ACT, CTE-II, LACH1, MGC1126, hBACH	uc001amt.3	O00154	OTTHUMG00000001295	ENST00000377855.2:c.1127C>A	1.37:g.6324673G>T	ENSP00000367086:p.Ala376Glu		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_181864	1150	0.00	0	A8K0K7|A8K232|A8K6B8|A8K837|B3KQ12|O43703|Q53Y78|Q5JYL2|Q5JYL3|Q5JYL4|Q5JYL5|Q5JYL6|Q5TGR4|Q9UJM9|Q9Y539|Q9Y540	Missense_Mutation	SNP	ENST00000377855.2	37	CCDS65.1	.	.	.	.	.	.	.	.	.	.	G	3.672	-0.067279	0.07273	.	.	ENSG00000097021	ENST00000377855;ENST00000377845;ENST00000377842;ENST00000361521;ENST00000545482	T;T;T;T;T	0.32988	1.44;1.44;1.44;1.43;1.49	5.61	-3.41	0.04839	.	1.727410	0.02903	N	0.135623	T	0.12689	0.0308	N	0.08118	0	0.09310	N	1	B;B;B;B	0.12630	0.006;0.005;0.0;0.004	B;B;B;B	0.14023	0.007;0.008;0.001;0.01	T	0.27706	-1.0066	10	0.02654	T	1	.	6.2885	0.21047	0.435:0.0:0.4434:0.1216	.	366;376;346;325	B3KQ12;O00154;O00154-5;O00154-6	.;BACH_HUMAN;.;.	E	376;346;325;366;261	ENSP00000367086:A376E;ENSP00000367076:A346E;ENSP00000367073:A325E;ENSP00000354615:A366E;ENSP00000439218:A261E	ENSP00000354615:A366E	A	-	2	0	ACOT7	6247260	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-0.713000	0.05007	-0.598000	0.05806	-0.244000	0.11960	GCG			0.622	ACOT7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000003773.1		NM_007274	
ESPNP	284729	broad.mit.edu	37	1	17030903	17030905	+	RNA	DEL	GAG	GAG	-	rs67156338|rs376609585	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:17030903_17030905delGAG	ENST00000492551.1	-	0	696					NR_026567.1				espin pseudogene																		AGAGATCGACGAGGAGGGGGCCT	0.64														1867	0.372804	0.3245	0.3343	5008	,	,		43669	0.4474		0.3936	False		,,,				2504	0.3671				.													.	.			0			.																																											0	.			ATCGACGAGGAGG	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17030906_17030908delGAG			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	0.50	4	.	0		0		RNA	DEL	ENST00000492551.1	37																																																																																						0.640	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000326311.1			
AGO3	192669	bcgsc.ca;mdanderson.org	37	1	36469953	36469953	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:36469953G>A	ENST00000373191.4	+	6	1019	c.670G>A	c.(670-672)Gcc>Acc	p.A224T	AGO3_ENST00000246314.6_5'UTR|RP4-665N4.8_ENST00000466576.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	224					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										TTCTGCCACTGCCTTCTACAA	0.358																																					p.A224T													.	.			0			c.G670A												124.0	119.0	121.0					1																	36469953		2203	4300	6503	SO:0001583	missense	192669	exon6			GCCACTGCCTTCT	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.670G>A	1.37:g.36469953G>A	ENSP00000362287:p.Ala224Thr		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_1	94	0.05	5	NM_024852	6	0.00	0	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105206	0.77096	.	.	ENSG00000126070	ENST00000373191	T	0.12361	2.69	5.35	5.35	0.76521	Argonaute/Dicer protein, PAZ (1);Domain of unknown function DUF1785 (1);	0.000000	0.85682	D	0.000000	T	0.32793	0.0841	M	0.64630	1.985	0.80722	D	1	B	0.29612	0.251	P	0.47864	0.559	T	0.08680	-1.0710	10	0.56958	D	0.05	4.5371	19.0588	0.93078	0.0:0.0:1.0:0.0	.	224	Q9H9G7	AGO3_HUMAN	T	224	ENSP00000362287:A224T	ENSP00000362287:A224T	A	+	1	0	EIF2C3	36242540	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.835000	0.99442	2.513000	0.84729	0.460000	0.39030	GCC			0.358	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019831.4		NM_024852	
MMACHC	25974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	45973168	45973168	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:45973168G>A	ENST00000401061.4	+	2	502	c.222G>A	c.(220-222)atG>atA	p.M74I		NM_015506.2	NP_056321.2	Q9Y4U1	MMAC_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria	74					cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8	Acute lymphoblastic leukemia(166;0.155)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCTCCGAATGCTGACTGACC	0.607																																					p.M74I													.	.			0			c.G222A												65.0	68.0	67.0					1																	45973168		2107	4236	6343	SO:0001583	missense	25974	exon2			CCGAATGCTGACT		CCDS41324.1	1p34.1	2011-05-12			ENSG00000132763	ENSG00000132763			24525	protein-coding gene	gene with protein product		609831				16311595	Standard	NM_015506		Approved	DKFZP564I122, cblC	uc009vxv.3	Q9Y4U1	OTTHUMG00000007742	ENST00000401061.4:c.222G>A	1.37:g.45973168G>A	ENSP00000383840:p.Met74Ile		Somatic	115	0	0		WXS	Illumina HiSeq	.	116	0.17	20	NM_015506	32	0.19	6	Q5T157|Q9BRQ7	Missense_Mutation	SNP	ENST00000401061.4	37	CCDS41324.1	.	.	.	.	.	.	.	.	.	.	G	4.812	0.151047	0.09185	.	.	ENSG00000132763	ENST00000401061	D	0.97303	-4.33	5.36	0.103	0.14526	.	1.405820	0.04110	N	0.314408	D	0.87386	0.6164	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.83015	-0.0170	10	0.19147	T	0.46	0.2848	3.3266	0.07068	0.3486:0.0:0.244:0.4075	.	74	Q9Y4U1	MMAC_HUMAN	I	74	ENSP00000383840:M74I	ENSP00000383840:M74I	M	+	3	0	MMACHC	45745755	0.000000	0.05858	0.675000	0.29917	0.185000	0.23345	-0.629000	0.05508	0.338000	0.23692	0.563000	0.77884	ATG			0.607	MMACHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000020864.2		NM_015506	
CTH	1491	broad.mit.edu	37	1	70877110	70877110	+	Silent	SNP	A	A	G			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:70877110A>G	ENST00000370938.3	+	1	156	c.12A>G	c.(10-12)aaA>aaG	p.K4K	CTH_ENST00000464926.1_3'UTR|CTH_ENST00000346806.2_Silent_p.K4K|CTH_ENST00000411986.2_Silent_p.K4K	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TGCAGGAAAAAGACGCCTCCT	0.547																																					p.K4K													.	CTH	48		0			c.A12G												115.0	127.0	123.0					1																	70877110		2203	4300	6503	SO:0001819	synonymous_variant	1491	exon1			GGAAAAAGACGCC	BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.12A>G	1.37:g.70877110A>G			Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	207	0.02	4	NM_153742	244	0.00	0	O95791|Q9NX42	Silent	SNP	ENST00000370938.3	37	CCDS650.1																																																																																					0.547	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025918.1		NM_001902	
KCNA2	3737	bcgsc.ca;mdanderson.org	37	1	111147358	111147358	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:111147358G>T	ENST00000485317.1	-	3	720	c.47C>A	c.(46-48)cCt>cAt	p.P16H	KCNA2_ENST00000440270.1_Missense_Mutation_p.P16H|KCNA2_ENST00000316361.4_Missense_Mutation_p.P16H|KCNA2_ENST00000525120.1_Intron|KCNA2_ENST00000369770.3_Missense_Mutation_p.P16H			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	16					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	TGGGTGCCCAGGGAGGGCAGC	0.597																																					p.P16H	Pancreas(18;568 735 10587 23710 36357)												.	KCNA2	61		0			c.C47A												94.0	99.0	97.0					1																	111147358		2203	4300	6503	SO:0001583	missense	3737	exon3			TGCCCAGGGAGGG	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.47C>A	1.37:g.111147358G>T	ENSP00000433109:p.Pro16His		Somatic	144	0	0		WXS	Illumina HiSeq	Phase_1	123	0.04	5	NM_001204269	1	0.00	0	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	37	CCDS827.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191302	0.58017	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	T;D;D;D	0.96587	-1.39;-4.06;-4.06;-4.06	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.95996	0.8696	L	0.54323	1.7	0.80722	D	1	P;P	0.44478	0.835;0.836	P;P	0.49561	0.615;0.595	D	0.95869	0.8889	10	0.62326	D	0.03	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	16;16	Q86XG6;P16389	.;KCNA2_HUMAN	H	16	ENSP00000358785:P16H;ENSP00000433109:P16H;ENSP00000415257:P16H;ENSP00000314520:P16H	ENSP00000314520:P16H	P	-	2	0	KCNA2	110948881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.803000	0.85983	2.793000	0.96121	0.655000	0.94253	CCT			0.597	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128001.2		NM_004974	
ITGA10	8515	mdanderson.org	37	1	145532485	145532485	+	Missense_Mutation	SNP	G	G	T	rs151338211		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:145532485G>T	ENST00000369304.3	+	9	1113	c.938G>T	c.(937-939)cGa>cTa	p.R313L	ITGA10_ENST00000538811.1_Missense_Mutation_p.R182L|ITGA10_ENST00000539363.1_Missense_Mutation_p.R170L|ITGA10_ENST00000481236.1_3'UTR	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	313	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CGGCGGCAGCGAGATCCCAGC	0.473																																					p.R313L													ITGA10,NS,carcinoma,+1,1	ITGA10	131	1	0			c.G938T												125.0	120.0	122.0					1																	145532485		2203	4300	6503	SO:0001583	missense	8515	exon9			GGCAGCGAGATCC	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.938G>T	1.37:g.145532485G>T	ENSP00000358310:p.Arg313Leu		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_003637	0		0	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	5.000	0.185694	0.09495	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.51574	0.7;0.7;0.7	5.12	4.2	0.49525	von Willebrand factor, type A (3);	0.255440	0.33110	N	0.005270	T	0.10294	0.0252	N	0.01168	-0.975	0.37128	D	0.901132	B;B;D;P	0.54397	0.434;0.244;0.966;0.49	B;B;P;B	0.53185	0.191;0.191;0.72;0.29	T	0.34601	-0.9822	10	0.02654	T	1	.	6.0588	0.19826	0.0946:0.0:0.7163:0.1891	.	279;182;170;313	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	L	313;279;170;182	ENSP00000358310:R313L;ENSP00000439894:R170L;ENSP00000440011:R182L	ENSP00000358310:R313L	R	+	2	0	ITGA10	144243842	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.866000	0.48420	2.573000	0.86826	0.561000	0.74099	CGA			0.473	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000038537.2		NM_003637	
KCNN3	3782	mdanderson.org	37	1	154698449	154698449	+	Silent	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:154698449G>T	ENST00000271915.4	-	5	1959	c.1644C>A	c.(1642-1644)ctC>ctA	p.L548L	KCNN3_ENST00000358505.2_Silent_p.L235L|KCNN3_ENST00000361147.4_Silent_p.L243L	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	553					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	CCGCTTTGGTGAGTTCCAGCT	0.552																																					p.L563L													.	KCNN3	141		0			c.C1689A												108.0	90.0	96.0					1																	154698449		2203	4300	6503	SO:0001819	synonymous_variant	3782	exon6			TTTGGTGAGTTCC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1644C>A	1.37:g.154698449G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001204087	4	0.00	0	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																					0.552	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090688.3		NM_002249	
ILDR2	387597	mdanderson.org	37	1	166890443	166890443	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:166890443G>T	ENST00000271417.3	-	9	1440	c.1385C>A	c.(1384-1386)tCg>tAg	p.S462*	ILDR2_ENST00000528703.1_Nonsense_Mutation_p.S403*|ILDR2_ENST00000526687.1_Nonsense_Mutation_p.S354*|ILDR2_ENST00000529071.1_Nonsense_Mutation_p.S443*|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000469934.2_Intron|ILDR2_ENST00000525740.1_Nonsense_Mutation_p.S335*	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	462					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						GTGCGCCCGCGACTCCGAGCG	0.726																																					p.S462X													.	ILDR2	79		0			c.C1385A												4.0	6.0	6.0					1																	166890443		1696	3541	5237	SO:0001587	stop_gained	387597	exon9			GCCCGCGACTCCG	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1385C>A	1.37:g.166890443G>T	ENSP00000271417:p.Ser462*		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_199351	4	0.00	0		Nonsense_Mutation	SNP	ENST00000271417.3	37	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297027	0.60086	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529071;ENST00000526687;ENST00000528703	.	.	.	4.28	3.35	0.38373	.	1.122620	0.06874	N	0.801294	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0409	0.64674	0.0:0.1526:0.8474:0.0	.	.	.	.	X	462;335;443;354;403	.	ENSP00000271417:S462X	S	-	2	0	ILDR2	165157067	0.641000	0.27251	0.003000	0.11579	0.004000	0.04260	4.623000	0.61247	0.768000	0.33290	0.558000	0.71614	TCG			0.726	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000082880.2		NM_199351	
FMN2	56776	mdanderson.org	37	1	240255583	240255583	+	Silent	SNP	C	C	G			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:240255583C>G	ENST00000319653.9	+	1	404	c.174C>G	c.(172-174)ggC>ggG	p.G58G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	58					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G201G(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			gcggcggcggcggggAGTCGG	0.662																																					p.G58G													FMN2,NS,carcinoma,0,1	FMN2	451	1	1	Substitution - coding silent(1)	ovary(1)	c.C174G												4.0	6.0	5.0					1																	240255583		2028	3989	6017	SO:0001819	synonymous_variant	56776	exon1			CGGCGGCGGGGAG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.174C>G	1.37:g.240255583C>G			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	28	0.07	2	NM_020066	2	0.00	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																					0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
OR2T3	343173	broad.mit.edu	37	1	248637495	248637495	+	Frame_Shift_Del	DEL	T	T	-			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr1:248637495delT	ENST00000359594.2	+	1	869	c.844delT	c.(844-846)tttfs	p.F282fs		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGTGTCTGCCTTTTACACCAT	0.507																																					p.F282fs													.	OR2T3	79		0			c.844delT												229.0	222.0	225.0					1																	248637495		2203	4297	6500	SO:0001589	frameshift_variant	343173	exon1			TCTGCCTTTTACA		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.844delT	1.37:g.248637495delT	ENSP00000352604:p.Phe282fs		Somatic	813	0	0		WXS	Illumina HiSeq	Phase_I	869	0.01	7	NM_001005495	0		0	B2RNJ1	Frame_Shift_Del	DEL	ENST00000359594.2	37	CCDS31117.1																																																																																					0.507	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097348.1		NM_001005495	
CUL2	8453	mdanderson.org	37	10	35300781	35300781	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr10:35300781G>T	ENST00000374748.1	-	21	2414	c.2101C>A	c.(2101-2103)Caa>Aaa	p.Q701K	CUL2_ENST00000537177.1_Missense_Mutation_p.Q720K|CUL2_ENST00000602371.1_Missense_Mutation_p.Q644K|CUL2_ENST00000374749.3_Missense_Mutation_p.Q701K|CUL2_ENST00000374751.3_Missense_Mutation_p.Q701K|CUL2_ENST00000374746.1_Intron|CUL2_ENST00000374742.1_Intron			Q13617	CUL2_HUMAN	cullin 2	701					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						TTTACCTCTTGAATAAGGGCA	0.433																																					p.Q720K													.	CUL2	63		0			c.C2158A												120.0	112.0	115.0					10																	35300781		2203	4300	6503	SO:0001583	missense	8453	exon20			CCTCTTGAATAAG	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.2101C>A	10.37:g.35300781G>T	ENSP00000363880:p.Gln701Lys		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_001198778	199	0.00	0	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	37	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422402	0.83559	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374749;ENST00000374754;ENST00000537177	T;T;T;T	0.69040	-0.36;-0.36;-0.36;-0.37	6.08	6.08	0.98989	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.72534	0.3472	M	0.67569	2.06	0.80722	D	1	P;P	0.39044	0.454;0.656	P;P	0.45577	0.474;0.486	T	0.65224	-0.6220	10	0.15066	T	0.55	-14.5411	20.6634	0.99662	0.0:0.0:1.0:0.0	.	720;701	G3V1S2;Q13617	.;CUL2_HUMAN	K	701;701;701;644;720	ENSP00000363883:Q701K;ENSP00000363880:Q701K;ENSP00000363881:Q701K;ENSP00000444856:Q720K	ENSP00000363880:Q701K	Q	-	1	0	CUL2	35340787	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.841000	0.99482	2.894000	0.99253	0.655000	0.94253	CAA			0.433	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047538.1		NM_003591	
ERCC6	2074	mdanderson.org	37	10	50708743	50708743	+	Splice_Site	SNP	C	C	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr10:50708743C>A	ENST00000355832.5	-	7	1605		c.e7-1		ERCC6_ENST00000542458.1_Splice_Site	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6						activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTGCTGGTACCTATGACAACA	0.433								Direct reversal of damage;Nucleotide excision repair (NER)																													.													.	ERCC6	162		0			c.1527-1G>T												79.0	74.0	76.0					10																	50708743		2203	4300	6503	SO:0001630	splice_region_variant	2074	exon8			TGGTACCTATGAC	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1527-1G>T	10.37:g.50708743C>A			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_000124	0		0	D3DX94|Q5W0L9	Splice_Site	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781476	0.70222	.	.	ENSG00000225830	ENST00000355832	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ERCC6	50378749	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	.			0.433	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047990.1		NM_000124	Intron
ANXA7	310	mdanderson.org	37	10	75138760	75138760	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr10:75138760G>T	ENST00000372921.5	-	12	1243	c.1187C>A	c.(1186-1188)cCt>cAt	p.P396H	ANXA7_ENST00000535178.1_Missense_Mutation_p.P266H|RP11-537A6.9_ENST00000427492.1_RNA	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	418					autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					AAAGAAGGCAGGGCGGTTCAG	0.502																																					p.P418H													.	ANXA7	50		0			c.C1253A												86.0	64.0	72.0					10																	75138760		2203	4300	6503	SO:0001583	missense	310	exon13			AAGGCAGGGCGGT	J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.1187C>A	10.37:g.75138760G>T	ENSP00000362012:p.Pro396His		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_004034	361	0.00	0	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	ENST00000372921.5	37	CCDS7325.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231840	0.58777	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178	T;T;T	0.05513	3.43;3.43;3.43	5.91	5.0	0.66597	.	0.176184	0.40469	N	0.001091	T	0.17195	0.0413	M	0.79693	2.465	0.48135	D	0.999599	D;D;P	0.63046	0.986;0.992;0.826	B;P;B	0.49853	0.42;0.624;0.215	T	0.01596	-1.1316	10	0.59425	D	0.04	.	14.2114	0.65767	0.0:0.0:0.8494:0.1506	.	396;396;418	Q53HM8;P20073-2;P20073	.;.;ANXA7_HUMAN	H	396;418;266	ENSP00000362012:P396H;ENSP00000362010:P418H;ENSP00000442864:P266H	ENSP00000362010:P418H	P	-	2	0	ANXA7	74808766	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	6.258000	0.72487	1.474000	0.48178	0.655000	0.94253	CCT			0.502	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048646.2		NM_001156	
EXOC6	54536	broad.mit.edu	37	10	94773973	94773973	+	Silent	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr10:94773973G>T	ENST00000260762.6	+	20	2132	c.2118G>T	c.(2116-2118)gtG>gtT	p.V706V	EXOC6_ENST00000371552.4_Silent_p.V701V|EXOC6_ENST00000371547.4_Silent_p.V722V|EXOC6_ENST00000443748.2_Silent_p.V603V	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	706					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				CTGAGCCTGTGCCAGGATTCC	0.363																																					p.V706V													.	EXOC6	147		0			c.G2118T												84.0	85.0	85.0					10																	94773973		2203	4300	6503	SO:0001819	synonymous_variant	54536	exon20			GCCTGTGCCAGGA	BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.2118G>T	10.37:g.94773973G>T			Somatic	385	0.0025974026	1		WXS	Illumina HiSeq	Phase_I	364	0.01	5	NM_019053	32	0.00	0	E9PHI3|Q5VXH8|Q9NZ24	Silent	SNP	ENST00000260762.6	37	CCDS7424.2																																																																																					0.363	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049410.2		NM_019053	
ZDHHC16	84287	mdanderson.org	37	10	99214534	99214534	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr10:99214534G>T	ENST00000370854.3	+	8	991	c.802G>T	c.(802-804)Gtc>Ttc	p.V268F	ZDHHC16_ENST00000370846.4_Intron|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.V187F|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.V252F|ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000353979.3_Missense_Mutation_p.V229F|ZDHHC16_ENST00000352634.4_Missense_Mutation_p.V252F|ZDHHC16_ENST00000393760.1_Missense_Mutation_p.V268F	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	268					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		CAAGAGTCTTGTCTACCTCTG	0.448																																					p.V268F													.	ZDHHC16	25		0			c.G802T												152.0	147.0	149.0					10																	99214534		2203	4300	6503	SO:0001583	missense	84287	exon9			AGTCTTGTCTACC	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.802G>T	10.37:g.99214534G>T	ENSP00000359891:p.Val268Phe		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	148	0.04	6	NM_198046	423	0.00	0	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	ENST00000370854.3	37	CCDS7460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.28|14.28	2.488251|2.488251	0.44249|0.44249	.|.	.|.	ENSG00000171307|ENSG00000171307	ENST00000420089;ENST00000417044|ENST00000370854;ENST00000393760;ENST00000352634;ENST00000353979;ENST00000370842;ENST00000345745;ENST00000433086	T;T|T;T;T;T;T;T	0.68181|0.22743	0.11;-0.31|1.94;1.94;1.94;1.94;1.94;1.94	5.88|5.88	4.03|4.03	0.46877|0.46877	.|.	.|0.132647	.|0.52532	.|D	.|0.000061	T|T	0.28499|0.28499	0.0705|0.0705	L|L	0.47190|0.47190	1.495|1.495	0.58432|0.58432	D|D	0.999997|0.999997	.|D;B;D;B;B;B;B	.|0.56287	.|0.957;0.004;0.975;0.056;0.001;0.036;0.364	.|P;B;P;B;B;B;B	.|0.56088	.|0.791;0.014;0.71;0.192;0.012;0.034;0.188	T|T	0.01643|0.01643	-1.1305|-1.1305	6|10	.|0.37606	.|T	.|0.19	-16.4692|-16.4692	8.3779|8.3779	0.32453|0.32453	0.2361:0.0:0.7639:0.0|0.2361:0.0:0.7639:0.0	.|.	.|268;203;227;229;187;252;268	.|B4DNL2;E9PCL9;B1AMU1;Q969W1-3;Q969W1-4;Q969W1-2;Q969W1	.|.;.;.;.;.;.;ZDH16_HUMAN	F|F	227;209|268;268;252;229;252;187;203	ENSP00000405240:L227F;ENSP00000396286:L209F|ENSP00000359891:V268F;ENSP00000377357:V268F;ENSP00000345383:V252F;ENSP00000359879:V252F;ENSP00000304487:V187F;ENSP00000398532:V203F	.|ENSP00000304487:V187F	L|V	+|+	3|1	2|0	ZDHHC16|ZDHHC16	99204524|99204524	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.759000|2.759000	0.47573|0.47573	1.495000|1.495000	0.48549|0.48549	0.655000|0.655000	0.94253|0.94253	TTG|GTC			0.448	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049658.2		NM_032327	
HPS6	79803	mdanderson.org	37	10	103825727	103825727	+	Silent	SNP	C	C	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr10:103825727C>A	ENST00000299238.5	+	1	581	c.496C>A	c.(496-498)Cgg>Agg	p.R166R		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	166					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		TGTGTGCGTCCGGACTCTGGA	0.721									Hermansky-Pudlak syndrome																												p.R166R													.	HPS6	38		0			c.C496A												10.0	12.0	11.0					10																	103825727		2174	4274	6448	SO:0001819	synonymous_variant	79803	exon1	Familial Cancer Database	HPS, HPS1-8	TGCGTCCGGACTC	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.496C>A	10.37:g.103825727C>A			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_024747	31	0.10	3	Q5VV69|Q9H685	Silent	SNP	ENST00000299238.5	37	CCDS7527.1																																																																																					0.721	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050018.2		NM_024747	
PPRC1	23082	mdanderson.org	37	10	103892979	103892979	+	Splice_Site	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr10:103892979G>T	ENST00000278070.2	+	1	192		c.e1+1		PPRC1_ENST00000413464.2_Splice_Site	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CGGCGAGCAGGTGAGAGGTTG	0.697																																					.													.	PPRC1	151		0			c.153+1G>T												10.0	9.0	10.0					10																	103892979		2163	4262	6425	SO:0001630	splice_region_variant	23082	exon1			GAGCAGGTGAGAG	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.153+1G>T	10.37:g.103892979G>T			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_015062	5	0.00	0	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Splice_Site	SNP	ENST00000278070.2	37	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569476	0.86439	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2264	0.82298	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPRC1	103882969	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.703000	0.61824	2.700000	0.92200	0.462000	0.41574	.			0.697	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050021.1		NM_015062	Intron
TH	7054	mdanderson.org	37	11	2188684	2188684	+	Missense_Mutation	SNP	C	C	T	rs549188961	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr11:2188684C>T	ENST00000381178.1	-	7	787	c.769G>A	c.(769-771)Gcc>Acc	p.A257T	TH_ENST00000352909.3_Missense_Mutation_p.A226T|TH_ENST00000333684.5_Missense_Mutation_p.A230T|TH_ENST00000381175.1_Missense_Mutation_p.A253T	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	257					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	ATCTCCTCGGCGGTGTACTCC	0.697													C|||	2	0.000399361	0.0	0.0	5008	,	,		14851	0.0		0.0	False		,,,				2504	0.002				p.A257T													.	TH	43		0			c.G769A												16.0	16.0	16.0					11																	2188684		2163	4262	6425	SO:0001583	missense	7054	exon7			CCTCGGCGGTGTA	X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.769G>A	11.37:g.2188684C>T	ENSP00000370571:p.Ala257Thr		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_199292	0		0	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	ENST00000381178.1	37	CCDS7731.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.069|8.069	0.769860|0.769860	0.15983|0.15983	.|.	.|.	ENSG00000180176|ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684|ENST00000412076	D;D;D;D|.	0.99532|.	-6.1;-6.1;-6.1;-6.1|.	2.88|2.88	1.92|1.92	0.25849|0.25849	Aromatic amino acid hydroxylase, C-terminal (3);|.	0.465118|.	0.21692|.	U|.	0.070556|.	T|T	0.46328|0.46328	0.1387|0.1387	M|M	0.71920|0.71920	2.185|2.185	0.09310|0.09310	N|N	1|1	B;P;P;B;P;P|.	0.37525|.	0.1;0.543;0.543;0.346;0.598;0.543|.	B;B;B;B;B;B|.	0.32677|.	0.019;0.042;0.042;0.093;0.15;0.093|.	T|T	0.36359|0.36359	-0.9751|-0.9751	10|5	0.87932|.	D|.	0|.	-21.1242|-21.1242	5.904|5.904	0.18982|0.18982	0.0:0.6931:0.1932:0.1137|0.0:0.6931:0.1932:0.1137	.|.	230;230;226;226;257;253|.	B7ZL73;Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2|.	.;.;.;.;TY3H_HUMAN;.|.	T|H	257;253;226;230|39	ENSP00000370571:A257T;ENSP00000370567:A253T;ENSP00000325951:A226T;ENSP00000328814:A230T|.	ENSP00000328814:A230T|.	A|R	-|-	1|2	0|0	TH|TH	2145260|2145260	0.005000|0.005000	0.15991|0.15991	0.123000|0.123000	0.21794|0.21794	0.224000|0.224000	0.24922|0.24922	1.327000|1.327000	0.33746|0.33746	0.503000|0.503000	0.28060|0.28060	0.313000|0.313000	0.20887|0.20887	GCC|CGC			0.697	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000026597.1		NM_000360	
ILK	3611	mdanderson.org	37	11	6625505	6625505	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr11:6625505G>T	ENST00000396751.2	+	1	460	c.4G>T	c.(4-6)Gac>Tac	p.D2Y	ILK_ENST00000537806.1_5'UTR|ILK_ENST00000420936.2_Missense_Mutation_p.D2Y|RRP8_ENST00000254605.6_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|RRP8_ENST00000534343.1_5'Flank|ILK_ENST00000299421.4_Missense_Mutation_p.D2Y|ILK_ENST00000528995.1_Missense_Mutation_p.D2Y	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	2					branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		CGCTGCTATGGACGACATTTT	0.597																																					p.D2Y													.	ILK	41		0			c.G4T												37.0	34.0	35.0					11																	6625505		2201	4295	6496	SO:0001583	missense	3611	exon2			GCTATGGACGACA	U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.4G>T	11.37:g.6625505G>T	ENSP00000379975:p.Asp2Tyr		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001014794	200	0.00	0	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Missense_Mutation	SNP	ENST00000396751.2	37	CCDS7768.1	.	.	.	.	.	.	.	.	.	.	G	35	5.539373	0.96474	.	.	ENSG00000166333	ENST00000299421;ENST00000420936;ENST00000528995;ENST00000396751	T;T;T;T	0.80909	-1.37;-1.37;-1.43;-1.37	5.01	5.01	0.66863	.	0.048085	0.85682	D	0.000000	D	0.84915	0.5578	L	0.41356	1.27	0.80722	D	1	D;D	0.76494	0.987;0.999	P;D	0.66847	0.86;0.947	D	0.86384	0.1731	10	0.87932	D	0	.	15.8497	0.78921	0.0:0.0:1.0:0.0	.	2;2	B7Z418;Q13418	.;ILK_HUMAN	Y	2	ENSP00000299421:D2Y;ENSP00000403487:D2Y;ENSP00000435323:D2Y;ENSP00000379975:D2Y	ENSP00000299421:D2Y	D	+	1	0	ILK	6582081	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.876000	0.92379	2.612000	0.88384	0.561000	0.74099	GAC			0.597	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384519.1		NM_004517	
ABCC8	6833	mdanderson.org	37	11	17464383	17464383	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr11:17464383C>T	ENST00000389817.3	-	10	1582	c.1514G>A	c.(1513-1515)gGc>gAc	p.G505D	ABCC8_ENST00000302539.4_Missense_Mutation_p.G505D|ABCC8_ENST00000528202.1_5'Flank			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	505	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CAGCTTGATGCCGCGGAGCAT	0.622																																					p.G505D													.	ABCC8	170		0			c.G1514A												93.0	87.0	89.0					11																	17464383		2200	4293	6493	SO:0001583	missense	6833	exon10			TTGATGCCGCGGA	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1514G>A	11.37:g.17464383C>T	ENSP00000374467:p.Gly505Asp		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_000352	2	0.00	0	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	C	35	5.592633	0.96602	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.93019	-3.15;-3.15	6.02	6.02	0.97574	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97996	0.9340	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98290	1.0513	10	0.87932	D	0	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	504;505	B7Z4N0;Q09428	.;ABCC8_HUMAN	D	505;505;519	ENSP00000374467:G505D;ENSP00000303960:G505D	ENSP00000303960:G505D	G	-	2	0	ABCC8	17420959	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.807000	0.86032	2.865000	0.98341	0.655000	0.94253	GGC			0.622	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000389093.1		NM_000352	
PCNXL3	399909	mdanderson.org	37	11	65386388	65386388	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr11:65386388G>A	ENST00000355703.3	+	6	2094	c.1555G>A	c.(1555-1557)Gct>Act	p.A519T		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	519						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GCCCCCACTGGCTGGCTGCAA	0.647																																					p.A519T													.	PCNXL3	140		0			c.G1555A												17.0	20.0	19.0					11																	65386388		2005	4173	6178	SO:0001583	missense	399909	exon6			CCACTGGCTGGCT	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.1555G>A	11.37:g.65386388G>A	ENSP00000347931:p.Ala519Thr		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_032223	53	0.00	0	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	G	5.924	0.354625	0.11239	.	.	ENSG00000197136	ENST00000355703	T	0.05258	3.47	5.4	5.4	0.78164	.	0.000000	0.39909	N	0.001236	T	0.02970	0.0088	N	0.03608	-0.345	0.34784	D	0.735006	B	0.17852	0.024	B	0.10450	0.005	T	0.23547	-1.0185	10	0.05959	T	0.93	.	14.6935	0.69103	0.0:0.0:1.0:0.0	.	519	Q9H6A9	PCX3_HUMAN	T	519	ENSP00000347931:A519T	ENSP00000347931:A519T	A	+	1	0	PCNXL3	65142964	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.613000	0.61176	2.536000	0.85505	0.561000	0.74099	GCT			0.647	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390321.1		NM_032223	
SORL1	6653	mdanderson.org	37	11	121475015	121475015	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr11:121475015G>T	ENST00000260197.7	+	33	4762	c.4633G>T	c.(4633-4635)Gat>Tat	p.D1545Y	SORL1_ENST00000534286.1_Missense_Mutation_p.D455Y|SORL1_ENST00000527934.1_Missense_Mutation_p.D160Y|SORL1_ENST00000532694.1_Missense_Mutation_p.D391Y|SORL1_ENST00000525532.1_Missense_Mutation_p.D489Y	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1545	LDL-receptor class A 11. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GGACGAGAGCGATGAAAAGGC	0.657																																					p.D1545Y													.	SORL1	218		0			c.G4633T												62.0	57.0	58.0					11																	121475015		2203	4299	6502	SO:0001583	missense	6653	exon33			GAGAGCGATGAAA	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.4633G>T	11.37:g.121475015G>T	ENSP00000260197:p.Asp1545Tyr		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_003105	37	0.00	0	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496185	0.64186	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	D;D;D;D;D	0.99232	-5.6;-5.6;-5.6;-5.6;-5.6	5.35	5.35	0.76521	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.056704	0.64402	D	0.000002	D	0.99711	0.9889	H	0.98426	4.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97181	0.9851	10	0.87932	D	0	.	18.6752	0.91526	0.0:0.0:1.0:0.0	.	160;1545	E9PKB0;Q92673	.;SORL_HUMAN	Y	1545;489;391;455;160	ENSP00000260197:D1545Y;ENSP00000434634:D489Y;ENSP00000432131:D391Y;ENSP00000436447:D455Y;ENSP00000435405:D160Y	ENSP00000260197:D1545Y	D	+	1	0	SORL1	120980225	1.000000	0.71417	0.529000	0.27951	0.272000	0.26649	9.084000	0.94076	2.510000	0.84645	0.655000	0.94253	GAT			0.657	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387626.2		NM_003105	
LPCAT3	10162	broad.mit.edu;mdanderson.org	37	12	7084421	7084421	+	IGR	SNP	C	C	G			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr12:7084421C>G	ENST00000261407.4	-	0	2268				EMG1_ENST00000546220.1_3'UTR|LPCAT3_ENST00000535021.1_5'Flank|EMG1_ENST00000261406.6_Missense_Mutation_p.P167A	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						AGATCACTTTCCAGTTGGATG	0.433																																					.													.	.			0			.												93.0	88.0	90.0					12																	7084421		1936	4144	6080	SO:0001628	intergenic_variant	10436	.			CACTTTCCAGTTG	U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970		12.37:g.7084421C>G			Somatic	124	0.0080645161	1		WXS	Illumina HiSeq	Phase_I	307	0.08	24	.	2244	0.09	199	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	RNA	SNP	ENST00000261407.4	37	CCDS8572.1																																																																																					0.433	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401812.1		NM_005768	
MRPS35	60488	broad.mit.edu;mdanderson.org	37	12	27863860	27863860	+	Silent	SNP	G	G	T	rs145435105	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr12:27863860G>T	ENST00000081029.3	+	1	155	c.84G>T	c.(82-84)tcG>tcT	p.S28S	RP11-1060J15.4_ENST00000542660.1_RNA|RP11-1060J15.7_ENST00000538640.1_lincRNA|RP11-1060J15.4_ENST00000536317.1_RNA|MRPS35_ENST00000538315.1_Silent_p.S28S	NM_021821.3	NP_068593.2	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					CCGTCTACTCGGCCACTCCGG	0.642																																					p.S28S													.	MRPS35	26		0			c.G84T							G	,	2,4404	4.2+/-10.8	0,2,2201	62.0	49.0	53.0		84,84	2.1	0.0	12	dbSNP_134	53	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MRPS35	NM_001190864.1,NM_021821.3	,	0,2,6501	TT,TG,GG		0.0,0.0454,0.0154	,	28/195,28/324	27863860	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	60488	exon1			CTACTCGGCCACT	AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215	ENST00000081029.3:c.84G>T	12.37:g.27863860G>T			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	95	0.04	4	NM_001190864	729	0.00	0	B2RDZ7|Q96Q21	Silent	SNP	ENST00000081029.3	37	CCDS8714.1																																																																																					0.642	MRPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402897.1		NM_021821	
HOXC10	3226	broad.mit.edu	37	12	54379332	54379332	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr12:54379332T>C	ENST00000303460.4	+	1	363	c.289T>C	c.(289-291)Tcc>Ccc	p.S97P	HOXC-AS3_ENST00000567780.1_RNA|RP11-834C11.12_ENST00000513209.1_5'Flank|HOXC-AS3_ENST00000509870.1_RNA|HOXC-AS3_ENST00000514702.1_RNA|HOXC-AS3_ENST00000513165.1_RNA	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	97					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						CAGGCCGCTGTCCTCCTGCTC	0.617																																					p.S97P													.	HOXC10	42		0			c.T289C												52.0	53.0	53.0					12																	54379332		2203	4300	6503	SO:0001583	missense	3226	exon1			CCGCTGTCCTCCT		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.289T>C	12.37:g.54379332T>C	ENSP00000307321:p.Ser97Pro		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_017409	1	0.00	0	O15219|O15220|Q9BVD5	Missense_Mutation	SNP	ENST00000303460.4	37	CCDS8868.1	.	.	.	.	.	.	.	.	.	.	T	1.393	-0.580176	0.03854	.	.	ENSG00000180818	ENST00000303460	T	0.22539	1.95	4.46	4.46	0.54185	.	0.123075	0.56097	D	0.000023	T	0.07188	0.0182	N	0.03930	-0.32	0.40560	D	0.981208	B	0.02656	0.0	B	0.04013	0.001	T	0.19063	-1.0317	10	0.02654	T	1	.	8.4167	0.32676	0.0:0.0953:0.0:0.9047	.	97	Q9NYD6	HXC10_HUMAN	P	97	ENSP00000307321:S97P	ENSP00000307321:S97P	S	+	1	0	HOXC10	52665599	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.385000	0.44371	1.796000	0.52611	0.413000	0.27773	TCC			0.617	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358952.2			
RNF10	9921	mdanderson.org	37	12	120972700	120972700	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr12:120972700G>A	ENST00000325954.4	+	1	547	c.86G>A	c.(85-87)gGc>gAc	p.G29D	RNF10_ENST00000413266.2_Missense_Mutation_p.G29D	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	29	Ser-rich.				negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCTCTTCGGGCAGCAGCAAA	0.716																																					p.G29D													.	RNF10	75		0			c.G86A												15.0	21.0	19.0					12																	120972700		2191	4278	6469	SO:0001583	missense	9921	exon1			CTTCGGGCAGCAG	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.86G>A	12.37:g.120972700G>A	ENSP00000322242:p.Gly29Asp		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_014868	244	0.00	0	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.405070	0.62288	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000542438;ENST00000413266	D;D	0.89270	-2.49;-2.49	5.08	4.19	0.49359	.	0.355860	0.23914	N	0.043319	D	0.86033	0.5836	L	0.38175	1.15	0.33463	D	0.58521	D	0.61080	0.989	P	0.49665	0.618	D	0.86438	0.1765	10	0.20519	T	0.43	.	12.8936	0.58087	0.0:0.1639:0.8361:0.0	.	29	Q8N5U6	RNF10_HUMAN	D	29	ENSP00000322242:G29D;ENSP00000415682:G29D	ENSP00000322242:G29D	G	+	2	0	RNF10	119457083	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	2.208000	0.42797	1.362000	0.46000	0.561000	0.74099	GGC			0.716	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000401898.4			
CDK8	1024	mdanderson.org	37	13	26956976	26956976	+	Missense_Mutation	SNP	G	G	T	rs267603792		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr13:26956976G>T	ENST00000381527.3	+	5	985	c.482G>T	c.(481-483)gGt>gTt	p.G161V	CDK8_ENST00000536792.1_Intron	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	161	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		TTAGTTATGGGTGAAGGTCCT	0.333																																					p.G161V													.	CDK8	61		0			c.G482T												104.0	107.0	106.0					13																	26956976		2203	4300	6503	SO:0001583	missense	1024	exon5			TTATGGGTGAAGG	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.482G>T	13.37:g.26956976G>T	ENSP00000370938:p.Gly161Val		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001260	19	0.00	0	Q5VUF3|Q6ISB5	Missense_Mutation	SNP	ENST00000381527.3	37	CCDS9317.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721995	0.89298	.	.	ENSG00000132964	ENST00000381527	T	0.69685	-0.42	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.086147	0.85682	D	0.000000	T	0.81098	0.4752	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80801	-0.1220	10	0.87932	D	0	-11.2088	20.5827	0.99408	0.0:0.0:1.0:0.0	.	161;161	P49336-2;P49336	.;CDK8_HUMAN	V	161	ENSP00000370938:G161V	ENSP00000370938:G161V	G	+	2	0	CDK8	25854976	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.142000	0.94618	2.941000	0.99782	0.655000	0.94253	GGT			0.333	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044250.1			
Unknown	0	bcgsc.ca	37	14	22070772	22070772	+	IGR	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr14:22070772C>T								OR10G3 (31897 upstream) : TRAV1-1 (19218 downstream)																							GAGAGCACTCCCAGAAGAATG	0.522																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GCACTCCCAGAAG																													14.37:g.22070772C>T			Somatic	151	0	0		WXS	Illumina HiSeq	Phase_1	113	0.12	13	.	0		0		RNA	SNP		37																																																																																					0	0.522										
PCK2	5106	mdanderson.org	37	14	24567817	24567817	+	Silent	SNP	G	G	T	rs373177664		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr14:24567817G>T	ENST00000216780.4	+	4	862	c.594G>T	c.(592-594)gtG>gtT	p.V198V	PCK2_ENST00000561286.1_Silent_p.V64V|PCK2_ENST00000558096.1_Silent_p.V64V|NRL_ENST00000561028.1_Intron|PCK2_ENST00000396973.4_Silent_p.V198V|PCK2_ENST00000545054.2_Silent_p.V64V|PCK2_ENST00000559250.1_Silent_p.V210V	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	198					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		GGACACCTGTGCTTCAGGCCC	0.612																																					p.V198V													.	PCK2	66		0			c.G594T												75.0	57.0	63.0					14																	24567817		2203	4300	6503	SO:0001819	synonymous_variant	5106	exon4			ACCTGTGCTTCAG	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.594G>T	14.37:g.24567817G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_004563	80	0.00	0	O43253|Q86U01|Q9BV62	Silent	SNP	ENST00000216780.4	37	CCDS9609.1																																																																																					0.612	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071900.3		NM_001018073	
TGM1	7051	mdanderson.org	37	14	24724426	24724426	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr14:24724426G>A	ENST00000206765.6	-	12	1802	c.1679C>T	c.(1678-1680)gCa>gTa	p.A560V	TGM1_ENST00000544573.1_Missense_Mutation_p.A118V	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	560					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GTGGGCTGCTGCTGTCTCTAC	0.622																																					p.A560V													.	TGM1	73		0			c.C1679T												69.0	62.0	64.0					14																	24724426		2203	4300	6503	SO:0001583	missense	7051	exon12			GCTGCTGCTGTCT	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1679C>T	14.37:g.24724426G>A	ENSP00000206765:p.Ala560Val		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_000359	3	0.00	0	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480117	0.84747	.	.	ENSG00000092295	ENST00000206765;ENST00000544573	D;D	0.96168	-3.93;-3.93	4.95	4.04	0.47022	.	0.051097	0.85682	D	0.000000	D	0.97108	0.9055	M	0.76002	2.32	0.58432	D	0.999991	D	0.89917	1.0	D	0.71184	0.972	D	0.97470	1.0040	10	0.87932	D	0	-18.1514	13.5134	0.61526	0.0:0.0:0.8421:0.1579	.	560	P22735	TGM1_HUMAN	V	560;118	ENSP00000206765:A560V;ENSP00000439446:A118V	ENSP00000206765:A560V	A	-	2	0	TGM1	23794266	1.000000	0.71417	0.041000	0.18516	0.926000	0.56050	8.668000	0.91158	1.268000	0.44264	0.563000	0.77884	GCA			0.622	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000073160.6		NM_000359	
ZFP36L1	677	mdanderson.org	37	14	69256669	69256669	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr14:69256669G>T	ENST00000439696.2	-	2	899	c.598C>A	c.(598-600)Cat>Aat	p.H200N	ZFP36L1_ENST00000555997.1_3'UTR|ZFP36L1_ENST00000336440.3_Missense_Mutation_p.H200N	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	200					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CTAAAGCTATGCTGGAGGCGG	0.687											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H269N													ZFP36L1,NS,carcinoma,+1,1	ZFP36L1	47	1	0			c.C805A												26.0	33.0	31.0					14																	69256669		2195	4283	6478	SO:0001583	missense	677	exon3			AGCTATGCTGGAG	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.598C>A	14.37:g.69256669G>T	ENSP00000388402:p.His200Asn		Somatic	33	0	0	1113	WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_001244701	443	0.00	0	Q13851	Missense_Mutation	SNP	ENST00000439696.2	37	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411194	0.83340	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246;ENST00000557086	T;T	0.34859	1.34;1.34	4.4	4.4	0.53042	.	0.134947	0.49305	U	0.000142	T	0.58736	0.2143	M	0.65498	2.005	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.64236	-0.6455	10	0.72032	D	0.01	-0.7401	17.1573	0.86794	0.0:0.0:1.0:0.0	.	200	Q07352	TISB_HUMAN	N	200;200;183;206	ENSP00000388402:H200N;ENSP00000337386:H200N	ENSP00000337386:H200N	H	-	1	0	ZFP36L1	68326422	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.553000	0.98118	2.264000	0.75181	0.585000	0.79938	CAT			0.687	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413227.1			
CHORDC2P	317775	bcgsc.ca	37	14	90204733	90204733	+	RNA	SNP	G	G	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr14:90204733G>C	ENST00000555070.1	-	0	170																											CGCTAGCACCGGTTTGACAAC	0.532																																					.													.	.			0			.																																											317775	.			AGCACCGGTTTGA																													14.37:g.90204733G>C			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_1	30	0.17	5	.	0		0		RNA	SNP	ENST00000555070.1	37																																																																																						0.532	RP11-33N16.3-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000411023.1			
FSIP1	161835	mdanderson.org	37	15	40034047	40034047	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr15:40034047G>T	ENST00000350221.3	-	6	823	c.614C>A	c.(613-615)cCt>cAt	p.P205H	FSIP1_ENST00000559692.1_5'UTR	NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	205										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		TTCTTCTGGAGGGATTTGAGT	0.338																																					p.P205H													.	FSIP1	53		0			c.C614A												86.0	85.0	85.0					15																	40034047		2203	4298	6501	SO:0001583	missense	161835	exon6			TCTGGAGGGATTT	BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.614C>A	15.37:g.40034047G>T	ENSP00000280236:p.Pro205His		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_152597	3	0.00	0	Q6X2C8|Q86Y89	Missense_Mutation	SNP	ENST00000350221.3	37	CCDS10050.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920955	0.33908	.	.	ENSG00000150667	ENST00000350221	T	0.26810	1.71	5.55	4.63	0.57726	.	0.282695	0.26788	N	0.022482	T	0.47303	0.1438	M	0.76002	2.32	0.33545	D	0.595338	D	0.76494	0.999	D	0.68483	0.958	T	0.62737	-0.6791	9	.	.	.	-3.7918	10.5283	0.44963	0.0895:0.0:0.9105:0.0	.	205	Q8NA03	FSIP1_HUMAN	H	205	ENSP00000280236:P205H	.	P	-	2	0	FSIP1	37821339	1.000000	0.71417	0.775000	0.31657	0.011000	0.07611	2.181000	0.42547	1.334000	0.45468	-0.150000	0.13652	CCT			0.338	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252118.2		NM_152597	
ITGA11	22801	mdanderson.org	37	15	68628046	68628046	+	Missense_Mutation	SNP	G	G	A	rs571292268	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr15:68628046G>A	ENST00000315757.7	-	12	1500	c.1414C>T	c.(1414-1416)Cgg>Tgg	p.R472W	ITGA11_ENST00000423218.2_Missense_Mutation_p.R472W	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	472					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TGCTGGCCCCGCATAGCCTGG	0.632													G|||	2	0.000399361	0.0	0.0	5008	,	,		19329	0.0		0.0	False		,,,				2504	0.002				p.R472W													.	ITGA11	110		0			c.C1414T												27.0	33.0	31.0					15																	68628046		2019	4176	6195	SO:0001583	missense	22801	exon12			GGCCCCGCATAGC	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1414C>T	15.37:g.68628046G>A	ENSP00000327290:p.Arg472Trp		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	62	0.05	3	NM_001004439	22	0.00	0	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	ENST00000315757.7	37	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324215	0.60634	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491;ENST00000537153	T;T	0.11712	2.75;2.75	5.77	4.79	0.61399	.	0.202876	0.50627	D	0.000106	T	0.12263	0.0298	L	0.39147	1.195	0.22457	N	0.999087	P;D	0.56521	0.918;0.976	P;B	0.44860	0.462;0.394	T	0.10730	-1.0617	10	0.62326	D	0.03	.	13.2986	0.60311	0.0:0.0:0.7842:0.2157	.	472;472	A8K8T0;Q9UKX5	.;ITA11_HUMAN	W	472;472;107;472	ENSP00000327290:R472W;ENSP00000403392:R472W	ENSP00000327290:R472W	R	-	1	2	ITGA11	66415100	0.098000	0.21812	1.000000	0.80357	0.951000	0.60555	1.334000	0.33827	2.723000	0.93209	0.655000	0.94253	CGG			0.632	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_012211	
ARIH1	25820	broad.mit.edu	37	15	72767235	72767235	+	Silent	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr15:72767235C>T	ENST00000379887.4	+	1	569	c.255C>T	c.(253-255)ggC>ggT	p.G85G	RP11-1007O24.3_ENST00000565181.1_lincRNA	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	85	Gly-rich.				cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						gcggcggcggcggtggtggtg	0.736																																					p.G85G													.	ARIH1	42		0			c.C255T												4.0	3.0	3.0					15																	72767235		1491	2998	4489	SO:0001819	synonymous_variant	25820	exon1			CGGCGGCGGTGGT	AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.255C>T	15.37:g.72767235C>T			Somatic	74	0.0135135135	1		WXS	Illumina HiSeq	Phase_I	61	0.10	6	NM_005744	1	0.00	0	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Silent	SNP	ENST00000379887.4	37	CCDS10244.1																																																																																					0.736	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257350.1		NM_005744	
PML	5371	mdanderson.org	37	15	74327860	74327860	+	Intron	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr15:74327860G>A	ENST00000268058.3	+	7	1806				PML_ENST00000395135.3_Intron|PML_ENST00000565898.1_Intron|PML_ENST00000569477.1_3'UTR|PML_ENST00000435786.2_3'UTR|PML_ENST00000569965.1_Intron|PML_ENST00000395132.2_Intron|PML_ENST00000436891.3_3'UTR|PML_ENST00000268059.6_Nonsense_Mutation_p.W686*|PML_ENST00000563500.1_3'UTR|PML_ENST00000354026.6_Nonsense_Mutation_p.W638*|PML_ENST00000359928.4_Intron|PML_ENST00000564428.1_Intron	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						TTCGGACTTGGTCTCCCCATG	0.607			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.W686X				Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML	169		0			c.G2058A												64.0	60.0	61.0					15																	74327860		2198	4297	6495	SO:0001627	intron_variant	5371	exon8			GACTTGGTCTCCC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1710+989G>A	15.37:g.74327860G>A			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	34	0.12	4	NM_033239	117	0.01	1	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Nonsense_Mutation	SNP	ENST00000268058.3	37	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065587	0.55539	.	.	ENSG00000140464	ENST00000268059;ENST00000354026	.	.	.	2.99	-3.29	0.05017	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6539	0.22977	0.0:0.3915:0.4097:0.1988	.	.	.	.	X	686;638	.	ENSP00000268059:W686X	W	+	3	0	PML	72114913	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.886000	0.00342	-0.799000	0.04439	0.462000	0.41574	TGG			0.607	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269021.3		NM_002675	
PIGQ	9091	mdanderson.org	37	16	626214	626214	+	Missense_Mutation	SNP	G	G	A	rs371210440		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr16:626214G>A	ENST00000026218.5	+	4	990	c.902G>A	c.(901-903)cGc>cAc	p.R301H	PIGQ_ENST00000321878.5_Missense_Mutation_p.R301H|PIGQ_ENST00000470411.2_3'UTR|PIGQ_ENST00000409527.2_Missense_Mutation_p.R301H	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	301	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				GGGAGAAGCCGCATCGGGCAT	0.706																																					p.R301H													.	PIGQ	43		0			c.G902A							G	HIS/ARG,HIS/ARG	0,4240		0,0,2120	25.0	22.0	23.0		902,902	1.8	0.0	16		23	1,8375		0,1,4187	no	missense,missense	PIGQ	NM_004204.3,NM_148920.1	29,29	0,1,6307	AA,AG,GG		0.0119,0.0,0.0079	probably-damaging,probably-damaging	301/582,301/761	626214	1,12615	2120	4188	6308	SO:0001583	missense	9091	exon4			GAAGCCGCATCGG	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.902G>A	16.37:g.626214G>A	ENSP00000026218:p.Arg301His		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_148920	72	0.00	0	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	G	8.316	0.823223	0.16678	0.0	1.19E-4	ENSG00000007541	ENST00000409527;ENST00000422307;ENST00000321878;ENST00000026218	T;T;T;T	0.51574	0.88;0.7;0.88;2.17	5.22	1.81	0.25067	.	0.366105	0.32444	N	0.006082	T	0.30198	0.0757	L	0.29908	0.895	0.44531	D	0.997483	B;B;B	0.27791	0.083;0.189;0.01	B;B;B	0.21708	0.028;0.036;0.011	T	0.05750	-1.0866	10	0.51188	T	0.08	-10.208	6.3948	0.21607	0.2347:0.0:0.6386:0.1266	.	315;301;301	E7ERP4;Q9BRB3;Q9BRB3-2	.;PIGQ_HUMAN;.	H	301	ENSP00000386760:R301H;ENSP00000413753:R301H;ENSP00000326674:R301H;ENSP00000026218:R301H	ENSP00000026218:R301H	R	+	2	0	PIGQ	566215	0.973000	0.33851	0.007000	0.13788	0.010000	0.07245	1.757000	0.38400	0.114000	0.18032	0.467000	0.42956	CGC			0.706	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000239270.2		NM_004204	
TSC2	7249	ucsc.edu;bcgsc.ca	37	16	2096364	2096364	+	5'Flank	SNP	G	G	T	rs375615004		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr16:2096364G>T	ENST00000219476.3	+	0	0				TSC2_ENST00000382538.6_5'Flank|TSC2_ENST00000350773.4_5'Flank|TSC2_ENST00000439673.2_5'Flank|TSC2_ENST00000353929.4_5'Flank|NTHL1_ENST00000219066.1_Missense_Mutation_p.A48E|TSC2_ENST00000401874.2_5'Flank|TSC2_ENST00000568454.1_5'Flank|NTHL1_ENST00000562951.1_5'Flank	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GCTTTTCCTCGCTTCTGCAAA	0.622			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.A48E			yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	NTHL1	24		0			c.C143A												55.0	58.0	57.0					16																	2096364		2198	4300	6498	SO:0001631	upstream_gene_variant	4913	exon2	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TTCCTCGCTTCTG	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745		16.37:g.2096364G>T	Exception_encountered		Somatic	64	0	0		WXS	Illumina HiSeq		42	0.10	4	NM_002528	156	0.00	0	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	G	6.587	0.476730	0.12521	.	.	ENSG00000065057	ENST00000219066	T	0.13778	2.56	4.83	1.32	0.21799	.	1.098890	0.06898	N	0.805511	T	0.03827	0.0108	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40997	-0.9533	10	0.02654	T	1	-3.4561	3.0134	0.06052	0.0:0.402:0.2342:0.3638	.	48;48	E5KTI5;P78549	.;NTHL1_HUMAN	E	48	ENSP00000219066:A48E	ENSP00000219066:A48E	A	-	2	0	NTHL1	2036365	0.000000	0.05858	0.328000	0.25416	0.092000	0.18411	-0.549000	0.06041	0.462000	0.27095	-0.270000	0.10280	GCG			0.622	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250657.2		NM_000548	
CREBBP	1387	mdanderson.org	37	16	3778522	3778522	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr16:3778522G>T	ENST00000262367.5	-	31	7335	c.6526C>A	c.(6526-6528)Cca>Aca	p.P2176T	CREBBP_ENST00000382070.3_Missense_Mutation_p.P2138T	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2176					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTGTGTCCTGGGTTCATGATG	0.607			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.P2176T				Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546		0			c.C6526A												106.0	84.0	91.0					16																	3778522		2197	4300	6497	SO:0001583	missense	1387	exon31			GTCCTGGGTTCAT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6526C>A	16.37:g.3778522G>T	ENSP00000262367:p.Pro2176Thr		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_004380	222	0.00	0	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	g	5.785	0.329159	0.10956	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.82893	-1.66;-1.57	5.28	2.01	0.26516	.	0.352376	0.27406	N	0.019507	T	0.63896	0.2550	N	0.19112	0.55	0.50632	D	0.999886	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.50825	-0.8782	10	0.13470	T	0.59	-6.6227	4.8306	0.13437	0.0761:0.1101:0.4679:0.3459	.	2206;2176	Q4LE28;Q92793	.;CBP_HUMAN	T	2176;2206;2138;711	ENSP00000262367:P2176T;ENSP00000371502:P2138T	ENSP00000262367:P2176T	P	-	1	0	CREBBP	3718523	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.010000	0.29898	1.202000	0.43218	0.655000	0.94253	CCA			0.607	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251591.2		NM_004380	
KIFC3	3801	mdanderson.org	37	16	57803627	57803627	+	Silent	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr16:57803627G>T	ENST00000379655.4	-	9	1355	c.1098C>A	c.(1096-1098)acC>acA	p.T366T	KIFC3_ENST00000541240.1_Silent_p.T388T|KIFC3_ENST00000539578.1_Silent_p.T308T|KIFC3_ENST00000543930.1_Silent_p.T227T|KIFC3_ENST00000562903.1_Silent_p.T227T|KIFC3_ENST00000465878.2_Silent_p.T227T|KIFC3_ENST00000540079.2_Silent_p.T264T|KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000421376.2_Silent_p.T227T|KIFC3_ENST00000445690.2_Silent_p.T366T	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	366					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				TCAGCAAGTTGGTCCGGACGC	0.682																																					p.T366T													.	KIFC3	55		0			c.C1098A												35.0	34.0	34.0					16																	57803627		2198	4300	6498	SO:0001819	synonymous_variant	3801	exon9			CAAGTTGGTCCGG	BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1098C>A	16.37:g.57803627G>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_005550	51	0.00	0	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Silent	SNP	ENST00000379655.4	37	CCDS10789.2																																																																																					0.682	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257329.2		NM_005550	
TCF25	22980	broad.mit.edu	37	16	89940142	89940142	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr16:89940142G>T	ENST00000263346.8	+	1	123	c.67G>T	c.(67-69)Gcc>Tcc	p.A23S		NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	23					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		CGGGCCCGGCGCCTTGCATTT	0.697																																					p.A23S													.	TCF25	61		0			c.G67T												15.0	21.0	19.0					16																	89940142		2187	4288	6475	SO:0001583	missense	22980	exon1			CCCGGCGCCTTGC	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.67G>T	16.37:g.89940142G>T	ENSP00000263346:p.Ala23Ser		Somatic	72	0.0138888889	1		WXS	Illumina HiSeq	Phase_I	71	0.08	6	NM_014972	150	0.01	2	Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	37	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	g	19.19	3.780277	0.70222	.	.	ENSG00000141002	ENST00000263346;ENST00000310554	.	.	.	4.67	3.72	0.42706	.	0.423635	0.25264	N	0.031930	T	0.36635	0.0974	N	0.08118	0	0.80722	D	1	D;P	0.57571	0.98;0.904	P;P	0.54270	0.747;0.502	T	0.11792	-1.0573	9	0.29301	T	0.29	.	9.8732	0.41187	0.0966:0.0:0.9034:0.0	.	23;23	B4DVF2;Q9BQ70	.;TCF25_HUMAN	S	23	.	ENSP00000263346:A23S	A	+	1	0	TCF25	88467643	0.999000	0.42202	0.900000	0.35374	0.531000	0.34715	3.236000	0.51336	1.212000	0.43366	0.457000	0.33378	GCC			0.697	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000272875.2		NM_014972	
TMEM132E	124842	mdanderson.org	37	17	32964437	32964437	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr17:32964437C>T	ENST00000321639.5	+	10	2469	c.2141C>T	c.(2140-2142)aCg>aTg	p.T714M		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	714						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTGCTCGCCACGACCCCTGTG	0.667																																					p.T714M													.	TMEM132E	122		0			c.C2141T												38.0	43.0	41.0					17																	32964437		2203	4299	6502	SO:0001583	missense	124842	exon10			TCGCCACGACCCC	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.2141C>T	17.37:g.32964437C>T	ENSP00000316532:p.Thr714Met		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_207313	0		0	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068791	0.76301	.	.	ENSG00000181291	ENST00000321639	T	0.18657	2.2	4.65	4.65	0.58169	.	0.184371	0.48286	D	0.000193	T	0.34164	0.0888	L	0.37630	1.12	0.36382	D	0.862007	D	0.89917	1.0	D	0.63113	0.911	T	0.31641	-0.9936	10	0.49607	T	0.09	-19.0289	16.2872	0.82727	0.0:1.0:0.0:0.0	.	714	Q6IEE7	T132E_HUMAN	M	714	ENSP00000316532:T714M	ENSP00000316532:T714M	T	+	2	0	TMEM132E	29988550	0.996000	0.38824	0.444000	0.26895	0.847000	0.48162	3.813000	0.55636	2.412000	0.81896	0.549000	0.68633	ACG			0.667	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256440.2		NM_207313	
KRT26	353288	broad.mit.edu	37	17	38925171	38925171	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr17:38925171C>T	ENST00000335552.4	-	6	1195	c.1147G>A	c.(1147-1149)Gaa>Aaa	p.E383K		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				ATGTCAATTTCTTTTTCTAAA	0.343																																					p.E383K													.	KRT26	49		0			c.G1147A												44.0	45.0	45.0					17																	38925171		2202	4299	6501	SO:0001583	missense	353288	exon6			CAATTTCTTTTTC	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.1147G>A	17.37:g.38925171C>T	ENSP00000334798:p.Glu383Lys		Somatic	111	0.0720720721	8		WXS	Illumina HiSeq	Phase_I	95	0.16	15	NM_181539	0		0		Missense_Mutation	SNP	ENST00000335552.4	37	CCDS11374.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.548809	0.86127	.	.	ENSG00000186393	ENST00000335552	D	0.96774	-4.12	5.26	5.26	0.73747	Filament (1);	0.000000	0.56097	D	0.000023	D	0.99102	0.9691	H	0.99211	4.47	0.45791	D	0.998674	D	0.89917	1.0	D	0.97110	1.0	D	0.98928	1.0786	10	0.87932	D	0	.	18.822	0.92100	0.0:1.0:0.0:0.0	.	383	Q7Z3Y9	K1C26_HUMAN	K	383	ENSP00000334798:E383K	ENSP00000334798:E383K	E	-	1	0	KRT26	36178697	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.105000	0.71505	2.608000	0.88229	0.655000	0.94253	GAA			0.343	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257215.1		NM_181539	
BRCA1	672	hgsc.bcm.edu;bcgsc.ca	37	17	41234509	41234509	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr17:41234509G>T	ENST00000357654.3	-	12	4387	c.4269C>A	c.(4267-4269)agC>agA	p.S1423R	BRCA1_ENST00000346315.3_Missense_Mutation_p.S1423R|BRCA1_ENST00000491747.2_Missense_Mutation_p.S320R|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.S1127R|BRCA1_ENST00000493795.1_Missense_Mutation_p.S1376R|BRCA1_ENST00000471181.2_Missense_Mutation_p.S1423R|BRCA1_ENST00000468300.1_Missense_Mutation_p.S320R|BRCA1_ENST00000351666.3_Missense_Mutation_p.S240R|BRCA1_ENST00000354071.3_Missense_Mutation_p.S1423R|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000352993.3_Missense_Mutation_p.S281R	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1423	Interaction with PALB2.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1423R(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TAGAAGGCTGGCTCCCATGCT	0.443			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.S1423R			yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	BRCA1,NS,carcinoma,0,1	BRCA1	0	1	1	Substitution - Missense(1)	lung(1)	c.C4269A												201.0	172.0	182.0					17																	41234509		2203	4300	6503	SO:0001583	missense	672	exon12	Familial Cancer Database		AGGCTGGCTCCCA	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4269C>A	17.37:g.41234509G>T	ENSP00000350283:p.Ser1423Arg		Somatic	112	0	0		WXS	Illumina HiSeq	.	115	0.05	6	NM_007300	82	0.00	0	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.37|19.37	3.815357|3.815357	0.70912|0.70912	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000461574|ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.62788	.|0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	5.5|5.5	4.47|4.47	0.54385|0.54385	.|.	.|0.184440	.|0.38959	.|N	.|0.001519	T|T	0.66597|0.66597	0.2805|0.2805	L|L	0.34521|0.34521	1.04|1.04	0.32968|0.32968	D|D	0.521921|0.521921	.|D;D;D;D;D;D;P;D	.|0.71674	.|0.995;0.998;0.986;0.995;0.986;0.995;0.454;0.997	.|P;D;P;D;P;P;B;D	.|0.75484	.|0.843;0.986;0.796;0.933;0.796;0.873;0.105;0.956	T|T	0.72507|0.72507	-0.4272|-0.4272	5|10	.|0.87932	.|D	.|0	.|.	9.1374|9.1374	0.36883|0.36883	0.1341:0.0:0.8659:0.0|0.1341:0.0:0.8659:0.0	.|.	.|319;273;319;320;320;1423;1423;1423	.|E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.|.;.;.;.;.;.;BRCA1_HUMAN;.	D|R	188|1423;1423;1423;281;1423;240;1127;320;273;1423;1376;319;319;194;273;195	.|ENSP00000350283:S1423R;ENSP00000326002:S1423R;ENSP00000312236:S281R;ENSP00000246907:S1423R;ENSP00000338007:S240R;ENSP00000310938:S1127R;ENSP00000417148:S320R;ENSP00000377294:S273R;ENSP00000418960:S1423R;ENSP00000418775:S1376R;ENSP00000420412:S319R;ENSP00000419481:S194R;ENSP00000418819:S273R;ENSP00000418212:S195R	.|ENSP00000310938:S1127R	A|S	-|-	2|3	0|2	BRCA1|BRCA1	38488035|38488035	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.883000|0.883000	0.51084|0.51084	1.459000|1.459000	0.35234|0.35234	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GCC|AGC			0.443	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348798.2		NM_007294	
LOC100294341	100294341	broad.mit.edu	37	17	43601766	43601766	+	RNA	DEL	A	A	-			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr17:43601766delA	ENST00000253803.2	+	0	267				RN7SL739P_ENST00000585071.1_RNA																							TTTTCAGGTCAAAAACCCTAA	0.363																																					.													.	.			0			.																																											0	.			CAGGTCAAAAACC																													17.37:g.43601766delA			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	3	0.00	0		RNA	DEL	ENST00000253803.2	37																																																																																						0.363	RP11-798G7.5-201	KNOWN	basic	antisense	antisense					
TLK2	11011	broad.mit.edu	37	17	60637441	60637441	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr17:60637441G>A	ENST00000326270.9	+	10	1053	c.785G>A	c.(784-786)cGa>cAa	p.R262Q	TLK2_ENST00000582809.1_Missense_Mutation_p.R113Q|TLK2_ENST00000343388.7_Missense_Mutation_p.R230Q|TLK2_ENST00000542523.1_Missense_Mutation_p.R230Q|TLK2_ENST00000346027.5_Missense_Mutation_p.R262Q	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	262			R -> Q. {ECO:0000269|PubMed:17344846}.		cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R262Q(17)|p.R261Q(9)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TACAAGGAACGATTAAATAGA	0.358																																					p.R262Q													TLK2_ENST00000346027,NS,carcinoma,0,31	TLK2	223	31	26	Substitution - Missense(26)	endometrium(15)|kidney(9)|central_nervous_system(2)	c.G785A												72.0	74.0	73.0					17																	60637441		2203	4298	6501	SO:0001583	missense	11011	exon10			AGGAACGATTAAA	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.785G>A	17.37:g.60637441G>A	ENSP00000316512:p.Arg262Gln		Somatic	500	0	0		WXS	Illumina HiSeq	Phase_I	457	0.02	7	NM_006852	43	0.00	0	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37		.	.	.	.	.	.	.	.	.	.	G	17.31	3.356600	0.61293	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.66460	-0.16;-0.21;-0.13;-0.21	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.70474	0.3228	N	0.26092	0.79	0.80722	D	1	D;B;B;B	0.89917	1.0;0.369;0.031;0.135	D;B;B;B	0.85130	0.997;0.074;0.016;0.012	T	0.64896	-0.6299	10	0.17369	T	0.5	.	16.8221	0.85835	0.0:0.0:1.0:0.0	.	262;230;262;262	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	Q	262;230;262;230	ENSP00000275780:R262Q;ENSP00000340800:R230Q;ENSP00000316512:R262Q;ENSP00000442311:R230Q	ENSP00000316512:R262Q	R	+	2	0	TLK2	57991173	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.504000	0.97986	2.516000	0.84829	0.655000	0.94253	CGA			0.358	TLK2-004	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000445140.1		NM_006852	
SMCHD1	23347	mdanderson.org	37	18	2724961	2724961	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr18:2724961G>T	ENST00000320876.6	+	21	3006	c.2668G>T	c.(2668-2670)Gcc>Tcc	p.A890S	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.A890S	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	890					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AGGTGTTACAGCCAAGGGCCC	0.323																																					p.A890S													.	SMCHD1	88		0			c.G2668T												65.0	61.0	62.0					18																	2724961		1827	4070	5897	SO:0001583	missense	23347	exon21			GTTACAGCCAAGG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2668G>T	18.37:g.2724961G>T	ENSP00000326603:p.Ala890Ser		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	67	0.06	4	NM_015295	26	0.00	0	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588703	0.46110	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.35789	1.29;1.31	5.6	5.6	0.85130	.	0.057631	0.64402	D	0.000002	T	0.42743	0.1216	L	0.36672	1.1	0.38945	D	0.958235	D	0.56521	0.976	P	0.50049	0.629	T	0.41998	-0.9477	10	0.72032	D	0.01	-16.7004	19.6107	0.95606	0.0:0.0:1.0:0.0	.	890	A6NHR9	SMHD1_HUMAN	S	890	ENSP00000326603:A890S;ENSP00000261598:A890S	ENSP00000261598:A890S	A	+	1	0	SMCHD1	2714961	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	6.968000	0.76086	2.648000	0.89879	0.655000	0.94253	GCC			0.323	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441082.2			
LRG1	116844	mdanderson.org	37	19	4538737	4538737	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:4538737G>T	ENST00000306390.6	-	2	719	c.259C>A	c.(259-261)Ctc>Atc	p.L87I	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'UTR	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	87					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTGGAGGAGGTTGGCTGGC	0.622																																					p.L87I													.	LRG1	25		0			c.C259A												43.0	40.0	41.0					19																	4538737		2203	4300	6503	SO:0001583	missense	116844	exon2			GGAGGAGGTTGGC		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.259C>A	19.37:g.4538737G>T	ENSP00000302621:p.Leu87Ile		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_052972	6	0.00	0	Q8N4F5|Q96QZ4	Missense_Mutation	SNP	ENST00000306390.6	37	CCDS12130.1	.	.	.	.	.	.	.	.	.	.	.	0.946	-0.707955	0.03230	.	.	ENSG00000171236	ENST00000306390;ENST00000538589	T	0.02606	4.23	4.71	-9.41	0.00613	.	2.324040	0.01962	N	0.043457	T	0.01189	0.0039	N	0.04724	-0.175	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46952	-0.9154	10	0.22706	T	0.39	-0.0293	0.0448	0.00010	0.3023:0.176:0.2036:0.3181	.	87	P02750	A2GL_HUMAN	I	87	ENSP00000302621:L87I	ENSP00000302621:L87I	L	-	1	0	LRG1	4489737	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.558000	0.05978	-2.917000	0.00306	-2.210000	0.00300	CTC			0.622	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458654.2		NM_052972	
KHSRP	8570	mdanderson.org	37	19	6417053	6417053	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:6417053G>T	ENST00000398148.3	-	12	1219	c.1127C>A	c.(1126-1128)cCa>cAa	p.P376Q	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	376	Gly-rich.|KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						GCACCTGTCTGGGGGCCCCAT	0.627																																					p.P376Q	Colon(55;593 1006 2067 9135 22980)												.	KHSRP	51		0			c.C1127A												57.0	64.0	62.0					19																	6417053		1926	4148	6074	SO:0001583	missense	8570	exon12			CTGTCTGGGGGCC	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1127C>A	19.37:g.6417053G>T	ENSP00000381216:p.Pro376Gln		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_003685	1844	0.00	1	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541256	0.85917	.	.	ENSG00000088247	ENST00000398148;ENST00000201886;ENST00000424942	T	0.35236	1.32	5.53	5.53	0.82687	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.052077	0.85682	D	0.000000	T	0.54967	0.1891	L	0.48986	1.54	0.58432	D	0.999999	P	0.38129	0.619	P	0.57679	0.825	T	0.48352	-0.9043	10	0.45353	T	0.12	.	18.2323	0.89937	0.0:0.0:1.0:0.0	.	376	Q92945	FUBP2_HUMAN	Q	376;376;332	ENSP00000381216:P376Q	ENSP00000201886:P376Q	P	-	2	0	KHSRP	6368053	1.000000	0.71417	0.970000	0.41538	0.979000	0.70002	7.751000	0.85126	2.587000	0.87381	0.655000	0.94253	CCA			0.627	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453305.1			
ATG4D	84971	mdanderson.org	37	19	10665783	10665783	+	IGR	SNP	G	G	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:10665783G>C	ENST00000309469.4	+	0	1949				KRI1_ENST00000361821.5_Missense_Mutation_p.F589L|KRI1_ENST00000312962.6_Missense_Mutation_p.F593L|MIR1238_ENST00000408483.1_RNA	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase						apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			AGAGTGACTTGAAGACCTGCC	0.602																																					p.F593L													.	KRI1	65		0			c.C1779G												71.0	68.0	69.0					19																	10665783		2203	4300	6503	SO:0001628	intergenic_variant	65095	exon18			TGACTTGAAGACC	AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582		19.37:g.10665783G>C			Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_023008	181	0.00	0	Q969K0	Missense_Mutation	SNP	ENST00000309469.4	37	CCDS12241.1	.	.	.	.	.	.	.	.	.	.	G	5.172	0.217234	0.09810	.	.	ENSG00000129347	ENST00000312962;ENST00000361821	T;T	0.08720	3.24;3.06	5.12	-0.158	0.13383	Kri1-like, C-terminal (1);	0.136644	0.50627	D	0.000110	T	0.01870	0.0059	N	0.01352	-0.895	0.41529	D	0.988442	B;B	0.18310	0.014;0.027	B;B	0.23150	0.024;0.044	T	0.44907	-0.9297	10	0.18710	T	0.47	-26.0824	0.2569	0.00213	0.263:0.1964:0.2987:0.2418	.	593;589	Q8N9T8;D3YTE0	KRI1_HUMAN;.	L	593;589	ENSP00000320917:F593L;ENSP00000355366:F589L	ENSP00000320917:F593L	F	-	3	2	KRI1	10526783	0.763000	0.28462	1.000000	0.80357	0.895000	0.52256	0.069000	0.14552	0.565000	0.29255	0.563000	0.77884	TTC			0.602	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452022.1		NM_032885	
KANK2	25959	broad.mit.edu	37	19	11304551	11304551	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:11304551G>T	ENST00000586659.1	-	4	519	c.205C>A	c.(205-207)Cgc>Agc	p.R69S	KANK2_ENST00000589894.1_Missense_Mutation_p.R69S|KANK2_ENST00000589359.1_Missense_Mutation_p.R69S|KANK2_ENST00000432929.2_Missense_Mutation_p.R69S|KANK2_ENST00000355150.5_Missense_Mutation_p.R69S			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	69	Interaction with AIFM1.				apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GAGCTCAGGCGGGGGCGGCGC	0.662																																					p.R69S													.	KANK2	47		0			c.C205A												36.0	38.0	37.0					19																	11304551		2199	4298	6497	SO:0001583	missense	25959	exon2			TCAGGCGGGGGCG	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.205C>A	19.37:g.11304551G>T	ENSP00000465650:p.Arg69Ser		Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	109	0.04	4	NM_015493	59	0.00	0	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	ENST00000586659.1	37	CCDS12255.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222530	0.58668	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.55052	0.54;0.56	4.38	4.38	0.52667	Kank N-terminal motif (1);	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	M	0.65498	2.005	0.48901	D	0.999721	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.85130	0.997;0.961;0.975	T	0.74648	-0.3595	10	0.66056	D	0.02	-20.289	15.7129	0.77644	0.0:0.0:1.0:0.0	.	69;69;69	Q63ZY3-3;Q63ZY3;Q63ZY3-2	.;KANK2_HUMAN;.	S	69	ENSP00000395650:R69S;ENSP00000347276:R69S	ENSP00000347276:R69S	R	-	1	0	KANK2	11165551	0.572000	0.26668	0.995000	0.50966	0.140000	0.21249	2.098000	0.41757	1.986000	0.57962	0.462000	0.41574	CGC			0.662	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000453066.2		NM_015493	
EPOR	2057	mdanderson.org	37	19	11492419	11492419	+	Silent	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:11492419G>T	ENST00000222139.6	-	4	638	c.534C>A	c.(532-534)atC>atA	p.I178I	EPOR_ENST00000592375.2_Silent_p.I178I	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	178	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CCTCGTAGCGGATGTGAGACG	0.692											OREG0025255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I178I													.	EPOR	26		0			c.C534A												23.0	19.0	20.0					19																	11492419		2202	4297	6499	SO:0001819	synonymous_variant	2057	exon4			GTAGCGGATGTGA	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.534C>A	19.37:g.11492419G>T			Somatic	81	0	0	672	WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_000121	11	0.00	0	B2RCG4|Q15443|Q2M205	Silent	SNP	ENST00000222139.6	37	CCDS12260.1																																																																																					0.692	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458791.1			
F2RL3	9002	mdanderson.org	37	19	17000071	17000071	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:17000071G>T	ENST00000248076.3	+	1	401	c.71G>T	c.(70-72)aGc>aTc	p.S24I	F2RL3_ENST00000599210.1_Missense_Mutation_p.S24I	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	24					blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CAGACCCCCAGCGTCTACGAC	0.662																																					p.S24I													.	F2RL3	20		0			c.G71T												24.0	26.0	26.0					19																	17000071		2186	4295	6481	SO:0001583	missense	9002	exon1			CCCCCAGCGTCTA	AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0		ENST00000248076.3:c.71G>T	19.37:g.17000071G>T	ENSP00000248076:p.Ser24Ile		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_003950	2	0.00	0	O76067|Q6DK42	Missense_Mutation	SNP	ENST00000248076.3	37	CCDS12350.1	.	.	.	.	.	.	.	.	.	.	G	7.038	0.561941	0.13498	.	.	ENSG00000127533	ENST00000248076	T	0.57273	0.41	2.51	-1.17	0.09648	.	2.543530	0.02295	N	0.070623	T	0.30696	0.0773	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.12502	-1.0545	10	0.31617	T	0.26	.	4.8417	0.13494	0.1216:0.0:0.5066:0.3717	.	24	Q96RI0	PAR4_HUMAN	I	24	ENSP00000248076:S24I	ENSP00000248076:S24I	S	+	2	0	F2RL3	16861071	0.001000	0.12720	0.006000	0.13384	0.176000	0.22953	0.833000	0.27504	-0.165000	0.10908	0.491000	0.48974	AGC			0.662	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462875.1			
CILP2	148113	mdanderson.org	37	19	19655439	19655439	+	Silent	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:19655439C>T	ENST00000291495.5	+	8	2170	c.2085C>T	c.(2083-2085)agC>agT	p.S695S	CILP2_ENST00000586018.1_Silent_p.S701S	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	695						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						AGGAGGAGAGCGGCTTCCGGC	0.716																																					p.S695S													.	CILP2	84		0			c.C2085T												4.0	6.0	5.0					19																	19655439		1999	3975	5974	SO:0001819	synonymous_variant	148113	exon8			GGAGAGCGGCTTC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2085C>T	19.37:g.19655439C>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_153221	10	0.00	0	Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	CCDS12405.1																																																																																					0.716	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000459738.3		NM_153221	
ZNF492	57615	mdanderson.org	37	19	22836775	22836775	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:22836775C>A	ENST00000456783.2	+	3	332	c.88C>A	c.(88-90)Cct>Act	p.P30T		NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	30	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P30S(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AGGAAAAGAACCTTGGAATGT	0.423																																					p.P30T													ZNF492_ENST00000456783,NS,carcinoma,0,1	ZNF492	129	1	1	Substitution - Missense(1)	prostate(1)	c.C88A												97.0	111.0	106.0					19																	22836775		2201	4298	6499	SO:0001583	missense	57615	exon3			AAAGAACCTTGGA	AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.88C>A	19.37:g.22836775C>A	ENSP00000413660:p.Pro30Thr		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_020855	28	0.00	0	Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	9.979	1.227512	0.22542	.	.	ENSG00000229676	ENST00000456783	T	0.10668	2.85	0.458	0.458	0.16670	Krueppel-associated box (2);	.	.	.	.	T	0.33847	0.0877	M	0.90483	3.12	0.09310	N	1	D	0.76494	0.999	D	0.69654	0.965	T	0.05903	-1.0857	8	0.66056	D	0.02	.	.	.	.	.	30	Q9P255	ZN492_HUMAN	T	30	ENSP00000413660:P30T	ENSP00000413660:P30T	P	+	1	0	ZNF492	22628615	0.674000	0.27549	0.100000	0.21137	0.091000	0.18340	1.166000	0.31834	0.482000	0.27582	0.484000	0.47621	CCT			0.423	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464581.1		NM_020855	
LTBP4	8425	broad.mit.edu;mdanderson.org	37	19	41113429	41113429	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:41113429G>T	ENST00000308370.7	+	10	1351	c.1351G>T	c.(1351-1353)Ggc>Tgc	p.G451C	LTBP4_ENST00000396819.3_Missense_Mutation_p.G384C|LTBP4_ENST00000545697.1_5'UTR|LTBP4_ENST00000204005.9_Missense_Mutation_p.G414C|RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000602240.1_3'UTR	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	451	TB 2.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCACCCTTCGGCTCAGGTGA	0.642																																					.													.	LTBP4	101		0			.												13.0	15.0	15.0					19																	41113429		2025	4161	6186	SO:0001583	missense	8425	.			CCCTTCGGCTCAG	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1351G>T	19.37:g.41113429G>T	ENSP00000311905:p.Gly451Cys		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	.	42	0.00	0	O00508|O75412|O75413	Missense_Mutation	SNP	ENST00000308370.7	37		.	.	.	.	.	.	.	.	.	.	G	24.9	4.583856	0.86748	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819	D;D;D	0.93906	-3.31;-3.31;-3.31	4.56	4.56	0.56223	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.39083	N	0.001467	D	0.97065	0.9041	M	0.88640	2.97	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97960	1.0337	10	0.72032	D	0.01	.	16.0844	0.81031	0.0:0.0:1.0:0.0	.	384;451;414	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	C	414;451;384	ENSP00000204005:G414C;ENSP00000311905:G451C;ENSP00000380031:G384C	ENSP00000204005:G414C	G	+	1	0	LTBP4	45805269	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	6.036000	0.70948	2.077000	0.62373	0.491000	0.48974	GGC			0.642	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_003573	
DACT3	147906	broad.mit.edu	37	19	47151865	47151865	+	Silent	SNP	A	A	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:47151865A>C	ENST00000391916.2	-	4	1837	c.1764T>G	c.(1762-1764)ggT>ggG	p.G588G	DACT3_ENST00000300875.4_Silent_p.G363G	NM_145056.2	NP_659493.2	Q96B18	DACT3_HUMAN	dishevelled-binding antagonist of beta-catenin 3	588					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			lung(1)	1		Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000173)|all cancers(93;0.000464)|Epithelial(262;0.02)|GBM - Glioblastoma multiforme(486;0.0325)		CACCTGCTCCACCCCCAGAGG	0.647																																					p.G588G													.	DACT3	26		0			c.T1764G												56.0	71.0	66.0					19																	47151865		2203	4300	6503	SO:0001819	synonymous_variant	147906	exon4			TGCTCCACCCCCA		CCDS12688.2, CCDS74402.1	19q13.32	2013-05-15	2013-05-15	2006-09-25	ENSG00000197380	ENSG00000197380			30745	protein-coding gene	gene with protein product		611112	"""arginine rich region 1"", ""dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)"""	RRR1		16881060	Standard	NM_145056		Approved	MGC15476, DAPPER3	uc010ekq.3	Q96B18	OTTHUMG00000153070	ENST00000391916.2:c.1764T>G	19.37:g.47151865A>C			Somatic	91	0.2197802198	20		WXS	Illumina HiSeq	Phase_I	94	0.15	14	NM_145056	10	0.10	1		Silent	SNP	ENST00000391916.2	37	CCDS12688.2																																																																																					0.647	DACT3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000334090.1		NM_145056	
GLTSCR1	29998	mdanderson.org	37	19	48204805	48204805	+	Silent	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:48204805C>T	ENST00000396720.3	+	15	4010	c.3816C>T	c.(3814-3816)tcC>tcT	p.S1272S	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1272	Poly-Ser.									breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		cctcctcttcctcctcctcct	0.716																																					p.S1272S													.	GLTSCR1	79		0			c.C3816T												6.0	9.0	8.0					19																	48204805		1999	4048	6047	SO:0001819	synonymous_variant	29998	exon15			CTCTTCCTCCTCC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.3816C>T	19.37:g.48204805C>T			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_015711	57	0.00	0	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																					0.716	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465846.1		NM_015711	
SPHK2	56848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49131956	49131956	+	Silent	SNP	C	C	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:49131956C>A	ENST00000245222.4	+	7	1257	c.891C>A	c.(889-891)ggC>ggA	p.G297G	SPHK2_ENST00000599748.1_Silent_p.G261G|SPHK2_ENST00000443164.1_Silent_p.G359G|SPHK2_ENST00000600537.1_Silent_p.G238G|SPHK2_ENST00000598088.1_Silent_p.G297G|SPHK2_ENST00000599029.1_Silent_p.G261G|SPHK2_ENST00000340932.3_Intron	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	297	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CAGCCCTGGGCCTCGACCTGT	0.612																																					p.G297G													.	.			0			c.C891A												71.0	67.0	69.0					19																	49131956		2203	4300	6503	SO:0001819	synonymous_variant	56848	exon7			CCTGGGCCTCGAC	AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.891C>A	19.37:g.49131956C>A			Somatic	31	0	0		WXS	Illumina HiSeq	.	22	0.32	7	NM_020126	22	0.27	6	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Silent	SNP	ENST00000245222.4	37	CCDS12727.1																																																																																					0.612	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000466153.1			
NR1H2	7376	mdanderson.org	37	19	50885775	50885775	+	Silent	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:50885775G>T	ENST00000253727.5	+	10	1534	c.1299G>T	c.(1297-1299)gtG>gtT	p.V433V	POLD1_ENST00000440232.2_5'Flank|NR1H2_ENST00000411902.2_Silent_p.V336V|NR1H2_ENST00000598168.1_Silent_p.V403V|POLD1_ENST00000599857.1_5'Flank|NR1H2_ENST00000599105.1_Silent_p.V389V|NR1H2_ENST00000542413.1_Silent_p.V164V|NR1H2_ENST00000593926.1_Silent_p.V433V	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	433	Ligand-binding. {ECO:0000255}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TGAGCTCTGTGCACTCGGAGC	0.672																																					p.V433V													.	NR1H2	47		0			c.G1299T												19.0	25.0	23.0					19																	50885775		2128	4249	6377	SO:0001819	synonymous_variant	7376	exon10			CTCTGTGCACTCG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.1299G>T	19.37:g.50885775G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_007121	248	0.00	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	CCDS42593.1																																																																																					0.672	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464724.2			
POLD1	5424	mdanderson.org	37	19	50918754	50918754	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:50918754G>A	ENST00000440232.2	+	21	2677	c.2624G>A	c.(2623-2625)cGc>cAc	p.R875H	POLD1_ENST00000599857.1_Missense_Mutation_p.R875H|POLD1_ENST00000595904.1_Missense_Mutation_p.R901H|CTD-2545M3.6_ENST00000599632.1_5'Flank	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	875					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		CTGTGCAACCGCATCGATATC	0.657								DNA polymerases (catalytic subunits)																													p.R875H													.	POLD1	174		0			c.G2624A												45.0	36.0	39.0					19																	50918754		2203	4300	6503	SO:0001583	missense	5424	exon21			GCAACCGCATCGA		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2624G>A	19.37:g.50918754G>A	ENSP00000406046:p.Arg875His		Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	129	0.04	5	NM_002691	402	0.00	0	Q8NER3|Q96H98	Missense_Mutation	SNP	ENST00000440232.2	37	CCDS12795.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604917	0.87157	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.18174	2.23	4.25	4.25	0.50352	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.059138	0.64402	D	0.000002	T	0.40886	0.1135	M	0.92219	3.285	0.80722	D	1	P;P	0.47409	0.792;0.895	B;P	0.49502	0.429;0.613	T	0.58487	-0.7628	10	0.62326	D	0.03	-20.3747	15.8183	0.78621	0.0:0.0:1.0:0.0	.	901;875	E7EVW0;P28340	.;DPOD1_HUMAN	H	875;876	ENSP00000406046:R875H	ENSP00000366129:R876H	R	+	2	0	POLD1	55610566	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	5.860000	0.69546	2.114000	0.64651	0.450000	0.29827	CGC			0.657	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464732.1			
U2AF2	11338	mdanderson.org	37	19	56172490	56172490	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr19:56172490G>T	ENST00000308924.4	+	5	461	c.421G>T	c.(421-423)Ggg>Tgg	p.G141W	U2AF2_ENST00000590551.1_5'Flank|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA|U2AF2_ENST00000450554.2_Missense_Mutation_p.G141W			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	141					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GCCCGTGGTCGGGAGCCAGAT	0.632																																					p.G141W													.	U2AF2	62		0			c.G421T												72.0	68.0	69.0					19																	56172490		2203	4300	6503	SO:0001583	missense	11338	exon5			GTGGTCGGGAGCC	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.421G>T	19.37:g.56172490G>T	ENSP00000307863:p.Gly141Trp		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001012478	1310	0.00	1	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	37	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	g	16.31	3.086325	0.55861	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.11385	2.79;2.78	3.56	1.18	0.20946	.	0.000000	0.85682	U	0.000000	T	0.24890	0.0604	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.00573	-1.1664	10	0.66056	D	0.02	-20.7269	8.6245	0.33881	0.0:0.1664:0.6617:0.1719	.	141;141	P26368;P26368-2	U2AF2_HUMAN;.	W	141	ENSP00000307863:G141W;ENSP00000388475:G141W	ENSP00000307863:G141W	G	+	1	0	U2AF2	60864302	1.000000	0.71417	0.944000	0.38274	0.821000	0.46438	8.735000	0.91549	0.257000	0.21650	0.466000	0.42574	GGG			0.632	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000453599.1		NM_007279	
PUM2	23369	mdanderson.org	37	2	20507802	20507802	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr2:20507802G>T	ENST00000361078.2	-	6	842	c.820C>A	c.(820-822)Caa>Aaa	p.Q274K	PUM2_ENST00000536417.1_Missense_Mutation_p.Q218K|PUM2_ENST00000420234.1_5'Flank|PUM2_ENST00000403432.1_Missense_Mutation_p.Q274K|PUM2_ENST00000319801.5_Missense_Mutation_p.Q274K|PUM2_ENST00000338086.5_Missense_Mutation_p.Q274K			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	274					regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTAACTGTTGAACTGTTAGT	0.358																																					p.Q274K													PUM2,NS,carcinoma,+1,1	PUM2	91	1	0			c.C820A												142.0	129.0	133.0					2																	20507802		2203	4300	6503	SO:0001583	missense	23369	exon6			ACTGTTGAACTGT	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.820C>A	2.37:g.20507802G>T	ENSP00000354370:p.Gln274Lys		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_015317	84	0.00	0	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37		.	.	.	.	.	.	.	.	.	.	G	34	5.394941	0.96009	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417;ENST00000442400	T;T;T;T;T;T	0.30981	1.71;1.9;1.87;1.51;1.71;1.69	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.55832	0.1945	L	0.61218	1.895	0.80722	D	1	D;B;D	0.57571	0.98;0.155;0.961	D;B;P	0.71656	0.974;0.043;0.839	T	0.54642	-0.8263	10	0.72032	D	0.01	-3.986	19.9944	0.97379	0.0:0.0:1.0:0.0	.	218;274;274	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	K	274;274;274;165;274;218;274	ENSP00000338173:Q274K;ENSP00000354370:Q274K;ENSP00000326746:Q274K;ENSP00000409905:Q165K;ENSP00000385992:Q274K;ENSP00000440093:Q218K	ENSP00000326746:Q274K	Q	-	1	0	PUM2	20371283	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.429000	0.97481	2.720000	0.93068	0.557000	0.71058	CAA			0.358	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015317	
EFR3B	22979	mdanderson.org	37	2	25364277	25364277	+	Nonsense_Mutation	SNP	G	G	T	rs569363896	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr2:25364277G>T	ENST00000403714.3	+	17	2080	c.1897G>T	c.(1897-1899)Gag>Tag	p.E633*	EFR3B_ENST00000402191.1_Nonsense_Mutation_p.E598*|EFR3B_ENST00000405108.1_Nonsense_Mutation_p.E485*|EFR3B_ENST00000401432.3_Nonsense_Mutation_p.E633*	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	633										endometrium(1)	1						CATGCTCCCCGAGGATGTGTT	0.597																																					p.E633X													.	EFR3B	29		0			c.G1897T												89.0	81.0	83.0					2																	25364277		692	1591	2283	SO:0001587	stop_gained	22979	exon17			CTCCCCGAGGATG	AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.1897G>T	2.37:g.25364277G>T	ENSP00000384081:p.Glu633*		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_014971	72	0.00	0	B7WPL8|Q86XU6	Nonsense_Mutation	SNP	ENST00000403714.3	37	CCDS46231.1	.	.	.	.	.	.	.	.	.	.	G	40	8.313629	0.98754	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000405108;ENST00000264719	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-29.1422	15.5535	0.76173	0.0:0.0:1.0:0.0	.	.	.	.	X	633;633;598;598;485;468	.	ENSP00000264719:E468X	E	+	1	0	EFR3B	25217781	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	8.568000	0.90741	2.449000	0.82847	0.563000	0.77884	GAG			0.597	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324808.1		NM_014971	
AC018804.7	0	bcgsc.ca	37	2	130987508	130987508	+	RNA	SNP	G	G	T	rs75869381		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr2:130987508G>T	ENST00000450578.1	+	0	0																											GACCAGGAAAGTGCTGAGGCC	0.552																																					.													.	.			0			.																																											0	.			AGGAAAGTGCTGA																													2.37:g.130987508G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_1	72	0.10	7	.	45	0.04	2		RNA	SNP	ENST00000450578.1	37																																																																																						0.552	AC018804.7-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000332326.2			
NFE2L2	4780	broad.mit.edu	37	2	178096691	178096691	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr2:178096691G>T	ENST00000397062.3	-	5	1194	c.640C>A	c.(640-642)Cca>Aca	p.P214T	NFE2L2_ENST00000446151.2_Missense_Mutation_p.P191T|NFE2L2_ENST00000464747.1_Missense_Mutation_p.P198T|NFE2L2_ENST00000397063.4_Missense_Mutation_p.P198T	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	214					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCTGGACTTGGAACCATGGTA	0.343			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.P214T				Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	225		0			c.C640A												134.0	127.0	129.0					2																	178096691		1855	4116	5971	SO:0001583	missense	4780	exon5			GACTTGGAACCAT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.640C>A	2.37:g.178096691G>T	ENSP00000380252:p.Pro214Thr		Somatic	255	0.0039215686	1		WXS	Illumina HiSeq	Phase_I	250	0.02	6	NM_006164	170	0.00	0	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	G	6.056	0.378698	0.11466	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929	T;T;T;T;T	0.32023	2.29;2.29;2.29;1.47;1.47	6.17	1.09	0.20402	.	0.264994	0.44285	D	0.000469	T	0.20210	0.0486	L	0.56396	1.775	0.28601	N	0.909141	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.25363	-1.0134	10	0.09084	T	0.74	.	2.9435	0.05839	0.1335:0.2363:0.4451:0.1851	.	191;214	E9PGJ7;Q16236	.;NF2L2_HUMAN	T	198;214;191;198;198	ENSP00000380253:P198T;ENSP00000380252:P214T;ENSP00000411575:P191T;ENSP00000400073:P198T;ENSP00000412191:P198T	ENSP00000380252:P214T	P	-	1	0	NFE2L2	177804937	0.976000	0.34144	0.947000	0.38551	0.969000	0.65631	1.673000	0.37534	0.167000	0.19631	-0.136000	0.14681	CCA			0.343	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000257752.4		NM_006164	
SPEG	10290	mdanderson.org	37	2	220342106	220342106	+	Silent	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr2:220342106C>T	ENST00000312358.7	+	20	4800	c.4668C>T	c.(4666-4668)acC>acT	p.T1556T	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1556	Ig-like 8.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GCGTCTACACCTGCACCGCCC	0.612																																					p.T1556T													.	SPEG	272		0			c.C4668T												36.0	43.0	41.0					2																	220342106		2079	4209	6288	SO:0001819	synonymous_variant	10290	exon20			CTACACCTGCACC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4668C>T	2.37:g.220342106C>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_005876	7	0.00	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	CCDS42824.1																																																																																					0.612	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130252.2		NM_005876	
WDFY1	57590	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	224809898	224809898	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr2:224809898T>C	ENST00000233055.4	-	1	206	c.104A>G	c.(103-105)aAg>aGg	p.K35R		NM_020830.3	NP_065881.1	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	35						cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)	18		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		GCCGTCCTCCTTGGGGATGAG	0.741																																					p.K35R													.	.			0			c.A104G												14.0	16.0	15.0					2																	224809898		2186	4290	6476	SO:0001583	missense	57590	exon1			TCCTCCTTGGGGA	AB037856	CCDS33387.1	2q36.2	2013-01-09	2003-03-13		ENSG00000085449	ENSG00000085449		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20451	protein-coding gene	gene with protein product			"""WD40 and FYVE domain containing 1"""			11739631	Standard	NM_020830		Approved	KIAA1435, FENS-1, WDF1, ZFYVE17	uc002vnq.3	Q8IWB7	OTTHUMG00000153370	ENST00000233055.4:c.104A>G	2.37:g.224809898T>C	ENSP00000233055:p.Lys35Arg		Somatic	32	0	0		WXS	Illumina HiSeq	.	32	0.22	7	NM_020830	109	0.26	28	Q53S17|Q9H9D5|Q9P2B3	Missense_Mutation	SNP	ENST00000233055.4	37	CCDS33387.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.428240	0.43122	.	.	ENSG00000085449	ENST00000233055;ENST00000429915	T;T	0.29397	1.57;1.57	4.1	2.94	0.34122	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.066631	0.56097	N	0.000021	T	0.22936	0.0554	L	0.37800	1.135	0.51767	D	0.999936	B	0.12630	0.006	B	0.12156	0.007	T	0.04752	-1.0929	10	0.51188	T	0.08	-15.325	9.0159	0.36170	0.0:0.0896:0.0:0.9104	.	35	Q8IWB7	WDFY1_HUMAN	R	35	ENSP00000233055:K35R;ENSP00000395416:K35R	ENSP00000233055:K35R	K	-	2	0	WDFY1	224518142	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	3.784000	0.55416	0.627000	0.30340	0.533000	0.62120	AAG			0.741	WDFY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000330908.1		NM_020830	
B3GNT7	93010	mdanderson.org	37	2	232263526	232263526	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr2:232263526T>C	ENST00000287590.5	+	2	1357	c.1096T>C	c.(1096-1098)Ttt>Ctt	p.F366L		NM_145236.2	NP_660279.1	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7	366					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)	17		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		GGAGCCGTGCTTTTTCCGCGC	0.647																																					p.F366L													.	B3GNT7	38		0			c.T1096C												25.0	30.0	28.0					2																	232263526		2127	4237	6364	SO:0001583	missense	93010	exon2			CCGTGCTTTTTCC	AK000770	CCDS46540.1	2q36.1	2013-02-21			ENSG00000156966	ENSG00000156966		"""Beta 3-glycosyltransferases"""	18811	protein-coding gene	gene with protein product		615313				12061784	Standard	NM_145236		Approved	beta3GnT7	uc002vrs.3	Q8NFL0	OTTHUMG00000153880	ENST00000287590.5:c.1096T>C	2.37:g.232263526T>C	ENSP00000287590:p.Phe366Leu		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_145236	294	0.00	1	B3KWY4|B7WNP0	Missense_Mutation	SNP	ENST00000287590.5	37	CCDS46540.1	.	.	.	.	.	.	.	.	.	.	T	12.30	1.895187	0.33442	.	.	ENSG00000156966	ENST00000287590	T	0.35236	1.32	5.05	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.29423	0.0733	L	0.45744	1.44	0.58432	D	0.999997	P	0.48230	0.907	B	0.40329	0.326	T	0.04976	-1.0914	10	0.28530	T	0.3	.	11.2943	0.49269	0.0:0.0:0.1521:0.8479	.	366	Q8NFL0	B3GN7_HUMAN	L	366	ENSP00000287590:F366L	ENSP00000287590:F366L	F	+	1	0	B3GNT7	231971770	1.000000	0.71417	0.998000	0.56505	0.527000	0.34593	7.939000	0.87685	1.905000	0.55150	0.454000	0.30748	TTT			0.647	B3GNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000332827.1		NM_145236	
MRPS26	64949	mdanderson.org	37	20	3027059	3027059	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr20:3027059G>T	ENST00000380325.3	+	2	377	c.253G>T	c.(253-255)Gcc>Tcc	p.A85S		NM_030811.3	NP_110438.1	Q9BYN8	RT26_HUMAN	mitochondrial ribosomal protein S26	85					DNA damage response, detection of DNA damage (GO:0042769)|peptide biosynthetic process (GO:0043043)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|lung(1)	2						GGTGCACGAGGCCCGAGCCGG	0.697																																					p.A85S													.	MRPS26	7		0			c.G253T												23.0	26.0	25.0					20																	3027059		2199	4295	6494	SO:0001583	missense	64949	exon2			CACGAGGCCCGAG	AB051354	CCDS13043.1	20p13	2012-09-13	2004-09-22		ENSG00000125901	ENSG00000125901		"""Mitochondrial ribosomal proteins / small subunits"""	14045	protein-coding gene	gene with protein product		611988	"""chromosome 20 open reading frame 193"""	C20orf193		11543634	Standard	NM_030811		Approved	MRP-S13, MRP-S26, RPMS13, dJ534B8.3	uc002whs.3	Q9BYN8	OTTHUMG00000031721	ENST00000380325.3:c.253G>T	20.37:g.3027059G>T	ENSP00000369682:p.Ala85Ser		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_030811	610	0.00	1	Q96Q58	Missense_Mutation	SNP	ENST00000380325.3	37	CCDS13043.1	.	.	.	.	.	.	.	.	.	.	G	9.116	1.007854	0.19199	.	.	ENSG00000125901	ENST00000380325	.	.	.	5.06	0.598	0.17512	.	0.238372	0.34700	N	0.003758	T	0.35595	0.0937	L	0.50333	1.59	0.20975	N	0.999811	B	0.20052	0.041	B	0.14578	0.011	T	0.19614	-1.0300	9	0.34782	T	0.22	-4.9559	7.2372	0.26076	0.0789:0.0:0.4919:0.4292	.	85	Q9BYN8	RT26_HUMAN	S	85	.	ENSP00000369682:A85S	A	+	1	0	MRPS26	2975059	0.986000	0.35501	0.022000	0.16811	0.002000	0.02628	1.409000	0.34680	-0.032000	0.13758	-0.251000	0.11542	GCC			0.697	MRPS26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077692.2		NM_030811	
PXMP4	11264	mdanderson.org	37	20	32307918	32307918	+	Silent	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr20:32307918G>T	ENST00000409299.3	-	1	188	c.96C>A	c.(94-96)ggC>ggA	p.G32G	PXMP4_ENST00000217398.3_Silent_p.G32G|PXMP4_ENST00000344022.3_Silent_p.G32G	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	32						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						CGTTCCGGAAGCCCTTAAGCA	0.687																																					p.G32G													.	PXMP4	20		0			c.C96A												40.0	42.0	41.0					20																	32307918		2203	4300	6503	SO:0001819	synonymous_variant	11264	exon1			CCGGAAGCCCTTA	AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.96C>A	20.37:g.32307918G>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	68	0.06	4	NM_183397	16	0.00	0	A2A2I7|Q9H0T4	Silent	SNP	ENST00000409299.3	37	CCDS13225.1																																																																																					0.687	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078739.2		NM_007238	
DPM1	8813	mdanderson.org	37	20	49576174	49576174	+	5'Flank	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr20:49576174G>T	ENST00000371588.5	-	0	0				DPM1_ENST00000466152.1_5'Flank|MOCS3_ENST00000244051.1_Silent_p.A265A|DPM1_ENST00000371582.4_5'Flank|DPM1_ENST00000371583.5_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						AAATCGCTGCGGGTCTGGGCC	0.637																																					p.A265A													.	MOCS3	44		0			c.G795T												50.0	57.0	55.0					20																	49576174		2203	4300	6503	SO:0001631	upstream_gene_variant	27304	exon1			CGCTGCGGGTCTG	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49576174G>T	Exception_encountered		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_014484	48	0.00	0	O15157|Q6IB78|Q96HK0	Silent	SNP	ENST00000371588.5	37	CCDS13434.1																																																																																					0.637	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079716.1		NM_003859	
KRTAP10-7	386675	mdanderson.org	37	21	46020867	46020867	+	Missense_Mutation	SNP	A	A	T	rs944419	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr21:46020867A>T	ENST00000380102.2	+	1	371	c.346A>T	c.(346-348)Atg>Ttg	p.M116L	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	116	30 X 5 AA repeats of C-C-X(3).		M -> V (in dbSNP:rs944419). {ECO:0000269|PubMed:15028290, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.			keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GGCCTGCTGCATGCCCGTCTG	0.627																																					p.M111L													.	KRTAP10-7	41		0			c.A331T												64.0	64.0	64.0					21																	46020867		2180	4289	6469	SO:0001583	missense	386675	exon2			TGCTGCATGCCCG	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.346A>T	21.37:g.46020867A>T	ENSP00000369445:p.Met116Leu		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	70	0.04	3	NM_198689	0		0	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37		.	.	.	.	.	.	.	.	.	.	N	5.366	0.252806	0.10185	.	.	ENSG00000205441	ENST00000380102	T	0.00633	6.08	3.91	-0.152	0.13407	.	.	.	.	.	T	0.00356	0.0011	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38308	-0.9667	9	0.08179	T	0.78	.	7.868	0.29549	0.3906:0.0:0.6094:0.0	.	111	P60409-2	.	L	116	ENSP00000369445:M116L	ENSP00000369445:M116L	M	+	1	0	KRTAP10-7	44845295	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.506000	0.06359	-0.305000	0.08831	-1.232000	0.01568	ATG			0.627	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000128038.1		NM_198689	
DIP2A	23181	mdanderson.org	37	21	47965817	47965817	+	Silent	SNP	A	A	G			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr21:47965817A>G	ENST00000417564.2	+	20	2358	c.2337A>G	c.(2335-2337)ggA>ggG	p.G779G	DIP2A_ENST00000400274.1_Silent_p.G775G|DIP2A_ENST00000466639.1_Silent_p.G736G|DIP2A_ENST00000435722.3_Silent_p.G779G|DIP2A_ENST00000457905.3_Silent_p.G779G|DIP2A_ENST00000427143.2_Silent_p.G715G|DIP2A_ENST00000318711.7_Silent_p.G780G			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	779					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CCACAGGAGGAGCACCCATCT	0.592																																					p.G779G													.	DIP2A	332		0			c.A2337G												112.0	121.0	118.0					21																	47965817		2109	4229	6338	SO:0001819	synonymous_variant	23181	exon20			AGGAGGAGCACCC	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2337A>G	21.37:g.47965817A>G			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_206890	38	0.00	0	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	ENST00000417564.2	37	CCDS46655.1																																																																																					0.592	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000376736.1		NM_015151	
LINC00207	388910	mdanderson.org	37	22	44966385	44966385	+	lincRNA	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr22:44966385G>T	ENST00000605505.1	+	0	163					NR_028409.1				long intergenic non-protein coding RNA 207											lung(3)	3						AACAGGTTCTGTTTAAAGAGG	0.498																																					.													.	LINC00207	8		0			.												62.0	57.0	59.0					22																	44966385		1962	4137	6099			388910	.			GGTTCTGTTTAAA	BC144508		22q13.31	2012-10-12	2011-08-11	2011-08-11	ENSG00000187012	ENSG00000187012		"""Long non-coding RNAs"""	37255	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 207"""	NCRNA00207			Standard	NR_028409		Approved		uc021wre.2		OTTHUMG00000150462		22.37:g.44966385G>T			Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	.	0		0		RNA	SNP	ENST00000605505.1	37																																																																																						0.498	LINC00207-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000468439.1		NR_028409	
ULK4	54986	mdanderson.org	37	3	41705146	41705146	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr3:41705146G>T	ENST00000301831.4	-	30	3485	c.3023C>A	c.(3022-3024)gCt>gAt	p.A1008D		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	1008					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CAGTTTCAGAGCATATGCTGG	0.363																																					p.A1008D													.	ULK4	150		0			c.C3023A												133.0	131.0	132.0					3																	41705146		1867	4101	5968	SO:0001583	missense	54986	exon30			TTCAGAGCATATG	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.3023C>A	3.37:g.41705146G>T	ENSP00000301831:p.Ala1008Asp		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_017886	10	0.00	0	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074055	0.76415	.	.	ENSG00000168038	ENST00000301831	T	0.73681	-0.77	5.86	5.86	0.93980	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	U	0.000008	T	0.80560	0.4646	L	0.54323	1.7	0.80722	D	1	D	0.61080	0.989	P	0.56474	0.799	T	0.81913	-0.0715	10	0.87932	D	0	.	15.6865	0.77415	0.0:0.0:1.0:0.0	.	1008	Q96C45	ULK4_HUMAN	D	1008	ENSP00000301831:A1008D	ENSP00000301831:A1008D	A	-	2	0	ULK4	41680150	0.989000	0.36119	0.717000	0.30585	0.632000	0.37999	4.052000	0.57420	2.781000	0.95711	0.650000	0.86243	GCT			0.363	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343490.1		XM_929989	
PTPN23	25930	mdanderson.org	37	3	47448239	47448239	+	Splice_Site	SNP	G	G	T	rs148327878		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr3:47448239G>T	ENST00000265562.4	+	9	883	c.806G>T	c.(805-807)cGg>cTg	p.R269L	PTPN23_ENST00000431726.1_Splice_Site_p.R143L	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	269	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTCGGGGAGCGGGTGAGCTAC	0.617																																					p.R269L													.	PTPN23	85		0			c.G806T												34.0	44.0	40.0					3																	47448239		2202	4300	6502	SO:0001630	splice_region_variant	25930	exon9			GGGAGCGGGTGAG	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.807+1G>T	3.37:g.47448239G>T			Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	99	0.04	4	NM_015466	117	0.00	0	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533100	0.85812	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	T	0.17528	2.27	5.11	2.16	0.27623	BRO1 domain (3);	0.296844	0.31257	N	0.007965	T	0.26521	0.0648	M	0.74647	2.275	0.80722	D	1	P;D	0.56746	0.787;0.977	B;P	0.50659	0.289;0.647	T	0.01729	-1.1286	10	0.66056	D	0.02	-17.2082	7.6909	0.28567	0.3673:0.0:0.6327:0.0	.	143;269	B4DST5;Q9H3S7	.;PTN23_HUMAN	L	234;269	ENSP00000265562:R269L	ENSP00000265562:R269L	R	+	2	0	PTPN23	47423243	1.000000	0.71417	0.998000	0.56505	0.700000	0.40528	3.150000	0.50662	0.126000	0.18424	0.655000	0.94253	CGG			0.617	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257492.2		NM_015466	Missense_Mutation
PVRL3	25945	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	110831212	110831212	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr3:110831212G>C	ENST00000485303.1	+	2	771	c.496G>C	c.(496-498)Gtg>Ctg	p.V166L	PVRL3_ENST00000493615.1_Missense_Mutation_p.V143L|PVRL3_ENST00000319792.3_Missense_Mutation_p.V166L	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	166					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						AACTGTAACTGTGTTAGGTAG	0.318																																					p.V166L													.	PVRL3	78		0			c.G496C												99.0	98.0	98.0					3																	110831212		2200	4299	6499	SO:0001583	missense	25945	exon2			GTAACTGTGTTAG	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.496G>C	3.37:g.110831212G>C	ENSP00000418070:p.Val166Leu		Somatic	213	0.0093896714	2		WXS	Illumina HiSeq	Phase_I	227	0.15	34	NM_001243286	15	0.33	5	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	37	CCDS2957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.0|29.0	4.973051|4.973051	0.92919|0.92919	.|.	.|.	ENSG00000177707|ENSG00000177707	ENST00000486596|ENST00000461477;ENST00000485303;ENST00000319792;ENST00000493615;ENST00000481766	.|D;D;D;D;D	.|0.98329	.|-4.87;-4.87;-4.87;-4.87;-4.87	5.76|5.76	5.76|5.76	0.90799|0.90799	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98883|0.98883	0.9622|0.9622	M|M	0.79011|0.79011	2.435|2.435	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.995;0.998	D|D	0.99771|0.99771	1.1024|1.1024	5|10	.|0.87932	.|D	.|0	.|.	17.8133|17.8133	0.88623|0.88623	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|143;166	.|E9PFR0;Q9NQS3	.|.;PVRL3_HUMAN	S|L	165|119;166;166;143;151	.|ENSP00000418327:V119L;ENSP00000418070:V166L;ENSP00000321514:V166L;ENSP00000420579:V143L;ENSP00000420479:V151L	.|ENSP00000321514:V166L	C|V	+|+	2|1	0|0	PVRL3|PVRL3	112313902|112313902	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	8.542000|8.542000	0.90647|0.90647	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	TGT|GTG			0.318	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354045.1		NM_015480	
ALG1L2	644974	hgsc.bcm.edu	37	3	129818153	129818153	+	RNA	SNP	A	A	C	rs56848274	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr3:129818153A>C	ENST00000507643.1	+	0	815				AC083906.2_ENST00000578837.1_RNA			C9J202	AG1L2_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like 2								transferase activity, transferring glycosyl groups (GO:0016757)										ATAGGGAAACAGTTTCTGGTC	0.507																																					.													.	.			0			.																																											729375	.			GGAAACAGTTTCT	BC127756		3q22.1	2013-02-22	2013-02-22		ENSG00000251287	ENSG00000251287		"""Glycosyltransferase group 1 domain containing"""	37258	other	unknown			"""asparagine-linked glycosylation 1-like 2"""				Standard	NM_001136152		Approved		uc011bld.2	C9J202	OTTHUMG00000159782		3.37:g.129818153A>C			Somatic	630	0	0		WXS	Illumina HiSeq	.	623	0.04	26	.	13	0.00	0		RNA	SNP	ENST00000507643.1	37																																																																																						0.507	ALG1L2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000357289.1		NM_001136152	
NOP14	8602	mdanderson.org	37	4	2949327	2949327	+	Silent	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr4:2949327G>T	ENST00000314262.6	-	10	1473	c.1425C>A	c.(1423-1425)ggC>ggA	p.G475G	NOP14_ENST00000502735.1_Silent_p.G475G|NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000507702.1_RNA|NOP14_ENST00000416614.2_Silent_p.G475G|NOP14_ENST00000398071.4_Silent_p.G475G|NOP14-AS1_ENST00000503709.1_RNA|NOP14-AS1_ENST00000515194.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	475					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						CCAAAAGAAAGCCAAACAGTT	0.443																																					p.G475G													.	NOP14	69		0			c.C1425A												137.0	126.0	130.0					4																	2949327		2203	4300	6503	SO:0001819	synonymous_variant	8602	exon10			AAGAAAGCCAAAC	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1425C>A	4.37:g.2949327G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_003703	140	0.01	1	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Silent	SNP	ENST00000314262.6	37	CCDS33945.1																																																																																					0.443	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000358135.2		NM_003703	
PCDH7	5099	mdanderson.org	37	4	30724751	30724751	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr4:30724751G>T	ENST00000361762.2	+	1	2715	c.1707G>T	c.(1705-1707)gaG>gaT	p.E569D	PCDH7_ENST00000543491.1_Missense_Mutation_p.E569D	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	569	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AGAACGCCGAGATCGCCTACT	0.607																																					p.E569D													.	PCDH7	215		0			c.G1707T												46.0	42.0	43.0					4																	30724751		2203	4300	6503	SO:0001583	missense	5099	exon1			CGCCGAGATCGCC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1707G>T	4.37:g.30724751G>T	ENSP00000355243:p.Glu569Asp		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_002589	2	0.00	0	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.35|12.35	1.910307|1.910307	0.33721|0.33721	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.51817	.|0.69;0.69	5.23|5.23	2.43|2.43	0.29744|0.29744	.|Cadherin (4);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.56731|0.56731	0.2005|0.2005	L|L	0.49640|0.49640	1.575|1.575	0.45648|0.45648	D|D	0.998578|0.998578	.|D;D;D	.|0.64830	.|0.992;0.992;0.994	.|D;D;D	.|0.68765	.|0.932;0.932;0.96	T|T	0.47947|0.47947	-0.9077|-0.9077	5|9	.|0.30078	.|T	.|0.28	.|.	10.3973|10.3973	0.44209|0.44209	0.2229:0.0:0.7771:0.0|0.2229:0.0:0.7771:0.0	.|.	.|569;522;569	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	Y|D	259|569;569;522	.|ENSP00000355243:E569D;ENSP00000441802:E569D	.|ENSP00000330302:E522D	D|E	+|+	1|3	0|2	PCDH7|PCDH7	30333849|30333849	1.000000|1.000000	0.71417|0.71417	0.903000|0.903000	0.35520|0.35520	0.691000|0.691000	0.40173|0.40173	1.590000|1.590000	0.36654|0.36654	0.289000|0.289000	0.22422|0.22422	0.655000|0.655000	0.94253|0.94253	GAT|GAG			0.607	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000360366.1		NM_032457, NM_002589	
PDGFRA	5156	mdanderson.org	37	4	55153609	55153609	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr4:55153609G>A	ENST00000257290.5	+	19	2906	c.2575G>A	c.(2575-2577)Gtg>Atg	p.V859M	FIP1L1_ENST00000507166.1_Missense_Mutation_p.V619M	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	859	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	CTTTCTGCCCGTGAAGTGGAT	0.502			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.V859M	Pancreas(151;208 1913 7310 23853 37092)			Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	PDGFRA	1583		0			c.G2575A												250.0	229.0	236.0					4																	55153609		2203	4300	6503	SO:0001583	missense	5156	exon19	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	CTGCCCGTGAAGT	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2575G>A	4.37:g.55153609G>A	ENSP00000257290:p.Val859Met		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_006206	53	0.00	0	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027316	0.93518	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	D;D	0.84589	-1.87;-1.87	5.84	5.84	0.93424	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.29522	U	0.011903	D	0.90103	0.6908	L	0.42686	1.345	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	D	0.90334	0.4354	10	0.87932	D	0	.	20.1466	0.98079	0.0:0.0:1.0:0.0	.	859	P16234	PGFRA_HUMAN	M	619;859	ENSP00000423325:V619M;ENSP00000257290:V859M	ENSP00000423325:V619M	V	+	1	0	FIP1L1;PDGFRA	54848366	1.000000	0.71417	0.982000	0.44146	0.935000	0.57460	7.795000	0.85887	2.779000	0.95612	0.591000	0.81541	GTG			0.502	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250598.2		NM_006206	
TSPAN5	10098	mdanderson.org	37	4	99579371	99579371	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr4:99579371C>T	ENST00000305798.3	-	1	409	c.7G>A	c.(7-9)Ggg>Agg	p.G3R	TSPAN5_ENST00000505184.1_5'Flank|RP11-1299A16.3_ENST00000569927.1_RNA	NM_005723.3	NP_005714.2	P62079	TSN5_HUMAN	tetraspanin 5	3					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)			kidney(2)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		TAGTGCTTCCCGGACATCCTC	0.547																																					p.G3R													.	TSPAN5	32		0			c.G7A												120.0	116.0	117.0					4																	99579371		2203	4300	6503	SO:0001583	missense	10098	exon1			GCTTCCCGGACAT		CCDS3646.1	4q22.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000168785	ENSG00000168785		"""Tetraspanins"""	17753	protein-coding gene	gene with protein product		613136	"""transmembrane 4 superfamily member 9"""	TM4SF9			Standard	NM_005723		Approved	Tspan-5, NET-4	uc003hub.3	P62079	OTTHUMG00000131008	ENST00000305798.3:c.7G>A	4.37:g.99579371C>T	ENSP00000307701:p.Gly3Arg		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_005723	28	0.00	0	B2RDY2|O60628|O60746|Q6FHE5|Q9JLY1	Missense_Mutation	SNP	ENST00000305798.3	37	CCDS3646.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966994	0.53507	.	.	ENSG00000168785	ENST00000305798	T	0.28454	1.61	4.19	3.35	0.38373	.	0.000000	0.85682	D	0.000000	T	0.19248	0.0462	N	0.25647	0.755	0.80722	D	1	B	0.26547	0.152	B	0.23419	0.046	T	0.03981	-1.0987	10	0.12103	T	0.63	.	12.2449	0.54563	0.0:0.9162:0.0:0.0838	.	3	P62079	TSN5_HUMAN	R	3	ENSP00000307701:G3R	ENSP00000307701:G3R	G	-	1	0	TSPAN5	99798394	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.393000	0.73217	0.970000	0.38263	0.305000	0.20034	GGG			0.547	TSPAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253641.2		NM_005723	
PCDHB10	56126	mdanderson.org	37	5	140573922	140573922	+	Silent	SNP	C	C	T	rs376773467		TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr5:140573922C>T	ENST00000239446.4	+	1	1981	c.1797C>T	c.(1795-1797)aaC>aaT	p.N599N		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGCCAGAACGCCTGGCTGT	0.721																																					p.N599N													.	PCDHB10	177		0			c.C1797T												4.0	6.0	5.0					5																	140573922		1101	2431	3532	SO:0001819	synonymous_variant	56126	exon1			CCAGAACGCCTGG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1797C>T	5.37:g.140573922C>T			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_018930	0		0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																					0.721	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251821.1		NM_018930	
PCDHGA8	9708	broad.mit.edu	37	5	140774176	140774176	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr5:140774176G>T	ENST00000398604.2	+	1	1796	c.1796G>T	c.(1795-1797)gGc>gTc	p.G599V	PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G599V(3)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGACTCGGGCCAGAACGCC	0.706																																					p.G599V													PCDHGA8,NS,carcinoma,0,4	PCDHGA8	146	4	3	Substitution - Missense(3)	kidney(3)	c.G1796T																																									SO:0001583	missense	0	exon1			ACTCGGGCCAGAA	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1796G>T	5.37:g.140774176G>T	ENSP00000381605:p.Gly599Val		Somatic	90	0.0333333333	3		WXS	Illumina HiSeq	Phase_I	86	0.07	6	NM_014004	2	0.00	0	A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	18.62	3.662262	0.67700	.	.	ENSG00000253767	ENST00000398604	T	0.21361	2.01	4.96	4.96	0.65561	Cadherin (4);Cadherin-like (1);	0.000000	0.31624	U	0.007336	T	0.68751	0.3035	H	0.99697	4.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85054	0.0930	10	0.87932	D	0	.	17.843	0.88720	0.0:0.0:1.0:0.0	.	599;599	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	V	599	ENSP00000381605:G599V	ENSP00000381605:G599V	G	+	2	0	PCDHGA8	140754360	1.000000	0.71417	0.974000	0.42286	0.997000	0.91878	7.609000	0.82925	2.308000	0.77769	0.655000	0.94253	GGC			0.706	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376972.1		NM_032088	
ZNF184	7738	mdanderson.org	37	6	27435652	27435652	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr6:27435652G>T	ENST00000211936.6	-	3	339	c.55C>A	c.(55-57)Ctc>Atc	p.L19I	ZNF184_ENST00000377419.1_Missense_Mutation_p.L19I	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GCTGATGAGAGTAGATTATGT	0.413																																					p.L19I													.	ZNF184	89		0			c.C55A												72.0	71.0	71.0					6																	27435652		2203	4300	6503	SO:0001583	missense	7738	exon3			ATGAGAGTAGATT	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.55C>A	6.37:g.27435652G>T	ENSP00000211936:p.Leu19Ile		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_007149	13	0.00	0	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627567	0.46944	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	T;T	0.06687	3.27;3.27	4.33	-0.428	0.12306	.	0.411189	0.18045	N	0.153485	T	0.02193	0.0068	L	0.46741	1.465	0.09310	N	1	B	0.32365	0.367	B	0.26864	0.074	T	0.38067	-0.9678	10	0.62326	D	0.03	.	7.2193	0.25977	0.502:0.0:0.498:0.0	.	19	Q99676	ZN184_HUMAN	I	19	ENSP00000211936:L19I;ENSP00000366636:L19I	ENSP00000211936:L19I	L	-	1	0	ZNF184	27543631	0.003000	0.15002	0.000000	0.03702	0.214000	0.24535	0.257000	0.18369	-0.112000	0.11979	-0.157000	0.13467	CTC			0.413	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040146.1		NM_007149	
ZBTB9	221504	mdanderson.org	37	6	33423522	33423522	+	Silent	SNP	G	G	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr6:33423522G>A	ENST00000395064.2	+	2	913	c.645G>A	c.(643-645)gaG>gaA	p.E215E		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						aagaagaagaggaggaggagg	0.552																																					p.E215E													.	ZBTB9	23		0			c.G645A												61.0	61.0	61.0					6																	33423522		2203	4300	6503	SO:0001819	synonymous_variant	221504	exon2			AGAAGAGGAGGAG	AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.645G>A	6.37:g.33423522G>A			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_152735	57	0.00	0	A2AB19	Silent	SNP	ENST00000395064.2	37	CCDS4780.1																																																																																					0.552	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276533.1		NM_152735	
DEF6	50619	broad.mit.edu	37	6	35287347	35287347	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr6:35287347C>A	ENST00000316637.5	+	8	1267	c.1262C>A	c.(1261-1263)gCt>gAt	p.A421D	DEF6_ENST00000542066.1_Missense_Mutation_p.A166D	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	421	Glu-rich.					cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						GAGGAGGAGGCTGCCCGGCAG	0.642																																					p.A421D													.	DEF6	36		0			c.C1262A												35.0	40.0	38.0					6																	35287347		2203	4298	6501	SO:0001583	missense	50619	exon8			AGGAGGCTGCCCG	AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.1262C>A	6.37:g.35287347C>A	ENSP00000319831:p.Ala421Asp		Somatic	182	0.032967033	6		WXS	Illumina HiSeq	Phase_I	159	0.04	7	NM_022047	34	0.06	2	Q86VF4	Missense_Mutation	SNP	ENST00000316637.5	37	CCDS4802.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.935223	0.73442	.	.	ENSG00000023892	ENST00000542066;ENST00000316637	T;T	0.29142	1.58;2.57	5.5	5.5	0.81552	.	0.105878	0.64402	D	0.000004	T	0.40767	0.1130	M	0.76574	2.34	0.80722	D	1	D;P;D	0.67145	0.996;0.933;0.966	P;P;P	0.62184	0.899;0.462;0.462	T	0.10245	-1.0638	10	0.19147	T	0.46	-13.0832	15.1127	0.72372	0.0:0.8592:0.1408:0.0	.	166;421;421	F5H853;B2RBP7;Q9H4E7	.;.;DEFI6_HUMAN	D	166;421	ENSP00000442166:A166D;ENSP00000319831:A421D	ENSP00000319831:A421D	A	+	2	0	DEF6	35395325	1.000000	0.71417	0.999000	0.59377	0.646000	0.38490	5.798000	0.69095	2.861000	0.98227	0.655000	0.94253	GCT			0.642	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040276.1		NM_022047	
RIPPLY2	134701	mdanderson.org	37	6	84563870	84563870	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr6:84563870C>A	ENST00000369689.1	+	3	380	c.229C>A	c.(229-231)Cac>Aac	p.H77N	RIPPLY2_ENST00000369687.1_Missense_Mutation_p.H19N	NM_001009994.1	NP_001009994.1	Q5TAB7	RIPP2_HUMAN	ripply transcriptional repressor 2	77	Ripply homology domain. {ECO:0000255}.				bone morphogenesis (GO:0060349)|determination of left/right symmetry (GO:0007368)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression (GO:0010468)|somite rostral/caudal axis specification (GO:0032525)|somitogenesis (GO:0001756)	nucleus (GO:0005634)				large_intestine(2)|lung(4)|urinary_tract(1)	7						CCAATTCAGGCACCCAGTCAG	0.617																																					p.H77N													.	RIPPLY2	17		0			c.C229A												91.0	85.0	87.0					6																	84563870		2203	4300	6503	SO:0001583	missense	134701	exon3			TTCAGGCACCCAG	BC130460	CCDS34493.1	6q14.2	2013-07-23	2013-07-23	2008-05-07	ENSG00000203877	ENSG00000203877			21390	protein-coding gene	gene with protein product		609891	"""chromosome 6 open reading frame 159"", ""ripply2 homolog (zebrafish)"""	C6orf159			Standard	NM_001009994		Approved	dJ237I15.1	uc003pke.3	Q5TAB7	OTTHUMG00000015117	ENST00000369689.1:c.229C>A	6.37:g.84563870C>A	ENSP00000358703:p.His77Asn		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001009994	1	0.00	0	Q5TAB6	Missense_Mutation	SNP	ENST00000369689.1	37	CCDS34493.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.728324	0.48833	.	.	ENSG00000203877	ENST00000369689;ENST00000369687	.	.	.	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.75474	0.3854	M	0.82056	2.57	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.80106	-0.1521	9	0.87932	D	0	-18.1922	15.0837	0.72133	0.0:1.0:0.0:0.0	.	77	Q5TAB7	RIPP2_HUMAN	N	77;19	.	ENSP00000358701:H19N	H	+	1	0	RIPPLY2	84620589	0.999000	0.42202	0.945000	0.38365	0.042000	0.13812	4.955000	0.63638	2.196000	0.70406	0.555000	0.69702	CAC			0.617	RIPPLY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041360.1		NM_001009994	
LRP11	84918	mdanderson.org	37	6	150164182	150164182	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr6:150164182C>T	ENST00000239367.2	-	3	855	c.850G>A	c.(850-852)Gcc>Acc	p.A284T	LRP11_ENST00000367368.2_Missense_Mutation_p.A284T|LRP11_ENST00000546019.1_Missense_Mutation_p.A29T	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	284	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.					integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		CTCTGCCCGGCAGTGTCCGTC	0.577																																					p.A284T													.	LRP11	27		0			c.G850A												139.0	101.0	114.0					6																	150164182		2203	4300	6503	SO:0001583	missense	84918	exon3			GCCCGGCAGTGTC	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.850G>A	6.37:g.150164182C>T	ENSP00000239367:p.Ala284Thr		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_032832	44	0.00	0	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.272045	0.40194	.	.	ENSG00000120256	ENST00000239367;ENST00000546019;ENST00000367368	T;T;T	0.14144	2.53;2.53;2.53	5.05	5.05	0.67936	PKD/Chitinase domain (1);PKD domain (3);	0.654641	0.15921	N	0.238119	T	0.11836	0.0288	L	0.58354	1.805	0.09310	N	1	D;P	0.54772	0.968;0.937	P;B	0.50970	0.655;0.328	T	0.09422	-1.0675	10	0.32370	T	0.25	-7.9454	12.3118	0.54933	0.1694:0.8306:0.0:0.0	.	284;284	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	T	284;29;284	ENSP00000239367:A284T;ENSP00000440196:A29T;ENSP00000356338:A284T	ENSP00000239367:A284T	A	-	1	0	LRP11	150205875	0.048000	0.20356	0.039000	0.18376	0.098000	0.18820	1.847000	0.39299	2.356000	0.79943	0.655000	0.94253	GCC			0.577	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042664.1		NM_032832	
UNCX	340260	broad.mit.edu	37	7	1275520	1275520	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr7:1275520A>G	ENST00000316333.8	+	3	614	c.503A>G	c.(502-504)aAg>aGg	p.K168R		NM_001080461.1	NP_001073930.1	A6NJT0	UNC4_HUMAN	UNC homeobox	168					cartilage condensation (GO:0001502)|common myeloid progenitor cell proliferation (GO:0035726)|dorsal spinal cord development (GO:0021516)|olfactory bulb interneuron differentiation (GO:0021889)|pattern specification process (GO:0007389)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|skin(1)|upper_aerodigestive_tract(1)	4		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		AACACGAAAAAGGGCCCGGGG	0.657																																					p.K168R													.	UNCX	17		0			c.A503G												16.0	22.0	20.0					7																	1275520		2191	4291	6482	SO:0001583	missense	340260	exon3			CGAAAAAGGGCCC		CCDS34583.1	7p22.3	2011-06-20			ENSG00000164853	ENSG00000164853		"""Homeoboxes / PRD class"""	33194	protein-coding gene	gene with protein product							Standard	NM_001080461		Approved	Uncx4.1	uc011jvw.2	A6NJT0	OTTHUMG00000152022	ENST00000316333.8:c.503A>G	7.37:g.1275520A>G	ENSP00000314480:p.Lys168Arg		Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	149	0.03	5	NM_001080461	8	0.00	0	A4D221	Missense_Mutation	SNP	ENST00000316333.8	37	CCDS34583.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596756	0.46318	.	.	ENSG00000164853	ENST00000316333	D	0.91843	-2.92	3.79	3.79	0.43588	.	0.327682	0.23189	N	0.050938	D	0.90926	0.7148	N	0.17278	0.47	0.39566	D	0.969207	D	0.58620	0.983	D	0.65233	0.933	D	0.91867	0.5504	10	0.66056	D	0.02	-10.2036	11.555	0.50741	1.0:0.0:0.0:0.0	.	168	A6NJT0	UNC4_HUMAN	R	168	ENSP00000314480:K168R	ENSP00000314480:K168R	K	+	2	0	UNCX	1242046	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.459000	0.66685	1.609000	0.50190	0.329000	0.21502	AAG			0.657	UNCX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324910.2		NM_001080461	
ZAN	7455	broad.mit.edu	37	7	100349991	100349991	+	RNA	SNP	T	T	C	rs560599163	byFrequency	TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr7:100349991T>C	ENST00000348028.3	+	0	2428				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S755P(5)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCCACCATCTCCCCAGAAAA	0.517													t|||	35	0.00698882	0.0038	0.0101	5008	,	,		14901	0.005		0.0129	False		,,,				2504	0.0051				.													ZAN_ENST00000542585,NS,carcinoma,0,5	ZAN	658	5	5	Substitution - Missense(5)	endometrium(4)|NS(1)	.												122.0	136.0	131.0					7																	100349991		1816	4060	5876			7455	.			ACCATCTCCCCAG	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349991T>C			Somatic	95	0.0736842105	7		WXS	Illumina HiSeq	Phase_I	74	0.12	9	.	0		0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	5.435	0.265377	0.10294	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.63255	-0.03;0.11;-0.03	4.24	0.21	0.15231	.	.	.	.	.	T	0.29716	0.0742	N	0.01140	-0.99	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20571	-1.0271	9	0.33940	T	0.23	.	7.9077	0.29771	0.0:0.5221:0.0:0.4779	.	755;755	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	755	ENSP00000445943:S755P;ENSP00000445091:S755P;ENSP00000444427:S755P	ENSP00000423579:S755P	S	+	1	0	ZAN	100187927	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.770000	0.00371	-0.086000	0.12550	-0.766000	0.03442	TCC			0.517	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347214.1		NM_003386	
ZAN	7455	broad.mit.edu	37	7	100350655	100350655	+	RNA	SNP	T	T	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr7:100350655T>C	ENST00000348028.3	+	0	3092				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACGGAAAAACTTACCATCCCC	0.552																																					.													.	ZAN	658		0			.												200.0	230.0	220.0					7																	100350655		1893	4107	6000			7455	.			AAAAACTTACCAT	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100350655T>C			Somatic	139	0.0071942446	1		WXS	Illumina HiSeq	Phase_I	83	0.07	6	.	3	0.00	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	3.429	-0.116570	0.06838	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.61392	0.11;0.11;0.11	3.62	1.78	0.24846	.	1.876470	0.03289	N	0.187368	T	0.38852	0.1056	N	0.04880	-0.145	0.09310	N	0.999997	B;B	0.13594	0.008;0.006	B;B	0.15484	0.007;0.013	T	0.25950	-1.0117	10	0.26408	T	0.33	.	9.7909	0.40706	0.0:0.7921:0.0:0.2079	.	976;976	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	976	ENSP00000445943:L976P;ENSP00000445091:L976P;ENSP00000444427:L976P	ENSP00000423579:L976P	L	+	2	0	ZAN	100188591	0.015000	0.18098	0.000000	0.03702	0.000000	0.00434	0.903000	0.28475	0.017000	0.15025	-0.716000	0.03619	CTT			0.552	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347214.1		NM_003386	
MFHAS1	9258	broad.mit.edu	37	8	8748487	8748487	+	Silent	SNP	A	A	C			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr8:8748487A>C	ENST00000276282.6	-	1	2668	c.2082T>G	c.(2080-2082)ggT>ggG	p.G694G		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	694										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CCTCGGTCAGACCCGCCTGCA	0.627																																					p.G694G	Melanoma(103;1201 2045 17515 28966)												.	MFHAS1	58		0			c.T2082G												43.0	42.0	42.0					8																	8748487		2203	4300	6503	SO:0001819	synonymous_variant	9258	exon1			GGTCAGACCCGCC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2082T>G	8.37:g.8748487A>C			Somatic	57	0.2631578947	15		WXS	Illumina HiSeq	Phase_I	60	0.23	14	NM_004225	62	0.10	6	Q96CI0	Silent	SNP	ENST00000276282.6	37	CCDS34844.1																																																																																					0.627	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374724.2		NM_004225	
CPSF1	29894	mdanderson.org	37	8	145618734	145618734	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr8:145618734C>T	ENST00000349769.3	-	37	4311	c.4217G>A	c.(4216-4218)cGc>cAc	p.R1406H	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'UTR	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	1406					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GTACAGGTAGCGGTTGAGCAG	0.677																																					p.R1406H	NSCLC(133;1088 1848 27708 34777 35269)												.	CPSF1	92		0			c.G4217A												40.0	32.0	34.0					8																	145618734		2190	4290	6480	SO:0001583	missense	29894	exon37			AGGTAGCGGTTGA	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.4217G>A	8.37:g.145618734C>T	ENSP00000339353:p.Arg1406His		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_013291	784	0.00	0	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534111	0.64972	.	.	ENSG00000071894	ENST00000349769	T	0.50001	0.76	4.88	4.88	0.63580	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.070230	0.56097	D	0.000035	T	0.40196	0.1107	L	0.43646	1.37	0.41175	D	0.986197	B	0.27997	0.197	B	0.26969	0.075	T	0.23726	-1.0180	10	0.20519	T	0.43	-30.841	15.5245	0.75890	0.0:1.0:0.0:0.0	.	1406	Q10570	CPSF1_HUMAN	H	1406	ENSP00000339353:R1406H	ENSP00000339353:R1406H	R	-	2	0	CPSF1	145589542	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.240000	0.58701	2.253000	0.74438	0.561000	0.74099	CGC			0.677	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382422.2		NM_013291	
NPR2	4882	mdanderson.org	37	9	35792487	35792487	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr9:35792487G>T	ENST00000342694.2	+	1	337	c.82G>T	c.(82-84)Gcg>Tcg	p.A28S		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	28					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CCTGACGCTGGCGGTGGTGCT	0.687																																					p.A28S													.	NPR2	162		0			c.G82T												33.0	35.0	34.0					9																	35792487		2201	4298	6499	SO:0001583	missense	4882	exon1			ACGCTGGCGGTGG	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.82G>T	9.37:g.35792487G>T	ENSP00000341083:p.Ala28Ser		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_003995	6	0.00	0	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685618	0.88639	.	.	ENSG00000159899	ENST00000342694	T	0.75938	-0.98	4.09	4.09	0.47781	.	0.000000	0.43919	D	0.000518	T	0.66317	0.2777	N	0.08118	0	0.58432	D	0.999997	P;P	0.51449	0.945;0.919	P;B	0.53593	0.73;0.214	T	0.72906	-0.4150	10	0.59425	D	0.04	.	13.5193	0.61559	0.0:0.0:1.0:0.0	.	28;28	P20594-2;P20594	.;ANPRB_HUMAN	S	28	ENSP00000341083:A28S	ENSP00000341083:A28S	A	+	1	0	NPR2	35782487	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.892000	0.92491	2.261000	0.74972	0.563000	0.77884	GCG			0.687	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052345.1			
IPPK	64768	mdanderson.org	37	9	95400366	95400366	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chr9:95400366G>T	ENST00000287996.3	-	9	1109	c.833C>A	c.(832-834)gCa>gAa	p.A278E	IPPK_ENST00000375522.1_5'Flank	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	278					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						CAGGGTGCCTGCCCGGCCCTT	0.682																																					p.A278E													.	IPPK	34		0			c.C833A												22.0	24.0	23.0					9																	95400366		2202	4299	6501	SO:0001583	missense	64768	exon9			GTGCCTGCCCGGC	AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.833C>A	9.37:g.95400366G>T	ENSP00000287996:p.Ala278Glu		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_022755	57	0.00	0	Q5T9F7|Q9H7V8	Missense_Mutation	SNP	ENST00000287996.3	37	CCDS6699.1	.	.	.	.	.	.	.	.	.	.	G	7.593	0.671070	0.14776	.	.	ENSG00000127080	ENST00000287996	T	0.28666	1.6	5.11	-1.1	0.09872	.	0.855874	0.10573	N	0.658856	T	0.13543	0.0328	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.35251	-0.9796	10	0.02654	T	1	0.5329	10.1457	0.42762	0.3965:0.0:0.6035:0.0	.	278	Q9H8X2	IPPK_HUMAN	E	278	ENSP00000287996:A278E	ENSP00000287996:A278E	A	-	2	0	IPPK	94440187	0.428000	0.25522	0.000000	0.03702	0.211000	0.24417	0.964000	0.29306	-0.437000	0.07243	-0.379000	0.06801	GCA			0.682	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053101.1		NM_022755	
DCAF8L2	347442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	27765692	27765692	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H1-01A-11D-A435-10	TCGA-XE-A8H1-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	308bc9ed-2d07-4805-8c9b-721b6dac164d	74fe1db1-9f3c-4457-804a-9432ce8156f5	g.chrX:27765692A>G	ENST00000451261.2	+	5	1079	c.680A>G	c.(679-681)cAt>cGt	p.H227R		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	227										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						CTTGCAGACCATGTCGGCTGT	0.577																																					p.H227R													.	.			0			c.A680G												68.0	54.0	58.0					X																	27765692		692	1591	2283	SO:0001583	missense	347442	exon1			CAGACCATGTCGG		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.680A>G	X.37:g.27765692A>G	ENSP00000462745:p.His227Arg		Somatic	104	0	0		WXS	Illumina HiSeq	.	117	0.37	43	NM_001136533	15	0.00	0	B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																					0.577	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056143.4		XM_293354	
