#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SCNN1D	6339	mdanderson.org	37	1	1226955	1226955	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr1:1226955G>T	ENST00000338555.2	+	15	3026	c.1882G>T	c.(1882-1884)Gct>Tct	p.A628S	SCNN1D_ENST00000379116.5_Missense_Mutation_p.A792S|SCNN1D_ENST00000400928.3_Missense_Mutation_p.A628S|SCNN1D_ENST00000325425.8_Missense_Mutation_p.A694S			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	628					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	AGAGAGCTGGGCTGGGCCCCA	0.662																																					p.A792S													.	.			0			c.G2374T												15.0	18.0	17.0					1																	1226955		2161	4230	6391	SO:0001583	missense	6339	exon18			AGCTGGGCTGGGC	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.1882G>T	1.37:g.1226955G>T	ENSP00000339504:p.Ala628Ser		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001130413	5	0.00	0	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Missense_Mutation	SNP	ENST00000338555.2	37		.	.	.	.	.	.	.	.	.	.	G	12.71	2.018812	0.35606	.	.	ENSG00000162572	ENST00000379110;ENST00000379116;ENST00000338555;ENST00000325425;ENST00000400928	T;T;T;T	0.72725	-0.68;-0.47;-0.59;-0.47	3.93	0.608	0.17569	.	1.899500	0.03734	U	0.253944	T	0.60625	0.2283	N	0.24115	0.695	0.09310	N	1	P;P;P	0.51057	0.941;0.941;0.941	B;B;P	0.46172	0.429;0.429;0.506	T	0.51244	-0.8730	10	0.56958	D	0.05	.	4.0779	0.09912	0.2472:0.1921:0.5607:0.0	.	450;628;792	B1AMF2;P51172;A6NNF7	.;SCNND_HUMAN;.	S	659;792;628;694;628	ENSP00000368411:A792S;ENSP00000339504:A628S;ENSP00000321594:A694S;ENSP00000383717:A628S	ENSP00000321594:A694S	A	+	1	0	SCNN1D	1216818	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.767000	0.04720	-0.078000	0.12730	0.484000	0.47621	GCT			0.662	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000005802.2		NM_002978	
SKI	6497	mdanderson.org	37	1	2160973	2160973	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr1:2160973G>T	ENST00000378536.4	+	1	840	c.768G>T	c.(766-768)ccG>ccT	p.P256P		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	256					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		TGTACCCGCCGCACAAGTTCG	0.662																																					p.P256P	Ovarian(177;144 1678 13697 20086 27838 40755)												.	.			0			c.G768T												29.0	31.0	31.0					1																	2160973		2188	4290	6478	SO:0001819	synonymous_variant	6497	exon1			CCCGCCGCACAAG	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.768G>T	1.37:g.2160973G>T			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	30	0.07	2	NM_003036	23	0.00	0	Q5SYT7	Silent	SNP	ENST00000378536.4	37	CCDS39.1																																																																																					0.662	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004070.1		NM_003036	
KCNAB2	8514	mdanderson.org	37	1	6142261	6142261	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr1:6142261G>T	ENST00000164247.1	+	6	772	c.208G>T	c.(208-210)Gag>Tag	p.E70*	KCNAB2_ENST00000378083.3_Nonsense_Mutation_p.E103*|KCNAB2_ENST00000352527.1_Nonsense_Mutation_p.E56*|KCNAB2_ENST00000341524.1_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000378087.3_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000378092.1_Nonsense_Mutation_p.E56*|KCNAB2_ENST00000602612.1_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000378097.1_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000458166.2_Nonsense_Mutation_p.E3*|KCNAB2_ENST00000378111.1_Nonsense_Mutation_p.E70*	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	70					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGATGGCAGAGCAGCTCAT	0.582																																					p.E103X													.	.			0			c.G307T												124.0	112.0	116.0					1																	6142261		2203	4300	6503	SO:0001587	stop_gained	8514	exon5			ATGGCAGAGCAGC	U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.208G>T	1.37:g.6142261G>T	ENSP00000164247:p.Glu70*		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001199862	24	0.00	0	A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Nonsense_Mutation	SNP	ENST00000164247.1	37	CCDS55.1	.	.	.	.	.	.	.	.	.	.	G	38	6.686903	0.97764	.	.	ENSG00000069424	ENST00000378111;ENST00000378097;ENST00000378092;ENST00000428161;ENST00000389632;ENST00000378087;ENST00000341524;ENST00000352527;ENST00000435937;ENST00000164247;ENST00000378083;ENST00000458166	.	.	.	5.33	5.33	0.75918	.	0.048672	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-35.5636	17.5837	0.87974	0.0:0.0:1.0:0.0	.	.	.	.	X	70;70;56;56;70;70;70;56;56;70;103;3	.	ENSP00000164247:E70X	E	+	1	0	KCNAB2	6064848	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.470000	0.90399	2.482000	0.83794	0.563000	0.77884	GAG			0.582	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000002114.3		NM_172130	
PGD	5226	broad.mit.edu	37	1	10464289	10464289	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr1:10464289G>T	ENST00000270776.8	+	5	440	c.402G>T	c.(400-402)ggG>ggT	p.G134G	PGD_ENST00000538557.1_Silent_p.G121G|PGD_ENST00000541529.1_Silent_p.G112G	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	134					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	GAGAGGAAGGGGCCCGGTATG	0.532																																					p.G134G													.	PGD	39		0			c.G402T												79.0	80.0	80.0					1																	10464289		2203	4300	6503	SO:0001819	synonymous_variant	5226	exon5			GGAAGGGGCCCGG	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.402G>T	1.37:g.10464289G>T			Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_002631	1353	0.00	0	A8K2Y9|B4DQJ8|Q9BWD8	Silent	SNP	ENST00000270776.8	37	CCDS113.1																																																																																					0.532	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005398.1		NM_002631	
PGBD5	79605	bcgsc.ca;mdanderson.org	37	1	230503883	230503883	+	Intron	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr1:230503883G>A	ENST00000525115.1	-	1	148				PGBD5_ENST00000321327.2_Silent_p.S44S|PGBD5_ENST00000391860.1_Intron			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5							integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GTGGTGGTGAGGAGGAGGCTG	0.493																																					.													.	PGBD5	73		0			.												91.0	87.0	88.0					1																	230503883		2203	4300	6503	SO:0001627	intron_variant	79605	.			TGGTGAGGAGGAG	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.124+9360C>T	1.37:g.230503883G>A			Somatic	180	0	0		WXS	Illumina HiSeq	Phase_1	112	0.04	5	.	1	0.00	0	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	ENST00000525115.1	37																																																																																						0.493	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000382617.1		NM_024554	
DIP2C	22982	mdanderson.org	37	10	707987	707987	+	Intron	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr10:707987G>T	ENST00000280886.6	-	1	173				RP11-809C18.5_ENST00000443662.1_RNA|PRR26_ENST00000381489.5_Missense_Mutation_p.W118C	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)							nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GTCCCCCGTGGCTCCACAGCA	0.602																																					.													.	.			0			.																																									SO:0001627	intron_variant	414235	.			CCCGTGGCTCCAC	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.85+27446C>A	10.37:g.707987G>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	.	0		0	B4DPI5|Q5SS78	RNA	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	1.251	-0.618575	0.03663	.	.	ENSG00000180525	ENST00000381489	.	.	.	2.22	-0.235	0.13071	.	.	.	.	.	T	0.15305	0.0369	.	.	.	0.09310	N	1	P	0.40197	0.706	B	0.28784	0.094	T	0.17228	-1.0376	7	0.87932	D	0	.	2.5322	0.04705	0.2582:0.3087:0.4331:0.0	.	118	Q5VXK3	.	C	118	.	ENSP00000370899:W118C	W	+	3	0	C10orf108	697987	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.178000	0.09782	-0.059000	0.13154	0.195000	0.17529	TGG			0.602	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046389.1		NM_014974	
WDFY4	57705	broad.mit.edu	37	10	49951285	49951285	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr10:49951285G>T	ENST00000325239.5	+	11	2178	c.2151G>T	c.(2149-2151)ctG>ctT	p.L717L	WDFY4_ENST00000413659.2_Silent_p.L717L	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	717						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						ACCTCTGCCTGCTGGGCTGTT	0.587																																					p.L717L													.	WDFY4	205		0			c.G2151T												32.0	31.0	31.0					10																	49951285		692	1591	2283	SO:0001819	synonymous_variant	57705	exon12			CTGCCTGCTGGGC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2151G>T	10.37:g.49951285G>T			Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	98	0.04	4	NM_020945	2	0.00	0	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1																																																																																					0.587	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				XM_033379	
PLCE1	51196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	95987141	95987141	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr10:95987141C>T	ENST00000371380.3	+	4	2123	c.1888C>T	c.(1888-1890)Cat>Tat	p.H630Y	RP11-391J2.3_ENST00000447227.1_RNA|PLCE1_ENST00000371385.3_Missense_Mutation_p.H322Y|PLCE1_ENST00000371375.1_Missense_Mutation_p.H322Y|PLCE1_ENST00000260766.3_Missense_Mutation_p.H630Y			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	630	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				ATATTTGGTGCATGTGGCCAA	0.507																																					p.H630Y													.	.			0			c.C1888T												151.0	159.0	156.0					10																	95987141		2101	4220	6321	SO:0001583	missense	51196	exon5			TTGGTGCATGTGG		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1888C>T	10.37:g.95987141C>T	ENSP00000360431:p.His630Tyr		Somatic	194	0	0		WXS	Illumina HiSeq	.	165	0.21	35	NM_016341	9	0.44	4	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.674665	0.88445	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.72	5.72	0.89469	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.195534	0.43416	D	0.000568	T	0.53126	0.1777	L	0.54323	1.7	0.42430	D	0.992676	D;D;D	0.76494	0.997;0.994;0.999	D;P;D	0.69307	0.963;0.882;0.959	T	0.52071	-0.8624	10	0.72032	D	0.01	.	19.8835	0.96906	0.0:1.0:0.0:0.0	.	630;322;630	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	Y	630;630;322;322	ENSP00000260766:H630Y;ENSP00000360431:H630Y;ENSP00000360438:H322Y;ENSP00000360426:H322Y	ENSP00000260766:H630Y	H	+	1	0	PLCE1	95977131	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.673000	0.68109	2.705000	0.92388	0.555000	0.69702	CAT			0.507	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049469.3		NM_016341	
HPX	3263	mdanderson.org	37	11	6452451	6452451	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr11:6452451C>T	ENST00000265983.3	-	10	1479	c.1379G>A	c.(1378-1380)tGc>tAc	p.C460Y		NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	460					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		TCAGTGAGTGCAGCCCAGGAG	0.537																																					p.C460Y													.	.			0			c.G1379A												58.0	56.0	57.0					11																	6452451		2201	4296	6497	SO:0001583	missense	3263	exon10			TGAGTGCAGCCCA	J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.1379G>A	11.37:g.6452451C>T	ENSP00000265983:p.Cys460Tyr		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_000613	44	0.00	0	B2R957	Missense_Mutation	SNP	ENST00000265983.3	37	CCDS7763.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640704	0.67244	.	.	ENSG00000110169	ENST00000265983	T	0.18810	2.19	5.32	5.32	0.75619	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.42314	0.1197	L	0.49126	1.545	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.24012	-1.0172	10	0.87932	D	0	-26.5421	16.4965	0.84246	0.0:1.0:0.0:0.0	.	460	P02790	HEMO_HUMAN	Y	460	ENSP00000265983:C460Y	ENSP00000265983:C460Y	C	-	2	0	HPX	6409027	0.995000	0.38212	0.979000	0.43373	0.920000	0.55202	2.514000	0.45503	2.513000	0.84729	0.561000	0.74099	TGC			0.537	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257256.1		NM_000613	
MAPK8IP1	9479	mdanderson.org	37	11	45924975	45924975	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr11:45924975C>T	ENST00000241014.2	+	6	1647	c.1477C>T	c.(1477-1479)Cac>Tac	p.H493Y	RP11-618K13.2_ENST00000533218.1_RNA|MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.H483Y	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	493	Interaction with VRK2.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GGAGCAGACCCACCGGGCCAT	0.632																																					p.H493Y													.	.			0			c.C1477T												40.0	35.0	37.0					11																	45924975		2203	4299	6502	SO:0001583	missense	9479	exon6			CAGACCCACCGGG		CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1477C>T	11.37:g.45924975C>T	ENSP00000241014:p.His493Tyr		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_005456	127	0.00	0	D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715054	0.89112	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.15487	2.42;2.42	4.68	4.68	0.58851	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.26738	0.0654	N	0.15975	0.35	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.23583	-1.0184	10	0.87932	D	0	-26.3077	17.7674	0.88482	0.0:1.0:0.0:0.0	.	493	Q9UQF2	JIP1_HUMAN	Y	493;483	ENSP00000241014:H493Y;ENSP00000378991:H483Y	ENSP00000241014:H493Y	H	+	1	0	MAPK8IP1	45881551	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.543000	0.82106	2.447000	0.82792	0.511000	0.50034	CAC			0.632	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259405.1		NM_005456	
LRP4	4038	broad.mit.edu	37	11	46924405	46924405	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr11:46924405G>T	ENST00000378623.1	-	2	370	c.128C>A	c.(127-129)aCc>aAc	p.T43N		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	43	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		AGGGATGCAGGTACACTCTCC	0.592																																					p.T43N													.	LRP4	160		0			c.C128A												86.0	76.0	80.0					11																	46924405		2201	4299	6500	SO:0001583	missense	4038	exon2			ATGCAGGTACACT	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.128C>A	11.37:g.46924405G>T	ENSP00000367888:p.Thr43Asn		Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	131	0.03	4	NM_002334	17	0.00	0	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486790	0.84854	.	.	ENSG00000134569	ENST00000378623	D	0.87887	-2.31	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.87939	0.6304	L	0.35542	1.07	0.80722	D	1	P	0.51791	0.948	P	0.54346	0.749	D	0.84903	0.0843	10	0.25751	T	0.34	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	43	O75096	LRP4_HUMAN	N	43	ENSP00000367888:T43N	ENSP00000367888:T43N	T	-	2	0	LRP4	46880981	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.635000	0.83286	2.775000	0.95449	0.655000	0.94253	ACC			0.592	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391133.1		NM_002334	
SLC3A2	6520	mdanderson.org	37	11	62648706	62648706	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr11:62648706G>T	ENST00000377890.2	+	4	682	c.514G>T	c.(514-516)Gtg>Ttg	p.V172L	SLC3A2_ENST00000377889.2_Missense_Mutation_p.V110L|SLC3A2_ENST00000536981.1_5'Flank|SLC3A2_ENST00000338663.7_Missense_Mutation_p.V71L|SLC3A2_ENST00000535296.1_Missense_Mutation_p.V141L|SLC3A2_ENST00000377892.1_Missense_Mutation_p.V203L|SLC3A2_ENST00000377891.2_Missense_Mutation_p.V173L	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	172					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						GCTGCTGAAGGTGGCAGGCAG	0.647											OREG0021031	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V173L													.	.			0			c.G517T												19.0	21.0	20.0					11																	62648706		2193	4294	6487	SO:0001583	missense	6520	exon4			CTGAAGGTGGCAG		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.514G>T	11.37:g.62648706G>T	ENSP00000367122:p.Val172Leu		Somatic	70	0	0	1062	WXS	Illumina HiSeq	Phase_I	46	0.09	4	NM_001012662	325	0.00	0	Q13543	Missense_Mutation	SNP	ENST00000377890.2	37	CCDS8039.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.449372|5.449372	0.96205|0.96205	.|.	.|.	ENSG00000168003|ENSG00000168003	ENST00000538084|ENST00000377892;ENST00000377891;ENST00000377890;ENST00000542007;ENST00000377889;ENST00000535296;ENST00000544377;ENST00000338663;ENST00000541372;ENST00000539458	.|T;T;T;T;T;T;T	.|0.77620	.|-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	.|0.060269	.|0.64402	.|D	.|0.000003	D|D	0.83008|0.83008	0.5161|0.5161	L|L	0.52905|0.52905	1.665|1.665	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P;D;P;D	.|0.64830	.|0.971;0.855;0.994;0.906;0.968	.|P;P;P;P;P	.|0.58331	.|0.646;0.452;0.837;0.641;0.758	D|D	0.83835|0.83835	0.0254|0.0254	5|10	.|0.54805	.|T	.|0.06	-20.4758|-20.4758	15.9301|15.9301	0.79651|0.79651	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|110;141;172;71;203	.|P08195-3;F5GZS6;P08195;P08195-2;P08195-4	.|.;.;4F2_HUMAN;.;.	S|L	142|203;173;172;173;110;141;71;71;29;71	.|ENSP00000367124:V203L;ENSP00000367123:V173L;ENSP00000367122:V172L;ENSP00000367121:V110L;ENSP00000444236:V141L;ENSP00000442135:V71L;ENSP00000340815:V71L	.|ENSP00000340815:V71L	R|V	+|+	3|1	2|0	SLC3A2|SLC3A2	62405282|62405282	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	7.801000|7.801000	0.85960|0.85960	2.619000|2.619000	0.88677|0.88677	0.561000|0.561000	0.74099|0.74099	AGG|GTG			0.647	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000157306.1		NM_001012661	
ANKRD42	338699	mdanderson.org	37	11	82922394	82922394	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr11:82922394G>T	ENST00000393392.2	+	5	586	c.424G>T	c.(424-426)Ggg>Tgg	p.G142W	ANKRD42_ENST00000531895.1_Missense_Mutation_p.G170W|ANKRD42_ENST00000393389.3_Missense_Mutation_p.G170W|ANKRD42_ENST00000260047.6_Missense_Mutation_p.G169W|ANKRD42_ENST00000526731.1_Missense_Mutation_p.G170W|RP11-727A23.7_ENST00000531869.1_RNA|ANKRD42_ENST00000528722.1_Missense_Mutation_p.G57W|ANKRD42_ENST00000533342.1_Missense_Mutation_p.G170W	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	142					positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						AGCTTTTCATGGGCGGCTTGG	0.413																																					p.G142W													.	.			0			c.G424T												169.0	158.0	162.0					11																	82922394		2203	4300	6503	SO:0001583	missense	338699	exon5			TTTCATGGGCGGC	AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.424G>T	11.37:g.82922394G>T	ENSP00000377051:p.Gly142Trp		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	55	0.07	4	NM_182603	8	0.00	0	Q49A49	Missense_Mutation	SNP	ENST00000393392.2	37	CCDS8265.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298218	0.81025	.	.	ENSG00000137494	ENST00000545672;ENST00000393389;ENST00000528722;ENST00000260047;ENST00000526731;ENST00000531895;ENST00000393392;ENST00000533342	T;T;T;T;T;T;T	0.75154	-0.91;-0.72;-0.79;-0.91;-0.79;-0.79;-0.79	5.71	5.71	0.89125	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000003	D	0.90164	0.6926	M	0.93197	3.39	0.58432	D	0.999992	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.92062	0.5657	9	.	.	.	-7.5041	18.6319	0.91363	0.0:0.0:1.0:0.0	.	170;170;434;261;142	E9PIL2;Q8N9B4-2;A1DRY3;A1XPJ0;Q8N9B4	.;.;.;.;ANR42_HUMAN	W	489;170;57;169;170;170;142;170	ENSP00000377049:G170W;ENSP00000432375:G57W;ENSP00000260047:G169W;ENSP00000433585:G170W;ENSP00000434666:G170W;ENSP00000377051:G142W;ENSP00000435790:G170W	.	G	+	1	0	ANKRD42	82600042	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	6.690000	0.74567	2.703000	0.92315	0.555000	0.69702	GGG			0.413	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000392934.1		NM_182603	
GRM5	2915	broad.mit.edu	37	11	88742239	88742239	+	Intron	SNP	C	C	T	rs533480892		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr11:88742239C>T	ENST00000305447.4	-	1	811				GRM5_ENST00000393297.1_Intron|GRM5_ENST00000305432.5_Intron|GRM5_ENST00000393294.3_Missense_Mutation_p.R230H|GRM5_ENST00000418177.2_Intron|GRM5_ENST00000455756.2_Intron	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5						activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ATCCCTCTTACGCATCTCTTC	0.294													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16567	0.0		0.0	False		,,,				2504	0.0				.													.	GRM5	414		0			.												10.0	11.0	11.0					11																	88742239		871	1983	2854	SO:0001627	intron_variant	2915	.			CTCTTACGCATCT	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.661+38140G>A	11.37:g.88742239C>T			Somatic	426	0	0		WXS	Illumina HiSeq	Phase_I	204	0.03	6	.	0		0	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.441|6.441	0.449560|0.449560	0.12223|0.12223	.|.	.|.	ENSG00000168959|ENSG00000168959	ENST00000393294|ENST00000449371	D|.	0.94417|.	-3.42|.	2.09|2.09	-2.19|-2.19	0.07015|0.07015	.|.	.|.	.|.	.|.	.|.	T|T	0.20007|0.20007	0.0481|0.0481	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.25328|0.25328	-1.0135|-1.0135	7|4	.|.	.|.	.|.	.|.	2.2403|2.2403	0.04018|0.04018	0.2315:0.308:0.0:0.4605|0.2315:0.308:0.0:0.4605	.|.	230|.	A8MT20|.	.|.	H|I	230|63	ENSP00000376972:R230H|.	.|.	R|V	-|-	2|1	0|0	GRM5|GRM5	88381887|88381887	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.226000|-1.226000	0.02953|0.02953	-0.564000|-0.564000	0.06070|0.06070	-1.472000|-1.472000	0.01007|0.01007	CGT|GTA			0.294	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000259226.1		NM_000842	
SIK3	23387	mdanderson.org	37	11	116718216	116718216	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr11:116718216G>A	ENST00000292055.4	-	22	3645	c.3610C>T	c.(3610-3612)Cag>Tag	p.Q1204*	SIK3_ENST00000434315.2_Nonsense_Mutation_p.Q1043*|AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000375288.1_Nonsense_Mutation_p.Q539*|SIK3_ENST00000542607.1_Nonsense_Mutation_p.Q1144*|SIK3_ENST00000375300.1_Nonsense_Mutation_p.Q1262*|SIK3_ENST00000446921.2_Nonsense_Mutation_p.Q1202*	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	1204					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						TCCTGAAACTGCTGGCTGCCC	0.562																																					p.Q1204X													.	.			0			c.C3610T												209.0	189.0	196.0					11																	116718216		2201	4292	6493	SO:0001587	stop_gained	23387	exon22			GAAACTGCTGGCT	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.3610C>T	11.37:g.116718216G>A	ENSP00000292055:p.Gln1204*		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	52	0.08	4	NM_025164	55	0.00	0	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Nonsense_Mutation	SNP	ENST00000292055.4	37	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	45|45	11.968660|11.968660	0.99622|0.99622	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000445177;ENST00000454905;ENST00000446921|ENST00000375300;ENST00000292055;ENST00000375288;ENST00000542607;ENST00000434315	.|.	.|.	.|.	4.92|4.92	4.92|4.92	0.64577|0.64577	.|.	.|0.000000	.|0.39544	.|U	.|0.001336	T|.	0.77412|.	0.4126|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81048|.	-0.1109|.	3|.	.|0.87932	.|D	.|0	.|.	18.1107|18.1107	0.89534|0.89534	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	1303;43;1166|1262;1204;539;1144;1043	.|.	.|ENSP00000292055:Q1204X	A|Q	-|-	2|1	0|0	SIK3|SIK3	116223426|116223426	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.046000|9.046000	0.93817|0.93817	2.253000|2.253000	0.74438|0.74438	0.557000|0.557000	0.71058|0.71058	GCA|CAG			0.562	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_025164	
FBXL14	144699	broad.mit.edu	37	12	1703090	1703090	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr12:1703090A>C	ENST00000339235.3	-	1	241	c.143T>G	c.(142-144)gTg>gGg	p.V48G	FBXL14_ENST00000543278.1_5'Flank|WNT5B_ENST00000537031.1_Intron	NM_152441.2	NP_689654.1	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14	48	F-box.|Required for down-regulation of SNAI1.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	8	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			CTTGGCCTCCACCCCCCGCCA	0.731																																					p.V48G													.	FBXL14	19		0			c.T143G												7.0	9.0	8.0					12																	1703090		2147	4245	6392	SO:0001583	missense	144699	exon1			GCCTCCACCCCCC	BC028132	CCDS8509.1	12p13.33	2011-06-09			ENSG00000171823	ENSG00000171823		"""F-boxes / Leucine-rich repeats"""	28624	protein-coding gene	gene with protein product		609081				12477932	Standard	NM_152441		Approved	MGC40195, Fbl14	uc001qjh.3	Q8N1E6	OTTHUMG00000090369	ENST00000339235.3:c.143T>G	12.37:g.1703090A>C	ENSP00000344855:p.Val48Gly		Somatic	22	0.5	11		WXS	Illumina HiSeq	Phase_I	44	0.68	30	NM_152441	75	0.40	30		Missense_Mutation	SNP	ENST00000339235.3	37	CCDS8509.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263601	0.59431	.	.	ENSG00000171823	ENST00000339235	T	0.56776	0.44	4.03	4.03	0.46877	F-box domain, cyclin-like (1);	0.155201	0.43260	D	0.000588	T	0.74913	0.3779	M	0.93678	3.445	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.78001	-0.2375	10	0.87932	D	0	.	6.3942	0.21603	0.8088:0.0:0.1912:0.0	.	48	Q8N1E6	FXL14_HUMAN	G	48	ENSP00000344855:V48G	ENSP00000344855:V48G	V	-	2	0	FBXL14	1573351	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.648000	0.83479	1.684000	0.51022	0.254000	0.18369	GTG			0.731	FBXL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206741.1		NM_152441	
HSD17B6	8630	mdanderson.org	37	12	57178677	57178677	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr12:57178677G>T	ENST00000554643.1	+	5	962	c.613G>T	c.(613-615)Gaa>Taa	p.E205*	HSD17B6_ENST00000554150.1_Nonsense_Mutation_p.E205*|HSD17B6_ENST00000555159.1_Nonsense_Mutation_p.E205*|HSD17B6_ENST00000322165.1_Nonsense_Mutation_p.E205*|HSD17B6_ENST00000555805.1_Nonsense_Mutation_p.E205*			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	205					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	CAGCATAGTTGAACCTGGCTA	0.418																																					p.E205X													.	.			0			c.G613T												171.0	164.0	167.0					12																	57178677		2203	4300	6503	SO:0001587	stop_gained	8630	exon4			ATAGTTGAACCTG	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.613G>T	12.37:g.57178677G>T	ENSP00000451406:p.Glu205*		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	92	0.05	5	NM_003725	23	0.00	0	O43275	Nonsense_Mutation	SNP	ENST00000554643.1	37	CCDS8925.1	.	.	.	.	.	.	.	.	.	.	g	41	9.144433	0.99080	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000554150;ENST00000322165	.	.	.	4.42	3.51	0.40186	.	0.235738	0.28284	N	0.015910	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	12.4746	0.55805	0.0:0.0:0.831:0.169	.	.	.	.	X	205	.	ENSP00000318631:E205X	E	+	1	0	HSD17B6	55464944	1.000000	0.71417	0.159000	0.22649	0.988000	0.76386	8.462000	0.90374	1.021000	0.39600	0.651000	0.88453	GAA			0.418	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000410714.1		NM_003725	
FOXN4	121643	ucsc.edu	37	12	109724470	109724470	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr12:109724470G>T	ENST00000299162.5	-	7	780	c.676C>A	c.(676-678)Cac>Aac	p.H226N	FOXN4_ENST00000355216.1_Missense_Mutation_p.H46N	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	226					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						TAGGGGAAGTGCTCCTTCATG	0.617																																					p.H226N													.	FOXN4	74		0			c.C676A												101.0	72.0	82.0					12																	109724470		2203	4300	6503	SO:0001583	missense	121643	exon7			GGAAGTGCTCCTT	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.676C>A	12.37:g.109724470G>T	ENSP00000299162:p.His226Asn		Somatic	42	0	0		WXS	Illumina HiSeq		40	0.10	4	NM_213596	0		0	Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	ENST00000299162.5	37	CCDS9126.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.85|12.85	2.060777|2.060777	0.36373|0.36373	.|.	.|.	ENSG00000139445|ENSG00000139445	ENST00000266856|ENST00000355216;ENST00000299162	.|D;D	.|0.95238	.|-3.65;-3.65	4.4|4.4	4.4|4.4	0.53042|0.53042	.|Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91260|0.91260	0.7245|0.7245	N|N	0.04260|0.04260	-0.245|-0.245	0.80722|0.80722	D|D	1|1	.|P;P	.|0.49696	.|0.927;0.756	.|P;P	.|0.58620	.|0.842;0.627	D|D	0.89987|0.89987	0.4105|0.4105	6|10	0.87932|0.19147	D|T	0|0.46	-6.6461|-6.6461	16.3552|16.3552	0.83233|0.83233	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|226;226	.|A6H901;Q96NZ1	.|.;FOXN4_HUMAN	E|N	184|46;226	.|ENSP00000347354:H46N;ENSP00000299162:H226N	ENSP00000266856:A184E|ENSP00000299162:H226N	A|H	-|-	2|1	0|0	FOXN4|FOXN4	108208853|108208853	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.811000|7.811000	0.86092|0.86092	2.171000|2.171000	0.68590|0.68590	0.491000|0.491000	0.48974|0.48974	GCA|CAC			0.617	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328306.1		XM_062735	
SETD1B	23067	mdanderson.org	37	12	122265972	122265972	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr12:122265972G>A	ENST00000604567.1	+	16	5791	c.5723G>A	c.(5722-5724)tGc>tAc	p.C1908Y	SETD1B_ENST00000267197.5_Missense_Mutation_p.C1865Y|SETD1B_ENST00000542440.1_Missense_Mutation_p.C1865Y			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1908	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						AACCACAGCTGCAACGTGAGT	0.667																																					p.C1865Y													.	.			0			c.G5594A												116.0	101.0	106.0					12																	122265972		692	1591	2283	SO:0001583	missense	23067	exon16			ACAGCTGCAACGT	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.5723G>A	12.37:g.122265972G>A	ENSP00000474253:p.Cys1908Tyr		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_015048	108	0.00	0	F6MFW1	Missense_Mutation	SNP	ENST00000604567.1	37		.	.	.	.	.	.	.	.	.	.	G	14.37	2.516350	0.44763	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	D;D	0.90069	-2.61;-2.61	5.11	5.11	0.69529	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.97228	0.9094	H	0.99117	4.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99346	1.0913	10	0.87932	D	0	.	18.5318	0.90995	0.0:0.0:1.0:0.0	.	1865	Q9UPS6	SET1B_HUMAN	Y	1865	ENSP00000442924:C1865Y;ENSP00000267197:C1865Y	ENSP00000267197:C1865Y	C	+	2	0	SETD1B	120750355	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	9.623000	0.98386	2.392000	0.81423	0.462000	0.41574	TGC			0.667	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000468264.1		XM_037523	
LATS2	26524	mdanderson.org	37	13	21563351	21563351	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr13:21563351G>T	ENST00000382592.4	-	4	973	c.568C>A	c.(568-570)Ccc>Acc	p.P190T	LATS2_ENST00000542899.1_Missense_Mutation_p.P190T|LATS2_ENST00000472754.1_5'UTR	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CCCTCGTAGGGGGTACCGCTC	0.677																																					p.P190T													LATS2_ENST00000382592,NS,carcinoma,+1,2	LATS2_ENST00000382592	1	2	0			c.C568A												80.0	68.0	72.0					13																	21563351		2203	4300	6503	SO:0001583	missense	26524	exon4			CGTAGGGGGTACC	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.568C>A	13.37:g.21563351G>T	ENSP00000372035:p.Pro190Thr		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_014572	6	0.00	0		Missense_Mutation	SNP	ENST00000382592.4	37	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	G	3.847	-0.032549	0.07543	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.23147	1.92;1.92	5.09	2.35	0.29111	.	0.590596	0.16294	N	0.220755	T	0.10165	0.0249	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31392	-0.9945	10	0.20519	T	0.43	.	3.4706	0.07566	0.1338:0.5707:0.1395:0.156	.	190	Q9NRM7	LATS2_HUMAN	T	190	ENSP00000372035:P190T;ENSP00000441817:P190T	ENSP00000372035:P190T	P	-	1	0	LATS2	20461351	0.006000	0.16342	0.068000	0.19968	0.014000	0.08584	0.249000	0.18216	0.149000	0.19098	-0.494000	0.04653	CCC			0.677	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044102.1			
ATP12A	479	mdanderson.org	37	13	25265283	25265283	+	Silent	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr13:25265283C>T	ENST00000381946.3	+	8	1130	c.963C>T	c.(961-963)ttC>ttT	p.F321F	ATP12A_ENST00000218548.6_Silent_p.F327F			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	321					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GCATCCTTTTCTTCATCATCG	0.527																																					p.F327F	Pancreas(156;1582 1935 18898 22665 26498)												.	.			0			c.C981T												154.0	116.0	129.0					13																	25265283		2203	4300	6503	SO:0001819	synonymous_variant	479	exon8			CCTTTTCTTCATC	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.963C>T	13.37:g.25265283C>T			Somatic	84	0.0714285714	6		WXS	Illumina HiSeq	Phase_I	48	0.10	5	NM_001185085	47	0.02	1	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	37	CCDS31948.1																																																																																					0.527	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044199.1		NM_001676	
PTMAP5	150928	broad.mit.edu	37	13	82265134	82265134	+	RNA	DEL	T	T	-			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr13:82265134delT	ENST00000607242.1	+	0	1089									prothymosin, alpha pseudogene 5																		TTGCTGTTTATTTTTTTTGGC	0.284																																					.													.	.			0			.																																											0	.			TGTTTATTTTTTT	S38627		13q13.1	2008-11-06	2008-04-03		ENSG00000214182	ENSG00000214182			9628	pseudogene	pseudogene	"""gene sequence 150"""		"""prothymosin, alpha pseudogene 5 (gene sequence 150)"""			1612591	Standard	NG_004798		Approved				OTTHUMG00000017147		13.37:g.82265134delT			Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	121	0.06	7	.	482	0.00	0		RNA	DEL	ENST00000607242.1	37																																																																																						0.284	PTMAP5-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000470311.1			
IRS2	8660	mdanderson.org	37	13	110436262	110436262	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr13:110436262G>T	ENST00000375856.3	-	1	2653	c.2139C>A	c.(2137-2139)acC>acA	p.T713T		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	713					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			CCGCCGCAGAGGTGGGTGCTG	0.756																																					p.T713T	Melanoma(100;613 2409 40847)												.	.			0			c.C2139A												4.0	3.0	3.0					13																	110436262		1474	3031	4505	SO:0001819	synonymous_variant	8660	exon1			CGCAGAGGTGGGT	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.2139C>A	13.37:g.110436262G>T			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_003749	1	0.00	0	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																					0.756	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045755.1		NM_003749	
ADPRHL1	113622	mdanderson.org	37	13	114083363	114083363	+	Missense_Mutation	SNP	C	C	T	rs377658823		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr13:114083363C>T	ENST00000375418.3	-	4	636	c.550G>A	c.(550-552)Gca>Aca	p.A184T	ADPRHL1_ENST00000356501.4_Missense_Mutation_p.A102T	NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	184					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			TTTCCTTGTGCGGCGAACGAC	0.657																																					p.A184T													.	.			0			c.G550A							C	THR/ALA,THR/ALA	1,4403	2.1+/-5.4	0,1,2201	44.0	40.0	41.0		550,304	-10.2	0.0	13		41	0,8590		0,0,4295	no	missense,missense	ADPRHL1	NM_138430.3,NM_199162.1	58,58	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	184/355,102/273	114083363	1,12993	2202	4295	6497	SO:0001583	missense	113622	exon4			CTTGTGCGGCGAA	AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.550G>A	13.37:g.114083363C>T	ENSP00000364567:p.Ala184Thr		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_138430	7	0.00	0	Q5JUG2|Q96GD1	Missense_Mutation	SNP	ENST00000375418.3	37	CCDS9535.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512734	0.27123	2.27E-4	0.0	ENSG00000153531	ENST00000356501;ENST00000375418;ENST00000413169	T;T;T	0.29655	1.56;1.56;1.56	5.08	-10.2	0.00374	.	0.559357	0.18497	N	0.139461	T	0.12050	0.0293	N	0.22421	0.69	0.09310	N	1	P	0.36535	0.557	B	0.22753	0.041	T	0.04537	-1.0944	10	0.46703	T	0.11	-0.3064	12.7322	0.57204	0.0:0.0969:0.0839:0.8192	.	184	Q8NDY3	ARHL1_HUMAN	T	102;184;102	ENSP00000348894:A102T;ENSP00000364567:A184T;ENSP00000416213:A102T	ENSP00000348894:A102T	A	-	1	0	ADPRHL1	113131364	0.038000	0.19896	0.000000	0.03702	0.043000	0.13939	0.365000	0.20348	-2.555000	0.00477	-0.379000	0.06801	GCA			0.657	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045915.2		NM_138430	
MLH3	27030	hgsc.bcm.edu	37	14	75514926	75514926	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr14:75514926G>T	ENST00000556740.1	-	1	1468	c.1433C>A	c.(1432-1434)gCa>gAa	p.A478E	MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000556257.1_Missense_Mutation_p.A478E|MLH3_ENST00000238662.7_Missense_Mutation_p.A478E|MLH3_ENST00000355774.2_Missense_Mutation_p.A478E|MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000555671.1_5'Flank			Q9UHC1	MLH3_HUMAN	mutL homolog 3	478					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		AGCTTCTGATGCTACAATTGT	0.383								Mismatch excision repair (MMR)																													p.A478E													.	.			0			c.C1433A												87.0	92.0	90.0					14																	75514926		2203	4299	6502	SO:0001583	missense	27030	exon2			TCTGATGCTACAA	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.1433C>A	14.37:g.75514926G>T	ENSP00000452316:p.Ala478Glu		Somatic	137	0	0		WXS	Illumina HiSeq	.	93	0.04	4	NM_014381	6	0.00	0	P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	37	CCDS32123.1	.	.	.	.	.	.	.	.	.	.	G	1.396	-0.579422	0.03854	.	.	ENSG00000119684	ENST00000355774;ENST00000238662;ENST00000556257;ENST00000556740	T;T;T;T	0.80653	-1.34;-1.35;-1.4;-1.34	4.81	-1.53	0.08611	.	1.149520	0.06328	N	0.705635	T	0.67636	0.2914	L	0.51422	1.61	0.09310	N	1	P;B	0.38504	0.634;0.363	B;B	0.36186	0.219;0.109	T	0.53690	-0.8403	10	0.05721	T	0.95	0.5293	4.8227	0.13400	0.47:0.1598:0.3702:0.0	.	478;478	Q9UHC1-2;Q9UHC1	.;MLH3_HUMAN	E	478	ENSP00000348020:A478E;ENSP00000238662:A478E;ENSP00000451540:A478E;ENSP00000452316:A478E	ENSP00000238662:A478E	A	-	2	0	MLH3	74584679	0.000000	0.05858	0.000000	0.03702	0.204000	0.24138	0.387000	0.20718	0.016000	0.14998	0.585000	0.79938	GCA			0.383	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415006.1		NM_014381	
FLVCR2	55640	mdanderson.org	37	14	76045333	76045333	+	Silent	SNP	C	C	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr14:76045333C>A	ENST00000238667.4	+	1	374	c.18C>A	c.(16-18)ccC>ccA	p.P6P	AC007182.6_ENST00000455232.1_RNA	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	6					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		ATGAAGGTCCCAACCAGGAAG	0.607											OREG0022816	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P6P													.	.			0			c.C18A												58.0	62.0	61.0					14																	76045333		2203	4300	6503	SO:0001819	synonymous_variant	55640	exon1			AGGTCCCAACCAG	AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.18C>A	14.37:g.76045333C>A			Somatic	59	0	0	1165	WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_017791	15	0.00	0	B7Z485|Q53ZT9|Q96JY3|Q9NX90	Silent	SNP	ENST00000238667.4	37	CCDS9844.1																																																																																					0.607	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413672.1		NM_017791	
SYNE3	161176	mdanderson.org	37	14	95921773	95921773	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr14:95921773G>T	ENST00000334258.5	-	5	1092	c.1078C>A	c.(1078-1080)Cag>Aag	p.Q360K	SYNE3_ENST00000553340.1_Missense_Mutation_p.Q360K|SYNE3_ENST00000554873.1_Missense_Mutation_p.Q117K|SYNE3_ENST00000557275.1_Missense_Mutation_p.Q360K	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	360					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GCCGCAGGCTGCAGGCCCTCC	0.657																																					p.Q360K													.	.			0			c.C1078A												28.0	32.0	31.0					14																	95921773		2203	4300	6503	SO:0001583	missense	161176	exon5			CAGGCTGCAGGCC	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1078C>A	14.37:g.95921773G>T	ENSP00000334308:p.Gln360Lys		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_152592	1	0.00	0	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	G	8.425	0.847235	0.17034	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.34859	3.55;1.34;3.55;2.99	4.99	0.842	0.18927	.	0.595280	0.13789	N	0.362653	T	0.24890	0.0604	N	0.22421	0.69	0.22620	N	0.998925	B;B;B	0.24368	0.102;0.102;0.062	B;B;B	0.23716	0.048;0.048;0.021	T	0.16188	-1.0411	10	0.11485	T	0.65	-11.2308	17.0329	0.86466	0.0:0.4552:0.5448:0.0	.	360;360;360	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	K	360;117;360;360	ENSP00000334308:Q360K;ENSP00000452154:Q117K;ENSP00000450562:Q360K;ENSP00000450774:Q360K	ENSP00000334308:Q360K	Q	-	1	0	C14orf49	94991526	1.000000	0.71417	0.007000	0.13788	0.008000	0.06430	1.143000	0.31553	-0.126000	0.11682	-0.519000	0.04390	CAG			0.657	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000420529.2		NM_152592	
PLCB2	5330	mdanderson.org	37	15	40580988	40580988	+	Nonsense_Mutation	SNP	G	G	T	rs61755439	byFrequency	TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr15:40580988G>T	ENST00000260402.3	-	32	3735	c.3486C>A	c.(3484-3486)tgC>tgA	p.C1162*	PLCB2_ENST00000557821.1_Nonsense_Mutation_p.C1158*|PLCB2_ENST00000456256.2_Nonsense_Mutation_p.C1147*	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	1162					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GGGGGCACTCGCAGGCCCTCT	0.627																																					p.C1162X													.	.			0			c.C3486A												44.0	50.0	48.0					15																	40580988		1965	4146	6111	SO:0001587	stop_gained	5330	exon32			GCACTCGCAGGCC		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.3486C>A	15.37:g.40580988G>T	ENSP00000260402:p.Cys1162*		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	73	0.05	4	NM_004573	51	0.00	0	A8K6J2|B9EGH5	Nonsense_Mutation	SNP	ENST00000260402.3	37	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	G	39	7.765423	0.98477	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	.	.	.	4.47	-1.67	0.08238	.	2.090910	0.01599	N	0.021975	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6731	0.12699	0.3346:0.2012:0.4642:0.0	.	.	.	.	X	1162;1147	.	ENSP00000260402:C1162X	C	-	3	2	PLCB2	38368280	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.007000	0.13174	-0.118000	0.11851	-0.367000	0.07326	TGC			0.627	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000418430.1			
LMAN1L	79748	bcgsc.ca;mdanderson.org	37	15	75112999	75112999	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr15:75112999G>T	ENST00000309664.5	+	8	937	c.798G>T	c.(796-798)gaG>gaT	p.E266D	RP11-414J4.2_ENST00000564823.1_RNA|LMAN1L_ENST00000379709.3_Missense_Mutation_p.E254D	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	266						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCTTCCTGGAGATGCAGCAGC	0.612																																					p.E266D													.	LMAN1L	43		0			c.G798T												77.0	78.0	78.0					15																	75112999		2197	4296	6493	SO:0001583	missense	79748	exon8			CCTGGAGATGCAG	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.798G>T	15.37:g.75112999G>T	ENSP00000310431:p.Glu266Asp		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_1	75	0.07	5	NM_021819	0		0	Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	37	CCDS10270.1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134579	0.21123	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.42900	0.97;0.96	4.3	2.39	0.29439	.	0.549745	0.18016	N	0.154402	T	0.23330	0.0564	N	0.08118	0	0.09310	N	1	P;P	0.49559	0.925;0.877	P;B	0.47162	0.54;0.339	T	0.10245	-1.0638	10	0.13108	T	0.6	.	7.4259	0.27098	0.2123:0.0:0.7877:0.0	.	254;266	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	D	266;254	ENSP00000310431:E266D;ENSP00000369031:E254D	ENSP00000310431:E266D	E	+	3	2	LMAN1L	72900052	0.044000	0.20184	0.097000	0.21041	0.376000	0.30014	0.749000	0.26320	0.526000	0.28541	0.555000	0.69702	GAG			0.612	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286397.4			
FAHD1	81889	mdanderson.org	37	16	1877842	1877842	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr16:1877842G>T	ENST00000427358.2	+	1	618	c.612G>T	c.(610-612)gaG>gaT	p.E204D	HAGH_ENST00000566709.1_5'Flank|FAHD1_ENST00000382666.4_Missense_Mutation_p.E204D|HAGH_ENST00000455446.2_5'Flank|HAGH_ENST00000397353.2_5'Flank|FAHD1_ENST00000382668.4_Missense_Mutation_p.E204D|HAGH_ENST00000397356.3_5'Flank	NM_031208.3	NP_112485.1	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing 1	204						cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetylpyruvate hydrolase activity (GO:0018773)|acylpyruvate hydrolase activity (GO:0047621)|fumarylpyruvate hydrolase activity (GO:0034545)|metal ion binding (GO:0046872)			NS(1)|large_intestine(1)|liver(1)|ovary(2)|urinary_tract(1)	6						AAAACGATGAGATCGAGGCTG	0.418																																					p.E204D													.	.			0			c.G612T												82.0	81.0	81.0					16																	1877842		2199	4300	6499	SO:0001583	missense	81889	exon1			CGATGAGATCGAG	BC063017	CCDS10448.1, CCDS32367.1, CCDS45380.1	16p13.3	2011-10-21	2004-08-19	2004-08-26	ENSG00000180185	ENSG00000180185			14169	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 36"""	C16orf36		21878618	Standard	NM_001018104		Approved	DKFZP566J2046	uc002cnd.3	Q6P587	OTTHUMG00000128663	ENST00000427358.2:c.612G>T	16.37:g.1877842G>T	ENSP00000398053:p.Glu204Asp		Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	107	0.05	5	NM_031208	56	0.00	0	B1AK40|B1AK41|Q6FIC7|Q96RY1|Q9H0N6	Missense_Mutation	SNP	ENST00000427358.2	37	CCDS10448.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160694	0.38119	.	.	ENSG00000180185	ENST00000382668;ENST00000382666;ENST00000427358	D;D;D	0.95171	-3.63;-3.63;-3.63	4.34	2.36	0.29203	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90669	0.7073	L	0.60067	1.865	0.49582	D	0.999804	B;B;B	0.26809	0.132;0.16;0.087	B;B;B	0.27262	0.046;0.078;0.043	T	0.83343	-0.0007	10	0.14252	T	0.57	.	9.598	0.39587	0.1707:0.0:0.8293:0.0	.	204;204;204	Q6P587-2;B1AK40;Q6P587	.;.;FAHD1_HUMAN	D	204	ENSP00000372114:E204D;ENSP00000372112:E204D;ENSP00000398053:E204D	ENSP00000372112:E204D	E	+	3	2	FAHD1	1817843	1.000000	0.71417	0.631000	0.29282	0.975000	0.68041	4.943000	0.63554	0.576000	0.29452	0.655000	0.94253	GAG			0.418	FAHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250550.2		NM_001018104	
FBXL19	54620	mdanderson.org	37	16	30939251	30939251	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr16:30939251G>T	ENST00000380310.2	+	5	812	c.654G>T	c.(652-654)gaG>gaT	p.E218D	FBXL19_ENST00000338343.4_Missense_Mutation_p.E198D|FBXL19_ENST00000565690.1_Intron|FBXL19_ENST00000471231.2_5'UTR|FBXL19_ENST00000562319.1_Missense_Mutation_p.E198D	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	218	Pro-rich.				proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						AGGAAAGGGAGGCAGGGAATG	0.672																																					p.E218D													.	.			0			c.G654T												8.0	8.0	8.0					16																	30939251		1908	4062	5970	SO:0001583	missense	54620	exon5			AAGGGAGGCAGGG	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.654G>T	16.37:g.30939251G>T	ENSP00000369666:p.Glu218Asp		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_001099784	31	0.00	0	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	37	CCDS45465.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.55|13.55	2.270802|2.270802	0.40194|0.40194	.|.	.|.	ENSG00000099364|ENSG00000099364	ENST00000338343;ENST00000380310|ENST00000427128	T;T|.	0.25749|.	1.78;2.1|.	4.8|4.8	4.8|4.8	0.61643|0.61643	.|.	2.597800|.	0.01597|.	N|.	0.021846|.	T|T	0.20047|0.20047	0.0482|0.0482	N|N	0.08118|0.08118	0|0	0.28013|0.28013	N|N	0.934824|0.934824	B;B|.	0.28324|.	0.207;0.183|.	B;B|.	0.33960|.	0.145;0.173|.	T|T	0.12293|0.12293	-1.0553|-1.0553	10|5	0.23302|.	T|.	0.38|.	-16.0447|-16.0447	9.0677|9.0677	0.36473|0.36473	0.1011:0.0:0.8989:0.0|0.1011:0.0:0.8989:0.0	.|.	218;218|.	Q6PCT2;Q6PCT2-2|.	FXL19_HUMAN;.|.	D|C	198;218|153	ENSP00000339712:E198D;ENSP00000369666:E218D|.	ENSP00000339712:E198D|.	E|G	+|+	3|1	2|0	FBXL19|FBXL19	30846752|30846752	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	4.723000|4.723000	0.61965|0.61965	2.225000|2.225000	0.72522|0.72522	0.306000|0.306000	0.20318|0.20318	GAG|GGC			0.672	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_019085	
ZNF646	9726	mdanderson.org	37	16	31088604	31088604	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr16:31088604G>T	ENST00000394979.2	+	1	1382	c.959G>T	c.(958-960)aGg>aTg	p.R320M	ZNF646_ENST00000300850.5_Missense_Mutation_p.R320M|ZNF668_ENST00000300849.4_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						GAGGGTGAAAGGCAGGAGCCA	0.632																																					p.R320M													.	.			0			c.G959T												50.0	45.0	46.0					16																	31088604		2197	4300	6497	SO:0001583	missense	9726	exon2			GTGAAAGGCAGGA	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.959G>T	16.37:g.31088604G>T	ENSP00000378429:p.Arg320Met		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_014699	17	0.00	0	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	G	12.46	1.943617	0.34283	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.10192	2.9;2.95	4.81	0.442	0.16582	.	.	.	.	.	T	0.10637	0.0260	N	0.19112	0.55	0.19300	N	0.999976	P	0.48016	0.904	P	0.50192	0.634	T	0.26503	-1.0101	9	0.72032	D	0.01	-2.251	8.2832	0.31913	0.6076:0.0:0.3924:0.0	.	320	O15015-2	.	M	320	ENSP00000300850:R320M;ENSP00000378429:R320M	ENSP00000300850:R320M	R	+	2	0	ZNF646	30996105	0.967000	0.33354	0.233000	0.24025	0.934000	0.57294	0.289000	0.18957	-0.042000	0.13535	-0.345000	0.07892	AGG			0.632	ZNF646-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000108510.2		NM_014699	
IGHV1OR16-3	28313	broad.mit.edu	37	16	32070612	32070612	+	RNA	SNP	A	A	C	rs368458790		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr16:32070612A>C	ENST00000566806.1	-	0	499																											GGTCTCCTGCAAGGCTTCTGG	0.552																																					.													.	.			0			.																																											0	.			TCCTGCAAGGCTT																													16.37:g.32070612A>C			Somatic	43	0.023255814	1		WXS	Illumina HiSeq	Phase_I	27	0.19	5	.	0		0		RNA	SNP	ENST00000566806.1	37																																																																																						0.552	RP11-1166P10.6-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000432459.1			
NPIPB15	440348	broad.mit.edu;mdanderson.org	37	16	74425946	74425946	+	Nonsense_Mutation	SNP	C	C	T	rs369331764		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr16:74425946C>T	ENST00000429990.1	+	7	1396	c.1300C>T	c.(1300-1302)Caa>Taa	p.Q434*				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	434						extracellular region (GO:0005576)		p.Q373*(1)|p.Q434*(1)									aatcaaaaaacaaaaCAAAAC	0.338																																					.													NPIPL2_ENST00000429990,NS,carcinoma,0,2	.		2	2	Substitution - Nonsense(2)	endometrium(2)	.												1.0	2.0	1.0					16																	74425946		800	1861	2661	SO:0001587	stop_gained	440348	.			AAAAAACAAAACA	BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1300C>T	16.37:g.74425946C>T	ENSP00000411140:p.Gln434*		Somatic	48	0.0208333333	1		WXS	Illumina HiSeq	Phase_I	42	0.14	6	.	6	0.00	0	C9J9U8	Nonsense_Mutation	SNP	ENST00000429990.1	37		.	.	.	.	.	.	.	.	.	.	-	9.643	1.139392	0.21205	.	.	ENSG00000196436	ENST00000504746;ENST00000429990	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.25876	N	0.983642	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	2.8176	0.05461	0.4997:0.4997:3.0E-4:3.0E-4	.	.	.	.	X	298;434	.	ENSP00000411140:Q434X	Q	+	1	0	NPIPL2	72983447	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.000000	0.14550	0.000000	0.15137	CAA			0.338	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000346597.2		NM_001018059	
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	88501926	88501926	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr16:88501926G>C	ENST00000437464.1	+	2	7964	c.7964G>C	c.(7963-7965)gGa>gCa	p.G2655A	ZNF469_ENST00000565624.1_Missense_Mutation_p.G2683A	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2655					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						TCTGTGGAAGGAGGGCCTGAG	0.642																																					p.G2655A													.	.			0			c.G7964C												13.0	18.0	17.0					16																	88501926		691	1588	2279	SO:0001583	missense	84627	exon2			TGGAAGGAGGGCC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7964G>C	16.37:g.88501926G>C	ENSP00000402343:p.Gly2655Ala		Somatic	36	0	0		WXS	Illumina HiSeq	.	17	0.47	8	NM_001127464	0		0		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	8.909	0.958285	0.18507	.	.	ENSG00000225614	ENST00000437464	T	0.06371	3.31	4.59	-1.01	0.10169	.	.	.	.	.	T	0.02156	0.0067	N	0.12182	0.205	0.09310	N	1	B	0.25235	0.121	B	0.19148	0.024	T	0.43180	-0.9407	9	0.02654	T	1	.	0.9485	0.01371	0.3981:0.1816:0.2725:0.1478	.	2655	Q96JG9	ZN469_HUMAN	A	2655	ENSP00000402343:G2655A	ENSP00000402343:G2655A	G	+	2	0	ZNF469	87029427	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.284000	0.08422	-0.199000	0.10317	0.561000	0.74099	GGA			0.642	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NG_012236	
NLE1	54475	mdanderson.org	37	17	33469134	33469134	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr17:33469134G>A	ENST00000442241.4	-	2	65	c.26C>T	c.(25-27)gCg>gTg	p.A9V	NLE1_ENST00000586869.1_5'UTR|NLE1_ENST00000593176.1_5'UTR|NLE1_ENST00000360831.5_Missense_Mutation_p.A9V	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	9					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				GCGCGCCACCGCCTCGTCCTG	0.701																																					p.A9V													.	.			0			c.C26T												30.0	24.0	26.0					17																	33469134		2196	4290	6486	SO:0001583	missense	54475	exon2			GCCACCGCCTCGT		CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.26C>T	17.37:g.33469134G>A	ENSP00000413572:p.Ala9Val		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_018096	9	0.00	0	O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	ENST00000442241.4	37	CCDS11291.1	.	.	.	.	.	.	.	.	.	.	G	8.369	0.834802	0.16820	.	.	ENSG00000073536	ENST00000442241;ENST00000537697	T	0.57436	0.4	4.79	-0.0481	0.13840	.	0.472937	0.23989	N	0.042584	T	0.16471	0.0396	N	0.01352	-0.895	0.24968	N	0.991686	B	0.19073	0.033	B	0.06405	0.002	T	0.12682	-1.0538	10	0.27082	T	0.32	-10.5392	2.3213	0.04211	0.0986:0.177:0.4035:0.3209	.	9	Q9NVX2	NLE1_HUMAN	V	9	ENSP00000413572:A9V	ENSP00000413572:A9V	A	-	2	0	NLE1	30493247	1.000000	0.71417	0.990000	0.47175	0.212000	0.24457	0.765000	0.26546	0.207000	0.20607	0.591000	0.81541	GCG			0.701	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256441.2		NM_018096	
SRCIN1	80725	mdanderson.org	37	17	36714529	36714529	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr17:36714529C>T	ENST00000264659.7	-	11	2359	c.2135G>A	c.(2134-2136)cGc>cAc	p.R712H	SRCIN1_ENST00000578925.1_Missense_Mutation_p.R746H|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	584					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						CACCAGGGTGCGCTGCCGCTG	0.701											OREG0024362	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R712H													.	.			0			c.G2135A												29.0	36.0	34.0					17																	36714529		2095	4208	6303	SO:0001583	missense	80725	exon11			AGGGTGCGCTGCC		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.2135G>A	17.37:g.36714529C>T	ENSP00000264659:p.Arg712His		Somatic	51	0.0196078431	1	865	WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_025248	3	0.00	0	Q75T46|Q8N4W8	Missense_Mutation	SNP	ENST00000264659.7	37	CCDS45660.1	.	.	.	.	.	.	.	.	.	.	C	35	5.523325	0.96431	.	.	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T	0.54279	0.58	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.72851	0.3512	M	0.76727	2.345	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.77133	-0.2700	10	0.87932	D	0	-16.5258	16.865	0.86027	0.0:1.0:0.0:0.0	.	18;584;584;712	Q9C0H9-4;Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;.;SRCN1_HUMAN;.	H	712;493;566	ENSP00000264659:R712H	ENSP00000264659:R712H	R	-	2	0	SRCIN1	33968055	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.349000	0.79376	2.273000	0.75805	0.455000	0.32223	CGC			0.701	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000441878.4		NM_025248	
RPL19	6143	hgsc.bcm.edu	37	17	37360424	37360424	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr17:37360424C>T	ENST00000225430.4	+	5	513	c.451C>T	c.(451-453)Cgc>Tgc	p.R151C	RPL19_ENST00000579260.1_Missense_Mutation_p.R149C|RPL19_ENST00000579374.1_Missense_Mutation_p.R148C|RPL19_ENST00000582193.1_Missense_Mutation_p.R149C	NM_000981.3	NP_000972.1	P84098	RL19_HUMAN	ribosomal protein L19	151					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7						AGACAAGGCCCGCAAGAAGCT	0.453																																					p.R151C													RPL19,NS,carcinoma,-1,1	RPL19	-1	1	0			c.C451T												62.0	65.0	64.0					17																	37360424		1909	4127	6036	SO:0001583	missense	6143	exon5			AAGGCCCGCAAGA		CCDS42312.1	17q12	2012-09-20			ENSG00000108298	ENSG00000108298		"""L ribosomal proteins"""	10312	protein-coding gene	gene with protein product	"""60S ribosomal protein L19"", ""ribosomal protein L19, cytosolic, N-terminus truncated"""	180466				1577483	Standard	XM_005257564		Approved	FLJ27452, MGC71997, DKFZp779D216, L19	uc002hrq.1	P84098	OTTHUMG00000178979	ENST00000225430.4:c.451C>T	17.37:g.37360424C>T	ENSP00000225430:p.Arg151Cys		Somatic	27	0.037037037	1		WXS	Illumina HiSeq	.	31	0.06	2	NM_000981	14796	0.00	15	B2R4K2|P14118|P22908|Q502Y6|Q7Z6E4	Missense_Mutation	SNP	ENST00000225430.4	37	CCDS42312.1	.	.	.	.	.	.	.	.	.	.	c	19.04	3.750092	0.69533	.	.	ENSG00000108298	ENST00000225430	.	.	.	5.43	5.43	0.79202	.	0.056541	0.64402	N	0.000001	T	0.81597	0.4856	H	0.96208	3.785	0.80722	D	1	B	0.16166	0.016	B	0.08055	0.003	T	0.81957	-0.0695	9	0.62326	D	0.03	.	18.8481	0.92215	0.0:1.0:0.0:0.0	.	151	P84098	RL19_HUMAN	C	151	.	ENSP00000225430:R151C	R	+	1	0	RPL19	34613950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.627000	0.83176	2.551000	0.86045	0.563000	0.77884	CGC			0.453	RPL19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000444190.1		NM_000981	
KRT33A	3883	mdanderson.org	37	17	39507011	39507011	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr17:39507011G>T	ENST00000007735.3	-	1	53	c.9C>A	c.(7-9)taC>taA	p.Y3*		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	3	Head.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				GGCCACAACTGTAAGACATGG	0.632																																					p.Y3X													.	.			0			c.C9A												13.0	15.0	14.0					17																	39507011		2177	4290	6467	SO:0001587	stop_gained	3883	exon1			ACAACTGTAAGAC	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.9C>A	17.37:g.39507011G>T	ENSP00000007735:p.Tyr3*		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_004138	0		0	B2RA87|Q6NTB9|Q6ZZB9	Nonsense_Mutation	SNP	ENST00000007735.3	37	CCDS11388.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773577	0.49786	.	.	ENSG00000006059	ENST00000007735	.	.	.	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8847	0.52596	0.0844:0.0:0.9156:0.0	.	.	.	.	X	3	.	ENSP00000007735:Y3X	Y	-	3	2	KRT33A	36760537	0.139000	0.22563	0.948000	0.38648	0.011000	0.07611	1.491000	0.35583	2.809000	0.96659	0.557000	0.71058	TAC			0.632	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257295.1		NM_004138	
KANSL1	284058	hgsc.bcm.edu;broad.mit.edu	37	17	44109654	44109662	+	In_Frame_Del	DEL	GACCTGTAG	GACCTGTAG	-			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	GACCTGTAG	GACCTGTAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr17:44109654_44109662delGACCTGTAG	ENST00000262419.6	-	14	3311_3319	c.2841_2849delCTACAGGTC	c.(2839-2850)tcctacaggtca>tca	p.947_950SYRS>S	KANSL1_ENST00000572904.1_In_Frame_Del_p.947_950SYRS>S|KANSL1_ENST00000432791.1_In_Frame_Del_p.947_950SYRS>S|KANSL1_ENST00000393476.3_In_Frame_Del_p.241_244SYRS>S|KANSL1_ENST00000574590.1_In_Frame_Del_p.947_950SYRS>S|KANSL1_ENST00000575318.1_In_Frame_Del_p.883_886SYRS>S	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	947	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GCCGTCTGATGACCTGTAGGACCTGCACA	0.565																																					p.948_950del													.	.			0			c.2842_2850del																																									SO:0001651	inframe_deletion	284058	exon14			TCTGATGACCTGT	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2841_2849delCTACAGGTC	17.37:g.44109654_44109662delGACCTGTAG	ENSP00000262419:p.Ser947_Arg949del		Somatic	21	0	0		WXS	Illumina HiSeq	.	29	0.38	11	NM_001193466	171	0.00	0	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	In_Frame_Del	DEL	ENST00000262419.6	37	CCDS11503.1																																																																																					0.565	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440274.1		NM_015443	
ABCA9	10350	mdanderson.org	37	17	66992072	66992072	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr17:66992072G>T	ENST00000340001.4	-	26	3730	c.3519C>A	c.(3517-3519)ccC>ccA	p.P1173P	ABCA9_ENST00000370732.2_Silent_p.P1173P|ABCA9_ENST00000453985.2_Silent_p.P1135P	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1173					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TCAATGTGAAGGGAGGTATTA	0.383																																					p.P1173P													ABCA9,NS,malignant_melanoma,-2,2	ABCA9	-2	2	0			c.C3519A												141.0	129.0	133.0					17																	66992072		2203	4300	6503	SO:0001819	synonymous_variant	10350	exon26			TGTGAAGGGAGGT	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3519C>A	17.37:g.66992072G>T			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_080283	2	0.00	0	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Silent	SNP	ENST00000340001.4	37	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	G	1.128	-0.653165	0.03480	.	.	ENSG00000154258	ENST00000453749	.	.	.	5.67	-0.159	0.13379	.	.	.	.	.	T	0.53238	0.1784	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52719	-0.8538	5	0.62326	D	0.03	.	2.0731	0.03618	0.2315:0.1319:0.5007:0.1359	.	.	.	.	I	1130	.	ENSP00000411523:L1130I	L	-	1	0	ABCA9	64503667	0.626000	0.27120	0.992000	0.48379	0.090000	0.18270	-0.240000	0.08952	0.053000	0.16036	0.609000	0.83330	CTT			0.383	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000277072.2		NM_172386	
MAP2K2	5605	mdanderson.org	37	19	4110627	4110627	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:4110627G>T	ENST00000262948.5	-	3	583	c.330C>A	c.(328-330)gcC>gcA	p.A110A	MAP2K2_ENST00000394867.4_Silent_p.A13A|MAP2K2_ENST00000599345.1_5'UTR	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	GGTTCCGGATGGCCGGCTTGA	0.612																																					p.A110A													.	.			0			c.C330A												68.0	56.0	60.0					19																	4110627		2203	4300	6503	SO:0001819	synonymous_variant	5605	exon3			CCGGATGGCCGGC	L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.330C>A	19.37:g.4110627G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_030662	622	0.00	0		Silent	SNP	ENST00000262948.5	37	CCDS12120.1																																																																																					0.612	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258957.2			
LRG1	116844	mdanderson.org	37	19	4538473	4538473	+	Missense_Mutation	SNP	G	G	T	rs200192398		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:4538473G>T	ENST00000306390.6	-	2	983	c.523C>A	c.(523-525)Cgc>Agc	p.R175S	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'Flank	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	175					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCCGGAGGCGGTTCCCAGAC	0.617																																					p.R175S													LRG1,colon,carcinoma,+1,1	LRG1	1	1	0			c.C523A												72.0	82.0	79.0					19																	4538473		2203	4300	6503	SO:0001583	missense	116844	exon2			GGAGGCGGTTCCC		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.523C>A	19.37:g.4538473G>T	ENSP00000302621:p.Arg175Ser		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_052972	13	0.00	0	Q8N4F5|Q96QZ4	Missense_Mutation	SNP	ENST00000306390.6	37	CCDS12130.1	.	.	.	.	.	.	.	.	.	.	.	5.545	0.285414	0.10513	.	.	ENSG00000171236	ENST00000306390;ENST00000538589	T	0.58210	0.35	4.71	-0.2	0.13216	.	1.924680	0.02581	N	0.098913	T	0.42154	0.1190	L	0.39147	1.195	0.09310	N	0.999999	B	0.09022	0.002	B	0.16289	0.015	T	0.09796	-1.0658	10	0.34782	T	0.22	-1.2951	3.3363	0.07102	0.1715:0.1342:0.5572:0.1372	.	175	P02750	A2GL_HUMAN	S	175;158	ENSP00000302621:R175S	ENSP00000302621:R175S	R	-	1	0	LRG1	4489473	0.039000	0.19947	0.004000	0.12327	0.016000	0.09150	0.187000	0.16998	-0.303000	0.08856	-0.797000	0.03246	CGC			0.617	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458654.2		NM_052972	
PLIN3	10226	hgsc.bcm.edu	37	19	4859920	4859920	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:4859920G>T	ENST00000221957.4	-	3	359	c.183C>A	c.(181-183)gaC>gaA	p.D61E	PLIN3_ENST00000592528.1_Missense_Mutation_p.D61E|PLIN3_ENST00000585479.1_Missense_Mutation_p.D61E	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	61					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	TCTCTGCTGCGTCGCAGACAG	0.637																																					p.D61E													PLIN3,bladder,carcinoma,-2,1	PLIN3	-2	1	0			c.C183A												70.0	60.0	63.0					19																	4859920		2203	4300	6503	SO:0001583	missense	10226	exon3			TGCTGCGTCGCAG	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.183C>A	19.37:g.4859920G>T	ENSP00000221957:p.Asp61Glu		Somatic	110	0	0		WXS	Illumina HiSeq	.	97	0.04	4	NM_001164189	178	0.00	0	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	G	0.751	-0.772919	0.02951	.	.	ENSG00000105355	ENST00000221957	T	0.04654	3.58	4.76	1.23	0.21249	.	0.128037	0.51477	D	0.000099	T	0.05686	0.0149	N	0.20881	0.62	0.21220	N	0.999756	D;D	0.63880	0.991;0.993	P;P	0.61800	0.83;0.894	T	0.29243	-1.0018	10	0.09084	T	0.74	-8.6555	4.7598	0.13102	0.3146:0.0:0.5438:0.1416	.	61;61	O60664-3;O60664	.;PLIN3_HUMAN	E	61	ENSP00000221957:D61E	ENSP00000221957:D61E	D	-	3	2	PLIN3	4810920	0.003000	0.15002	0.286000	0.24833	0.271000	0.26615	-0.667000	0.05274	0.051000	0.15978	0.462000	0.41574	GAC			0.637	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000450436.1		NM_005817	
ZNF564	163050	broad.mit.edu	37	19	12637879	12637879	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:12637879G>T	ENST00000339282.7	-	4	1239	c.1043C>A	c.(1042-1044)tCt>tAt	p.S348Y	CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR|ZNF709_ENST00000428311.1_Intron	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ATTACTGGAAGAACTGAAGGT	0.423																																					p.S348Y													.	ZNF564	55		0			c.C1043A												74.0	79.0	77.0					19																	12637879		2200	4297	6497	SO:0001583	missense	163050	exon4			CTGGAAGAACTGA	BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.1043C>A	19.37:g.12637879G>T	ENSP00000340004:p.Ser348Tyr		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	95	0.04	4	NM_144976	42	0.00	0	B9EGT4|Q6P1K6	Missense_Mutation	SNP	ENST00000339282.7	37	CCDS42505.1	.	.	.	.	.	.	.	.	.	.	G	0.371	-0.934135	0.02340	.	.	ENSG00000249709	ENST00000339282	T	0.06608	3.28	1.71	-3.41	0.04839	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04861	0.0131	L	0.54965	1.715	0.09310	N	0.999999	B	0.20988	0.05	B	0.21708	0.036	T	0.50004	-0.8878	9	0.02654	T	1	.	5.2954	0.15749	0.0:0.3572:0.3218:0.321	.	348	Q8TBZ8	ZN564_HUMAN	Y	348	ENSP00000340004:S348Y	ENSP00000340004:S348Y	S	-	2	0	ZNF564	12498879	0.000000	0.05858	0.000000	0.03702	0.998000	0.95712	-4.116000	0.00292	-1.321000	0.02281	0.643000	0.83706	TCT			0.423	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344120.2		NM_144976	
ZNF676	163223	ucsc.edu	37	19	22363172	22363172	+	Silent	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:22363172G>A	ENST00000397121.2	-	3	1664	c.1347C>T	c.(1345-1347)taC>taT	p.Y449Y		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CTTCACATTTGTAGGGTTTCT	0.438																																					p.Y449Y													.	ZNF676	146		0			c.C1347T																																									SO:0001819	synonymous_variant	163223	exon3			ACATTTGTAGGGT	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1347C>T	19.37:g.22363172G>A			Somatic	55	0.0545454545	3		RNA-Seq	Illumina HiSeq		75	0.07	5	NM_001001411	125	0.13	16	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																					0.438	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464392.1		NM_001001411	
MAG	4099	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	35790585	35790585	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:35790585G>T	ENST00000392213.3	+	5	703	c.544G>T	c.(544-546)Gag>Tag	p.E182*	MAG_ENST00000597035.1_3'UTR|MAG_ENST00000537831.2_Nonsense_Mutation_p.E157*|MAG_ENST00000361922.4_Nonsense_Mutation_p.E182*	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	182	Ig-like C2-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGGGCTGGGGGAGCCCGCTGT	0.711																																					p.E182X													.	.			0			c.G544T												13.0	16.0	15.0					19																	35790585		2195	4292	6487	SO:0001587	stop_gained	4099	exon5			CTGGGGGAGCCCG	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.544G>T	19.37:g.35790585G>T	ENSP00000376048:p.Glu182*		Somatic	41	0	0		WXS	Illumina HiSeq	.	41	0.20	8	NM_080600	0		0	B7Z2E5|F5GYC0|Q567S4	Nonsense_Mutation	SNP	ENST00000392213.3	37	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	g	38	6.914203	0.97932	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	.	.	.	4.57	4.57	0.56435	.	0.171581	0.49305	D	0.000153	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	10.6849	0.45837	0.0:0.1941:0.8058:0.0	.	.	.	.	X	219;182;182;157	.	ENSP00000262624:E219X	E	+	1	0	MAG	40482425	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.692000	0.54727	2.361000	0.80049	0.306000	0.20318	GAG			0.711	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466071.1		NM_080600	
RYR1	6261	mdanderson.org	37	19	38958374	38958374	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:38958374G>T	ENST00000359596.3	+	25	3303	c.3303G>T	c.(3301-3303)gtG>gtT	p.V1101V	RYR1_ENST00000360985.3_Silent_p.V1101V|RYR1_ENST00000355481.4_Silent_p.V1101V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1101	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGATGCGCGTGGGCTGGGCGA	0.627																																					p.V1101V													.	.			0			c.G3303T												88.0	73.0	78.0					19																	38958374		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon25			GCGCGTGGGCTGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3303G>T	19.37:g.38958374G>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001042723	4	0.25	1	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																					0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000462137.1			
LIPE	3991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42912431	42912431	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:42912431C>A	ENST00000244289.4	-	3	1739	c.1463G>T	c.(1462-1464)gGg>gTg	p.G488V	LIPE_ENST00000602000.1_5'UTR|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	488					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				GGACACCAGCCCAATGGAGAT	0.622																																					p.G488V													.	.			0			c.G1463T												172.0	164.0	167.0					19																	42912431		2203	4300	6503	SO:0001583	missense	3991	exon3			ACCAGCCCAATGG	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1463G>T	19.37:g.42912431C>A	ENSP00000244289:p.Gly488Val		Somatic	129	0	0		WXS	Illumina HiSeq	.	102	0.26	27	NM_005357	112	0.28	31	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981361	0.53827	.	.	ENSG00000079435	ENST00000244289	T	0.36699	1.24	4.0	4.0	0.46444	Hormone-sensitive lipase, N-terminal (1);	0.156107	0.42821	D	0.000652	T	0.46190	0.1380	L	0.28115	0.83	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.984;1.0	T	0.42682	-0.9437	10	0.41790	T	0.15	-14.5888	15.401	0.74841	0.0:1.0:0.0:0.0	.	488;488	A8K8W7;Q05469	.;LIPS_HUMAN	V	488	ENSP00000244289:G488V	ENSP00000244289:G488V	G	-	2	0	LIPE	47604271	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	6.380000	0.73158	2.257000	0.74773	0.561000	0.74099	GGG			0.622	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463861.1		NM_005357	
ZNF233	353355	ucsc.edu	37	19	44778238	44778238	+	Silent	SNP	T	T	C			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:44778238T>C	ENST00000391958.2	+	5	1552	c.1425T>C	c.(1423-1425)acT>acC	p.T475T	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Silent_p.T457T|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				GAATCCACACTGGAGAGAAAC	0.453																																					p.T475T													.	ZNF233	73		0			c.T1425C												56.0	62.0	60.0					19																	44778238		2203	4300	6503	SO:0001819	synonymous_variant	353355	exon5			CCACACTGGAGAG	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1425T>C	19.37:g.44778238T>C			Somatic	72	0	0		RNA-Seq	Illumina HiSeq		82	0.01	1	NM_001207005	29	0.17	5	B2RN78|B2RN79|Q86WL8	Silent	SNP	ENST00000391958.2	37	CCDS33047.1																																																																																					0.453	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000460737.1		NM_181756	
ZNF671	79891	broad.mit.edu	37	19	58232944	58232944	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr19:58232944G>T	ENST00000317398.6	-	4	605	c.510C>A	c.(508-510)ggC>ggA	p.G170G	AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Silent_p.G72G|ZNF671_ENST00000594803.1_5'Flank	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G170G(1)		kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TCAATATTGGGCCACATATGT	0.473																																					p.G170G													ZNF671,NS,carcinoma,0,1	ZNF671	55	1	1	Substitution - coding silent(1)	kidney(1)	c.C510A												148.0	141.0	144.0					19																	58232944		2203	4300	6503	SO:0001819	synonymous_variant	79891	exon4			TATTGGGCCACAT		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.510C>A	19.37:g.58232944G>T			Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	188	0.02	4	NM_024833	11	0.00	0	A6NF07|Q9H5E9	Silent	SNP	ENST00000317398.6	37	CCDS12961.1																																																																																					0.473	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466817.1		NM_024833	
OSR1	130497	broad.mit.edu	37	2	19553461	19553461	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr2:19553461C>G	ENST00000272223.2	-	2	450	c.106G>C	c.(106-108)Gac>Cac	p.D36H	OSR1_ENST00000536433.1_Missense_Mutation_p.D36H	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	36					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				GGCAGATGGTCCGAAGGCACT	0.612																																					p.D36H													.	OSR1	29		0			c.G106C												50.0	47.0	48.0					2																	19553461		2203	4300	6503	SO:0001583	missense	130497	exon2			GATGGTCCGAAGG	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.106G>C	2.37:g.19553461C>G	ENSP00000272223:p.Asp36His		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	101	0.03	3	NM_145260	0		0	B3KV97|D6W521	Missense_Mutation	SNP	ENST00000272223.2	37	CCDS1694.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709922	0.68730	.	.	ENSG00000143867	ENST00000272223;ENST00000536433	T;T	0.09163	3.01;3.01	5.8	5.8	0.92144	.	0.088190	0.85682	D	0.000000	T	0.15219	0.0367	L	0.53249	1.67	0.58432	D	0.999997	B	0.17268	0.021	B	0.21917	0.037	T	0.06588	-1.0818	9	.	.	.	-28.0171	19.699	0.96045	0.0:1.0:0.0:0.0	.	36	Q8TAX0	OSR1_HUMAN	H	36	ENSP00000272223:D36H;ENSP00000441801:D36H	.	D	-	1	0	OSR1	19416942	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.818000	0.86416	2.755000	0.94549	0.555000	0.69702	GAC			0.612	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000201432.2		NM_145260	
ASXL2	55252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	25976403	25976403	+	Splice_Site	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr2:25976403C>T	ENST00000435504.4	-	11	1435	c.1142G>A	c.(1141-1143)aGt>aAt	p.S381N	ASXL2_ENST00000336112.4_Splice_Site_p.S353N|ASXL2_ENST00000272341.4_Splice_Site_p.S121N|ASXL2_ENST00000404843.1_Splice_Site_p.S121N			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	381					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.S381N(1)|p.S121N(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTAATATTACCTCTGCCCATA	0.378																																					p.S381N													ASXL2_ENST00000435504,NS,carcinoma,0,2	ASXL2_ENST00000435504	0	2	2	Substitution - Missense(2)	prostate(2)	c.G1142A												170.0	170.0	170.0					2																	25976403		1839	4080	5919	SO:0001630	splice_region_variant	55252	exon10			TATTACCTCTGCC			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1142+1G>A	2.37:g.25976403C>T			Somatic	132	0	0		WXS	Illumina HiSeq	.	81	0.17	14	NM_018263	3	0.00	0	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	C	14.23	2.474405	0.43942	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.18502	2.21;2.21;2.22;2.22	5.72	5.72	0.89469	.	0.099628	0.64402	D	0.000001	T	0.20251	0.0487	N	0.08118	0	0.42626	D	0.993363	P;D	0.63046	0.487;0.992	B;D	0.77557	0.203;0.99	T	0.14868	-1.0457	9	.	.	.	-4.4026	11.8544	0.52429	0.0:0.9198:0.0:0.0802	.	121;381	Q76L83-2;Q76L83	.;ASXL2_HUMAN	N	381;353;121;121	ENSP00000391447:S381N;ENSP00000337250:S353N;ENSP00000383920:S121N;ENSP00000272341:S121N	.	S	-	2	0	ASXL2	25829907	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.013000	0.49582	2.714000	0.92807	0.643000	0.83706	AGT			0.378	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000325593.3		NM_018263	Missense_Mutation
ASPRV1	151516	mdanderson.org	37	2	70187846	70187846	+	Silent	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr2:70187846C>T	ENST00000320256.4	-	1	1551	c.975G>A	c.(973-975)ctG>ctA	p.L325L	PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						CTATGAGCTCCAGGTCAAACT	0.527																																					p.L325L													.	.			0			c.G975A												103.0	106.0	105.0					2																	70187846		2203	4300	6503	SO:0001819	synonymous_variant	151516	exon1			GAGCTCCAGGTCA	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.975G>A	2.37:g.70187846C>T			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_152792	3	0.00	0		Silent	SNP	ENST00000320256.4	37	CCDS1897.1																																																																																					0.527	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334161.1		NM_152792	
AC027612.3	0	broad.mit.edu	37	2	91887904	91887905	+	RNA	INS	-	-	T	rs374250838|rs373336109|rs369805878|rs199562278	byFrequency	TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr2:91887904_91887905insT	ENST00000436174.1	-	0	540																											AGCTATTTTCCATTTTTTTTTT	0.292																																					.													.	.			0			.																																											0	.			ATTTTCCATTTTT																													2.37:g.91887904_91887905insT			Somatic	174	0.0459770115	8		WXS	Illumina HiSeq	Phase_I	141	0.14	20	.	0		0		RNA	INS	ENST00000436174.1	37																																																																																						0.292	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338339.1			
RGPD4	285190	hgsc.bcm.edu;broad.mit.edu	37	2	108488726	108488726	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr2:108488726G>T	ENST00000408999.3	+	20	4343	c.4266G>T	c.(4264-4266)ggG>ggT	p.G1422G	RGPD4_ENST00000354986.4_Silent_p.G1422G	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1422	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						ATATGAAAGGGACAGAAAGAG	0.378																																					p.G1422G													RGPD4,right_upper_lobe,carcinoma,+2,1	RGPD4	2	1	0			c.G4266T												9.0	6.0	7.0					2																	108488726		675	1499	2174	SO:0001819	synonymous_variant	285190	exon20			GAAAGGGACAGAA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.4266G>T	2.37:g.108488726G>T			Somatic	128	0	0		WXS	Illumina HiSeq	.	91	0.21	19	NM_182588	0		0	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																					0.378	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330096.2		XM_496581	
STAT1	6772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	191843624	191843624	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr2:191843624C>T	ENST00000361099.3	-	21	2218	c.1831G>A	c.(1831-1833)Gcc>Acc	p.A611T	STAT1_ENST00000392323.2_Missense_Mutation_p.A613T|STAT1_ENST00000392322.3_Missense_Mutation_p.A611T|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Missense_Mutation_p.A611T	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	611	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			AATGTGATGGCCCCTTCCCGG	0.592																																					p.A611T													.	.			0			c.G1831A												55.0	47.0	49.0					2																	191843624		2203	4300	6503	SO:0001583	missense	6772	exon21			TGATGGCCCCTTC		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1831G>A	2.37:g.191843624C>T	ENSP00000354394:p.Ala611Thr		Somatic	88	0	0		WXS	Illumina HiSeq	.	66	0.23	15	NM_007315	227	0.01	3	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	C	37	6.174121	0.97348	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	5.22	5.22	0.72569	SH2 motif (4);	0.091688	0.85682	D	0.000000	D	0.93723	0.7994	M	0.71581	2.175	0.80722	D	1	D;D	0.63880	0.982;0.993	P;D	0.63597	0.861;0.916	D	0.93903	0.7190	10	0.87932	D	0	-25.1458	19.3296	0.94280	0.0:1.0:0.0:0.0	.	611;611	P42224-2;P42224	.;STAT1_HUMAN	T	611;611;611;613	ENSP00000354394:A611T;ENSP00000386244:A611T;ENSP00000376136:A611T;ENSP00000376137:A613T	ENSP00000354394:A611T	A	-	1	0	STAT1	191551869	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	7.617000	0.83032	2.873000	0.98535	0.563000	0.77884	GCC			0.592	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255997.3		NM_007315	
GAL3ST2	64090	mdanderson.org	37	2	242738496	242738496	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr2:242738496C>A	ENST00000192314.6	+	2	177	c.46C>A	c.(46-48)Ctc>Atc	p.L16I	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	16					biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)	p.L16I(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CCGGGTCATCCTCCTCCTCCT	0.637																																					p.L16I													GAL3ST2,NS,carcinoma,0,1	GAL3ST2	0	1	1	Substitution - Missense(1)	prostate(1)	c.C46A												100.0	89.0	93.0					2																	242738496		2203	4300	6503	SO:0001583	missense	64090	exon2			GTCATCCTCCTCC	AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.46C>A	2.37:g.242738496C>A	ENSP00000192314:p.Leu16Ile		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	61	0.07	4	NM_022134	0		0	Q17RK0|Q57Z52	Missense_Mutation	SNP	ENST00000192314.6	37	CCDS33427.1	.	.	.	.	.	.	.	.	.	.	C	6.106	0.387881	0.11581	.	.	ENSG00000154252	ENST00000192314	T	0.15017	2.46	0.235	0.235	0.15431	.	2.330970	0.02268	N	0.068157	T	0.09113	0.0225	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.24799	-1.0150	9	0.23302	T	0.38	.	.	.	.	.	16	Q9H3Q3	G3ST2_HUMAN	I	16	ENSP00000192314:L16I	ENSP00000192314:L16I	L	+	1	0	GAL3ST2	242387169	0.001000	0.12720	0.003000	0.11579	0.397000	0.30659	-0.008000	0.12788	0.308000	0.22923	0.313000	0.20887	CTC			0.637	GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322792.1		NM_022134	
UQCC1	55245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	33891797	33891797	+	Nonsense_Mutation	SNP	T	T	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr20:33891797T>A	ENST00000374385.5	-	10	1018	c.841A>T	c.(841-843)Aag>Tag	p.K281*	UQCC1_ENST00000374384.2_Nonsense_Mutation_p.K255*|UQCC1_ENST00000407996.2_Nonsense_Mutation_p.K144*|UQCC1_ENST00000397556.3_Nonsense_Mutation_p.K182*|UQCC1_ENST00000540457.1_Nonsense_Mutation_p.K126*|UQCC1_ENST00000374377.5_Nonsense_Mutation_p.K169*|UQCC1_ENST00000359226.2_Nonsense_Mutation_p.K201*|UQCC1_ENST00000374380.2_Nonsense_Mutation_p.K213*|UQCC1_ENST00000349714.5_Nonsense_Mutation_p.K254*	NM_018244.4	NP_060714.3	Q9NVA1	UQCC1_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 1	281						cytoplasmic membrane-bounded vesicle (GO:0016023)|mitochondrion (GO:0005739)											TGAGGATTCTTCTCCACTAGA	0.612											OREG0025888	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K281X													UQCC,NS,carcinoma,+1,1	UQCC	1	1	0			c.A841T												121.0	112.0	115.0					20																	33891797		2203	4300	6503	SO:0001587	stop_gained	55245	exon10			GATTCTTCTCCAC	AK001712	CCDS13252.1, CCDS13253.1, CCDS13253.2, CCDS54458.1	20q11.22	2013-09-20	2013-09-20	2013-09-20	ENSG00000101019	ENSG00000101019		"""Mitochondrial respiratory chain complex assembly factors"""	15891	protein-coding gene	gene with protein product	"""Basic FGF-repressed Zic-binding protein"", ""cytochrome B protein synthesis 3 homolog (S. cerevisiae)"""	611797	"""chromosome 20 open reading frame 44"", ""ubiquinol-cytochrome c reductase complex chaperone"""	C20orf44, UQCC			Standard	NM_018244		Approved	FLJ10850, CBP3, BFZB	uc002xcd.3	Q9NVA1	OTTHUMG00000032335	ENST00000374385.5:c.841A>T	20.37:g.33891797T>A	ENSP00000363506:p.Lys281*		Somatic	156	0	0	843	WXS	Illumina HiSeq	.	135	0.22	30	NM_018244	57	0.26	15	B1AKV5|Q0VF37|Q5T348|Q5T351|Q5T353|Q86YU3|Q86YU4|Q96H66|Q9H438|Q9H452|Q9H9K8|Q9H9R5	Nonsense_Mutation	SNP	ENST00000374385.5	37	CCDS13252.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359419	0.61403	.	.	ENSG00000101019	ENST00000349714;ENST00000359226;ENST00000374384;ENST00000374380;ENST00000374385;ENST00000374377;ENST00000397556;ENST00000407996;ENST00000540457;ENST00000424405	.	.	.	4.99	4.99	0.66335	.	0.246048	0.39407	N	0.001377	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.7738	14.3226	0.66496	0.0:0.0:0.0:1.0	.	.	.	.	X	254;201;255;213;281;169;182;144;126;249	.	ENSP00000335364:K254X	K	-	1	0	UQCC	33355211	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.923000	0.40055	2.239000	0.73571	0.533000	0.62120	AAG			0.612	UQCC1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078866.1		NM_018244	
SOGA1	140710	broad.mit.edu	37	20	35443918	35443918	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr20:35443918G>T	ENST00000357779.3	-	5	1539	c.1213C>A	c.(1213-1215)Cga>Aga	p.R405R	SOGA1_ENST00000279034.6_Silent_p.R405R|SOGA1_ENST00000237536.4_Silent_p.R643R|SOGA1_ENST00000456801.2_Silent_p.R246R			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	405					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CTGCAGAGTCGGACCGCATGG	0.677																																					p.R643R													SOGA1_ENST00000237536,bladder,carcinoma,+1,4	SOGA1	136	4	0			c.C1927A												10.0	12.0	11.0					20																	35443918		2184	4279	6463	SO:0001819	synonymous_variant	140710	exon5			AGAGTCGGACCGC	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1213C>A	20.37:g.35443918G>T			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	60	0.05	3	NM_080627	12	0.00	0	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Silent	SNP	ENST00000357779.3	37																																																																																						0.677	SOGA1-201	KNOWN	basic	protein_coding	protein_coding				NM_199181	
DOPEY2	9980	broad.mit.edu	37	21	37609660	37609660	+	Missense_Mutation	SNP	C	C	T	rs541281990		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr21:37609660C>T	ENST00000399151.3	+	16	2808	c.2723C>T	c.(2722-2724)aCg>aTg	p.T908M		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	908					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.T908M(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CTGGCCCCTACGGCCAACATC	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17497	0.0		0.0	False		,,,				2504	0.0				p.T908M													DOPEY2,NS,carcinoma,0,1	DOPEY2	184	1	1	Substitution - Missense(1)	ovary(1)	c.C2723T												104.0	79.0	88.0					21																	37609660		2203	4300	6503	SO:0001583	missense	9980	exon16			CCCCTACGGCCAA	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2723C>T	21.37:g.37609660C>T	ENSP00000382104:p.Thr908Met		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	98	0.04	4	NM_005128	27	0.00	0	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486356	0.84854	.	.	ENSG00000142197	ENST00000399151	T	0.66995	-0.24	5.42	5.42	0.78866	.	0.124012	0.56097	D	0.000027	T	0.67477	0.2897	L	0.44542	1.39	0.44104	D	0.996879	D	0.65815	0.995	P	0.47251	0.542	T	0.71955	-0.4436	10	0.72032	D	0.01	.	19.2437	0.93893	0.0:1.0:0.0:0.0	.	908	Q9Y3R5	DOP2_HUMAN	M	908	ENSP00000382104:T908M	ENSP00000382104:T908M	T	+	2	0	DOPEY2	36531530	0.998000	0.40836	0.046000	0.18839	0.931000	0.56810	7.321000	0.79088	2.545000	0.85829	0.591000	0.81541	ACG			0.612	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000194636.1		NM_005128	
ITGB2	3689	mdanderson.org	37	21	46308741	46308741	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr21:46308741G>T	ENST00000397850.2	-	15	2399	c.1947C>A	c.(1945-1947)ggC>ggA	p.G649G	ITGB2_ENST00000397857.1_Silent_p.G649G|ITGB2_ENST00000355153.4_Silent_p.G649G|ITGB2_ENST00000397854.3_Silent_p.G592G|ITGB2_ENST00000397852.1_Silent_p.G649G|ITGB2_ENST00000302347.5_Silent_p.G649G			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	649					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	ACAGCTGCAGGCCCGGACACG	0.662																																					p.G649G													.	.			0			c.C1947A												65.0	60.0	62.0					21																	46308741		2203	4300	6503	SO:0001819	synonymous_variant	3689	exon14			CTGCAGGCCCGGA	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1947C>A	21.37:g.46308741G>T			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001127491	617	0.00	0	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	ENST00000397850.2	37	CCDS13716.1																																																																																					0.662	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206566.2		NM_000211	
IL17RA	23765	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17589771	17589771	+	Silent	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr22:17589771G>A	ENST00000319363.6	+	13	1795	c.1662G>A	c.(1660-1662)tcG>tcA	p.S554S		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	554					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GGGAGCTGTCGGGGGACAACT	0.682																																					p.S554S													.	IL17RA	62		0			c.G1662A												19.0	18.0	18.0					22																	17589771		2195	4297	6492	SO:0001819	synonymous_variant	23765	exon13			GCTGTCGGGGGAC	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.1662G>A	22.37:g.17589771G>A			Somatic	66	0.0151515152	1		WXS	Illumina HiSeq	Phase_I	60	0.18	11	NM_014339	47	0.19	9	O43844|Q20WK1	Silent	SNP	ENST00000319363.6	37	CCDS13739.1																																																																																					0.682	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315820.1		NM_014339	
ZDHHC8	29801	bcgsc.ca	37	22	20117004	20117004	+	5'Flank	SNP	C	C	T	rs570346401	byFrequency	TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr22:20117004C>T	ENST00000334554.7	+	0	0				ZDHHC8_ENST00000405930.3_5'Flank|SNORA77_ENST00000578179.1_RNA|ZDHHC8_ENST00000320602.7_5'Flank	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8						locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GATGGTGCTGCGGGAAGGGAG	0.622													C|||	4	0.000798722	0.003	0.0	5008	,	,		18484	0.0		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001631	upstream_gene_variant	29801	.			GTGCTGCGGGAAG	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499		22.37:g.20117004C>T	Exception_encountered		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_1	29	0.14	4	.	0		0	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.516386	0.27123	.	.	ENSG00000099904	ENST00000436518	T	0.60424	0.19	1.72	0.521	0.17046	.	.	.	.	.	T	0.52338	0.1728	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.50206	-0.8855	6	0.87932	D	0	.	5.5483	0.17076	0.0:0.6459:0.3541:0.0	.	.	.	.	W	4	ENSP00000412807:R4W	ENSP00000412807:R4W	R	+	1	2	ZDHHC8	18497004	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-0.700000	0.05081	0.237000	0.21200	0.313000	0.20887	CGG			0.622	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318564.1		NM_013373	
CCDC157	550631	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	22	30771567	30771567	+	Missense_Mutation	SNP	G	G	A	rs368250287		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr22:30771567G>A	ENST00000405659.1	+	10	2481	c.1772G>A	c.(1771-1773)cGc>cAc	p.R591H	RP1-130H16.16_ENST00000332468.4_RNA|CCDC157_ENST00000338306.3_Missense_Mutation_p.R591H			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	591										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						AACGACATCCGCATCCGGGTC	0.592																																					p.R591H													.	.			0			c.G1772A							G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	95.0	79.0	84.0		1772	5.2	1.0	22		84	0,8600		0,0,4300	no	missense	CCDC157	NM_001017437.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	591/753	30771567	1,13005	2203	4300	6503	SO:0001583	missense	550631	exon10			ACATCCGCATCCG	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.1772G>A	22.37:g.30771567G>A	ENSP00000385357:p.Arg591His		Somatic	107	0	0		WXS	Illumina HiSeq	.	97	0.05	5	NM_001017437	19	0.00	0	Q0VD76|Q9BYA4	Missense_Mutation	SNP	ENST00000405659.1	37	CCDS33632.2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913796	0.92178	2.27E-4	0.0	ENSG00000187860	ENST00000405659;ENST00000338306	T;T	0.77620	-1.11;-1.11	5.24	5.24	0.73138	.	0.059115	0.64402	D	0.000005	D	0.86552	0.5960	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87709	0.2565	10	0.72032	D	0.01	-21.2246	16.6295	0.85029	0.0:0.0:1.0:0.0	.	591	Q569K6	CC157_HUMAN	H	591	ENSP00000385357:R591H;ENSP00000343087:R591H	ENSP00000343087:R591H	R	+	2	0	CCDC157	29101567	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.209000	0.65208	2.445000	0.82738	0.655000	0.94253	CGC			0.592	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000320936.1		NM_001017437	
GGA1	26088	broad.mit.edu	37	22	38027039	38027039	+	Silent	SNP	G	G	T	rs138927569		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr22:38027039G>T	ENST00000343632.4	+	14	1847	c.1461G>T	c.(1459-1461)ccG>ccT	p.P487P	GGA1_ENST00000381756.5_Silent_p.P504P|GGA1_ENST00000325180.8_Silent_p.P400P|GGA1_ENST00000337437.4_Silent_p.P454P|GGA1_ENST00000406772.1_Silent_p.P414P	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	487	Unstructured hinge.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					CCAGGCCTCCGCAGCAGCCCG	0.657																																					p.P487P													GGA1,NS,carcinoma,+1,1	GGA1	39	1	0			c.G1461T												68.0	73.0	71.0					22																	38027039		2203	4300	6503	SO:0001819	synonymous_variant	26088	exon14			GCCTCCGCAGCAG	AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.1461G>T	22.37:g.38027039G>T			Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	111	0.05	5	NM_013365	309	0.00	0	A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Silent	SNP	ENST00000343632.4	37	CCDS13951.1																																																																																					0.657	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075873.3		NM_013365	
MKL1	57591	mdanderson.org	37	22	40815349	40815349	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr22:40815349G>T	ENST00000355630.3	-	12	1683	c.1093C>A	c.(1093-1095)Cct>Act	p.P365T	MKL1_ENST00000396617.3_Missense_Mutation_p.P365T|MKL1_ENST00000407029.1_Missense_Mutation_p.P365T|MKL1_ENST00000402042.1_Missense_Mutation_p.P315T	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	365	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CCCGAGACAGGCAGTGATCGC	0.622			T	RBM15	acute megakaryocytic leukemia																																p.P365T				Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	.			0			c.C1093A												51.0	50.0	50.0					22																	40815349		2203	4300	6503	SO:0001583	missense	57591	exon12			AGACAGGCAGTGA	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1093C>A	22.37:g.40815349G>T	ENSP00000347847:p.Pro365Thr		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_020831	52	0.00	0	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932830	0.73442	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.57436	0.46;0.41;0.4;0.46	5.03	5.03	0.67393	DNA-binding SAP (4);	0.115412	0.64402	D	0.000012	T	0.67841	0.2936	L	0.48935	1.535	0.58432	D	0.999996	D;D;D	0.89917	0.957;1.0;1.0	P;D;D	0.91635	0.71;0.999;0.999	T	0.68784	-0.5317	10	0.56958	D	0.05	-18.6651	18.5611	0.91100	0.0:0.0:1.0:0.0	.	315;365;365	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	T	365;365;315;365	ENSP00000347847:P365T;ENSP00000379861:P365T;ENSP00000385584:P315T;ENSP00000385835:P365T	ENSP00000347847:P365T	P	-	1	0	MKL1	39145295	1.000000	0.71417	0.815000	0.32552	0.801000	0.45260	4.345000	0.59360	2.613000	0.88420	0.655000	0.94253	CCT			0.622	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321522.1		NM_020831	
TOPAZ1	375337	broad.mit.edu	37	3	44285524	44285524	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:44285524A>G	ENST00000309765.4	+	2	1694	c.1526A>G	c.(1525-1527)aAg>aGg	p.K509R		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	509						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										TGTTGGAAAAAGGCTTCCTTG	0.408																																					p.K509R													.	.			0			c.A1526G												122.0	102.0	108.0					3																	44285524		692	1591	2283	SO:0001583	missense	375337	exon2			GGAAAAAGGCTTC	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.1526A>G	3.37:g.44285524A>G	ENSP00000310303:p.Lys509Arg		Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	130	0.02	3	NM_001145030	0		0		Missense_Mutation	SNP	ENST00000309765.4	37	CCDS46809.1	.	.	.	.	.	.	.	.	.	.	A	11.79	1.744894	0.30865	.	.	ENSG00000173769	ENST00000309765	T	0.11712	2.75	5.55	1.83	0.25207	.	0.355474	0.27981	N	0.017068	T	0.07503	0.0189	L	0.32530	0.975	0.22719	N	0.998812	B	0.23249	0.082	B	0.22386	0.039	T	0.27400	-1.0075	10	0.48119	T	0.1	-7.8913	5.4127	0.16356	0.6441:0.1396:0.2163:0.0	.	509	Q8N9V7	CC077_HUMAN	R	509	ENSP00000310303:K509R	ENSP00000310303:K509R	K	+	2	0	C3orf77	44260528	0.826000	0.29277	0.959000	0.39883	0.993000	0.82548	1.532000	0.36029	0.371000	0.24564	0.528000	0.53228	AAG			0.408	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343247.1		NM_001145030	
KLHL18	23276	mdanderson.org	37	3	47374795	47374795	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:47374795G>T	ENST00000232766.5	+	5	769	c.749G>T	c.(748-750)tGc>tTc	p.C250F	KLHL18_ENST00000455924.2_Missense_Mutation_p.C138F	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	250										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GTGCGTTGCTGCCACAAATGC	0.572																																					p.C250F													.	.			0			c.G749T												58.0	48.0	51.0					3																	47374795		2203	4300	6503	SO:0001583	missense	23276	exon5			GTTGCTGCCACAA	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.749G>T	3.37:g.47374795G>T	ENSP00000232766:p.Cys250Phe		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_025010	52	0.00	0	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	37	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280461	0.59758	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	T;T	0.74632	-0.71;-0.86	5.31	5.31	0.75309	.	0.145067	0.64402	D	0.000008	T	0.69115	0.3075	L	0.58101	1.795	0.80722	D	1	P;B;B	0.40970	0.734;0.213;0.402	B;B;B	0.32805	0.153;0.068;0.105	T	0.74968	-0.3483	10	0.66056	D	0.02	.	16.2818	0.82694	0.0:0.0:1.0:0.0	.	101;250;185	Q647K1;O94889;O94889-2	.;KLH18_HUMAN;.	F	250;138	ENSP00000232766:C250F;ENSP00000405585:C138F	ENSP00000232766:C250F	C	+	2	0	KLHL18	47349799	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.537000	0.82033	2.768000	0.95171	0.561000	0.74099	TGC			0.572	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344493.1		NM_025010	
NCKIPSD	51517	mdanderson.org	37	3	48719045	48719045	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:48719045G>T	ENST00000294129.2	-	5	886	c.767C>A	c.(766-768)tCc>tAc	p.S256Y	NCKIPSD_ENST00000416649.2_Missense_Mutation_p.S249Y|NCKIPSD_ENST00000341520.4_Missense_Mutation_p.S256Y	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain	256	Pro-rich.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTGGACTTGGGACACGGTGGT	0.627																																					p.S256Y													.	.			0			c.C767A												43.0	45.0	44.0					3																	48719045		2203	4300	6503	SO:0001583	missense	51517	exon5			ACTTGGGACACGG	AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.767C>A	3.37:g.48719045G>T	ENSP00000294129:p.Ser256Tyr		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_016453	127	0.00	0	B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Missense_Mutation	SNP	ENST00000294129.2	37	CCDS2776.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.056178	0.55325	.	.	ENSG00000213672	ENST00000341520;ENST00000416649;ENST00000294129;ENST00000439518;ENST00000453349;ENST00000426678	T;T;T;T	0.50277	0.75;1.36;1.35;1.33	5.27	4.36	0.52297	.	0.386006	0.23537	U	0.047115	T	0.51924	0.1703	L	0.29908	0.895	0.40299	D	0.978586	D;D;D	0.67145	0.996;0.976;0.986	P;P;P	0.57548	0.823;0.656;0.814	T	0.57670	-0.7771	10	0.62326	D	0.03	.	15.9358	0.79707	0.0:0.1348:0.8652:0.0	.	256;256;249	C9JSC3;Q9NZQ3;Q9NZQ3-3	.;SPN90_HUMAN;.	Y	256;249;256;256;178;140	ENSP00000342621:S256Y;ENSP00000389059:S249Y;ENSP00000294129:S256Y;ENSP00000409675:S256Y	ENSP00000294129:S256Y	S	-	2	0	NCKIPSD	48694049	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	6.849000	0.75414	2.442000	0.82660	0.563000	0.77884	TCC			0.627	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257520.1		NM_016453	
MCM2	4171	broad.mit.edu	37	3	127323901	127323901	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:127323901G>A	ENST00000265056.7	+	4	819	c.575G>A	c.(574-576)cGg>cAg	p.R192Q		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	192	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						GCGGGCCCCCGGCTGGAGATC	0.612																																					p.R192Q													.	MCM2	79		0			c.G575A												71.0	74.0	73.0					3																	127323901		2203	4300	6503	SO:0001583	missense	4171	exon4			GCCCCCGGCTGGA	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.575G>A	3.37:g.127323901G>A	ENSP00000265056:p.Arg192Gln		Somatic	181	0.0055248619	1		WXS	Illumina HiSeq	Phase_I	161	0.02	4	NM_004526	165	0.01	2	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	37	CCDS3043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.0|23.0	4.358124|4.358124	0.82243|0.82243	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000491422|ENST00000265056;ENST00000539922;ENST00000543142	.|T	.|0.02395	.|4.31	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	.|0.061993	.|0.64402	.|D	.|0.000003	T|T	0.14270|0.14270	0.0345|0.0345	M|M	0.65677|0.65677	2.01|2.01	0.80722|0.80722	D|D	1|1	.|D;B;P	.|0.76494	.|0.999;0.265;0.65	.|D;B;B	.|0.77557	.|0.99;0.047;0.097	T|T	0.00920|0.00920	-1.1514|-1.1514	5|10	.|0.40728	.|T	.|0.16	-28.5698|-28.5698	18.6857|18.6857	0.91563|0.91563	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|173;62;192	.|F5H1E9;B4DSV5;P49736	.|.;.;MCM2_HUMAN	S|Q	55|192;96;173	.|ENSP00000265056:R192Q	.|ENSP00000265056:R192Q	G|R	+|+	1|2	0|0	MCM2|MCM2	128806591|128806591	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	9.835000|9.835000	0.99442|0.99442	2.406000|2.406000	0.81754|0.81754	0.591000|0.591000	0.81541|0.81541	GGC|CGG			0.612	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356612.1			
TRH	7200	mdanderson.org	37	3	129695840	129695840	+	Silent	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:129695840G>A	ENST00000302649.3	+	3	1037	c.510G>A	c.(508-510)gaG>gaA	p.E170E	TRH_ENST00000507066.1_Silent_p.E166E	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	170					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)	p.E170E(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						Gggaagaagaggaggaggagg	0.642																																					p.E170E	Esophageal Squamous(60;321 1330 17401 41911)												TRH,right_upper_lobe,carcinoma,0,2	TRH	0	2	1	Substitution - coding silent(1)	prostate(1)	c.G510A												33.0	35.0	34.0					3																	129695840		2202	4300	6502	SO:0001819	synonymous_variant	7200	exon3			AGAAGAGGAGGAG		CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.510G>A	3.37:g.129695840G>A			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_007117	33	0.00	0	B2R8R1|Q2TB83	Silent	SNP	ENST00000302649.3	37	CCDS3066.1																																																																																					0.642	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000356592.1		NM_007117	
CHST2	9435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142840363	142840363	+	Silent	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:142840363C>T	ENST00000309575.3	+	2	2089	c.705C>T	c.(703-705)agC>agT	p.S235S		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	235					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						AGTTGTATAGCCCCGCGGGCA	0.652																																					p.S235S													.	.			0			c.C705T												29.0	37.0	34.0					3																	142840363		2200	4298	6498	SO:0001819	synonymous_variant	9435	exon2			GTATAGCCCCGCG	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.705C>T	3.37:g.142840363C>T			Somatic	111	0	0		WXS	Illumina HiSeq	.	93	0.22	20	NM_004267	282	0.32	89	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Silent	SNP	ENST00000309575.3	37	CCDS3129.1																																																																																					0.652	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354850.1		NM_004267	
DCUN1D1	54165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	182665069	182665069	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:182665069G>T	ENST00000292782.4	-	6	810	c.657C>A	c.(655-657)ttC>ttA	p.F219L	DCUN1D1_ENST00000469954.1_Missense_Mutation_p.F204L	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	219	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					ubiquitin ligase complex (GO:0000151)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TCATCGTACTGAAGTCTAAAA	0.308																																					p.F219L													.	.			0			c.C657A												157.0	153.0	154.0					3																	182665069		2203	4297	6500	SO:0001583	missense	54165	exon6			CGTACTGAAGTCT	AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.657C>A	3.37:g.182665069G>T	ENSP00000292782:p.Phe219Leu		Somatic	82	0	0		WXS	Illumina HiSeq	.	184	0.10	18	NM_020640	272	0.12	33	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Missense_Mutation	SNP	ENST00000292782.4	37	CCDS3240.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314794	0.81358	.	.	ENSG00000043093	ENST00000292782;ENST00000458486;ENST00000469954	.	.	.	5.53	5.53	0.82687	Domain of unknown function DUF298 (2);	0.046406	0.85682	D	0.000000	T	0.81945	0.4930	M	0.90252	3.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84976	0.0885	9	0.66056	D	0.02	-12.7315	13.1928	0.59722	0.0824:0.0:0.9175:0.0	.	219	Q96GG9	DCNL1_HUMAN	L	219;179;204	.	ENSP00000292782:F219L	F	-	3	2	DCUN1D1	184147763	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.389000	0.59639	2.579000	0.87056	0.563000	0.77884	TTC			0.308	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350658.1		NM_020640	
MUC4	4585	broad.mit.edu	37	3	195505783	195505783	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:195505783G>A	ENST00000463781.3	-	2	13127	c.12668C>T	c.(12667-12669)aCc>aTc	p.T4223I	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4223I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	980					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGGGTGGCGTGACC	0.592																																					p.T4223I													MUC4_ENST00000463781,NS,neuroblastoma,+1,1	MUC4	1505	1	0			c.C12668T												30.0	31.0	30.0					3																	195505783		2090	4182	6272	SO:0001583	missense	4585	exon2			AGAGGGGTGGCGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12668C>T	3.37:g.195505783G>A	ENSP00000417498:p.Thr4223Ile		Somatic	121	0.0082644628	1		WXS	Illumina HiSeq	Phase_I	285	0.02	7	NM_018406	42	0.02	1	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.187	0.220066	0.09863	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.41;1.37	1.25	-0.806	0.10875	.	.	.	.	.	T	0.15565	0.0375	N	0.14661	0.345	0.09310	N	1	B	0.28324	0.207	B	0.17098	0.017	T	0.20605	-1.0270	8	.	.	.	.	3.9636	0.09421	0.477:0.0:0.523:0.0	.	4095	E7ESK3	.	I	4223	ENSP00000417498:T4223I;ENSP00000420243:T4223I	.	T	-	2	0	MUC4	196990562	0.013000	0.17824	0.000000	0.03702	0.000000	0.00434	0.360000	0.20250	-0.275000	0.09219	-0.441000	0.05720	ACC			0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MUC4	4585	bcgsc.ca;mdanderson.org	37	3	195506559	195506559	+	Silent	SNP	A	A	G	rs540229983	byFrequency	TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:195506559A>G	ENST00000463781.3	-	2	12351	c.11892T>C	c.(11890-11892)ggT>ggC	p.G3964G	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.G3964G	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGTGGCGTGACCTGTGGATA	0.592													.|||	8	0.00159744	0.0061	0.0	5008	,	,		8078	0.0		0.0	False		,,,				2504	0.0				p.G3964G													.	MUC4	1505		0			c.T11892C												16.0	10.0	12.0					3																	195506559		670	1499	2169	SO:0001819	synonymous_variant	4585	exon2			GGCGTGACCTGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11892T>C	3.37:g.195506559A>G			Somatic	112	0.0178571429	2		WXS	Illumina HiSeq	Phase_1	87	0.14	12	NM_018406	17	0.18	3	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																					0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195506626	195506626	+	Missense_Mutation	SNP	G	G	A	rs573187517	byFrequency	TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:195506626G>A	ENST00000463781.3	-	2	12284	c.11825C>T	c.(11824-11826)aCt>aTt	p.T3942I	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3942I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGTGCTGGTGAC	0.582													.|||	33	0.00658946	0.0091	0.0043	5008	,	,		10638	0.006		0.0099	False		,,,				2504	0.002				p.T3942I													MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4_ENST00000463781	-1	3	0			c.C11825T												16.0	15.0	15.0					3																	195506626		577	1241	1818	SO:0001583	missense	4585	exon2			GAGGAAGTGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11825C>T	3.37:g.195506626G>A	ENSP00000417498:p.Thr3942Ile		Somatic	190	0.0052631579	1		WXS	Illumina HiSeq	.	128	0.05	6	NM_018406	22	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	9.517	1.107233	0.20714	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.33;1.42	.	.	.	.	.	.	.	.	T	0.33904	0.0879	N	0.14661	0.345	0.22199	N	0.999291	D	0.65815	0.995	D	0.64595	0.927	T	0.17992	-1.0351	7	.	.	.	.	6.4784	0.22049	2.0E-4:0.0:0.9998:0.0	.	3814	E7ESK3	.	I	3942	ENSP00000417498:T3942I;ENSP00000420243:T3942I	.	T	-	2	0	MUC4	196991405	0.000000	0.05858	0.044000	0.18714	0.027000	0.11550	0.124000	0.15728	0.413000	0.25759	0.064000	0.15345	ACT			0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195506986	195506986	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:195506986G>C	ENST00000463781.3	-	2	11924	c.11465C>G	c.(11464-11466)aCc>aGc	p.T3822S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3822S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGAGGGGTGGTGTCACCTGT	0.587																																					p.T3822S													MUC4_ENST00000463781,extremity,malignant_melanoma,-1,2	MUC4_ENST00000463781	-1	2	0			c.C11465G												4.0	4.0	4.0					3																	195506986		477	1316	1793	SO:0001583	missense	4585	exon2			GGGGTGGTGTCAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11465C>G	3.37:g.195506986G>C	ENSP00000417498:p.Thr3822Ser		Somatic	62	0.0161290323	1		WXS	Illumina HiSeq	.	69	0.04	3	NM_018406	15	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.743	0.321585	0.10845	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31247	1.6;1.5	.	.	.	.	.	.	.	.	T	0.12774	0.0310	N	0.19112	0.55	0.09310	N	1	P	0.42584	0.784	B	0.28638	0.092	T	0.15954	-1.0419	7	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3694	E7ESK3	.	S	3822	ENSP00000417498:T3822S;ENSP00000420243:T3822S	.	T	-	2	0	MUC4	196991765	0.020000	0.18652	0.113000	0.21522	0.114000	0.19823	-0.601000	0.05687	0.064000	0.16427	0.064000	0.15345	ACC			0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MUC4	4585	broad.mit.edu	37	3	195509580	195509580	+	Missense_Mutation	SNP	G	G	C	rs370251272	byFrequency	TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:195509580G>C	ENST00000463781.3	-	2	9330	c.8871C>G	c.(8869-8871)caC>caG	p.H2957Q	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H2957Q	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGAGGTGGCGTGACCTGTGG	0.592													.|||	4	0.000798722	0.0023	0.0	5008	,	,		9445	0.0		0.0	False		,,,				2504	0.001				p.H2957Q													.	MUC4	1505		0			c.C8871G												9.0	8.0	8.0					3																	195509580		617	1456	2073	SO:0001583	missense	4585	exon2			GGTGGCGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8871C>G	3.37:g.195509580G>C	ENSP00000417498:p.His2957Gln		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	146	0.03	4	NM_018406	49	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.411	0.260921	0.10239	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29142	1.59;1.58	.	.	.	.	.	.	.	.	T	0.21062	0.0507	N	0.19112	0.55	0.09310	N	1	P	0.46142	0.873	P	0.45377	0.478	T	0.12066	-1.0562	7	.	.	.	.	7.5518	0.27802	0.0:0.0:1.0:0.0	.	2829	E7ESK3	.	Q	2957	ENSP00000417498:H2957Q;ENSP00000420243:H2957Q	.	H	-	3	2	MUC4	196994359	0.000000	0.05858	0.003000	0.11579	0.000000	0.00434	-0.286000	0.08399	0.482000	0.27582	0.000000	0.15137	CAC			0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MUC4	4585	bcgsc.ca	37	3	195510020	195510020	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:195510020T>A	ENST00000463781.3	-	2	8890	c.8431A>T	c.(8431-8433)Aca>Tca	p.T2811S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2811S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCGTGACCTGTGGACACTGAC	0.587																																					p.T2811S													.	MUC4	1505		0			c.A8431T												70.0	43.0	52.0					3																	195510020		685	1501	2186	SO:0001583	missense	4585	exon2			GACCTGTGGACAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8431A>T	3.37:g.195510020T>A	ENSP00000417498:p.Thr2811Ser		Somatic	115	0.0086956522	1		WXS	Illumina HiSeq	Phase_1	88	0.15	13	NM_018406	7	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.759	0.508816	0.12883	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.54;1.48	.	.	.	.	.	.	.	.	T	0.13329	0.0323	N	0.19112	0.55	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.14952	-1.0454	7	.	.	.	.	5.7459	0.18120	0.0:0.0:0.0:1.0	.	2683	E7ESK3	.	S	2811	ENSP00000417498:T2811S;ENSP00000420243:T2811S	.	T	-	1	0	MUC4	196994799	0.005000	0.15991	0.059000	0.19551	0.063000	0.16089	-0.513000	0.06305	0.357000	0.24183	0.000000	0.15137	ACA			0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
NRROS	375387	broad.mit.edu	37	3	196386681	196386681	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr3:196386681C>T	ENST00000328557.4	+	3	370	c.167C>T	c.(166-168)cCg>cTg	p.P56L		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	56					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AGCAGCCTCCCGCCCCACGCC	0.672																																					p.P56L													LRRC33,NS,carcinoma,-1,1	LRRC33	91	1	0			c.C167T												51.0	45.0	47.0					3																	196386681		2203	4299	6502	SO:0001583	missense	375387	exon3			GCCTCCCGCCCCA	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.167C>T	3.37:g.196386681C>T	ENSP00000328625:p.Pro56Leu		Somatic	227	0	0		WXS	Illumina HiSeq	Phase_I	427	0.02	7	NM_198565	47	0.00	0		Missense_Mutation	SNP	ENST00000328557.4	37	CCDS3319.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369565	0.42003	.	.	ENSG00000174004	ENST00000328557	T	0.58358	0.34	6.07	6.07	0.98685	.	0.110695	0.64402	D	0.000007	T	0.63450	0.2512	M	0.66939	2.045	0.80722	D	1	D	0.63046	0.992	P	0.53988	0.739	T	0.66296	-0.5959	10	0.87932	D	0	.	13.2539	0.60068	0.1252:0.7541:0.1207:0.0	.	56	Q86YC3	LRC33_HUMAN	L	56	ENSP00000328625:P56L	ENSP00000328625:P56L	P	+	2	0	LRRC33	197871078	0.458000	0.25760	0.981000	0.43875	0.696000	0.40369	1.969000	0.40510	2.884000	0.98904	0.655000	0.94253	CCG			0.672	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340676.1		NM_198565	
MEF2C	4208	broad.mit.edu	37	5	88024334	88024334	+	Missense_Mutation	SNP	G	G	T	rs17852408		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr5:88024334G>T	ENST00000437473.2	-	10	1493	c.1076C>A	c.(1075-1077)cCa>cAa	p.P359Q	MEF2C_ENST00000508569.1_Missense_Mutation_p.P351Q|MEF2C_ENST00000510942.1_Missense_Mutation_p.P351Q|MEF2C_ENST00000424173.2_Missense_Mutation_p.P349Q|MEF2C_ENST00000514015.1_Missense_Mutation_p.P359Q|MEF2C_ENST00000504921.2_Missense_Mutation_p.P359Q|MEF2C_ENST00000506554.1_Missense_Mutation_p.P359Q|MEF2C_ENST00000340208.5_Missense_Mutation_p.P369Q|MEF2C_ENST00000514028.1_Missense_Mutation_p.P359Q|MEF2C_ENST00000539796.1_Missense_Mutation_p.P303Q	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	359					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		GGCAGATGGTGGCATGTTATG	0.403										HNSCC(66;0.2)																											p.P369Q													.	MEF2C	184		0			c.C1106A												53.0	49.0	51.0					5																	88024334		1735	3711	5446	SO:0001583	missense	4208	exon11			GATGGTGGCATGT	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.1076C>A	5.37:g.88024334G>T	ENSP00000396219:p.Pro359Gln		Somatic	328	0	0		WXS	Illumina HiSeq	Phase_I	247	0.02	4	NM_001193347	1	0.00	0	C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	ENST00000437473.2	37	CCDS47245.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330221	0.41297	.	.	ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000506554;ENST00000508569;ENST00000514015;ENST00000539796	T;T;T;T;T;T;T;T;T;T	0.66815	0.29;0.3;0.3;0.3;0.3;0.29;-0.23;-0.02;-0.01;0.69	5.76	5.76	0.90799	.	0.099135	0.64402	D	0.000001	T	0.36496	0.0969	N	0.00436	-1.5	0.54753	D	0.999987	B;B;B;B	0.28584	0.0;0.216;0.003;0.203	B;B;B;B	0.27887	0.001;0.084;0.002;0.061	T	0.46428	-0.9192	10	0.21540	T	0.41	-5.1028	20.3431	0.98773	0.0:0.0:1.0:0.0	rs17852408	349;369;359;351	C9JMZ0;F8W7V7;Q06413;Q06413-2	.;.;MEF2C_HUMAN;.	Q	369;349;359;359;359;351;359;351;359;303	ENSP00000340874:P369Q;ENSP00000389610:P349Q;ENSP00000421925:P359Q;ENSP00000426665:P359Q;ENSP00000396219:P359Q;ENSP00000422390:P351Q;ENSP00000425636:P359Q;ENSP00000423597:P351Q;ENSP00000424606:P359Q;ENSP00000441153:P303Q	ENSP00000340874:P369Q	P	-	2	0	MEF2C	88060090	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.962000	0.76048	2.880000	0.98712	0.650000	0.86243	CCA			0.403	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000369817.1		NM_002397	
ANKHD1	54882	hgsc.bcm.edu	37	5	139887489	139887489	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr5:139887489G>T	ENST00000360839.2	+	20	3825	c.3671G>T	c.(3670-3672)cGg>cTg	p.R1224L	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.R1224L|ANKHD1_ENST00000297183.6_Missense_Mutation_p.R1224L	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1224						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGACCAATCGGAACACGGCT	0.483																																					p.R1224L													ANKHD1_ENST00000261805,colon,carcinoma,+1,3	ANKHD1_ENST00000261805	1	3	0			c.G3671T												101.0	93.0	96.0					5																	139887489		2203	4300	6503	SO:0001583	missense	54882	exon20			CCAATCGGAACAC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3671G>T	5.37:g.139887489G>T	ENSP00000354085:p.Arg1224Leu		Somatic	145	0	0		WXS	Illumina HiSeq	.	115	0.04	5	NM_017747	57	0.00	0	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.691716|5.691716	0.96793|0.96793	.|.	.|.	ENSG00000131503|ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000246149|ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000532219	.|T;T;T;T;T	.|0.15603	.|2.41;2.41;2.41;2.41;2.41	5.69|5.69	5.69|5.69	0.88448|0.88448	.|Ankyrin repeat-containing domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.39064	.|0.1064	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.76494	.|0.999;0.998;0.998;0.999;0.999	.|D;D;D;D;D	.|0.85130	.|0.993;0.989;0.96;0.997;0.997	.|T	.|0.02654	.|-1.1128	.|10	.|0.62326	.|D	.|0.03	.|.	20.2504|20.2504	0.98404|0.98404	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|435;1224;1243;1224;1224	.|E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3	.|.;.;.;.;ANKH1_HUMAN	X|L	450|1224;1257;1224;1224;758;435;1243;377;1224	.|ENSP00000354085:R1224L;ENSP00000297183:R1224L;ENSP00000394489:R1243L;ENSP00000405602:R377L;ENSP00000432016:R1224L	.|ENSP00000432016:R1224L	G|R	+|+	1|2	0|0	ANKHD1|ANKHD1-EIF4EBP3;ANKHD1	139867673|139867673	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.865000|9.865000	0.99609|0.99609	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	GGA|CGG			0.483	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000251672.1		NM_017747	
PCDHA6	56142	broad.mit.edu	37	5	140209500	140209500	+	Silent	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr5:140209500G>T	ENST00000529310.1	+	1	1938	c.1824G>T	c.(1822-1824)tcG>tcT	p.S608S	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	608	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S608S(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGCTTTCGTATGAGCTGC	0.657																																					p.S608S													PCDHA6_ENST00000529310,NS,carcinoma,+1,6	PCDHA6	442	6	2	Substitution - coding silent(2)	endometrium(2)	c.G1824T												81.0	82.0	82.0					5																	140209500		2203	4300	6503	SO:0001819	synonymous_variant	0	exon1			GCTTTCGTATGAG	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1824G>T	5.37:g.140209500G>T			Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_018909	0		0	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	CCDS47281.1																																																																																					0.657	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372829.3		NM_018909	
PTK7	5754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43100169	43100169	+	Silent	SNP	C	C	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr6:43100169C>T	ENST00000230419.4	+	7	1193	c.972C>T	c.(970-972)gaC>gaT	p.D324D	PTK7_ENST00000352931.2_Silent_p.D324D|PTK7_ENST00000481273.1_Silent_p.D332D|PTK7_ENST00000345201.2_Silent_p.D324D|PTK7_ENST00000349241.2_Silent_p.D324D|PTK7_ENST00000471863.1_Silent_p.D324D	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	324	Ig-like C2-type 4.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGATTGAAGACATGCCGCTAT	0.567																																					p.D332D													.	.			0			c.C996T												90.0	96.0	94.0					6																	43100169		2203	4300	6503	SO:0001819	synonymous_variant	5754	exon7			TGAAGACATGCCG	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.972C>T	6.37:g.43100169C>T			Somatic	123	0	0		WXS	Illumina HiSeq	.	128	0.21	27	NM_001270398	168	0.36	61	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Silent	SNP	ENST00000230419.4	37	CCDS4884.1																																																																																					0.567	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040580.2			
PHKG1	5260	mdanderson.org	37	7	56149324	56149324	+	Splice_Site	SNP	T	T	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr7:56149324T>A	ENST00000297373.2	-	9	1111	c.917A>T	c.(916-918)aAg>aTg	p.K306M	PHKG1_ENST00000489604.1_5'Flank|PHKG1_ENST00000452681.2_Splice_Site_p.K338M|PHKG1_ENST00000537360.1_Splice_Site_p.K252M	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	306	Calmodulin-binding (domain-N).				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCTTAGTACCTTGAACTTCCC	0.597																																					p.K338M	Melanoma(184;580 2064 5329 24177 35303)												.	.			0			c.A1013T												42.0	46.0	44.0					7																	56149324		2203	4300	6503	SO:0001630	splice_region_variant	5260	exon10			AGTACCTTGAACT	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.918+1A>T	7.37:g.56149324T>A			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_001258459	1	0.00	0	B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	ENST00000297373.2	37	CCDS5525.1	.	.	.	.	.	.	.	.	.	.	T	15.33	2.800684	0.50315	.	.	ENSG00000164776	ENST00000452681;ENST00000537360;ENST00000297373	T;T;T	0.32272	1.46;1.46;1.46	4.58	4.58	0.56647	Protein kinase-like domain (1);	0.087475	0.47852	D	0.000219	T	0.52435	0.1734	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.76494	0.998;0.996;0.999;0.994	D;D;D;P	0.64237	0.923;0.91;0.919;0.861	T	0.58763	-0.7579	10	0.87932	D	0	-22.8931	13.4537	0.61187	0.0:0.0:0.0:1.0	.	252;297;338;306	B7Z5U3;B7Z6U2;F5H2S1;Q16816	.;.;.;PHKG1_HUMAN	M	338;252;306	ENSP00000445440:K338M;ENSP00000441528:K252M;ENSP00000297373:K306M	ENSP00000297373:K306M	K	-	2	0	PHKG1	56116818	1.000000	0.71417	1.000000	0.80357	0.177000	0.22998	4.267000	0.58877	1.846000	0.53633	0.260000	0.18958	AAG			0.597	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251587.1		NM_006213	Missense_Mutation
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			Somatic	120	0.0083333333	1		WXS	Illumina HiSeq	Phase_I	178	0.03	6	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
FAM185A	222234	broad.mit.edu	37	7	102401776	102401776	+	Silent	SNP	T	T	G			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr7:102401776T>G	ENST00000413034.2	+	4	711	c.711T>G	c.(709-711)ggT>ggG	p.G237G	FAM185A_ENST00000481697.1_3'UTR|FAM185A_ENST00000409231.3_Silent_p.G120G	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	237										kidney(1)	1						CCGAAGATGGTTTGCTGAAAG	0.383																																					p.G237G													.	FAM185A	10		0			c.T711G												207.0	168.0	180.0					7																	102401776		692	1591	2283	SO:0001819	synonymous_variant	222234	exon4			AGATGGTTTGCTG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.711T>G	7.37:g.102401776T>G			Somatic	452	0	0		WXS	Illumina HiSeq	Phase_I	536	0.01	5	NM_001145268	21	0.00	0	A8MUR7|B4DQD3|C9IZ91	Silent	SNP	ENST00000413034.2	37	CCDS47676.1																																																																																					0.383	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349482.1		NM_001145268	
KIAA1549	57670	mdanderson.org	37	7	138555928	138555928	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr7:138555928G>T	ENST00000422774.1	-	13	4574	c.4526C>A	c.(4525-4527)gCg>gAg	p.A1509E	KIAA1549_ENST00000440172.1_Missense_Mutation_p.A1509E|KIAA1549_ENST00000242365.4_Missense_Mutation_p.A1459E			Q9HCM3	K1549_HUMAN	KIAA1549	1509						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						ATTGCTTTCCGCCACTCGGTC	0.547			O	BRAF	pilocytic astrocytoma																																p.A1509E	NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	.	.			0			c.C4526A												24.0	30.0	28.0					7																	138555928		1906	4108	6014	SO:0001583	missense	57670	exon13			CTTTCCGCCACTC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4526C>A	7.37:g.138555928G>T	ENSP00000416040:p.Ala1509Glu		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001164665	24	0.00	0	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248711	0.80024	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.25414	1.8;1.81;1.81	5.06	5.06	0.68205	.	0.113229	0.64402	D	0.000015	T	0.44074	0.1276	L	0.41236	1.265	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.85130	0.997;0.957;0.996;0.957	T	0.31392	-0.9945	10	0.62326	D	0.03	.	17.596	0.88012	0.0:0.0:1.0:0.0	.	1509;293;1509;293	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3	K1549_HUMAN;.;.;.	E	1509;1459;1509	ENSP00000406661:A1509E;ENSP00000242365:A1459E;ENSP00000416040:A1509E	ENSP00000242365:A1459E	A	-	2	0	KIAA1549	138206468	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	7.457000	0.80775	2.619000	0.88677	0.655000	0.94253	GCG			0.547	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000348092.1			
SSPO	23145	mdanderson.org	37	7	149500591	149500591	+	RNA	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr7:149500591G>T	ENST00000378016.2	+	0	7992							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCTCCTTCTGCATGACACTC	0.662																																					p.L2664L													.	.			0			c.G7992T												25.0	29.0	28.0					7																	149500591		2049	4191	6240			23145	exon54			CCTTCTGCATGAC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149500591G>T			Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	44	0.09	4	NM_198455	0		0	Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																						0.662	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
TUBBP1	92755	broad.mit.edu	37	8	30210434	30210434	+	RNA	SNP	A	A	C			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr8:30210434A>C	ENST00000518096.1	+	0	1046									tubulin, beta pseudogene 1																		GCTGCCTGTGACCCCCGCCAC	0.587																																					.													.	.			0			.																																											0	.			CCTGTGACCCCCG	J00317		8p12	2012-10-16	2005-11-15		ENSG00000127589	ENSG00000127589			12414	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 1"""			7070533	Standard	NG_001206		Approved				OTTHUMG00000163834		8.37:g.30210434A>C			Somatic	52	0.1153846154	6		WXS	Illumina HiSeq	Phase_I	44	0.20	9	.	5	0.20	1		RNA	SNP	ENST00000518096.1	37																																																																																						0.587	TUBBP1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000375880.1		NG_001206	
DENND3	22898	mdanderson.org	37	8	142200511	142200511	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr8:142200511G>T	ENST00000262585.2	+	20	3412	c.3134G>T	c.(3133-3135)tGg>tTg	p.W1045L	DENND3_ENST00000519811.1_Missense_Mutation_p.W1125L|DENND3_ENST00000424248.1_Missense_Mutation_p.W993L|DENND3_ENST00000523308.1_Missense_Mutation_p.W95L	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	1045					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCCGCCTGTGGTGCTGTAAG	0.617																																					p.W1045L													.	.			0			c.G3134T												32.0	32.0	32.0					8																	142200511		2202	4296	6498	SO:0001583	missense	22898	exon20			GCCTGTGGTGCTG	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.3134G>T	8.37:g.142200511G>T	ENSP00000262585:p.Trp1045Leu		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_014957	24	0.00	0	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064107	0.36373	.	.	ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811;ENST00000523308	T;T;T;T	0.29917	1.81;1.81;1.81;1.55	5.31	4.43	0.53597	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.236010	0.47093	D	0.000244	T	0.46308	0.1386	L	0.58669	1.825	0.45914	D	0.998758	P;D;B	0.61697	0.476;0.99;0.284	B;P;B	0.59546	0.085;0.859;0.059	T	0.40794	-0.9544	10	0.48119	T	0.1	-18.6785	13.2451	0.60018	0.0:0.0:0.7123:0.2877	.	1125;95;1045	E9PF32;A2RUS2-3;A2RUS2	.;.;DEND3_HUMAN	L	1045;993;1125;95	ENSP00000262585:W1045L;ENSP00000410594:W993L;ENSP00000428714:W1125L;ENSP00000430912:W95L	ENSP00000262585:W1045L	W	+	2	0	DENND3	142269693	1.000000	0.71417	0.993000	0.49108	0.272000	0.26649	5.570000	0.67398	1.206000	0.43276	0.313000	0.20887	TGG			0.617	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_014957	
ADCK5	203054	mdanderson.org	37	8	145616415	145616415	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr8:145616415G>T	ENST00000308860.6	+	6	669	c.625G>T	c.(625-627)Gcc>Tcc	p.A209S	CPSF1_ENST00000531727.1_5'Flank|ADCK5_ENST00000526231.2_3'UTR|MIR939_ENST00000401314.1_RNA	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	209	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			AATTGCTGCCGCCAGCCTGGC	0.612																																					p.A209S													.	.			0			c.G625T												58.0	59.0	59.0					8																	145616415		2203	4300	6503	SO:0001583	missense	203054	exon6			GCTGCCGCCAGCC	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.625G>T	8.37:g.145616415G>T	ENSP00000310547:p.Ala209Ser		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_174922	75	0.01	1	B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Missense_Mutation	SNP	ENST00000308860.6	37	CCDS34965.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688983	0.88735	.	.	ENSG00000173137	ENST00000308860	T	0.74421	-0.84	5.19	5.19	0.71726	ABC-1 (1);Protein kinase-like domain (1);	0.062767	0.64402	D	0.000007	D	0.91637	0.7357	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94502	0.7710	10	0.87932	D	0	-27.3753	14.196	0.65672	0.0:0.0:1.0:0.0	.	209	Q3MIX3	ADCK5_HUMAN	S	209	ENSP00000310547:A209S	ENSP00000310547:A209S	A	+	1	0	ADCK5	145587223	1.000000	0.71417	0.382000	0.26119	0.939000	0.58152	8.679000	0.91220	2.419000	0.82065	0.462000	0.41574	GCC			0.612	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382556.2		NM_174922	
ZNF462	58499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	109689998	109689998	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr9:109689998C>A	ENST00000277225.5	+	3	4094	c.3805C>A	c.(3805-3807)Cag>Aag	p.Q1269K	ZNF462_ENST00000457913.1_Missense_Mutation_p.Q1269K|ZNF462_ENST00000441147.2_Missense_Mutation_p.Q114K			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1269					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CAAATGTAGGCAGTGCTCATA	0.542																																					p.Q1269K													.	.			0			c.C3805A												188.0	192.0	191.0					9																	109689998		2203	4300	6503	SO:0001583	missense	58499	exon3			TGTAGGCAGTGCT	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3805C>A	9.37:g.109689998C>A	ENSP00000277225:p.Gln1269Lys		Somatic	60	0	0		WXS	Illumina HiSeq	.	80	0.71	57	NM_021224	3	1.00	3	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500489	0.85176	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.04970	3.52;3.95;4.08;4.09	5.35	4.44	0.53790	Zinc finger, C2H2-like (1);	0.108965	0.64402	D	0.000004	T	0.07548	0.0190	L	0.27053	0.805	0.80722	D	1	P;B	0.42941	0.794;0.089	B;B	0.42995	0.404;0.06	T	0.21586	-1.0241	10	0.62326	D	0.03	.	15.3533	0.74405	0.1408:0.8592:0.0:0.0	.	1269;1269	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	K	1269;1269;152;114	ENSP00000277225:Q1269K;ENSP00000414570:Q1269K;ENSP00000363818:Q152K;ENSP00000397306:Q114K	ENSP00000277225:Q1269K	Q	+	1	0	ZNF462	108729819	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.383000	0.79741	1.224000	0.43551	0.555000	0.69702	CAG			0.542	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000053532.2		NM_021224	
TMEM245	23731	mdanderson.org	37	9	111881924	111881924	+	Silent	SNP	G	G	A			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr9:111881924G>A	ENST00000374586.3	-	1	301	c.270C>T	c.(268-270)tgC>tgT	p.C90C		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	90						integral component of membrane (GO:0016021)											GAAAAGTGCCGCATAGCACGG	0.711																																					p.C90C													.	.			0			c.C270T												12.0	21.0	18.0					9																	111881924		2043	4167	6210	SO:0001819	synonymous_variant	23731	exon1			AGTGCCGCATAGC	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.270C>T	9.37:g.111881924G>A			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_032012	17	0.00	0	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Silent	SNP	ENST00000374586.3	37	CCDS43858.1																																																																																					0.711	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053587.2		NM_032012	
C9orf171	389799	broad.mit.edu	37	9	135447890	135447890	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr9:135447890A>C	ENST00000343036.2	+	7	1004	c.956A>C	c.(955-957)cAc>cCc	p.H319P	C9orf171_ENST00000393216.2_Missense_Mutation_p.H283P	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	319										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						AACTACACCCACCCCTAGCCC	0.597																																					p.H319P													C9orf171,right_upper_lobe,carcinoma,0,1	C9orf171	53	1	0			c.A956C																																									SO:0001583	missense	389799	exon7			ACACCCACCCCTA	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.956A>C	9.37:g.135447890A>C	ENSP00000343290:p.His319Pro		Somatic	32	0.1875	6		WXS	Illumina HiSeq	Phase_I	47	0.26	12	NM_207417	0		0	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	A	16.67	3.187873	0.57909	.	.	ENSG00000188523	ENST00000343036;ENST00000393216	T;T	0.24538	1.87;1.85	5.4	4.19	0.49359	.	0.558849	0.17096	N	0.187177	T	0.27967	0.0689	N	0.19112	0.55	0.27154	N	0.961336	D;D	0.64830	0.962;0.994	P;P	0.59889	0.605;0.865	T	0.03910	-1.0993	10	0.42905	T	0.14	.	8.7175	0.34421	0.808:0.192:0.0:0.0	.	283;319	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	P	319;283	ENSP00000343290:H319P;ENSP00000376909:H283P	ENSP00000343290:H319P	H	+	2	0	C9orf171	134437711	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	2.954000	0.49113	2.060000	0.61445	0.363000	0.22086	CAC			0.597	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254589.1		NM_207417	
SLC34A3	142680	mdanderson.org	37	9	140128920	140128920	+	Silent	SNP	C	C	A	rs565479962		TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chr9:140128920C>A	ENST00000538474.1	+	11	1370	c.1146C>A	c.(1144-1146)ggC>ggA	p.G382G	SLC34A3_ENST00000361134.2_Silent_p.G382G	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	382					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		TCCTCGCGGGCGCCGGCCTGA	0.731																																					p.G382G													.	.			0			c.C1146A												9.0	11.0	10.0					9																	140128920		2137	4217	6354	SO:0001819	synonymous_variant	142680	exon11			CGCGGGCGCCGGC	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.1146C>A	9.37:g.140128920C>A			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_080877	1	0.00	0	A2BFA1	Silent	SNP	ENST00000538474.1	37	CCDS7038.1																																																																																					0.731	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254712.1		NM_080877	
SSX6	280657	hgsc.bcm.edu	37	X	47969832	47969832	+	IGR	SNP	T	T	G			TCGA-XE-AANJ-01A-11D-A435-10	TCGA-XE-AANJ-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a43cd317-9fe6-401e-971c-f82498898d79	c84ec2ea-8d3d-4b69-a6eb-e4d3ac9e0e18	g.chrX:47969832T>G								snoU13 (28593 upstream) : SSX6 (6633 downstream)																							CATGCCTAGTTGAGTCACTGC	0.458																																					.													.	.			0			.												53.0	46.0	48.0					X																	47969832		2192	4290	6482	SO:0001628	intergenic_variant	280657	.			CCTAGTTGAGTCA																													X.37:g.47969832T>G			Somatic	224	0	0		WXS	Illumina HiSeq	.	233	0.09	21	.	0		0		RNA	SNP		37																																																																																					0	0.458										
