#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PUM1	9698	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	31441219	31441219	+	Silent	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:31441219G>A	ENST00000257075.5	-	11	1720	c.1627C>T	c.(1627-1629)Ctg>Ttg	p.L543L	PUM1_ENST00000490546.1_5'UTR|PUM1_ENST00000373741.4_Silent_p.L579L|PUM1_ENST00000373747.3_Silent_p.L544L|PUM1_ENST00000426105.2_Silent_p.L543L|PUM1_ENST00000440538.2_Silent_p.L544L|PUM1_ENST00000423018.2_Silent_p.L447L|PUM1_ENST00000424085.2_Silent_p.L301L|PUM1_ENST00000373742.2_Silent_p.L484L|SNORD85_ENST00000363311.1_RNA	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	543	Ala-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		CCTGCTGCCAGACCTTGTCCA	0.532																																					p.L543L													.	PUM1	107		0			c.C1627T												88.0	79.0	82.0					1																	31441219		2203	4300	6503	SO:0001819	synonymous_variant	9698	exon11			CTGCCAGACCTTG	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1627C>T	1.37:g.31441219G>A			Somatic	129	0.007751938	1		WXS	Illumina HiSeq	Phase_I	95	0.14	13	NM_014676	8	0.38	3	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Silent	SNP	ENST00000257075.5	37	CCDS338.1	.	.	.	.	.	.	.	.	.	.	G	9.161	1.018706	0.19355	.	.	ENSG00000134644	ENST00000525843;ENST00000498419;ENST00000532678	.	.	.	5.87	3.96	0.45880	.	.	.	.	.	T	0.63663	0.2530	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62849	-0.6767	4	.	.	.	-5.7998	12.7267	0.57174	0.1412:0.0:0.8588:0.0	.	.	.	.	F	560;254;230	.	.	S	-	2	0	PUM1	31213806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.765000	0.55272	1.598000	0.50083	0.655000	0.94253	TCT			0.532	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000010671.1			
NOTCH2	4853	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	120468323	120468323	+	Silent	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:120468323C>T	ENST00000256646.2	-	25	4335	c.4116G>A	c.(4114-4116)cgG>cgA	p.R1372R	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1372					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACTCGCAGTCCCGGGGACTGG	0.652			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.R1372R				Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348		0			c.G4116A												24.0	24.0	24.0					1																	120468323		2202	4294	6496	SO:0001819	synonymous_variant	4853	exon25	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GCAGTCCCGGGGA	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.4116G>A	1.37:g.120468323C>T			Somatic	149	0.0067114094	1		WXS	Illumina HiSeq	Phase_I	126	0.20	25	NM_024408	3	0.00	0	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1																																																																																					0.652	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033679.1		NM_024408	
RP11-782C8.2	0	broad.mit.edu	37	1	143195473	143195473	+	lincRNA	DEL	A	A	-	rs201120234		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:143195473delA	ENST00000412204.2	-	0	2287				RP11-782C8.1_ENST00000438000.1_lincRNA																							ATACAAAAGCAAAAAAAAAAA	0.244																																					.													.	.			0			.																																											0	.			AAAAGCAAAAAAA																													1.37:g.143195473delA			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	10	0.30	3	.	1	0.00	0		RNA	DEL	ENST00000412204.2	37																																																																																						0.244	RP11-782C8.2-004	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000037567.2			
MRPL9	65005	broad.mit.edu	37	1	151735988	151735988	+	5'UTR	SNP	A	A	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:151735988A>C	ENST00000368830.3	-	0	52				OAZ3_ENST00000453029.2_Silent_p.G6G|OAZ3_ENST00000315067.8_Intron|OAZ3_ENST00000479764.1_5'Flank|RP11-98D18.2_ENST00000420382.1_RNA|OAZ3_ENST00000321531.5_Intron|RP11-98D18.16_ENST00000596133.1_RNA|MRPL9_ENST00000368829.3_5'Flank|MRPL9_ENST00000467306.1_5'Flank|RP11-98D18.3_ENST00000512280.1_RNA	NM_031420.2	NP_113608.1	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTGAGGGAGGACCCCGGCGTC	0.716																																					.													.	MRPL9	21		0			.												3.0	4.0	4.0					1																	151735988		2019	4081	6100	SO:0001623	5_prime_UTR_variant	51686	.			GGGAGGACCCCGG	AK026363	CCDS1003.1, CCDS72916.1	1q21	2012-09-13			ENSG00000143436	ENSG00000143436		"""Mitochondrial ribosomal proteins / large subunits"""	14277	protein-coding gene	gene with protein product		611824					Standard	XM_005245455		Approved		uc001eyv.3	Q9BYD2	OTTHUMG00000013063	ENST00000368830.3:c.-33T>G	1.37:g.151735988A>C			Somatic	82	0.1951219512	16		WXS	Illumina HiSeq	Phase_I	58	0.31	18	.	1	0.00	0	B2RD99|Q5SZR2|Q9BSW8	Silent	SNP	ENST00000368830.3	37	CCDS1003.1																																																																																					0.716	MRPL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036653.2		NM_031420	
NME7	29922	broad.mit.edu	37	1	169272390	169272390	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:169272390A>G	ENST00000367811.3	-	5	689	c.433T>C	c.(433-435)Ttt>Ctt	p.F145L	NME7_ENST00000469474.1_5'UTR|NME7_ENST00000472647.1_Missense_Mutation_p.F109L	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	145					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TACTTGAAAAAGGGTCTTGAC	0.284																																					p.F145L													NME7,NS,carcinoma,0,1	NME7	34	1	0			c.T433C												59.0	57.0	58.0					1																	169272390		2203	4295	6498	SO:0001583	missense	29922	exon5			TGAAAAAGGGTCT	AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.433T>C	1.37:g.169272390A>G	ENSP00000356785:p.Phe145Leu		Somatic	474	0	0		WXS	Illumina HiSeq	Phase_I	522	0.01	6	NM_013330	19	0.00	0	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	ENST00000367811.3	37	CCDS1277.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.112865	0.37242	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.79940	-1.32;-1.32	5.24	4.08	0.47627	.	0.106414	0.64402	D	0.000004	T	0.77198	0.4095	H	0.94808	3.585	0.52501	D	0.999950	B;B	0.21381	0.051;0.055	B;B	0.30029	0.068;0.11	T	0.72577	-0.4251	9	0.27082	T	0.32	-12.4035	9.8643	0.41134	0.8277:0.1723:0.0:0.0	.	149;145	Q59GR0;Q9Y5B8	.;NDK7_HUMAN	L	109;145	ENSP00000433341:F109L;ENSP00000356785:F145L	ENSP00000356785:F145L	F	-	1	0	NME7	167539014	1.000000	0.71417	0.893000	0.35052	0.314000	0.28054	6.072000	0.71238	0.792000	0.33850	0.377000	0.23210	TTT			0.284	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083688.1		NM_013330	
FMOD	2331	broad.mit.edu	37	1	203317121	203317121	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:203317121T>C	ENST00000354955.4	-	2	741	c.278A>G	c.(277-279)gAc>gGc	p.D93G	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	93	LRRNT.				carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			GTTGCGATTGTCACAGTACAT	0.592																																					p.D93G													.	FMOD	49		0			c.A278G												82.0	71.0	75.0					1																	203317121		2203	4300	6503	SO:0001583	missense	2331	exon2			CGATTGTCACAGT	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.278A>G	1.37:g.203317121T>C	ENSP00000347041:p.Asp93Gly		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	133	0.02	3	NM_002023	5	0.00	0	Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	37	CCDS30976.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472280	0.84533	.	.	ENSG00000122176	ENST00000354955;ENST00000539467	D	0.97041	-4.22	5.16	5.16	0.70880	Leucine-rich repeat-containing N-terminal (2);	0.108034	0.64402	D	0.000007	D	0.97854	0.9295	M	0.77616	2.38	0.54753	D	0.999984	D	0.57571	0.98	P	0.59487	0.858	D	0.98442	1.0587	10	0.72032	D	0.01	.	13.8362	0.63410	0.0:0.0:0.0:1.0	.	93	Q06828	FMOD_HUMAN	G	93;73	ENSP00000347041:D93G	ENSP00000347041:D93G	D	-	2	0	FMOD	201583744	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	1.943000	0.56356	0.460000	0.39030	GAC			0.592	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087472.1		NM_002023	
IKBKE	9641	mdanderson.org	37	1	206651589	206651589	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:206651589C>T	ENST00000367120.3	+	9	1272	c.899C>T	c.(898-900)gCg>gTg	p.A300V	IKBKE_ENST00000537984.1_Missense_Mutation_p.A215V	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					CAGTTCTTTGCGGAGACCAGT	0.602																																					p.A300V													.	.			0			c.C899T												164.0	135.0	144.0					1																	206651589		2203	4300	6503	SO:0001583	missense	9641	exon9			TCTTTGCGGAGAC	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.899C>T	1.37:g.206651589C>T	ENSP00000356087:p.Ala300Val		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_014002	11	0.00	0	D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	ENST00000367120.3	37	CCDS30996.1	.	.	.	.	.	.	.	.	.	.	c	26.4	4.738215	0.89573	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	T;T	0.44482	0.92;1.77	5.31	5.31	0.75309	Protein kinase, catalytic domain (1);	0.168613	0.52532	D	0.000075	T	0.59004	0.2162	L	0.53249	1.67	0.32745	N	0.507121	D;D	0.76494	0.999;0.997	D;P	0.63793	0.918;0.851	T	0.64101	-0.6486	10	0.37606	T	0.19	-5.4135	18.9825	0.92760	0.0:1.0:0.0:0.0	.	215;300	Q3B754;Q14164	.;IKKE_HUMAN	V	300;215	ENSP00000356087:A300V;ENSP00000444529:A215V	ENSP00000356087:A300V	A	+	2	0	IKBKE	204718212	0.998000	0.40836	0.997000	0.53966	0.992000	0.81027	3.904000	0.56325	2.496000	0.84212	0.556000	0.70494	GCG			0.602	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088484.1			
CR1	1378	broad.mit.edu	37	1	207751172	207751172	+	Silent	SNP	A	A	C	rs373191459	byFrequency	TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:207751172A>C	ENST00000367049.4	+	29	4560	c.4560A>C	c.(4558-4560)ccA>ccC	p.P1520P	CR1_ENST00000367051.1_Silent_p.P1070P|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000400960.2_Silent_p.P1070P|CR1_ENST00000367052.1_Silent_p.P1070P|CR1_ENST00000367053.1_Silent_p.P1070P|RP11-78B10.2_ENST00000597497.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1070	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GGCTACCCCCAACCATCGCCA	0.493													A|||	4	0.000798722	0.003	0.0	5008	,	,		19901	0.0		0.0	False		,,,				2504	0.0				p.P1520P													CR1_ENST00000367049,NS,carcinoma,+2,2	CR1	354	2	0			c.A4560C							A	,	5,3751		0,5,1873	117.0	104.0	108.0		3210,4560	-4.7	0.0	1		108	0,8230		0,0,4115	no	coding-synonymous,coding-synonymous	CR1	NM_000573.3,NM_000651.4	,	0,5,5988	CC,CA,AA		0.0,0.1331,0.0417	,	1070/2040,1520/2490	207751172	5,11981	1878	4115	5993	SO:0001819	synonymous_variant	1378	exon29			ACCCCCAACCATC	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4560A>C	1.37:g.207751172A>C			Somatic	526	0	0		WXS	Illumina HiSeq	Phase_I	487	0.01	4	NM_000651	0		0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	37	CCDS44308.1																																																																																					0.493	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382527.1		NM_000573	
NVL	4931	hgsc.bcm.edu	37	1	224514122	224514122	+	Silent	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:224514122G>T	ENST00000281701.6	-	2	361	c.102C>A	c.(100-102)gtC>gtA	p.V34V	NVL_ENST00000482491.1_Intron|NVL_ENST00000391875.2_Intron|NVL_ENST00000361463.3_Intron|NVL_ENST00000340871.4_Intron|NVL_ENST00000468673.1_5'UTR|NVL_ENST00000469075.1_Silent_p.V34V	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	34						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		CAGACGCTAAGACTCCAATGT	0.318																																					p.V34V													.	.			0			c.C102A												101.0	103.0	102.0					1																	224514122		2203	4300	6503	SO:0001819	synonymous_variant	4931	exon2			CGCTAAGACTCCA	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.102C>A	1.37:g.224514122G>T			Somatic	125	0	0		WXS	Illumina HiSeq	.	94	0.05	5	NM_001243147	7	0.00	0	B4DMC4|B4DP98|Q96EM7	Silent	SNP	ENST00000281701.6	37	CCDS1541.1																																																																																					0.318	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000091453.2		NM_002533	
OBSCN	84033	broad.mit.edu;mdanderson.org	37	1	228505368	228505368	+	Missense_Mutation	SNP	G	G	C	rs532516650		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:228505368G>C	ENST00000422127.1	+	52	13809	c.13765G>C	c.(13765-13767)Ggg>Cgg	p.G4589R	OBSCN_ENST00000284548.11_Missense_Mutation_p.G4589R|OBSCN_ENST00000570156.2_Missense_Mutation_p.G5546R|OBSCN_ENST00000366709.4_Missense_Mutation_p.G1708R|OBSCN_ENST00000366707.4_Missense_Mutation_p.G2223R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4589	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCTGGCCCCCGGGGAGACCTA	0.677																																					p.G5546R													.	OBSCN	2142		0			c.G16636C												35.0	43.0	40.0					1																	228505368		2071	4192	6263	SO:0001583	missense	84033	exon63			GCCCCCGGGGAGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13765G>C	1.37:g.228505368G>C	ENSP00000409493:p.Gly4589Arg		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	54	0.07	4	NM_001271223	1	0.00	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	g	34	5.331125	0.95733	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	4.51	4.51	0.55191	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.82815	0.5119	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.84609	0.0677	10	0.35671	T	0.21	.	17.4347	0.87548	0.0:0.0:1.0:0.0	.	4589;4589	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	R	4589;4589;2223;1708	ENSP00000284548:G4589R;ENSP00000409493:G4589R;ENSP00000355668:G2223R;ENSP00000355670:G1708R	ENSP00000284548:G4589R	G	+	1	0	OBSCN	226571991	1.000000	0.71417	0.970000	0.41538	0.934000	0.57294	9.176000	0.94839	2.368000	0.80403	0.479000	0.44913	GGG			0.677	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
FMN2	56776	mdanderson.org	37	1	240256211	240256211	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr1:240256211G>T	ENST00000319653.9	+	1	1032	c.802G>T	c.(802-804)Gac>Tac	p.D268Y		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	268					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGCAGTCCGGACACCGAGCA	0.796																																					p.D268Y													.	.			0			c.G802T												1.0	2.0	2.0					1																	240256211		1148	2701	3849	SO:0001583	missense	56776	exon1			AGTCCGGACACCG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.802G>T	1.37:g.240256211G>T	ENSP00000318884:p.Asp268Tyr		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	9	0.22	2	NM_020066	6	0.33	2	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	3.002	-0.205867	0.06180	.	.	ENSG00000155816	ENST00000319653	T	0.39997	1.05	4.27	3.35	0.38373	.	0.327052	0.26404	N	0.024572	T	0.44829	0.1312	L	0.47716	1.5	0.27735	N	0.944661	D	0.56521	0.976	P	0.53809	0.735	T	0.36163	-0.9759	10	0.87932	D	0	.	7.6757	0.28484	0.1992:0.0:0.8007:0.0	.	268	Q9NZ56	FMN2_HUMAN	Y	268	ENSP00000318884:D268Y	ENSP00000318884:D268Y	D	+	1	0	FMN2	238322834	0.003000	0.15002	0.105000	0.21289	0.124000	0.20399	0.820000	0.27323	0.912000	0.36772	0.462000	0.41574	GAC			0.796	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
PRKCDBP	112464	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	6340567	6340567	+	Silent	SNP	G	G	T	rs144522181		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr11:6340567G>T	ENST00000303927.3	-	2	782	c.612C>A	c.(610-612)ccC>ccA	p.P204P	PRKCDBP_ENST00000530979.1_Silent_p.P236P	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	204					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGACCGGGGTGGGCGGTGGCG	0.731																																					p.P204P													.	PRKCDBP	19		0			c.C612A												23.0	31.0	28.0					11																	6340567		2188	4288	6476	SO:0001819	synonymous_variant	112464	exon2			CGGGGTGGGCGGT	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.612C>A	11.37:g.6340567G>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	46	0.11	5	NM_145040	38	0.00	0		Silent	SNP	ENST00000303927.3	37	CCDS7762.1																																																																																					0.731	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257228.2		NM_145040	
MRPL17	63875	mdanderson.org	37	11	6703420	6703420	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr11:6703420G>A	ENST00000288937.6	-	3	561	c.457C>T	c.(457-459)Cgg>Tgg	p.R153W	MRPL17_ENST00000532676.1_5'UTR	NM_022061.3	NP_071344.1	Q9NRX2	RM17_HUMAN	mitochondrial ribosomal protein L17	153					translation (GO:0006412)	mitochondrial inner membrane (GO:0005743)|ribosome (GO:0005840)	protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)			lung(4)	4		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGGTCCTGCCGCAAACCCTGC	0.547																																					p.R153W													.	.			0			c.C457T												101.0	90.0	94.0					11																	6703420		2201	4296	6497	SO:0001583	missense	63875	exon3			CCTGCCGCAAACC	AB051620	CCDS31412.1	11p15.5-p15.4	2012-09-13				ENSG00000158042		"""Mitochondrial ribosomal proteins / large subunits"""	14053	protein-coding gene	gene with protein product		611830					Standard	NM_022061		Approved	RPML26, MRP-L26	uc001men.2	Q9NRX2		ENST00000288937.6:c.457C>T	11.37:g.6703420G>A	ENSP00000288937:p.Arg153Trp		Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	132	0.04	5	NM_022061	855	0.00	2	D3DQU3|Q6IAH8|Q96Q53|Q9C066	Missense_Mutation	SNP	ENST00000288937.6	37	CCDS31412.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787446	0.49997	.	.	ENSG00000158042	ENST00000288937;ENST00000532203	.	.	.	5.87	3.04	0.35103	.	0.470066	0.23461	N	0.047936	T	0.39517	0.1081	L	0.34521	1.04	0.33384	D	0.575208	B	0.14012	0.009	B	0.06405	0.002	T	0.44205	-0.9343	9	0.56958	D	0.05	-1.291	9.3253	0.37988	0.2309:0.0:0.7691:0.0	.	153	Q9NRX2	RM17_HUMAN	W	153;130	.	ENSP00000288937:R153W	R	-	1	2	MRPL17	6659996	0.974000	0.33945	0.022000	0.16811	0.161000	0.22273	1.584000	0.36589	0.415000	0.25817	-0.142000	0.14014	CGG			0.547	MRPL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384544.1		NM_022061	
KDM2A	22992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	66948811	66948811	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr11:66948811C>T	ENST00000529006.2	+	4	648	c.202C>T	c.(202-204)Cag>Tag	p.Q68*	KDM2A_ENST00000398645.2_Nonsense_Mutation_p.Q68*	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	68					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						AGAGTATATTCAGCGGGGTGG	0.363																																					p.Q68X													.	.			0			c.C202T												67.0	61.0	63.0					11																	66948811		1820	4075	5895	SO:0001587	stop_gained	22992	exon4			TATATTCAGCGGG	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.202C>T	11.37:g.66948811C>T	ENSP00000432786:p.Gln68*		Somatic	143	0	0		WXS	Illumina HiSeq	.	99	0.19	19	NM_012308	5	0.20	1	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Nonsense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	C	42	9.750315	0.99255	.	.	ENSG00000173120	ENST00000398645;ENST00000529006	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-18.8704	16.3189	0.82938	0.0:1.0:0.0:0.0	.	.	.	.	X	68	.	ENSP00000381640:Q68X	Q	+	1	0	KDM2A	66705387	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.644000	0.61397	2.715000	0.92844	0.655000	0.94253	CAG			0.363	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393140.2		NM_012308	
MRGPRF	116535	mdanderson.org	37	11	68772840	68772840	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr11:68772840G>T	ENST00000309099.6	-	3	1320	c.938C>A	c.(937-939)gCc>gAc	p.A313D	MRGPRF_ENST00000441623.1_Missense_Mutation_p.A313D|RP11-554A11.5_ENST00000562506.1_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	313						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GTCCCGCAGGGCCCGCTGGAA	0.682																																					p.A313D													.	.			0			c.C938A												13.0	11.0	12.0					11																	68772840		2175	4264	6439	SO:0001583	missense	116535	exon3			CGCAGGGCCCGCT	AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.938C>A	11.37:g.68772840G>T	ENSP00000309782:p.Ala313Asp		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_001098515	2	0.00	0	B3KV43|Q8NBK8	Missense_Mutation	SNP	ENST00000309099.6	37	CCDS8188.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991230	0.74703	.	.	ENSG00000172935	ENST00000441623;ENST00000309099;ENST00000421543	T;T	0.37584	1.19;1.19	5.07	4.15	0.48705	.	0.000000	0.41097	D	0.000957	T	0.56247	0.1972	M	0.81112	2.525	0.36911	D	0.890893	D	0.76494	0.999	D	0.66716	0.946	T	0.66139	-0.5998	10	0.87932	D	0	-31.1167	8.4713	0.32986	0.1037:0.0:0.8963:0.0	.	313	Q96AM1	MRGRF_HUMAN	D	313;313;285	ENSP00000403660:A313D;ENSP00000309782:A313D	ENSP00000309782:A313D	A	-	2	0	MRGPRF	68529416	0.216000	0.23585	1.000000	0.80357	0.990000	0.78478	1.107000	0.31110	2.339000	0.79563	0.561000	0.74099	GCC			0.682	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396875.1		NM_145015	
LOC728715	728715	bcgsc.ca	37	12	9659703	9659703	+	IGR	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr12:9659703T>C								SNORA75 (61902 upstream) : AC006432.1 (39860 downstream)																							CTTTTCCTTATAAGTACTAAA	0.348																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TCCTTATAAGTAC																													12.37:g.9659703T>C			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_1	73	0.16	12	.	0		0		RNA	SNP		37																																																																																					0	0.348										
TAS2R31	259290	hgsc.bcm.edu	37	12	11182975	11182975	+	IGR	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr12:11182975T>C	ENST00000390675.2	-	0	1021				TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						TGTTTTCTGCTAGAAGACACA	0.383																																					.													.	.			0			.												110.0	115.0	113.0					12																	11182975		1915	4145	6060	SO:0001628	intergenic_variant	0	.			TTCTGCTAGAAGA	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538			12.37:g.11182975T>C			Somatic	270	0	0		WXS	Illumina HiSeq	.	306	0.10	32	.	2	0.00	0	P59547|Q17R84|Q645X5	RNA	SNP	ENST00000390675.2	37	CCDS53747.1																																																																																					0.383	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400233.1		NM_176885	
GPR19	2842	broad.mit.edu	37	12	12815307	12815307	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr12:12815307G>T	ENST00000540510.1	-	2	268	c.76C>A	c.(76-78)Cgc>Agc	p.R26S	GPR19_ENST00000332427.2_Missense_Mutation_p.R26S			P46093	GPR4_HUMAN	G protein-coupled receptor 19	0					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		GTGCAGCTGCGGTTTTGGAGG	0.438																																					p.R26S													GPR19,NS,carcinoma,+1,1	GPR19	47	1	0			c.C76A												121.0	112.0	115.0					12																	12815307		2203	4300	6503	SO:0001583	missense	2842	exon4			AGCTGCGGTTTTG		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.76C>A	12.37:g.12815307G>T	ENSP00000441832:p.Arg26Ser		Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	201	0.02	4	NM_006143	6	0.00	0	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000540510.1	37	CCDS8652.1	.	.	.	.	.	.	.	.	.	.	G	1.679	-0.506920	0.04231	.	.	ENSG00000183150	ENST00000540510;ENST00000332427;ENST00000540796	T;T	0.67171	-0.25;-0.25	5.43	1.2	0.21068	.	1.034790	0.07641	N	0.930305	T	0.39733	0.1089	N	0.08118	0	0.22435	N	0.999106	B	0.02656	0.0	B	0.01281	0.0	T	0.25293	-1.0136	10	0.09338	T	0.73	-4.7099	5.0312	0.14411	0.0761:0.1009:0.4713:0.3517	.	26	Q15760	GPR19_HUMAN	S	26	ENSP00000441832:R26S;ENSP00000333744:R26S	ENSP00000333744:R26S	R	-	1	0	GPR19	12706574	0.987000	0.35691	0.993000	0.49108	0.249000	0.25844	0.228000	0.17814	0.403000	0.25479	0.655000	0.94253	CGC			0.438	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400662.1		NM_006143	
PTPRO	5800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	15722430	15722430	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr12:15722430G>C	ENST00000281171.4	+	19	3157	c.2827G>C	c.(2827-2829)Gag>Cag	p.E943Q	PTPRO_ENST00000445537.2_Missense_Mutation_p.E132Q|PTPRO_ENST00000544244.1_Missense_Mutation_p.E104Q|PTPRO_ENST00000348962.2_Missense_Mutation_p.E915Q|PTPRO_ENST00000442921.2_Missense_Mutation_p.E132Q|PTPRO_ENST00000542557.1_Missense_Mutation_p.E104Q	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	943	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TCTTCAGTTTGAGGTGAGTTG	0.448																																					p.E943Q													.	.			0			c.G2827C												185.0	185.0	185.0					12																	15722430		2203	4300	6503	SO:0001583	missense	5800	exon19			CAGTTTGAGGTGA	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.2827G>C	12.37:g.15722430G>C	ENSP00000281171:p.Glu943Gln		Somatic	1236	0.0008090615	1		WXS	Illumina HiSeq	.	1415	0.10	137	NM_030667	0		0	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207877	0.79240	.	.	ENSG00000151490	ENST00000281171;ENST00000348962;ENST00000442921;ENST00000542557;ENST00000445537;ENST00000544244	T;T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72;2.72	4.75	4.75	0.60458	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.46758	D	0.000268	T	0.29288	0.0729	L	0.37630	1.12	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.79784	0.915;0.993;0.988	T	0.02202	-1.1196	10	0.59425	D	0.04	.	17.9475	0.89043	0.0:0.0:1.0:0.0	.	104;915;943	Q9UBT5;Q16827-2;Q16827	.;.;PTPRO_HUMAN	Q	943;915;132;104;132;104	ENSP00000281171:E943Q;ENSP00000343434:E915Q;ENSP00000404188:E132Q;ENSP00000437571:E104Q;ENSP00000393449:E132Q;ENSP00000439234:E104Q	ENSP00000281171:E943Q	E	+	1	0	PTPRO	15613697	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.613000	0.90913	2.482000	0.83794	0.563000	0.77884	GAG			0.448	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401079.1			
SOCS2	8835	mdanderson.org	37	12	93966744	93966744	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr12:93966744G>T	ENST00000340600.2	+	2	669	c.71G>T	c.(70-72)gGg>gTg	p.G24V	SOCS2_ENST00000548537.1_Missense_Mutation_p.G24V|SOCS2_ENST00000549122.1_Missense_Mutation_p.G24V|SOCS2-AS1_ENST00000551626.1_RNA|SOCS2-AS1_ENST00000500986.1_RNA|SOCS2-AS1_ENST00000499137.2_RNA|SOCS2_ENST00000551556.1_Missense_Mutation_p.G24V|SOCS2_ENST00000549206.1_Missense_Mutation_p.G24V|SOCS2_ENST00000536696.2_Missense_Mutation_p.G24V	NM_001270468.1|NM_001270469.1|NM_001270471.1|NM_003877.4	NP_001257397.1|NP_001257398.1|NP_001257400.1|NP_003868.1	O14508	SOCS2_HUMAN	suppressor of cytokine signaling 2	24					cellular response to hormone stimulus (GO:0032870)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of signal transduction (GO:0009967)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of signal transduction (GO:0009966)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	growth hormone receptor binding (GO:0005131)|insulin-like growth factor receptor binding (GO:0005159)|JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)	14						GGGACCGCGGGGTCGGCGGAG	0.726																																					p.G24V													.	.			0			c.G71T												7.0	7.0	7.0					12																	93966744		2150	4214	6364	SO:0001583	missense	8835	exon2			CCGCGGGGTCGGC	AF037989	CCDS9047.1	12q	2013-02-14			ENSG00000120833	ENSG00000120833		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19382	protein-coding gene	gene with protein product	"""STAT-induced STAT inhibitor-2"""	605117				9344848, 9266833	Standard	NM_003877		Approved	STATI2, SSI2, SOCS-2, SSI-2, CIS2, Cish2	uc031qjc.1	O14508		ENST00000340600.2:c.71G>T	12.37:g.93966744G>T	ENSP00000339428:p.Gly24Val		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001270469	19	0.00	0	A8K3D1|O14542|O95102|Q9UKS5	Missense_Mutation	SNP	ENST00000340600.2	37	CCDS9047.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745257	0.69418	.	.	ENSG00000120833	ENST00000340600;ENST00000549206;ENST00000536696;ENST00000548091;ENST00000549122;ENST00000548537;ENST00000549887;ENST00000551556	T;T;T;T;T;T;T	0.31510	1.94;1.94;1.94;1.49;1.94;1.5;1.94	4.97	3.04	0.35103	.	0.439504	0.21435	N	0.074582	T	0.16385	0.0394	L	0.27053	0.805	0.31325	N	0.685534	B	0.33494	0.414	B	0.28553	0.091	T	0.20042	-1.0287	10	0.15066	T	0.55	-2.6071	7.5696	0.27900	0.0902:0.3523:0.5575:0.0	.	24	O14508	SOCS2_HUMAN	V	24	ENSP00000339428:G24V;ENSP00000448815:G24V;ENSP00000442898:G24V;ENSP00000447902:G24V;ENSP00000447161:G24V;ENSP00000448611:G24V;ENSP00000449227:G24V	ENSP00000339428:G24V	G	+	2	0	SOCS2	92490875	0.722000	0.28017	0.177000	0.23020	0.908000	0.53690	0.912000	0.28597	0.435000	0.26365	0.555000	0.69702	GGG			0.726	SOCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407731.2			
NCOR2	9612	hgsc.bcm.edu;mdanderson.org	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2_ENST00000405201	0	11	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A												9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			Somatic	69	0.0144927536	1		WXS	Illumina HiSeq	.	46	0.11	5	NM_006312	0		0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
SUPT20H	55578	broad.mit.edu	37	13	37614740	37614740	+	Silent	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr13:37614740C>T	ENST00000350612.6	-	8	706	c.486G>A	c.(484-486)cgG>cgA	p.R162R	SUPT20H_ENST00000356185.3_Silent_p.R163R|SUPT20H_ENST00000360252.4_Silent_p.R163R|SUPT20H_ENST00000475892.1_Silent_p.R162R|SUPT20H_ENST00000542180.1_Silent_p.R150R|SUPT20H_ENST00000464744.1_Silent_p.R163R|SUPT20H_ENST00000470359.2_5'UTR	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	162					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										AGAGAATGTGCCGACTTTGGT	0.358																																					p.R163R													.	.			0			c.G489A												131.0	120.0	124.0					13																	37614740		2203	4300	6503	SO:0001819	synonymous_variant	55578	exon8			AATGTGCCGACTT	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.486G>A	13.37:g.37614740C>T			Somatic	536	0.0018656716	1		WXS	Illumina HiSeq	Phase_I	404	0.01	6	NM_017569	40	0.00	0	E7ER46|Q71RF3|Q9Y6A6	Silent	SNP	ENST00000350612.6	37	CCDS31959.1																																																																																					0.358	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000354766.1		NM_017569	
TRIM13	10206	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	13	50589360	50589360	+	3'UTR	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr13:50589360G>T	ENST00000378182.3	+	0	4022				KCNRG_ENST00000312942.1_5'Flank|TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		TCTATCTTCAGATATATTGGC	0.299																																					.													.	.			0			.																																									SO:0001624	3_prime_UTR_variant	10206	.			TCTTCAGATATAT	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*2060G>T	13.37:g.50589360G>T			Somatic	128	0	0		WXS	Illumina HiSeq	.	81	0.21	17	.	2	0.00	0	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	SNP	ENST00000378182.3	37	CCDS9423.1																																																																																					0.299	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354875.1		NM_001007278	
PARP1P1	144	bcgsc.ca	37	13	111589523	111589523	+	IGR	SNP	A	A	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr13:111589523A>T								ANKRD10 (22107 upstream) : LINC00431 (46130 downstream)																							AGATGCGCCTATCCAAGAAGA	0.537																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	144	.			GCGCCTATCCAAG																													13.37:g.111589523A>T			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_1	41	0.20	8	.	0		0		RNA	SNP		37																																																																																					0	0.537										
ADAM21	8747	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	14	70925910	70925910	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr14:70925910G>A	ENST00000603540.1	+	2	1952	c.1694G>A	c.(1693-1695)tGt>tAt	p.C565Y	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.C565Y	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	565	Cys-rich.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AGAGTTCAATGTGAGAATGTG	0.398																																					p.C565Y													.	.			0			c.G1694A												46.0	55.0	52.0					14																	70925910		2202	4280	6482	SO:0001583	missense	8747	exon2			TTCAATGTGAGAA	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.1694G>A	14.37:g.70925910G>A	ENSP00000474385:p.Cys565Tyr		Somatic	268	0	0		WXS	Illumina HiSeq	.	193	0.18	35	NM_003813	0		0	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584030	0.46110	.	.	ENSG00000139985	ENST00000267499	T	0.63580	-0.05	4.49	4.49	0.54785	ADAM, cysteine-rich (2);	0.000000	0.44688	U	0.000429	D	0.88254	0.6387	H	0.99325	4.515	0.41567	D	0.988665	D	0.89917	1.0	D	0.97110	1.0	D	0.93612	0.6940	10	0.87932	D	0	.	17.7263	0.88366	0.0:0.0:1.0:0.0	.	565	Q9UKJ8	ADA21_HUMAN	Y	565	ENSP00000267499:C565Y	ENSP00000267499:C565Y	C	+	2	0	ADAM21	69995663	1.000000	0.71417	0.998000	0.56505	0.682000	0.39822	6.830000	0.75319	2.485000	0.83878	0.563000	0.77884	TGT			0.398	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413008.3			
ACOT4	122970	broad.mit.edu	37	14	74059005	74059005	+	Silent	SNP	C	C	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr14:74059005C>G	ENST00000326303.4	+	1	596	c.342C>G	c.(340-342)ccC>ccG	p.P114P		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	114					acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		GCCACGACCCCGAGCCTGGAC	0.692																																					p.P114P													.	ACOT4	25		0			c.C342G												15.0	17.0	16.0					14																	74059005		2122	4101	6223	SO:0001819	synonymous_variant	122970	exon1			CGACCCCGAGCCT	BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.342C>G	14.37:g.74059005C>G			Somatic	41	0.0243902439	1		WXS	Illumina HiSeq	Phase_I	37	0.11	4	NM_152331	0		0	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Silent	SNP	ENST00000326303.4	37	CCDS9817.1																																																																																					0.692	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404298.2		NM_152331	
SNW1	22938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	78197400	78197400	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr14:78197400C>G	ENST00000261531.7	-	10	1026	c.964G>C	c.(964-966)Gag>Cag	p.E322Q	SNW1_ENST00000554775.1_Missense_Mutation_p.E160Q|SNW1_ENST00000555761.1_Missense_Mutation_p.E322Q|SLIRP_ENST00000557431.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	322	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CTAAGTTTCTCTTCATGTTTT	0.408																																					p.E322Q													.	.			0			c.G964C												133.0	131.0	131.0					14																	78197400		2203	4300	6503	SO:0001583	missense	22938	exon10			GTTTCTCTTCATG	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.964G>C	14.37:g.78197400C>G	ENSP00000261531:p.Glu322Gln		Somatic	127	0	0		WXS	Illumina HiSeq	.	85	0.19	16	NM_012245	303	0.34	103	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	37	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324597	0.81580	.	.	ENSG00000100603	ENST00000261531;ENST00000554775;ENST00000555761	.	.	.	5.36	5.36	0.76844	SKI-interacting protein SKIP, SNW domain (1);	0.000000	0.85682	D	0.000000	T	0.76335	0.3973	L	0.60845	1.875	0.80722	D	1	D;D	0.69078	0.991;0.997	D;D	0.79108	0.925;0.992	T	0.72740	-0.4202	9	0.30854	T	0.27	.	19.1193	0.93355	0.0:1.0:0.0:0.0	.	322;322	G3V3A4;Q13573	.;SNW1_HUMAN	Q	322;160;322	.	ENSP00000261531:E322Q	E	-	1	0	SNW1	77267153	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.438000	0.80431	2.511000	0.84671	0.573000	0.79308	GAG			0.408	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413912.1		NM_012245	
RPS6KA5	9252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	91366534	91366534	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr14:91366534C>G	ENST00000261991.3	-	11	1470	c.1297G>C	c.(1297-1299)Gga>Cga	p.G433R	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.G354R|RPS6KA5_ENST00000418736.2_Missense_Mutation_p.G433R	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	433	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CTACCTTCTCCCAGGGGTTTG	0.343																																					p.G433R													.	.			0			c.G1297C												81.0	86.0	84.0					14																	91366534		2203	4300	6503	SO:0001583	missense	9252	exon11			CTTCTCCCAGGGG	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.1297G>C	14.37:g.91366534C>G	ENSP00000261991:p.Gly433Arg		Somatic	169	0	0		WXS	Illumina HiSeq	.	134	0.16	21	NM_182398	11	0.27	3	O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	37	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002990	0.74932	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	D;D;D	0.82984	-1.67;-1.67;-1.67	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95121	0.8419	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	D	0.96381	0.9281	10	0.87932	D	0	.	20.0736	0.97735	0.0:1.0:0.0:0.0	.	433;433	O75582-2;O75582	.;KS6A5_HUMAN	R	433;354;433	ENSP00000261991:G433R;ENSP00000442803:G354R;ENSP00000402787:G433R	ENSP00000261991:G433R	G	-	1	0	RPS6KA5	90436287	1.000000	0.71417	0.978000	0.43139	0.279000	0.26890	7.748000	0.85085	2.748000	0.94277	0.655000	0.94253	GGA			0.343	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411442.2		NM_004755	
TP53BP1	7158	hgsc.bcm.edu	37	15	43739017	43739017	+	Intron	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr15:43739017G>A	ENST00000263801.3	-	14	3074				TP53BP1_ENST00000382044.4_Intron|TP53BP1_ENST00000450115.2_Intron|TP53BP1_ENST00000382039.3_Intron|TP53BP1_ENST00000605155.1_5'UTR	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTGGACAAAGGATGCTGCATG	0.488								Other conserved DNA damage response genes																													.													.	.			0			.																																									SO:0001627	intron_variant	100873756	.			ACAAAGGATGCTG	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.2822-229C>T	15.37:g.43739017G>A			Somatic	83	0	0		WXS	Illumina HiSeq	.	67	0.12	8	.	1	0.00	0	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	RNA	SNP	ENST00000263801.3	37	CCDS10096.1																																																																																					0.488	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000132897.3			
LOC101926911	101926911	broad.mit.edu	37	15	91577398	91577398	+	RNA	DEL	G	G	-	rs71463787|rs547659371|rs398043561	byFrequency	TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr15:91577398delG	ENST00000557804.1	+	0	465																											TCCTGCTGCCGGTTCAGGTGA	0.627													GG|GG|G|deletion	263	0.052516	0.003	0.0288	5008	,	,		17580	0.003		0.0487	False		,,,				2504	0.1912				.													.	.			0			.																																											0	.			GCTGCCGGTTCAG																													15.37:g.91577398delG			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	11	0.36	4	.	0		0		RNA	DEL	ENST00000557804.1	37																																																																																						0.627	AC068831.10-004	KNOWN	basic	antisense	antisense		OTTHUMT00000418639.1			
FAM173A	65990	mdanderson.org	37	16	771876	771876	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr16:771876C>T	ENST00000569529.1	+	3	643	c.343C>T	c.(343-345)Cgg>Tgg	p.R115W	FAM173A_ENST00000564000.1_Missense_Mutation_p.R115W|FAM173A_ENST00000219535.3_Missense_Mutation_p.R115W	NM_023933.2	NP_076422.1	Q9BQD7	F173A_HUMAN	family with sequence similarity 173, member A	115						integral component of membrane (GO:0016021)				pancreas(1)	1						GGCGCTGGCGCGGCTGCACGC	0.716																																					p.R115W													.	.			0			c.C343T												4.0	6.0	5.0					16																	771876		1879	3923	5802	SO:0001583	missense	65990	exon3			CTGGCGCGGCTGC	BC002624	CCDS10423.1, CCDS59254.1	16p13.3	2008-06-19	2008-06-19	2008-06-19	ENSG00000103254	ENSG00000103254			14152	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 24"""	C16orf24			Standard	NM_023933		Approved	MGC2494	uc002cje.4	Q9BQD7	OTTHUMG00000121177	ENST00000569529.1:c.343C>T	16.37:g.771876C>T	ENSP00000454380:p.Arg115Trp		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_023933	61	0.02	1	A2IDD4	Missense_Mutation	SNP	ENST00000569529.1	37	CCDS10423.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590459	0.46214	.	.	ENSG00000103254	ENST00000219535	T	0.38722	1.12	5.1	-0.779	0.10973	.	0.442568	0.25514	N	0.030145	T	0.33147	0.0853	M	0.67625	2.065	0.09310	N	1	B	0.21381	0.055	B	0.14578	0.011	T	0.21143	-1.0254	10	0.45353	T	0.12	-11.9288	4.8805	0.13677	0.4741:0.313:0.0:0.213	.	115	Q9BQD7	F173A_HUMAN	W	115	ENSP00000219535:R115W	ENSP00000219535:R115W	R	+	1	2	FAM173A	711877	0.000000	0.05858	0.012000	0.15200	0.858000	0.48976	-0.602000	0.05680	-0.092000	0.12417	-0.314000	0.08810	CGG			0.716	FAM173A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000241667.2		NM_023933	
ABCC6P1	653190	broad.mit.edu	37	16	18603964	18603964	+	RNA	SNP	C	C	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr16:18603964C>A	ENST00000546162.2	+	0	1307					NR_003569.1				ATP-binding cassette, sub-family C, member 6 pseudogene 1 (functional)																		GCTGTTTGAGCAGCAGAACAT	0.582																																					.													.	.			0			.																																											0	.			TTTGAGCAGCAGA	BC075833		16p12.3	2014-09-11	2014-05-09		ENSG00000256340	ENSG00000256340		"""-"""	33352	pseudogene	pseudogene			"""ATP-binding cassette, sub-family C, member 6 pseudogene 1"""			18405356, 22873774	Standard	NR_003569		Approved		uc002dfg.3		OTTHUMG00000177192		16.37:g.18603964C>A			Somatic	309	0	0		WXS	Illumina HiSeq	Phase_I	221	0.02	5	.	0		0		RNA	SNP	ENST00000546162.2	37		.	.	.	.	.	.	.	.	.	.	.	11.33	1.606826	0.28623	.	.	ENSG00000256340	ENST00000546162	.	.	.	2.47	2.47	0.30058	.	.	.	.	.	T	0.65903	0.2736	.	.	.	.	.	.	D;D	0.71674	0.998;0.996	D;D	0.66847	0.94;0.947	T	0.73795	-0.3870	6	0.66056	D	0.02	.	8.4306	0.32755	0.0:1.0:0.0:0.0	.	254;368	B7Z554;A2RRN8	.;.	K	254	.	ENSP00000443361:Q254K	Q	+	1	0	ABCC6P1	18511465	1.000000	0.71417	0.995000	0.50966	0.654000	0.38779	6.514000	0.73746	1.371000	0.46172	0.400000	0.26472	CAG			0.582	ABCC6P1-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000435772.2		NR_003569	
CD2BP2	10421	ucsc.edu	37	16	30365078	30365078	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr16:30365078T>C	ENST00000305596.3	-	5	594	c.419A>G	c.(418-420)gAc>gGc	p.D140G	RP11-347C12.10_ENST00000563252.1_lincRNA|CD2BP2_ENST00000569466.1_Missense_Mutation_p.D140G	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	140					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)			breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CTCCTCCGAGTCTGAGGCCTG	0.607																																					p.D140G													.	CD2BP2	30		0			c.A419G												20.0	21.0	21.0					16																	30365078		2188	4290	6478	SO:0001583	missense	10421	exon5			TCCGAGTCTGAGG	AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.419A>G	16.37:g.30365078T>C	ENSP00000304903:p.Asp140Gly		Somatic	39	0	0		RNA-Seq	Illumina HiSeq		24	0.13	3	NM_006110	137	0.26	35	B2RDX2|Q9ULP2	Missense_Mutation	SNP	ENST00000305596.3	37	CCDS10675.1	.	.	.	.	.	.	.	.	.	.	t	8.824	0.938189	0.18206	.	.	ENSG00000169217	ENST00000305596	T	0.35048	1.33	5.06	3.96	0.45880	.	0.247919	0.46145	N	0.000313	T	0.34483	0.0899	M	0.68317	2.08	0.58432	D	0.999995	B	0.06786	0.001	B	0.09377	0.004	T	0.10064	-1.0646	10	0.30078	T	0.28	-18.7456	9.9161	0.41434	0.0:0.0823:0.0:0.9177	.	140	O95400	CD2B2_HUMAN	G	140	ENSP00000304903:D140G	ENSP00000304903:D140G	D	-	2	0	CD2BP2	30272579	1.000000	0.71417	0.998000	0.56505	0.387000	0.30353	5.523000	0.67099	0.759000	0.33084	-0.290000	0.09829	GAC			0.607	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255528.1		NM_006110	
EMC8	10328	ucsc.edu;bcgsc.ca	37	16	85814060	85814060	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr16:85814060G>T	ENST00000253457.3	-	4	642	c.398C>A	c.(397-399)aCg>aAg	p.T133K	EMC8_ENST00000435200.2_Intron|RNU1-103P_ENST00000516502.1_RNA	NM_006067.4	NP_006058.1	O43402	EMC8_HUMAN	ER membrane protein complex subunit 8	133						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											GCAGTCCATCGTAAACTTGGT	0.602																																					p.T133K													.	.			0			c.C398A												127.0	87.0	100.0					16																	85814060		2198	4300	6498	SO:0001583	missense	10328	exon4			TCCATCGTAAACT	AF005888	CCDS10954.1, CCDS45541.1	16q24	2012-05-30	2012-05-30	2012-05-30	ENSG00000131148	ENSG00000131148			7864	protein-coding gene	gene with protein product	"""family with sequence similarity 158, member B"""	604886	"""chromosome 16 open reading frame 4"", ""neighbor of COX4"", ""chromosome 16 open reading frame 2"", ""COX4 neighbor"""	C16orf4, NOC4, C16orf2, COX4NB		10337626, 22119785	Standard	NM_006067		Approved	FAM158B	uc002fjd.3	O43402	OTTHUMG00000137647	ENST00000253457.3:c.398C>A	16.37:g.85814060G>T	ENSP00000253457:p.Thr133Lys		Somatic	63	0	0		WXS	Illumina HiSeq		39	0.10	4	NM_006067	94	0.00	0	C9JB21	Missense_Mutation	SNP	ENST00000253457.3	37	CCDS10954.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974374	0.92919	.	.	ENSG00000131148	ENST00000253457	T	0.45276	0.9	5.12	5.12	0.69794	.	0.098801	0.64402	D	0.000002	T	0.59998	0.2235	M	0.68593	2.085	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.55121	-0.8190	10	0.21014	T	0.42	-22.9663	18.5651	0.91114	0.0:0.0:1.0:0.0	.	133	O43402	CX4NB_HUMAN	K	133	ENSP00000253457:T133K	ENSP00000253457:T133K	T	-	2	0	COX4NB	84371561	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.328000	0.79160	2.377000	0.81083	0.561000	0.74099	ACG			0.602	EMC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269099.1		NM_006067	
SPAG7	9552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4863123	4863123	+	Missense_Mutation	SNP	T	T	C	rs574343509		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr17:4863123T>C	ENST00000206020.3	-	6	573	c.506A>G	c.(505-507)cAc>cGc	p.H169R	SPAG7_ENST00000573366.1_Missense_Mutation_p.H118R|SPAG7_ENST00000575142.1_Missense_Mutation_p.H158R	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	169						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						GCCGATGAGGTGGCTGTACTT	0.637													t|||	1	0.000199681	0.0	0.0	5008	,	,		17991	0.001		0.0	False		,,,				2504	0.0				p.H169R													.	.			0			c.A506G												98.0	104.0	102.0					17																	4863123		2167	4259	6426	SO:0001583	missense	9552	exon6			ATGAGGTGGCTGT	AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.506A>G	17.37:g.4863123T>C	ENSP00000206020:p.His169Arg		Somatic	82	0	0		WXS	Illumina HiSeq	.	56	0.23	13	NM_004890	413	0.30	125	Q96EU5	Missense_Mutation	SNP	ENST00000206020.3	37	CCDS42240.1	.	.	.	.	.	.	.	.	.	.	t	16.17	3.048229	0.55110	.	.	ENSG00000091640	ENST00000206020	.	.	.	5.1	2.89	0.33648	.	0.045848	0.85682	N	0.000000	T	0.50956	0.1646	M	0.69463	2.115	0.51767	D	0.999935	P	0.49185	0.92	P	0.45071	0.468	T	0.48246	-0.9052	9	0.49607	T	0.09	-3.731	8.1176	0.30953	0.0:0.168:0.0:0.832	.	169	O75391	SPAG7_HUMAN	R	169	.	ENSP00000206020:H169R	H	-	2	0	SPAG7	4803846	1.000000	0.71417	0.998000	0.56505	0.890000	0.51754	5.054000	0.64275	0.414000	0.25790	-0.360000	0.07572	CAC			0.637	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438747.1		NM_004890	
EFCAB5	374786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	28382962	28382962	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr17:28382962A>C	ENST00000394835.3	+	11	2443	c.2251A>C	c.(2251-2253)Ata>Cta	p.I751L	EFCAB5_ENST00000536908.2_Missense_Mutation_p.I695L|EFCAB5_ENST00000320856.5_Missense_Mutation_p.I751L|EFCAB5_ENST00000541045.1_Missense_Mutation_p.I408L|EFCAB5_ENST00000394832.2_Missense_Mutation_p.I751L|EFCAB5_ENST00000378738.3_Missense_Mutation_p.I751L	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	751							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GTCCCAAAAAATAGAAGGAAA	0.343																																					p.I751L													.	.			0			c.A2251C												145.0	133.0	137.0					17																	28382962		1831	4080	5911	SO:0001583	missense	374786	exon11			CAAAAAATAGAAG	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.2251A>C	17.37:g.28382962A>C	ENSP00000378312:p.Ile751Leu		Somatic	187	0	0		WXS	Illumina HiSeq	.	116	0.18	21	NM_198529	0		0	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	37	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	A	9.911	1.209575	0.22289	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	T;T;T;T;T;T;T	0.61040	1.23;0.14;2.42;2.41;1.58;1.22;2.42	5.29	2.99	0.34606	.	0.221074	0.31323	N	0.007847	T	0.53126	0.1777	M	0.66939	2.045	0.22066	N	0.999381	B;B;B;B;P;B	0.40909	0.115;0.183;0.347;0.347;0.732;0.012	B;B;B;B;B;B	0.41988	0.039;0.085;0.069;0.085;0.372;0.011	T	0.42155	-0.9468	10	0.31617	T	0.26	-19.2359	7.4053	0.26987	0.8208:0.0:0.1792:0.0	.	695;695;751;751;751;751	B4DS75;F5GYL2;A8MSY9;B5MEA3;E7EVS9;A4FU69	.;.;.;.;.;EFCB5_HUMAN	L	695;494;408;751;751;751;751;695;557	ENSP00000440619:I695L;ENSP00000445575:I408L;ENSP00000378312:I751L;ENSP00000322003:I751L;ENSP00000378309:I751L;ENSP00000368012:I751L;ENSP00000417009:I557L	ENSP00000322003:I751L	I	+	1	0	EFCAB5	25407088	0.846000	0.29590	0.434000	0.26772	0.341000	0.28922	1.438000	0.35002	0.287000	0.22375	0.528000	0.53228	ATA			0.343	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256120.4		NM_198529	
LIG3	3980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33310332	33310332	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr17:33310332C>T	ENST00000378526.4	+	2	441	c.308C>T	c.(307-309)gCt>gTt	p.A103V	LIG3_ENST00000586407.1_Intron|LIG3_ENST00000262327.5_Missense_Mutation_p.A103V	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	103					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	CGTGGCACAGCTGGCTGCAAA	0.522								Other BER factors																													p.A103V													.	.			0			c.C308T												91.0	86.0	88.0					17																	33310332		2203	4300	6503	SO:0001583	missense	3980	exon2			GCACAGCTGGCTG		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.308C>T	17.37:g.33310332C>T	ENSP00000367787:p.Ala103Val		Somatic	189	0	0		WXS	Illumina HiSeq	.	136	0.15	20	NM_013975	6	0.00	0	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	37	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	C	35	5.477596	0.96291	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.46819	0.86;0.86	5.51	5.51	0.81932	Zinc finger, PARP-type (3);	0.000000	0.85682	D	0.000000	T	0.74015	0.3661	M	0.86805	2.84	0.80722	D	1	D;D;D;D	0.89917	0.998;0.998;0.998;1.0	D;D;D;D	0.80764	0.99;0.99;0.983;0.994	T	0.78740	-0.2086	10	0.87932	D	0	-9.8612	18.4019	0.90519	0.0:1.0:0.0:0.0	.	103;103;103;103	E5KLB5;P49916;E5KLB6;Q96DF0	.;DNLI3_HUMAN;.;.	V	103	ENSP00000367787:A103V;ENSP00000262327:A103V	ENSP00000262327:A103V	A	+	2	0	LIG3	30334445	1.000000	0.71417	0.991000	0.47740	0.999000	0.98932	7.552000	0.82192	2.597000	0.87782	0.655000	0.94253	GCT			0.522	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250330.3		NM_013975	
MRPL45P2	653479	broad.mit.edu	37	17	45559946	45559947	+	RNA	INS	-	-	A	rs200451643|rs199799313	byFrequency	TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr17:45559946_45559947insA	ENST00000575291.1	-	0	606									mitochondrial ribosomal protein L45 pseudogene 2																		aaataaaaaataaaaaaaaaaa	0.401																																					.													.	.			0			.																																											0	.			AAAAAATAAAAAA			17q21.32	2010-09-29				ENSG00000228782			29716	pseudogene	pseudogene						12706105	Standard	NR_033934		Approved		uc002ilq.3				17.37:g.45559957_45559957dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	0		0		RNA	INS	ENST00000575291.1	37																																																																																						0.401	MRPL45P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000441112.1		NR_033934	
ARSG	22901	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	66339899	66339899	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr17:66339899C>G	ENST00000448504.2	+	3	1169	c.373C>G	c.(373-375)Ctg>Gtg	p.L125V	ARSG_ENST00000452479.2_5'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	125					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGCAGAGGTGCTGCAGCAGGC	0.582																																					p.L125V													.	ARSG	55		0			c.C373G												69.0	51.0	57.0					17																	66339899		2203	4300	6503	SO:0001583	missense	22901	exon3			GAGGTGCTGCAGC	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.373C>G	17.37:g.66339899C>G	ENSP00000407193:p.Leu125Val		Somatic	93	0.0107526882	1		WXS	Illumina HiSeq	Phase_I	68	0.16	11	NM_001267727	3	0.00	0	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.437290	0.83885	.	.	ENSG00000141337	ENST00000452479	.	.	.	4.56	4.56	0.56223	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.64402	D	0.000007	D	0.84442	0.5473	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.87724	0.2575	9	0.72032	D	0.01	.	17.4747	0.87656	0.0:1.0:0.0:0.0	.	125	Q96EG1	ARSG_HUMAN	V	125	.	ENSP00000413953:L125V	L	+	1	2	ARSG	63851494	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.810000	0.62598	2.514000	0.84764	0.650000	0.86243	CTG			0.582	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448369.1		NM_014960	
REXO1	57455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1826917	1826917	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:1826917G>C	ENST00000170168.4	-	2	1965	c.1871C>G	c.(1870-1872)aCc>aGc	p.T624S	CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA|REXO1_ENST00000587524.1_5'Flank	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	624						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGACGCTGGTGGACTCGTT	0.692																																					p.T624S													.	.			0			c.C1871G												16.0	12.0	14.0					19																	1826917		2194	4292	6486	SO:0001583	missense	57455	exon2			ACGCTGGTGGACT	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1871C>G	19.37:g.1826917G>C	ENSP00000170168:p.Thr624Ser		Somatic	278	0	0		WXS	Illumina HiSeq	.	176	0.15	27	NM_020695	30	0.17	5	Q9ULT2	Missense_Mutation	SNP	ENST00000170168.4	37	CCDS32866.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668590	0.67814	.	.	ENSG00000079313	ENST00000170168	T	0.20598	2.06	4.55	4.55	0.56014	.	0.219434	0.37136	N	0.002232	T	0.30293	0.0760	M	0.68317	2.08	0.09310	N	1	D	0.57257	0.979	P	0.49799	0.622	T	0.15464	-1.0436	10	0.42905	T	0.14	-42.274	11.2662	0.49112	0.0:0.0:0.6886:0.3113	.	624	Q8N1G1	REXO1_HUMAN	S	624	ENSP00000170168:T624S	ENSP00000170168:T624S	T	-	2	0	REXO1	1777917	0.988000	0.35896	0.992000	0.48379	0.955000	0.61496	1.750000	0.38329	2.081000	0.62600	0.455000	0.32223	ACC			0.692	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449200.1		NM_020695	
ATCAY	85300	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3905468	3905468	+	Missense_Mutation	SNP	G	G	T	rs199662587		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:3905468G>T	ENST00000450849.2	+	4	640	c.173G>T	c.(172-174)cGt>cTt	p.R58L	ATCAY_ENST00000398448.3_Missense_Mutation_p.R64L|ATCAY_ENST00000301260.6_Missense_Mutation_p.R58L|ATCAY_ENST00000600960.1_Missense_Mutation_p.R58L	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	58					apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		GGAGCGCATCGTAAGAGGAAG	0.493																																					p.R58L													.	ATCAY	84		0			c.G173T												54.0	55.0	55.0					19																	3905468		1943	4133	6076	SO:0001583	missense	85300	exon4			CGCATCGTAAGAG		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.173G>T	19.37:g.3905468G>T	ENSP00000390941:p.Arg58Leu		Somatic	155	0.0064516129	1		WXS	Illumina HiSeq	Phase_I	101	0.12	12	NM_033064	1	1.00	1	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638539	0.47153	.	.	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.38077	1.18;1.18;1.16	4.8	4.8	0.61643	.	0.167864	0.51477	D	0.000081	T	0.42675	0.1213	M	0.69823	2.125	0.45899	D	0.998749	P;B	0.34780	0.468;0.21	B;B	0.36808	0.233;0.171	T	0.44605	-0.9317	10	0.45353	T	0.12	-4.7741	16.8586	0.86012	0.0:0.0:1.0:0.0	.	64;58	B4DS11;Q86WG3	.;ATCAY_HUMAN	L	58;58;58;64;36	ENSP00000390941:R58L;ENSP00000301260:R58L;ENSP00000381466:R64L	ENSP00000301260:R58L	R	+	2	0	ATCAY	3856468	1.000000	0.71417	0.543000	0.28128	0.338000	0.28826	7.203000	0.77864	2.210000	0.71456	0.549000	0.68633	CGT			0.493	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457872.2			
ICAM5	7087	mdanderson.org	37	19	10407206	10407206	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:10407206G>T	ENST00000221980.4	+	11	2752	c.2689G>T	c.(2689-2691)Gcg>Tcg	p.A897S		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	897					phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			ggcggcaggcgcggagggcgg	0.751																																					p.A897S													.	.			0			c.G2689T												2.0	2.0	2.0					19																	10407206		992	1681	2673	SO:0001583	missense	7087	exon11			GCAGGCGCGGAGG	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.2689G>T	19.37:g.10407206G>T	ENSP00000221980:p.Ala897Ser		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_003259	0		0	Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	37	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.649414	0.47362	.	.	ENSG00000105376	ENST00000221980	T	0.42131	0.98	3.75	3.75	0.43078	.	.	.	.	.	T	0.25306	0.0615	N	0.19112	0.55	0.09310	N	1	P	0.39601	0.68	B	0.33799	0.17	T	0.04635	-1.0937	9	0.26408	T	0.33	-23.4163	11.2619	0.49089	0.0:0.0:1.0:0.0	.	897	Q9UMF0	ICAM5_HUMAN	S	897	ENSP00000221980:A897S	ENSP00000221980:A897S	A	+	1	0	ICAM5	10268206	0.001000	0.12720	0.054000	0.19295	0.011000	0.07611	0.241000	0.18065	2.118000	0.64928	0.561000	0.74099	GCG			0.751	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451217.1		NM_003259	
NWD1	284434	mdanderson.org	37	19	16860654	16860654	+	Silent	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:16860654T>C	ENST00000552788.1	+	4	1201	c.1201T>C	c.(1201-1203)Ttg>Ctg	p.L401L	NWD1_ENST00000379808.3_Silent_p.L401L|NWD1_ENST00000523826.1_Silent_p.L195L|NWD1_ENST00000524140.2_Silent_p.L401L|NWD1_ENST00000549814.1_Silent_p.L401L|NWD1_ENST00000339803.6_Silent_p.L266L			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	401	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGGGCTGCCCTTGCCCCCTGC	0.607																																					p.L401L													.	.			0			c.T1201C												42.0	44.0	43.0					19																	16860654		2203	4299	6502	SO:0001819	synonymous_variant	284434	exon6			CTGCCCTTGCCCC	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1201T>C	19.37:g.16860654T>C			Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_001007525	0		0	C9J021|Q68CT3	Silent	SNP	ENST00000552788.1	37																																																																																						0.607	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000403569.1		NM_001007525	
ZNF536	9745	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	31040045	31040045	+	Silent	SNP	C	C	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:31040045C>A	ENST00000355537.3	+	4	3666	c.3519C>A	c.(3517-3519)tcC>tcA	p.S1173S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1173					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TGGACTCCTCCAAGGGGGAGA	0.537																																					p.S1173S													.	ZNF536	424		0			c.C3519A												69.0	71.0	70.0					19																	31040045		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon4			CTCCTCCAAGGGG		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3519C>A	19.37:g.31040045C>A			Somatic	127	0.0078740157	1		WXS	Illumina HiSeq	Phase_I	103	0.13	13	NM_014717	1	0.00	0	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																					0.537	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459667.2		NM_014717	
KMT2B	9757	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	36224181	36224181	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:36224181C>G	ENST00000222270.7	+	28	6731	c.6731C>G	c.(6730-6732)cCc>cGc	p.P2244R	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.P2244R	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	2244					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GGCGTGCTGCCCGTGGTCGGA	0.751																																					p.P2244R													.	.			0			c.C6731G												14.0	14.0	14.0					19																	36224181		1554	3552	5106	SO:0001583	missense	8085	exon28			TGCTGCCCGTGGT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.6731C>G	19.37:g.36224181C>G	ENSP00000222270:p.Pro2244Arg		Somatic	94	0	0		WXS	Illumina HiSeq	.	65	0.22	14	NM_014727	23	0.17	4	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.286604	0.23478	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.84370	-1.84;-1.84	4.28	4.28	0.50868	.	0.386833	0.18934	N	0.127135	D	0.86777	0.6014	N	0.24115	0.695	0.40605	D	0.981612	D	0.89917	1.0	D	0.83275	0.996	D	0.88272	0.2930	10	0.66056	D	0.02	.	14.1616	0.65450	0.0:1.0:0.0:0.0	.	2244	Q9UMN6	MLL4_HUMAN	R	2244	ENSP00000222270:P2244R;ENSP00000398837:P2244R	ENSP00000222270:P2244R	P	+	2	0	AD000671.1	40916021	0.871000	0.30034	1.000000	0.80357	0.234000	0.25298	1.932000	0.40143	2.386000	0.81285	0.549000	0.68633	CCC			0.751	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_014727	
ARHGAP33	115703	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	36278481	36278481	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:36278481C>T	ENST00000007510.4	+	21	3158	c.3014C>T	c.(3013-3015)gCa>gTa	p.A1005V	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.A844V|ARHGAP33_ENST00000378944.5_Intron|AC002398.5_ENST00000433059.1_lincRNA			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1005					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CAGCTCAGGGCAGGTGGCGGG	0.682																																					p.A844V													.	ARHGAP33	102		0			c.C2531T												17.0	21.0	20.0					19																	36278481		2184	4270	6454	SO:0001583	missense	115703	exon21			TCAGGGCAGGTGG	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3014C>T	19.37:g.36278481C>T	ENSP00000007510:p.Ala1005Val		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	46	0.09	4	NM_052948	17	0.24	4	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	C	7.457	0.643849	0.14451	.	.	ENSG00000004777	ENST00000007510;ENST00000314737	T;T	0.13538	3.07;2.58	4.67	-3.68	0.04463	.	1.777430	0.03049	N	0.154303	T	0.05777	0.0151	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25467	-1.0131	10	0.07990	T	0.79	.	1.3765	0.02221	0.1223:0.3099:0.241:0.3268	.	844	O14559-11	.	V	1005;844	ENSP00000007510:A1005V;ENSP00000320038:A844V	ENSP00000007510:A1005V	A	+	2	0	ARHGAP33	40970321	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-2.851000	0.00732	-0.437000	0.07243	0.462000	0.41574	GCA			0.682	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding				NM_052948	
CYP2A6	1548	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	41354213	41354213	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:41354213delC	ENST00000301141.5	-	4	585	c.565delG	c.(565-567)gacfs	p.D189fs	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	189					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.D189N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TCAAAGCGGTCCCCAAAGACA	0.547																																					p.D189fs													.	CYP2A6	69		1	Substitution - Missense(1)	skin(1)	c.566delA												150.0	135.0	140.0					19																	41354213		2203	4300	6503	SO:0001589	frameshift_variant	1548	exon4			AGCGGTCCCCAAA	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.565delG	19.37:g.41354213delC	ENSP00000301141:p.Asp189fs		Somatic	150	0	0		WXS	Illumina HiSeq	.	130	0.17	22	NM_000762	0		0	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Frame_Shift_Del	DEL	ENST00000301141.5	37	CCDS12568.1																																																																																					0.547	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463259.1		NM_000762	
LIPE-AS1	100996307	broad.mit.edu	37	19	43136362	43136363	+	RNA	DEL	TG	TG	-	rs142080128		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:43136362_43136363delTG	ENST00000594688.1	+	0	1450				LIPE-AS1_ENST00000594624.2_RNA	NR_073179.1				LIPE antisense RNA 1																		TGAGTATGTATGTGTGTGTGTG	0.505																																					.													.	.			0			.																																											0	.			TATGTATGTGTGT	AK096849, BM974950		19q13.2	2013-05-21			ENSG00000213904	ENSG00000213904		"""Long non-coding RNAs"""	48589	non-coding RNA	RNA, long non-coding							Standard	NR_073179		Approved				OTTHUMG00000182815		19.37:g.43136372_43136373delTG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000594688.1	37																																																																																						0.505	LIPE-AS1-004	KNOWN	basic	antisense	antisense		OTTHUMT00000464099.1		NR_073179	
ZNF233	353355	ucsc.edu	37	19	44778739	44778739	+	Silent	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:44778739T>C	ENST00000391958.2	+	5	2053	c.1926T>C	c.(1924-1926)caT>caC	p.H642H	ZNF233_ENST00000592581.1_3'UTR|ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Silent_p.H624H	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	642					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				AGAGAGTCCATACTGGAGAGA	0.433																																					p.H642H													.	ZNF233	73		0			c.T1926C												97.0	100.0	99.0					19																	44778739		2203	4300	6503	SO:0001819	synonymous_variant	353355	exon5			AGTCCATACTGGA	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1926T>C	19.37:g.44778739T>C			Somatic	174	0	0		RNA-Seq	Illumina HiSeq		144	0.01	1	NM_001207005	34	0.12	4	B2RN78|B2RN79|Q86WL8	Silent	SNP	ENST00000391958.2	37	CCDS33047.1																																																																																					0.433	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000460737.1		NM_181756	
LENG9	94059	mdanderson.org	37	19	54974255	54974255	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:54974255G>A	ENST00000333834.4	-	1	639	c.521C>T	c.(520-522)gCg>gTg	p.A174V		NM_198988.1	NP_945339.2	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	174							catalytic activity (GO:0003824)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)	11	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		CCCGCGTCCCGCCGCCGAGCC	0.726																																					p.A174V													.	.			0			c.C521T												10.0	13.0	12.0					19																	54974255		2067	4131	6198	SO:0001583	missense	94059	exon1			CGTCCCGCCGCCG	AF211976		19q13.4	2014-05-06			ENSG00000182909	ENSG00000275183			16306	protein-coding gene	gene with protein product						10941842	Standard	NM_198988		Approved		uc010yez.2	Q96B70	OTTHUMG00000188273	ENST00000333834.4:c.521C>T	19.37:g.54974255G>A	ENSP00000331647:p.Ala174Val		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_198988	2	0.00	0	B2VAM3	Missense_Mutation	SNP	ENST00000333834.4	37	CCDS12895.2	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681693	0.47991	.	.	ENSG00000182909	ENST00000333834	T	0.33216	1.42	3.63	-0.242	0.13039	.	0.381588	0.20167	U	0.097806	T	0.26011	0.0634	M	0.61703	1.905	0.09310	N	1	D	0.61080	0.989	B	0.41619	0.361	T	0.18777	-1.0326	10	0.52906	T	0.07	-12.2093	7.1906	0.25824	0.0:0.1661:0.4923:0.3416	.	174	Q96B70	LENG9_HUMAN	V	174	ENSP00000331647:A174V	ENSP00000331647:A174V	A	-	2	0	LENG9	59666067	0.016000	0.18221	0.000000	0.03702	0.006000	0.05464	1.271000	0.33098	-0.168000	0.10853	0.455000	0.32223	GCG			0.726	LENG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000140806.3		NM_198988	
ZSCAN22	342945	mdanderson.org	37	19	58846207	58846207	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr19:58846207G>A	ENST00000329665.4	+	2	186	c.39G>A	c.(37-39)tgG>tgA	p.W13*		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	13					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CAGTGCCGTGGGAAGAGGACA	0.607																																					p.W13X													.	.			0			c.G39A												54.0	46.0	49.0					19																	58846207		2203	4300	6503	SO:0001587	stop_gained	342945	exon2			GCCGTGGGAAGAG	M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.39G>A	19.37:g.58846207G>A	ENSP00000332433:p.Trp13*		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_181846	0		0	Q15922|Q7Z3L8	Nonsense_Mutation	SNP	ENST00000329665.4	37	CCDS12975.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436362	0.43224	.	.	ENSG00000182318	ENST00000329665	.	.	.	4.01	2.98	0.34508	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	6.9233	0.24401	0.1236:0.0:0.8764:0.0	.	.	.	.	X	13	.	ENSP00000332433:W13X	W	+	3	0	ZSCAN22	63538019	0.959000	0.32827	0.640000	0.29408	0.034000	0.12701	1.201000	0.32259	2.252000	0.74401	0.591000	0.81541	TGG			0.607	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466765.1		NM_181846	
GAREML	150946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	26410715	26410715	+	Silent	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:26410715C>T	ENST00000401533.2	+	6	2344	c.2214C>T	c.(2212-2214)ggC>ggT	p.G738G	GAREML_ENST00000407684.1_Silent_p.G528G	NM_001168241.1	NP_001161713.1	Q75VX8	GAREL_HUMAN	GRB2 associated, regulator of MAPK1-like	738	Pro-rich.					extracellular vesicular exosome (GO:0070062)											CACCACTTGGCCCCTCCAAGG	0.652																																					p.G738G													.	.			0			c.C2214T												17.0	20.0	19.0					2																	26410715		692	1591	2283	SO:0001819	synonymous_variant	150946	exon6			ACTTGGCCCCTCC	AK090454, AB015349, AB124552	CCDS54336.1, CCDS54337.1	2p23.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000157833	ENSG00000157833			27172	protein-coding gene	gene with protein product			"""family with sequence similarity 59, member B"""	FAM59B			Standard	NM_001168241		Approved	KIAA2038, FLJ00375	uc002rgw.2	Q75VX8	OTTHUMG00000151935	ENST00000401533.2:c.2214C>T	2.37:g.26410715C>T			Somatic	139	0	0		WXS	Illumina HiSeq	.	90	0.14	13	NM_001168241	7	0.14	1	B5MC97|B7WNK9|Q8NF27|Q9UIK8	Silent	SNP	ENST00000401533.2	37	CCDS54336.1																																																																																					0.652	GAREML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324498.2		NM_001168241	
AFTPH	54812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	64778749	64778749	+	Missense_Mutation	SNP	C	C	A	rs113401509	byFrequency	TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:64778749C>A	ENST00000422803.1	+	2	455	c.141C>A	c.(139-141)ttC>ttA	p.F47L	AFTPH_ENST00000409933.1_Missense_Mutation_p.F47L|AFTPH_ENST00000238856.4_Missense_Mutation_p.F47L|AFTPH_ENST00000238855.7_Missense_Mutation_p.F47L|AFTPH_ENST00000409183.1_5'Flank			Q6ULP2	AFTIN_HUMAN	aftiphilin	47					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						TTGTTGATTTCGATACACCAG	0.398													c|||	3	0.000599042	0.0015	0.0	5008	,	,		18602	0.0		0.001	False		,,,				2504	0.0				p.F47L													AFTPH_ENST00000238855,NS,carcinoma,0,2	AFTPH_ENST00000238855	0	2	0			c.C141A							T	LEU/PHE,LEU/PHE,LEU/PHE	7,4399	12.9+/-30.5	0,7,2196	143.0	148.0	146.0		141,141,141	2.0	1.0	2	dbSNP_132	146	2,8598	3.0+/-9.4	0,2,4298	yes	missense,missense,missense	AFTPH	NM_001002243.2,NM_017657.4,NM_203437.3	22,22,22	0,9,6494	AA,AC,CC		0.0233,0.1589,0.0692	probably-damaging,probably-damaging,probably-damaging	47/909,47/910,47/937	64778749	9,12997	2203	4300	6503	SO:0001583	missense	54812	exon2			TGATTTCGATACA	AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.141C>A	2.37:g.64778749C>A	ENSP00000397726:p.Phe47Leu		Somatic	221	0	0		WXS	Illumina HiSeq	.	185	0.10	18	NM_017657	2	0.00	0	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	37		.	.	.	.	.	.	.	.	.	.	c	14.37	2.516052	0.44763	0.001589	2.33E-4	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.63	1.99	0.26369	.	0.000000	0.85682	D	0.000000	T	0.33440	0.0863	L	0.60455	1.87	0.44227	D	0.99706	D;D;D;D	0.56968	0.978;0.978;0.978;0.978	P;P;P;P	0.57244	0.816;0.816;0.816;0.816	T	0.03157	-1.1066	10	0.62326	D	0.03	-11.3967	10.7762	0.46350	0.0:0.2022:0.0:0.7978	.	47;47;47;47	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	L	47	ENSP00000238856:F47L;ENSP00000397726:F47L;ENSP00000238855:F47L;ENSP00000387071:F47L	ENSP00000238855:F47L	F	+	3	2	AFTPH	64632253	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.152000	0.31663	0.169000	0.19679	-1.073000	0.02249	TTC	0.001		0.398	AFTPH-202	KNOWN	basic	protein_coding	protein_coding				NM_017657	
EXOC6B	23233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	72968493	72968493	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:72968493C>G	ENST00000272427.6	-	2	349	c.219G>C	c.(217-219)caG>caC	p.Q73H	EXOC6B_ENST00000410104.1_Missense_Mutation_p.Q73H	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	73					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						CCACAAAGCCCTGGTAATGAA	0.423																																					p.Q73H													.	.			0			c.G219C												179.0	172.0	174.0					2																	72968493		1852	4099	5951	SO:0001583	missense	23233	exon2			AAAGCCCTGGTAA	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.219G>C	2.37:g.72968493C>G	ENSP00000272427:p.Gln73His		Somatic	171	0	0		WXS	Illumina HiSeq	.	171	0.22	37	NM_015189	3	0.33	1	B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182503	0.78677	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.29655	1.56;1.56	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.55465	0.1922	M	0.72624	2.21	0.80722	D	1	D;D	0.57571	0.98;0.964	D;P	0.69654	0.965;0.797	T	0.56950	-0.7894	10	0.56958	D	0.05	.	17.52	0.87784	0.0:1.0:0.0:0.0	.	73;73	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	H	73	ENSP00000272427:Q73H;ENSP00000386698:Q73H	ENSP00000272427:Q73H	Q	-	3	2	EXOC6B	72822001	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.488000	0.45276	2.459000	0.83118	0.655000	0.94253	CAG			0.423	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327558.1		XM_039570	
ANKRD20A8P	729171	broad.mit.edu	37	2	95514650	95514651	+	RNA	INS	-	-	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:95514650_95514651insA	ENST00000432432.2	-	0	712				RNU6-1320P_ENST00000390838.1_RNA	NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		gactccatctcaaaaaaaaaaa	0.386																																					.													.	.			0			.																																											0	.			CCATCTCAAAAAA			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95514661_95514661dupA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	11	0.27	3	.	0		0	A6NC18	RNA	INS	ENST00000432432.2	37																																																																																						0.386	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	pseudogene		OTTHUMT00000451404.1			
HS6ST1	9394	broad.mit.edu	37	2	129025861	129025861	+	Missense_Mutation	SNP	G	G	A	rs372735853		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:129025861G>A	ENST00000259241.6	-	2	1124	c.1111C>T	c.(1111-1113)Cgc>Tgc	p.R371C		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	371					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		CTCCTCAGGCGCTGCTCCCTG	0.677													g|||	1	0.000199681	0.0	0.0	5008	,	,		18056	0.0		0.001	False		,,,				2504	0.0				p.R371C													HS6ST1,NS,carcinoma,+1,2	HS6ST1	31	2	0			c.C1111T							G	CYS/ARG	0,4216		0,0,2108	33.0	42.0	39.0		1111	3.2	1.0	2		39	1,8501		0,1,4250	no	missense	HS6ST1	NM_004807.2	180	0,1,6358	AA,AG,GG		0.0118,0.0,0.0079	probably-damaging	371/412	129025861	1,12717	2108	4251	6359	SO:0001583	missense	9394	exon2			TCAGGCGCTGCTC	AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.1111C>T	2.37:g.129025861G>A	ENSP00000259241:p.Arg371Cys		Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	123	0.02	3	NM_004807	4	0.00	0	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	ENST00000259241.6	37	CCDS42748.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892743	0.72524	0.0	1.18E-4	ENSG00000136720	ENST00000259241	D	0.85629	-2.01	4.3	3.25	0.37280	.	0.000000	0.85682	D	0.000000	D	0.90407	0.6997	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.89985	0.4103	9	.	.	.	-12.2845	11.3312	0.49477	0.0:0.0:0.7166:0.2833	.	371	O60243	H6ST1_HUMAN	C	371	ENSP00000259241:R371C	.	R	-	1	0	HS6ST1	128742331	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.176000	0.58269	2.099000	0.63709	0.462000	0.41574	CGC			0.677	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331572.1		NM_004807	
SDPR	8436	broad.mit.edu	37	2	192700837	192700837	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:192700837T>C	ENST00000304141.4	-	2	1419	c.1090A>G	c.(1090-1092)Agt>Ggt	p.S364G		NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			CCCGAGTTACTCCCCCTGGAG	0.577																																					p.S364G													.	SDPR	67		0			c.A1090G												131.0	123.0	126.0					2																	192700837		2203	4300	6503	SO:0001583	missense	8436	exon2			AGTTACTCCCCCT	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.1090A>G	2.37:g.192700837T>C	ENSP00000305675:p.Ser364Gly		Somatic	178	0.0056179775	1		WXS	Illumina HiSeq	Phase_I	188	0.03	5	NM_004657	8	0.00	0		Missense_Mutation	SNP	ENST00000304141.4	37	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	T	6.000	0.368509	0.11352	.	.	ENSG00000168497	ENST00000304141	T	0.64085	-0.08	5.25	2.89	0.33648	.	0.633271	0.17120	N	0.186247	T	0.49201	0.1543	L	0.47716	1.5	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.31696	-0.9934	10	0.15952	T	0.53	-3.0555	8.0568	0.30610	0.0:0.2966:0.0:0.7034	.	364	O95810	SDPR_HUMAN	G	364	ENSP00000305675:S364G	ENSP00000305675:S364G	S	-	1	0	SDPR	192409082	0.011000	0.17503	0.344000	0.25628	0.110000	0.19582	0.718000	0.25866	0.466000	0.27193	-0.376000	0.06991	AGT			0.577	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334791.2		NM_004657	
ADAM23	8745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	207432037	207432037	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:207432037G>T	ENST00000264377.3	+	15	1813	c.1485G>T	c.(1483-1485)agG>agT	p.R495S	ADAM23_ENST00000374416.1_Missense_Mutation_p.R495S|ADAM23_ENST00000374415.3_Missense_Mutation_p.R495S	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	495	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TTTTCAACAGGCCAACAAAGG	0.413																																					p.R495S	Melanoma(194;1127 2130 19620 24042 27855)												.	.			0			c.G1485T												64.0	65.0	64.0					2																	207432037		2203	4300	6503	SO:0001583	missense	8745	exon15			CAACAGGCCAACA	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1485G>T	2.37:g.207432037G>T	ENSP00000264377:p.Arg495Ser		Somatic	115	0	0		WXS	Illumina HiSeq	.	162	0.13	21	NM_003812	56	0.16	9	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854964	0.71719	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.62788	0.0;0.0;0.0	5.94	-1.17	0.09648	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000001	T	0.54615	0.1869	L	0.44542	1.39	0.58432	D	0.999995	P	0.42993	0.797	P	0.45660	0.489	T	0.49204	-0.8964	10	0.39692	T	0.17	.	11.2986	0.49292	0.4552:0.0:0.5448:0.0	.	495	O75077	ADA23_HUMAN	S	495;495;389;495	ENSP00000264377:R495S;ENSP00000363537:R495S;ENSP00000363536:R495S	ENSP00000264377:R495S	R	+	3	2	ADAM23	207140282	1.000000	0.71417	0.976000	0.42696	0.998000	0.95712	0.780000	0.26760	-0.546000	0.06216	0.561000	0.74099	AGG			0.413	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256431.2		NM_003812	
THAP4	51078	mdanderson.org	37	2	242545856	242545856	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr2:242545856G>T	ENST00000407315.1	-	3	1704	c.1273C>A	c.(1273-1275)Ctg>Atg	p.L425M	THAP4_ENST00000402545.1_Missense_Mutation_p.L13M|THAP4_ENST00000402136.1_Missense_Mutation_p.L13M	NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	425							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		ATCCAGGACAGTGGCTCCACC	0.587																																					p.L425M													.	.			0			c.C1273A												33.0	28.0	30.0					2																	242545856		2203	4296	6499	SO:0001583	missense	51078	exon3			AGGACAGTGGCTC	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.1273C>A	2.37:g.242545856G>T	ENSP00000385006:p.Leu425Met		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_015963	119	0.01	1	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Missense_Mutation	SNP	ENST00000407315.1	37	CCDS2551.1	.	.	.	.	.	.	.	.	.	.	g	21.3	4.123221	0.77436	.	.	ENSG00000176946	ENST00000402136;ENST00000407315;ENST00000402545;ENST00000512346	D	0.98234	-4.81	4.92	4.03	0.46877	Domain of unknown function DUF1794 (1);Calycin-like (1);	0.000000	0.46758	D	0.000270	D	0.98488	0.9496	M	0.68317	2.08	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.981	D	0.98962	1.0798	10	0.72032	D	0.01	-20.1851	12.3227	0.54993	0.0833:0.0:0.9167:0.0	.	425;13	Q8WY91;Q8WY91-2	THAP4_HUMAN;.	M	13;425;13;100	ENSP00000385006:L425M	ENSP00000385931:L13M	L	-	1	2	THAP4	242194529	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.522000	0.67092	1.045000	0.40225	0.655000	0.94253	CTG			0.587	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257267.3		NM_015963	
NRSN2	80023	mdanderson.org	37	20	330397	330397	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr20:330397C>T	ENST00000382291.3	+	3	350	c.110C>T	c.(109-111)gCa>gTa	p.A37V	NRSN2_ENST00000608736.1_Missense_Mutation_p.A37V|NRSN2_ENST00000382285.2_Missense_Mutation_p.A37V|NRSN2_ENST00000492242.1_Intron|RP5-1103G7.4_ENST00000442637.1_RNA	NM_024958.2	NP_079234.1	Q9GZP1	NRSN2_HUMAN	neurensin 2	37						integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8		all_cancers(10;0.0834)				GAGGACTGTGCAGGCACTGCT	0.647																																					p.A37V													.	.			0			c.C110T												61.0	58.0	59.0					20																	330397		2203	4300	6503	SO:0001583	missense	80023	exon3			ACTGTGCAGGCAC	AL136915	CCDS12996.1	20p13	2008-02-04	2006-07-04	2006-07-04	ENSG00000125841	ENSG00000125841			16229	protein-coding gene	gene with protein product		610666	"""chromosome 20 open reading frame 98"""	C20orf98		16527258	Standard	NM_024958		Approved	dJ1103G7.6	uc002wdi.4	Q9GZP1	OTTHUMG00000031628	ENST00000382291.3:c.110C>T	20.37:g.330397C>T	ENSP00000371728:p.Ala37Val		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_024958	61	0.00	0	A8K3B2|Q6FII5|Q9NUD3	Missense_Mutation	SNP	ENST00000382291.3	37	CCDS12996.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056767	0.36277	.	.	ENSG00000125841	ENST00000382291;ENST00000382285	T;T	0.18960	2.18;2.18	4.31	1.04	0.20106	.	0.570642	0.16876	N	0.195926	T	0.16769	0.0403	L	0.53249	1.67	0.20975	N	0.999817	B	0.28291	0.206	B	0.28139	0.086	T	0.18650	-1.0330	10	0.51188	T	0.08	-0.3515	3.515	0.07722	0.0:0.5028:0.2386:0.2586	.	37	Q9GZP1	NRSN2_HUMAN	V	37	ENSP00000371728:A37V;ENSP00000371722:A37V	ENSP00000371722:A37V	A	+	2	0	NRSN2	278397	0.989000	0.36119	0.476000	0.27291	0.850000	0.48378	1.606000	0.36826	0.429000	0.26202	0.643000	0.83706	GCA			0.647	NRSN2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077446.1		NM_024958	
ASXL1	171023	mdanderson.org	37	20	31021114	31021114	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr20:31021114G>T	ENST00000375687.4	+	12	1537	c.1113G>T	c.(1111-1113)ttG>ttT	p.L371F	ASXL1_ENST00000306058.5_Missense_Mutation_p.L366F	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	371	Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						AAGAGTCATTGCAGCAGAACG	0.493			"""F, N, Mis"""		"""MDS, CMML"""																																p.L371F				Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	.			0			c.G1113T												77.0	64.0	68.0					20																	31021114		2203	4300	6503	SO:0001583	missense	171023	exon11			GTCATTGCAGCAG	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1113G>T	20.37:g.31021114G>T	ENSP00000364839:p.Leu371Phe		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_015338	9	0.00	0	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499088	0.44455	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058;ENST00000553345	T;T	0.16073	2.38;2.37	4.26	3.31	0.37934	.	0.259807	0.31760	N	0.007114	T	0.33469	0.0864	M	0.65975	2.015	0.45747	D	0.998643	D;D	0.76494	0.999;0.994	D;D	0.78314	0.991;0.938	T	0.05162	-1.0902	10	0.25106	T	0.35	-0.6995	8.9248	0.35634	0.1721:0.0:0.8279:0.0	.	366;371	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	F	371;371;371;310;366;143	ENSP00000364839:L371F;ENSP00000305119:L366F	ENSP00000305119:L366F	L	+	3	2	ASXL1	30484775	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	2.092000	0.41700	1.152000	0.42452	0.655000	0.94253	TTG			0.493	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078624.2		NM_015338	
NNAT	4826	bcgsc.ca	37	20	36151139	36151139	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr20:36151139G>A	ENST00000062104.2	+	3	341	c.224G>A	c.(223-225)cGc>cAc	p.R75H	NNAT_ENST00000346199.2_Missense_Mutation_p.R48H|BLCAP_ENST00000397131.1_Intron|BLCAP_ENST00000397135.1_Intron|BLCAP_ENST00000373537.2_Intron|BLCAP_ENST00000414542.2_Intron|BLCAP_ENST00000397134.1_5'Flank|BLCAP_ENST00000397137.1_Intron	NM_005386.2	NP_005377.1	Q16517	NNAT_HUMAN	neuronatin	75					brain development (GO:0007420)|neuron differentiation (GO:0030182)|positive regulation of insulin secretion (GO:0032024)|protein lipoylation (GO:0009249)|regulation of protein localization (GO:0032880)|response to glucose (GO:0009749)|transport (GO:0006810)	cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|lung(1)	3		Myeloproliferative disorder(115;0.00878)				TTGGGGGAGCGCAGGCAGCGA	0.677																																					p.R75H													.	NNAT	8		0			c.G224A												37.0	30.0	32.0					20																	36151139		2201	4300	6501	SO:0001583	missense	4826	exon3			GGGAGCGCAGGCA		CCDS13296.1, CCDS13297.1	20q11.2-q12	2007-12-07			ENSG00000053438	ENSG00000053438			7860	protein-coding gene	gene with protein product		603106				8660979	Standard	NM_005386		Approved	Peg5	uc002xhd.3	Q16517	OTTHUMG00000032420	ENST00000062104.2:c.224G>A	20.37:g.36151139G>A	ENSP00000062104:p.Arg75His		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_1	42	0.10	4	NM_005386	116	0.00	0	B2R558|E1P5V6|Q16596|Q5U0N3	Missense_Mutation	SNP	ENST00000062104.2	37	CCDS13296.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907969	0.72868	.	.	ENSG00000053438	ENST00000062104;ENST00000346199	.	.	.	5.0	4.05	0.47172	.	0.000000	0.48286	D	0.000181	T	0.47432	0.1445	.	.	.	0.30336	N	0.786179	D;D	0.59767	0.958;0.986	B;P	0.53006	0.099;0.715	T	0.52734	-0.8536	8	0.87932	D	0	-8.521	8.6775	0.34187	0.1003:0.0:0.8997:0.0	.	48;75	Q16517-2;Q16517	.;NNAT_HUMAN	H	75;48	.	ENSP00000062104:R75H	R	+	2	0	NNAT	35584553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.454000	0.35178	2.780000	0.95670	0.644000	0.83932	CGC			0.677	NNAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000079116.2		NM_005386	
LAMA5	3911	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	20	60921757	60921757	+	Missense_Mutation	SNP	C	C	A	rs556381906		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr20:60921757C>A	ENST00000252999.3	-	8	1238	c.1172G>T	c.(1171-1173)gGt>gTt	p.G391V	LAMA5_ENST00000370677.3_Missense_Mutation_p.G391V|LAMA5_ENST00000370692.3_Missense_Mutation_p.G391V	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	391	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GATACAGACACCCCCACCCTG	0.657																																					p.G391V													.	.			0			c.G1172T												54.0	57.0	56.0					20																	60921757		2202	4297	6499	SO:0001583	missense	3911	exon8			CAGACACCCCCAC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.1172G>T	20.37:g.60921757C>A	ENSP00000252999:p.Gly391Val		Somatic	95	0	0		WXS	Illumina HiSeq	.	67	0.12	8	NM_005560	0		0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315792	0.60524	.	.	ENSG00000130702	ENST00000252999;ENST00000370692;ENST00000370677	T;T;T	0.69806	-0.43;-0.43;-0.43	4.54	4.54	0.55810	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.85548	0.5722	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89609	0.3840	10	0.87932	D	0	.	17.2818	0.87130	0.0:1.0:0.0:0.0	.	391	O15230	LAMA5_HUMAN	V	391	ENSP00000252999:G391V;ENSP00000359726:G391V;ENSP00000359711:G391V	ENSP00000252999:G391V	G	-	2	0	LAMA5	60355152	1.000000	0.71417	0.861000	0.33841	0.132000	0.20833	7.245000	0.78237	2.078000	0.62432	0.561000	0.74099	GGT			0.657	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
N6AMT1	29104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	30257631	30257631	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr21:30257631G>A	ENST00000303775.5	-	1	62	c.37C>T	c.(37-39)Cac>Tac	p.H13Y	N6AMT1_ENST00000351429.3_Missense_Mutation_p.H13Y	NM_013240.4	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1 (putative)	13					positive regulation of cell growth (GO:0030307)|protein methylation (GO:0006479)	protein complex (GO:0043234)	nucleic acid binding (GO:0003676)|protein methyltransferase activity (GO:0008276)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)	12						CGGCCCACGTGCCCGTGGAAC	0.677																																					p.H13Y													.	.			0			c.C37T												33.0	35.0	34.0					21																	30257631		2201	4298	6499	SO:0001583	missense	29104	exon1			CCACGTGCCCGTG	AF139682	CCDS33525.1, CCDS33526.1	21q21.3	2006-12-14	2006-12-14	2006-12-14	ENSG00000156239	ENSG00000156239	2.1.1.72		16021	protein-coding gene	gene with protein product		614553	"""chromosome 21 open reading frame 127"", ""HemK methyltransferase family member 2"""	C21orf127, HEMK2			Standard	NM_013240		Approved	PRED28, N6AMT, MTQ2	uc002ymo.2	Q9Y5N5	OTTHUMG00000078750	ENST00000303775.5:c.37C>T	21.37:g.30257631G>A	ENSP00000303584:p.His13Tyr		Somatic	145	0	0		WXS	Illumina HiSeq	.	139	0.11	15	NM_182749	28	0.14	4	Q96F73	Missense_Mutation	SNP	ENST00000303775.5	37	CCDS33526.1	.	.	.	.	.	.	.	.	.	.	G	36	5.681325	0.96774	.	.	ENSG00000156239	ENST00000303775;ENST00000351429	T;T	0.32272	2.1;1.46	5.18	5.18	0.71444	.	0.055063	0.85682	D	0.000000	T	0.56746	0.2006	M	0.84326	2.69	0.50039	D	0.999847	D;D	0.62365	0.991;0.971	D;D	0.66979	0.948;0.912	T	0.60151	-0.7319	10	0.56958	D	0.05	-14.2799	14.07	0.64854	0.0:0.0:1.0:0.0	.	13;13	Q9Y5N5-2;Q9Y5N5	.;HEMK2_HUMAN	Y	13	ENSP00000303584:H13Y;ENSP00000286764:H13Y	ENSP00000303584:H13Y	H	-	1	0	N6AMT1	29179502	1.000000	0.71417	0.958000	0.39756	0.591000	0.36615	6.734000	0.74801	2.704000	0.92352	0.585000	0.79938	CAC			0.677	N6AMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000171738.1		NM_013240	
CLDN14	23562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	37833547	37833547	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr21:37833547G>T	ENST00000399137.1	-	3	1313	c.447C>A	c.(445-447)aaC>aaA	p.N149K	CLDN14_ENST00000399135.1_Missense_Mutation_p.N149K|AP000695.4_ENST00000454980.1_RNA|CLDN14_ENST00000399136.1_Missense_Mutation_p.N149K|CLDN14_ENST00000342108.2_Missense_Mutation_p.N149K|AP000695.6_ENST00000429588.1_RNA|AP000695.4_ENST00000428667.1_RNA|CLDN14_ENST00000399139.1_Missense_Mutation_p.N149K	NM_144492.2	NP_652763.1	O95500	CLD14_HUMAN	claudin 14	149					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|protein complex assembly (GO:0006461)|tight junction assembly (GO:0070830)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|lung(5)|skin(1)	7						GCAGCAGCGGGTTGTAGAAGT	0.622																																					p.N149K													.	.			0			c.C447A												82.0	78.0	79.0					21																	37833547		2203	4300	6503	SO:0001583	missense	23562	exon3			CAGCGGGTTGTAG	AJ132445	CCDS13645.1	21q22.3	2008-07-31			ENSG00000159261	ENSG00000159261		"""Claudins"""	2035	protein-coding gene	gene with protein product		605608		DFNB29		11163249	Standard	NM_144492		Approved		uc002yvk.2	O95500	OTTHUMG00000086638	ENST00000399137.1:c.447C>A	21.37:g.37833547G>T	ENSP00000382090:p.Asn149Lys		Somatic	75	0	0		WXS	Illumina HiSeq	.	72	0.29	21	NM_144492	0		0		Missense_Mutation	SNP	ENST00000399137.1	37	CCDS13645.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872250	0.72180	.	.	ENSG00000159261	ENST00000399139;ENST00000399137;ENST00000399135;ENST00000399136;ENST00000342108	D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32	5.42	5.42	0.78866	.	0.117701	0.56097	D	0.000037	D	0.92919	0.7747	M	0.93375	3.41	0.54753	D	0.999987	P	0.51057	0.941	P	0.51615	0.675	D	0.94332	0.7563	10	0.87932	D	0	.	13.5161	0.61541	0.0748:0.0:0.9252:0.0	.	149	O95500	CLD14_HUMAN	K	149	ENSP00000382092:N149K;ENSP00000382090:N149K;ENSP00000382087:N149K;ENSP00000382088:N149K;ENSP00000339292:N149K	ENSP00000339292:N149K	N	-	3	2	CLDN14	36755417	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.089000	0.50183	2.526000	0.85167	0.462000	0.41574	AAC			0.622	CLDN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000194697.1		NM_144492	
MYO18B	84700	mdanderson.org	37	22	26157088	26157088	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr22:26157088G>T	ENST00000407587.2	+	2	198	c.29G>T	c.(28-30)tGg>tTg	p.W10L	MYO18B_ENST00000536101.1_Missense_Mutation_p.W10L|MYO18B_ENST00000335473.7_Missense_Mutation_p.W10L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	10						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTCGCCCTGTGGGAGCAGAAG	0.602																																					p.W10L													.	.			0			c.G29T												100.0	101.0	101.0					22																	26157088		2187	4278	6465	SO:0001583	missense	84700	exon2			CCCTGTGGGAGCA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.29G>T	22.37:g.26157088G>T	ENSP00000386096:p.Trp10Leu		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_032608	0		0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	G	22.4	4.286865	0.80803	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.96745	-4.08;-4.08;-4.11	5.3	5.3	0.74995	.	0.000000	0.33875	N	0.004477	D	0.97371	0.9140	L	0.59436	1.845	0.36424	D	0.864502	D	0.89917	1.0	D	0.87578	0.998	D	0.99940	1.1401	10	0.87932	D	0	.	14.4541	0.67404	0.0:0.0:1.0:0.0	.	10	F5GYU7	.	L	10	ENSP00000441229:W10L;ENSP00000334563:W10L;ENSP00000386096:W10L	ENSP00000334563:W10L	W	+	2	0	MYO18B	24487088	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.191000	0.65110	2.487000	0.83934	0.591000	0.81541	TGG			0.602	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000400691.1		NM_032608	
MN1	4330	mdanderson.org	37	22	28195275	28195275	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr22:28195275C>T	ENST00000302326.4	-	1	2211	c.1257G>A	c.(1255-1257)atG>atA	p.M419I		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	419					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						AATAAGGGTGCATGCTCCGGT	0.662			T	ETV6	"""AML, meningioma"""																																p.M419I				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	.			0			c.G1257A												16.0	20.0	18.0					22																	28195275		2108	4242	6350	SO:0001583	missense	4330	exon1			AGGGTGCATGCTC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1257G>A	22.37:g.28195275C>T	ENSP00000304956:p.Met419Ile		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_002430	0		0	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249833	0.39797	.	.	ENSG00000169184	ENST00000302326	T	0.44482	0.92	5.29	5.29	0.74685	.	2.230900	0.01609	N	0.022440	T	0.39332	0.1074	N	0.14661	0.345	0.41894	D	0.990384	P	0.42941	0.794	B	0.43052	0.406	T	0.36841	-0.9731	10	0.18710	T	0.47	-3.3172	17.9352	0.89010	0.0:1.0:0.0:0.0	.	419	Q10571	MN1_HUMAN	I	419	ENSP00000304956:M419I	ENSP00000304956:M419I	M	-	3	0	MN1	26525275	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.581000	0.67471	2.473000	0.83533	0.484000	0.47621	ATG			0.662	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
XRCC6	2547	broad.mit.edu	37	22	42059649	42059649	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr22:42059649A>G	ENST00000359308.4	+	12	2315	c.1660A>G	c.(1660-1662)Agg>Ggg	p.R554G	XRCC6_ENST00000360079.3_Missense_Mutation_p.R554G|XRCC6_ENST00000405506.1_Missense_Mutation_p.R504G|XRCC6_ENST00000402580.3_Missense_Mutation_p.R513G|XRCC6_ENST00000428575.2_Missense_Mutation_p.R421G|XRCC6_ENST00000405878.1_Missense_Mutation_p.R554G			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	554	Interaction with DEAF1.				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						TGGAAGCAAAAGGCCCAAGGT	0.547								Non-homologous end-joining																													p.R554G													XRCC6,NS,carcinoma,0,1	XRCC6	64	1	0			c.A1660G												101.0	100.0	100.0					22																	42059649		2203	4300	6503	SO:0001583	missense	2547	exon13			AGCAAAAGGCCCA	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1660A>G	22.37:g.42059649A>G	ENSP00000352257:p.Arg554Gly		Somatic	284	0.0035211268	1		WXS	Illumina HiSeq	Phase_I	187	0.02	4	NM_001469	6207	0.00	2	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	ENST00000359308.4	37	CCDS14021.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.148134	0.78001	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000405506	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.42	4.31	0.51392	Ku70/Ku80 C-terminal arm (1);	0.190291	0.56097	D	0.000024	T	0.47377	0.1442	L	0.38531	1.155	0.36750	D	0.882709	B;P;P	0.39044	0.086;0.656;0.51	B;P;P	0.52031	0.111;0.532;0.688	T	0.56926	-0.7898	10	0.51188	T	0.08	-14.4461	13.0006	0.58672	0.8564:0.1436:0.0:0.0	.	504;513;554	B1AHC9;B1AHC8;P12956	.;.;XRCC6_HUMAN	G	554;513;421;554;554;504	ENSP00000353192:R554G;ENSP00000384941:R513G;ENSP00000403679:R421G;ENSP00000352257:R554G;ENSP00000384257:R554G;ENSP00000384082:R504G	ENSP00000352257:R554G	R	+	1	2	XRCC6	40389595	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	6.783000	0.75078	2.052000	0.61016	0.460000	0.39030	AGG			0.547	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321688.1		NM_001469	
PHF21B	112885	mdanderson.org	37	22	45289362	45289362	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr22:45289362G>A	ENST00000313237.5	-	7	1085	c.935C>T	c.(934-936)gCc>gTc	p.A312V	PHF21B_ENST00000447824.3_Missense_Mutation_p.A258V|PHF21B_ENST00000404079.2_Missense_Mutation_p.A258V|PHF21B_ENST00000396103.3_Missense_Mutation_p.A270V|PHF21B_ENST00000403565.1_Missense_Mutation_p.A108V	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	312							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GCCGCTGTAGGCAGGGTTGGC	0.632																																					p.A312V													.	.			0			c.C935T												118.0	88.0	98.0					22																	45289362		2203	4299	6502	SO:0001583	missense	112885	exon7			CTGTAGGCAGGGT	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.935C>T	22.37:g.45289362G>A	ENSP00000324403:p.Ala312Val		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_138415	0		0	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	ENST00000313237.5	37	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489917	0.26686	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000414269	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	4.73	4.73	0.59995	.	0.078127	0.49305	D	0.000154	T	0.56292	0.1975	N	0.25201	0.72	0.47245	D	0.999367	P;D;D;D;D	0.71674	0.702;0.998;0.997;0.983;0.993	B;D;D;P;P	0.69142	0.438;0.962;0.917;0.7;0.907	T	0.48758	-0.9007	10	0.10636	T	0.68	-14.1703	18.076	0.89427	0.0:0.0:1.0:0.0	.	258;270;258;312;108	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5	.;.;.;PF21B_HUMAN;.	V	108;312;270;258;258;108	ENSP00000385053:A108V;ENSP00000324403:A312V;ENSP00000379410:A270V;ENSP00000385105:A258V;ENSP00000388619:A258V;ENSP00000401091:A108V	ENSP00000324403:A312V	A	-	2	0	PHF21B	43668026	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.903000	0.69877	2.330000	0.79161	0.655000	0.94253	GCC			0.632	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000321731.2		NM_138415	
PTPN23	25930	mdanderson.org	37	3	47453110	47453110	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr3:47453110G>T	ENST00000265562.4	+	20	3899	c.3822G>T	c.(3820-3822)tgG>tgT	p.W1274C	PTPN23_ENST00000431726.1_Missense_Mutation_p.W1148C	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1274	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGACTTCTGGCTCATGGTCC	0.592																																					p.W1274C													.	.			0			c.G3822T												36.0	35.0	35.0					3																	47453110		2202	4300	6502	SO:0001583	missense	25930	exon20			CTTCTGGCTCATG	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.3822G>T	3.37:g.47453110G>T	ENSP00000265562:p.Trp1274Cys		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_015466	32	0.00	0	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469212	0.63625	.	.	ENSG00000076201	ENST00000265562	D	0.92752	-3.1	4.62	4.62	0.57501	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.85682	D	0.000000	D	0.97832	0.9288	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99486	1.0949	10	0.87932	D	0	-12.4015	16.3982	0.83630	0.0:0.0:1.0:0.0	.	1148;1274	B4DST5;Q9H3S7	.;PTN23_HUMAN	C	1274	ENSP00000265562:W1274C	ENSP00000265562:W1274C	W	+	3	0	PTPN23	47428114	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.221000	0.95188	2.389000	0.81357	0.563000	0.77884	TGG			0.592	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257492.2		NM_015466	
PSMD6	9861	bcgsc.ca;mdanderson.org	37	3	64008194	64008194	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr3:64008194C>T	ENST00000295901.4	-	2	291	c.151G>A	c.(151-153)Gct>Act	p.A51T	PSMD6_ENST00000394431.2_Missense_Mutation_p.A13T|PSMD6_ENST00000482510.1_Missense_Mutation_p.A12T|PSMD6_ENST00000492933.1_Missense_Mutation_p.A104T|RP11-245J9.6_ENST00000605919.1_RNA	NM_014814.1	NP_055629.1	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6	51					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATPase activity (GO:0016887)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(1)	13		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		TAGTAAGGAGCCATGTCTAAC	0.488																																					p.A104T													.	PSMD6	30		0			c.G310A												112.0	104.0	106.0					3																	64008194		2203	4300	6503	SO:0001583	missense	9861	exon3			AAGGAGCCATGTC	AF215935	CCDS2901.1, CCDS63677.1, CCDS63678.1, CCDS63679.1	3p14.1	2008-05-22			ENSG00000163636	ENSG00000163636		"""Proteasome (prosome, macropain) subunits"""	9564	protein-coding gene	gene with protein product						10723133	Standard	NM_001271779		Approved	S10, p44S10, KIAA0107, Rpn7	uc003dmb.2	Q15008	OTTHUMG00000158765	ENST00000295901.4:c.151G>A	3.37:g.64008194C>T	ENSP00000295901:p.Ala51Thr		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_1	92	0.05	5	NM_001271779	148	0.00	0	A8K2E0|E9PHI9|Q6UV22	Missense_Mutation	SNP	ENST00000295901.4	37	CCDS2901.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810175	0.90707	.	.	ENSG00000163636	ENST00000295901;ENST00000492933;ENST00000394431;ENST00000482510;ENST00000497323;ENST00000478185	.	.	.	4.93	4.93	0.64822	.	0.048575	0.85682	D	0.000000	T	0.76637	0.4015	M	0.92317	3.295	0.80722	D	1	B;B;P;B	0.36753	0.409;0.414;0.568;0.275	B;B;B;B	0.38106	0.12;0.126;0.265;0.213	T	0.80502	-0.1354	9	0.40728	T	0.16	-4.6465	18.337	0.90291	0.0:1.0:0.0:0.0	.	13;12;104;51	Q6UV22;E9PHI9;C9IZE4;Q15008	.;.;.;PSMD6_HUMAN	T	51;104;13;12;65;72	.	ENSP00000295901:A51T	A	-	1	0	PSMD6	63983234	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.514000	0.81750	2.555000	0.86185	0.655000	0.94253	GCT			0.488	PSMD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352082.1		NM_014814	
CTBP1	1487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	1244599	1244599	+	5'Flank	SNP	G	G	A	rs1680031|rs1732116		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr4:1244599G>A	ENST00000290921.6	-	0	0				CTBP1-AS2_ENST00000581398.1_RNA|CTBP1_ENST00000382952.3_5'Flank|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000507044.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA|CTBP1-AS2_ENST00000578730.1_RNA|CTBP1-AS2_ENST00000357591.2_RNA	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		GGAATTCCTGGCTCCCGCGTG	0.557																																					.													.	.			0			.												60.0	64.0	63.0					4																	1244599		2203	4300	6503	SO:0001631	upstream_gene_variant	92070	.			TTCCTGGCTCCCG	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244599G>A	Exception_encountered		Somatic	105	0	0		WXS	Illumina HiSeq	.	58	0.17	10	.	8	0.38	3	Q4W5N3|Q7Z2Q5	RNA	SNP	ENST00000290921.6	37	CCDS3348.1	.	.	.	.	.	.	.	.	.	.	G	1.922	-0.448113	0.04572	.	.	ENSG00000196810	ENST00000357591	.	.	.	1.41	-0.71	0.11234	.	.	.	.	.	T	0.20292	0.0488	.	.	.	0.23056	N	0.998368	B	0.30686	0.29	B	0.17979	0.02	T	0.17930	-1.0353	6	0.87932	D	0	.	2.6613	0.05027	0.2381:0.3379:0.424:0.0	.	80	Q0VAR9	CD042_HUMAN	T	80	.	ENSP00000350204:A80T	A	+	1	0	C4orf42	1234599	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	0.470000	0.22084	-0.260000	0.09418	0.462000	0.41574	GCT			0.557	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000202938.1		NM_001328	
NELFA	7469	broad.mit.edu;bcgsc.ca	37	4	2010671	2010671	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr4:2010671C>T	ENST00000411638.2	-	1	31	c.16G>A	c.(16-18)Gag>Aag	p.E6K	NELFA_ENST00000542778.1_5'UTR|NELFA_ENST00000382882.3_Missense_Mutation_p.E17K	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	6					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										GTGTCGCTCTCCCGCATGGAC	0.697																																					p.E17K													.	.			0			c.G49A												19.0	19.0	19.0					4																	2010671		2186	4267	6453	SO:0001583	missense	7469	exon1			CGCTCTCCCGCAT	AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.16G>A	4.37:g.2010671C>T	ENSP00000399165:p.Glu6Lys		Somatic	91	0.010989011	1		WXS	Illumina HiSeq	Phase_I	70	0.19	13	NM_005663	17	0.53	9	A2A2T1|O95392	Missense_Mutation	SNP	ENST00000411638.2	37		.	.	.	.	.	.	.	.	.	.	C	15.28	2.786884	0.49997	.	.	ENSG00000185049	ENST00000382882;ENST00000411638;ENST00000431323	T;T;T	0.30981	1.51;1.51;1.51	3.19	2.32	0.28847	.	0.070437	0.56097	D	0.000026	T	0.26810	0.0656	L	0.44542	1.39	0.80722	D	1	B	0.25904	0.137	B	0.26969	0.075	T	0.13926	-1.0491	10	0.66056	D	0.02	-24.1193	12.3437	0.55109	0.0:0.8279:0.1721:0.0	.	6	Q9H3P2	NELFA_HUMAN	K	17;6;17	ENSP00000372335:E17K;ENSP00000399165:E6K;ENSP00000395761:E17K	ENSP00000330311:E6K	E	-	1	0	WHSC2	1980469	1.000000	0.71417	1.000000	0.80357	0.132000	0.20833	6.817000	0.75252	0.666000	0.31087	-0.502000	0.04539	GAG			0.697	NELFA-015	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000473007.1		NM_005663	
YTHDC1	91746	broad.mit.edu	37	4	69202915	69202915	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr4:69202915T>A	ENST00000344157.4	-	4	1048	c.713A>T	c.(712-714)gAg>gTg	p.E238V	YTHDC1_ENST00000579690.1_Missense_Mutation_p.E238V|YTHDC1_ENST00000355665.3_Missense_Mutation_p.E238V	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	238	Glu-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						ctcctcttcctcctcctcctc	0.478																																					p.E238V													.	YTHDC1	81		0			c.A713T												127.0	90.0	103.0					4																	69202915		2203	4300	6503	SO:0001583	missense	91746	exon4			TCTTCCTCCTCCT	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.713A>T	4.37:g.69202915T>A	ENSP00000339245:p.Glu238Val		Somatic	127	0.0078740157	1		WXS	Illumina HiSeq	Phase_I	85	0.06	5	NM_001031732	5	0.00	0	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	37	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	T	3.425	-0.117277	0.06838	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.30714	1.76;1.52	4.54	3.34	0.38264	.	0.251995	0.29707	N	0.011412	T	0.16428	0.0395	N	0.14661	0.345	0.36590	D	0.874031	B;B	0.12013	0.005;0.003	B;B	0.11329	0.006;0.002	T	0.10154	-1.0642	10	0.31617	T	0.26	.	7.9574	0.30051	0.1828:0.0:0.0:0.8171	.	238;238	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	V	238	ENSP00000339245:E238V;ENSP00000347888:E238V	ENSP00000339245:E238V	E	-	2	0	YTHDC1	68885510	0.532000	0.26346	0.035000	0.18076	0.002000	0.02628	4.957000	0.63652	0.847000	0.35167	-0.542000	0.04241	GAG			0.478	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251437.1		NM_133370	
CYP2U1	113612	mdanderson.org	37	4	108853256	108853256	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr4:108853256G>A	ENST00000332884.6	+	1	732	c.457G>A	c.(457-459)Gtg>Atg	p.V153M	RP11-286E11.1_ENST00000499098.1_RNA|CYP2U1_ENST00000508453.1_5'UTR|RP11-286E11.1_ENST00000513071.1_RNA|CYP2U1_ENST00000513302.1_3'UTR	NM_183075.2	NP_898898.1	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U, polypeptide 1	153					arachidonic acid metabolic process (GO:0019369)|cell death (GO:0008219)|omega-hydroxylase P450 pathway (GO:0097267)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|large_intestine(2)|lung(4)|skin(2)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		CCGCCCGCGGGTGCCGCTCAT	0.667																																					p.V153M													.	.			0			c.G457A												8.0	8.0	8.0					4																	108853256		2172	4238	6410	SO:0001583	missense	113612	exon1			CCGCGGGTGCCGC	BC012027	CCDS34047.1	4q25	2012-11-23			ENSG00000155016	ENSG00000155016		"""Cytochrome P450s"""	20582	protein-coding gene	gene with protein product	"""spastic paraplegia 49"""	610670				14975754, 14660610	Standard	XM_005262717		Approved	SPG49	uc003hyp.3	Q7Z449	OTTHUMG00000161084	ENST00000332884.6:c.457G>A	4.37:g.108853256G>A	ENSP00000333212:p.Val153Met		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_183075	0		0	B2RMV7|Q96EQ6	Missense_Mutation	SNP	ENST00000332884.6	37	CCDS34047.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311250	0.40895	.	.	ENSG00000155016	ENST00000332884;ENST00000424249	T	0.68181	-0.31	4.47	-0.913	0.10500	.	0.508862	0.21441	N	0.074485	T	0.36717	0.0977	N	0.11870	0.19	0.80722	D	1	B	0.06786	0.001	B	0.19666	0.026	T	0.03335	-1.1047	10	0.19147	T	0.46	.	1.3786	0.02225	0.3362:0.1367:0.3874:0.1397	.	153	Q7Z449	CP2U1_HUMAN	M	153;110	ENSP00000333212:V153M	ENSP00000333212:V153M	V	+	1	0	CYP2U1	109072705	0.264000	0.24093	0.995000	0.50966	0.977000	0.68977	-0.203000	0.09438	-0.092000	0.12417	0.644000	0.83932	GTG			0.667	CYP2U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363691.2		NM_183075	
ARRDC3	57561	mdanderson.org	37	5	90667229	90667229	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr5:90667229G>T	ENST00000265138.3	-	8	1499	c.1233C>A	c.(1231-1233)tgC>tgA	p.C411*		NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	411					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		AACGAGAGGGGCAGGATGGTC	0.423																																					p.C411X													.	.			0			c.C1233A												88.0	73.0	78.0					5																	90667229		2203	4300	6503	SO:0001587	stop_gained	57561	exon8			AGAGGGGCAGGAT	AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.1233C>A	5.37:g.90667229G>T	ENSP00000265138:p.Cys411*		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_020801	6	0.00	0	A8K6T8|Q9P2H1	Nonsense_Mutation	SNP	ENST00000265138.3	37	CCDS34202.1	.	.	.	.	.	.	.	.	.	.	G	39	7.299924	0.98196	.	.	ENSG00000113369	ENST00000265138	.	.	.	5.85	4.09	0.47781	.	0.041093	0.85682	D	0.000000	.	.	.	.	.	.	0.46416	D	0.999037	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.1844	12.5717	0.56341	0.1335:0.0:0.8665:0.0	.	.	.	.	X	411	.	ENSP00000265138:C411X	C	-	3	2	ARRDC3	90702985	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.142000	0.42177	0.840000	0.34995	-0.122000	0.15005	TGC			0.423	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369763.2		NM_020801	
BCLAF1P1	728366	bcgsc.ca	37	5	110283861	110283861	+	IGR	SNP	G	G	A	rs76289261		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr5:110283861G>A								SLC25A46 (183004 upstream) : CTC-551A13.1 (22788 downstream)																							TTTGAAGTTAGAGCACCCTCT	0.413																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AAGTTAGAGCACC																													5.37:g.110283861G>A			Somatic	77	0.0519480519	4		WXS	Illumina HiSeq	Phase_1	34	0.26	9	.	0		0		RNA	SNP		37																																																																																					0	0.413										
BCLAF1P1	728366	bcgsc.ca	37	5	110283865	110283865	+	IGR	SNP	A	A	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr5:110283865A>G								SLC25A46 (183008 upstream) : CTC-551A13.1 (22784 downstream)																							AAGTTAGAGCACCCTCTGCCA	0.413																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TAGAGCACCCTCT																													5.37:g.110283865A>G			Somatic	81	0.0617283951	5		WXS	Illumina HiSeq	Phase_1	36	0.28	10	.	0		0		RNA	SNP		37																																																																																					0	0.413										
H2AFY	9555	mdanderson.org	37	5	134678955	134678955	+	Silent	SNP	G	G	A	rs149002266	byFrequency	TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr5:134678955G>A	ENST00000511689.1	-	8	1541	c.948C>T	c.(946-948)agC>agT	p.S316S	H2AFY_ENST00000304332.4_Silent_p.S315S|H2AFY_ENST00000512507.1_5'UTR|H2AFY_ENST00000510038.1_Silent_p.S316S|CTC-349C3.1_ENST00000432382.3_Silent_p.P79P|H2AFY_ENST00000312469.4_Silent_p.S313S|H2AFY_ENST00000423969.2_Silent_p.S144S	NM_001040158.1|NM_138610.2	NP_001035248.1|NP_613258.2	O75367	H2AY_HUMAN	H2A histone family, member Y	316	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of cell cycle G2/M phase transition (GO:1902750)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|condensed chromosome (GO:0000793)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleosome (GO:0000786)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|sex chromatin (GO:0001739)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|rDNA binding (GO:0000182)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCTACCTGCCGCTGCCGATGG	0.507													G|||	8	0.00159744	0.0053	0.0014	5008	,	,		22822	0.0		0.0	False		,,,				2504	0.0				p.S316S													.	.			0			c.C948T							G	,,,	22,4384	28.1+/-56.4	0,22,2181	157.0	148.0	151.0		945,945,939,948	-11.2	0.2	5	dbSNP_134	151	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	H2AFY	NM_001040158.1,NM_004893.2,NM_138609.2,NM_138610.2	,,,	0,22,6481	AA,AG,GG		0.0,0.4993,0.1692	,,,	315/372,315/372,313/370,316/373	134678955	22,12984	2203	4300	6503	SO:0001819	synonymous_variant	9555	exon8			CCTGCCGCTGCCG	AF054174	CCDS4183.1, CCDS4184.1, CCDS4185.1	5q31.1	2011-01-27			ENSG00000113648	ENSG00000113648		"""Histones / Replication-independent"""	4740	protein-coding gene	gene with protein product		610054				9653160, 9714746	Standard	NM_004893		Approved	macroH2A1.2	uc003lam.1	O75367	OTTHUMG00000129141	ENST00000511689.1:c.948C>T	5.37:g.134678955G>A			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_138610	470	0.00	0	O75377|Q503A8|Q7Z5E3|Q96D41|Q9H8P3|Q9UP96	Silent	SNP	ENST00000511689.1	37	CCDS4185.1																																																																																			0.002		0.507	H2AFY-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251196.3		NM_004893	
CDC25C	995	mdanderson.org	37	5	137622859	137622859	+	Splice_Site	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr5:137622859T>C	ENST00000323760.6	-	11	1303	c.1025A>G	c.(1024-1026)cAg>cGg	p.Q342R	CDC25C_ENST00000357274.3_Splice_Site_p.Q299R|CDC25C_ENST00000415130.2_Splice_Site_p.Q269R|CDC25C_ENST00000513970.1_Splice_Site_p.Q342R|CDC25C_ENST00000356505.3_Splice_Site_p.Q312R|CDC25C_ENST00000514555.1_Splice_Site_p.Q312R|CDC25C_ENST00000348983.3_Splice_Site_p.Q269R	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	342	HIV-1 Vpr binding site.|Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TCGTCTCACCTGGATGTGTCC	0.478																																					p.Q342R													.	.			0			c.A1025G												100.0	98.0	99.0					5																	137622859		2203	4300	6503	SO:0001630	splice_region_variant	995	exon11			CTCACCTGGATGT	M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.1026+1A>G	5.37:g.137622859T>C			Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_001790	28	0.00	0	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	37	CCDS4202.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.220907	0.58560	.	.	ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555	T;T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82;1.82	4.98	2.49	0.30216	Rhodanese-like (5);	0.406125	0.25030	N	0.033688	T	0.14743	0.0356	N	0.02539	-0.55	0.31222	N	0.697305	D;D;P;D	0.54964	0.961;0.969;0.956;0.968	P;P;P;P	0.53518	0.728;0.728;0.61;0.725	T	0.08006	-1.0743	10	0.41790	T	0.15	-3.4267	6.2455	0.20815	0.1463:0.0803:0.0:0.7734	.	359;312;269;342	G3V1P6;P30307-2;P30307-4;P30307	.;.;.;MPIP3_HUMAN	R	342;312;299;269;269;342;359;312	ENSP00000321656:Q342R;ENSP00000348898:Q312R;ENSP00000349821:Q299R;ENSP00000345205:Q269R;ENSP00000392631:Q269R;ENSP00000424795:Q342R;ENSP00000425470:Q312R	ENSP00000321656:Q342R	Q	-	2	0	CDC25C	137650758	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	2.717000	0.47227	0.429000	0.26202	0.533000	0.62120	CAG			0.478	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251280.1			Missense_Mutation
ATP10B	23120	mdanderson.org	37	5	160114833	160114833	+	Silent	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr5:160114833G>T	ENST00000327245.5	-	5	1095	c.249C>A	c.(247-249)ccC>ccA	p.P83P	CTC-529G1.1_ENST00000524198.1_RNA|ATP10B_ENST00000518411.1_5'UTR	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	83					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGAGATTCCGGGGCAGGAAGG	0.458																																					p.P83P													.	.			0			c.C249A												183.0	187.0	186.0					5																	160114833		1929	4127	6056	SO:0001819	synonymous_variant	23120	exon5			ATTCCGGGGCAGG	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.249C>A	5.37:g.160114833G>T			Somatic	210	0	0		WXS	Illumina HiSeq	Phase_I	121	0.04	5	NM_025153	0		0	Q9H725	Silent	SNP	ENST00000327245.5	37	CCDS43394.1																																																																																					0.458	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374127.1		NM_025153	
ABCF1	23	broad.mit.edu	37	6	30557690	30557690	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr6:30557690G>T	ENST00000326195.8	+	22	2284	c.2172G>T	c.(2170-2172)aaG>aaT	p.K724N	ABCF1_ENST00000376545.3_Missense_Mutation_p.K686N|ABCF1_ENST00000396515.4_Missense_Mutation_p.K117N	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	724	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						ATGCCCGCAAGTGCCTGGGCC	0.617																																					p.K724N													.	ABCF1	61		0			c.G2172T												138.0	155.0	149.0					6																	30557690		1511	2709	4220	SO:0001583	missense	23	exon22			CCGCAAGTGCCTG	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.2172G>T	6.37:g.30557690G>T	ENSP00000313603:p.Lys724Asn		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	60	0.05	3	NM_001025091	140	0.00	0	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	.	.	.	.	.	.	.	.	.	.	g	15.57	2.872369	0.51695	.	.	ENSG00000204574	ENST00000326195;ENST00000376545;ENST00000396515	T;D;T	0.94138	1.42;-3.36;3.31	5.94	5.07	0.68467	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	T	0.81288	0.4791	N	0.11927	0.2	0.58432	D	0.999999	P;P;P	0.37370	0.592;0.592;0.592	B;B;B	0.41135	0.348;0.241;0.241	D	0.83952	0.0317	10	0.62326	D	0.03	-33.6584	7.9635	0.30085	0.236:0.0:0.764:0.0	.	117;686;724	Q5STZ7;Q2L6I2;Q8NE71	.;.;ABCF1_HUMAN	N	724;686;117	ENSP00000313603:K724N;ENSP00000365728:K686N;ENSP00000379772:K117N	ENSP00000313603:K724N	K	+	3	2	ABCF1	30665669	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.440000	0.52886	1.516000	0.48900	0.651000	0.88453	AAG			0.617	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000076137.3			
TMEM63B	55362	mdanderson.org	37	6	44114585	44114585	+	Splice_Site	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr6:44114585G>T	ENST00000259746.9	+	11	967	c.784G>T	c.(784-786)Gaa>Taa	p.E262*	TMEM63B_ENST00000323267.6_Splice_Site_p.E262*			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	262					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			GTGTTTCAGGGAAGCCTACCC	0.557																																					p.E262X													.	.			0			c.G784T												121.0	104.0	109.0					6																	44114585		2203	4300	6503	SO:0001630	splice_region_variant	55362	exon11			TTCAGGGAAGCCT	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.783-1G>T	6.37:g.44114585G>T			Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	78	0.08	6	NM_018426	34	0.00	0	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Nonsense_Mutation	SNP	ENST00000259746.9	37	CCDS34461.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.1|26.1	4.700255|4.700255	0.88924|0.88924	.|.	.|.	ENSG00000137216|ENSG00000137216	ENST00000259746;ENST00000323267|ENST00000371893	.|.	.|.	.|.	4.37|4.37	4.37|4.37	0.52481|0.52481	.|.	0.347798|.	0.30602|.	N|.	0.009269|.	.|T	.|0.63977	.|0.2557	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64478	.|-0.6398	.|3	0.41790|.	T|.	0.15|.	.|.	16.4459|16.4459	0.83932|0.83932	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|S	262|190	.|.	ENSP00000259746:E262X|.	E|R	+|+	1|3	0|2	TMEM63B|TMEM63B	44222563|44222563	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.887000|0.887000	0.51463|0.51463	4.468000|4.468000	0.60162|0.60162	2.418000|2.418000	0.82041|0.82041	0.650000|0.650000	0.86243|0.86243	GAA|AGG			0.557	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040712.2		XM_166410	Nonsense_Mutation
FAM83B	222584	broad.mit.edu	37	6	54806078	54806078	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr6:54806078A>G	ENST00000306858.7	+	5	2425	c.2309A>G	c.(2308-2310)aAg>aGg	p.K770R	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	770										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TTTTTGAAAAAGGGGTCTCAG	0.363																																					p.K770R													FAM83B,right_upper_lobe,carcinoma,0,1	FAM83B	186	1	0			c.A2309G												53.0	56.0	55.0					6																	54806078		2203	4300	6503	SO:0001583	missense	222584	exon5			TGAAAAAGGGGTC	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2309A>G	6.37:g.54806078A>G	ENSP00000304078:p.Lys770Arg		Somatic	181	0.0055248619	1		WXS	Illumina HiSeq	Phase_I	166	0.02	4	NM_001010872	0		0	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.283144	0.59867	.	.	ENSG00000168143	ENST00000306858	T	0.12039	2.72	5.63	4.47	0.54385	.	0.065633	0.64402	N	0.000008	T	0.08492	0.0211	M	0.71581	2.175	0.46701	D	0.999164	B	0.22541	0.071	B	0.17722	0.019	T	0.02625	-1.1132	10	0.62326	D	0.03	-25.7974	11.2864	0.49224	0.9288:0.0:0.0712:0.0	.	770	Q5T0W9	FA83B_HUMAN	R	770	ENSP00000304078:K770R	ENSP00000304078:K770R	K	+	2	0	FAM83B	54914037	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.511000	0.60462	0.979000	0.38497	0.533000	0.62120	AAG			0.363	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040994.1		XM_294139	
NPC1L1	29881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44555488	44555488	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr7:44555488A>T	ENST00000289547.4	-	19	3846	c.3791T>A	c.(3790-3792)aTc>aAc	p.I1264N	NPC1L1_ENST00000546276.1_Missense_Mutation_p.I1191N|NPC1L1_ENST00000381160.3_Missense_Mutation_p.I1237N	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1264					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GAAGAAGAAGATCTGAATGAG	0.612																																					p.I1264N													.	.			0			c.T3791A												69.0	70.0	70.0					7																	44555488		2203	4300	6503	SO:0001583	missense	29881	exon19			AAGAAGATCTGAA		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3791T>A	7.37:g.44555488A>T	ENSP00000289547:p.Ile1264Asn		Somatic	108	0	0		WXS	Illumina HiSeq	.	87	0.16	14	NM_013389	0		0	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.153496	0.78114	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.87412	-2.25;-2.25;-2.25	5.49	5.49	0.81192	.	0.051986	0.64402	D	0.000001	D	0.93884	0.8043	M	0.87971	2.92	0.49582	D	0.999808	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.994;0.997;1.0	D	0.94745	0.7922	10	0.87932	D	0	-37.6642	13.5148	0.61535	1.0:0.0:0.0:0.0	.	1191;1237;1264	B7ZLE6;Q17RV5;D3DVK9	.;.;.	N	1264;1237;1191	ENSP00000289547:I1264N;ENSP00000370552:I1237N;ENSP00000438033:I1191N	ENSP00000289547:I1264N	I	-	2	0	NPC1L1	44522013	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	8.575000	0.90766	2.092000	0.63282	0.459000	0.35465	ATC			0.612	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251256.1		NM_013389	
GUSBP6	0	bcgsc.ca	37	7	63601979	63601979	+	RNA	SNP	C	C	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr7:63601979C>G	ENST00000434932.1	+	0	115				RP11-321E8.4_ENST00000442436.1_lincRNA					glucuronidase, beta pseudogene 6																		GCAGGTAGCCCTGGAGCTGAG	0.378																																					.													.	.			0			.																																											0	.			GTAGCCCTGGAGC			7q11.21	2011-06-09			ENSG00000224458	ENSG00000224458			42320	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000156481		7.37:g.63601979C>G			Somatic	98	0	0		WXS	Illumina HiSeq	Phase_1	82	0.13	11	.	0		0		RNA	SNP	ENST00000434932.1	37																																																																																						0.378	GUSBP6-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene		OTTHUMT00000344314.1			
GTF2I	2969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	74105442	74105442	+	Splice_Site	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr7:74105442T>C	ENST00000324896.4	+	3	626	c.237T>C	c.(235-237)taT>taC	p.Y79Y	GTF2I_ENST00000346152.4_Splice_Site_p.Y79Y|AC083884.8_ENST00000450426.2_RNA|GTF2I_ENST00000353920.4_Splice_Site_p.Y79Y|GTF2I_ENST00000443166.1_Splice_Site_p.Y79Y|GTF2I_ENST00000416070.1_Splice_Site_p.Y79Y	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	79					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						TTGTAAAATATTGTAAGCATT	0.294																																					p.Y79Y													.	.			0			c.T237C												52.0	54.0	53.0					7																	74105442		2203	4300	6503	SO:0001630	splice_region_variant	2969	exon3			AAAATATTGTAAG	U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.238+1T>C	7.37:g.74105442T>C			Somatic	236	0	0		WXS	Illumina HiSeq	.	235	0.11	27	NM_032999	42	0.14	6	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Silent	SNP	ENST00000324896.4	37	CCDS5573.1																																																																																					0.294	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252708.1		NM_032999	Silent
PVRIG	79037	mdanderson.org	37	7	99818409	99818409	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr7:99818409G>T	ENST00000317271.2	+	5	986	c.623G>T	c.(622-624)cGc>cTc	p.R208L	GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA|AC005071.1_ENST00000410550.1_RNA	NM_024070.3	NP_076975.2	Q6DKI7	PVRIG_HUMAN	poliovirus receptor related immunoglobulin domain containing	208						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)	11	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGCCGTCCCGCACCAGCCCC	0.697																																					p.R208L													.	.			0			c.G623T												42.0	45.0	44.0					7																	99818409		2203	4300	6503	SO:0001583	missense	79037	exon5			CGTCCCGCACCAG	BC001129	CCDS5690.1	7q22.1	2013-06-26			ENSG00000213413	ENSG00000213413			32190	protein-coding gene	gene with protein product						16926269	Standard	NM_024070		Approved	MGC2463, C7orf15	uc003uuf.1	Q6DKI7	OTTHUMG00000156798	ENST00000317271.2:c.623G>T	7.37:g.99818409G>T	ENSP00000316675:p.Arg208Leu		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_024070	58	0.00	0	D6W5U9|Q9BVK3	Missense_Mutation	SNP	ENST00000317271.2	37	CCDS5690.1	.	.	.	.	.	.	.	.	.	.	g	1.338	-0.594916	0.03771	.	.	ENSG00000213413	ENST00000317271	T	0.42900	0.96	2.78	-5.57	0.02521	.	.	.	.	.	T	0.18718	0.0449	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17592	-1.0364	9	0.24483	T	0.36	.	4.6381	0.12534	0.496:0.0:0.2943:0.2097	.	208	Q6DKI7	PVRIG_HUMAN	L	208	ENSP00000316675:R208L	ENSP00000316675:R208L	R	+	2	0	PVRIG	99656345	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.741000	0.00798	-1.378000	0.02120	-2.261000	0.00279	CGC			0.697	PVRIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345870.2		NM_024070	
DPY19L2P2	349152	hgsc.bcm.edu;broad.mit.edu	37	7	102920486	102920486	+	RNA	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr7:102920486T>C	ENST00000312132.4	-	0	371							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										TCCCGCCGCCTAGGGCCGACT	0.672																																					.													.	.			0			.																																											349152	.			GCCGCCTAGGGCC	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102920486T>C			Somatic	41	0	0		WXS	Illumina HiSeq	.	43	0.12	5	.	2	0.00	0	Q8N9V4|Q8ND62	RNA	SNP	ENST00000312132.4	37																																																																																						0.672	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000347877.1		NM_182634	
MDFIC	29969	broad.mit.edu	37	7	114582420	114582420	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr7:114582420G>T	ENST00000393486.1	+	3	775	c.185G>T	c.(184-186)tGg>tTg	p.W62L	MDFIC_ENST00000257724.3_Missense_Mutation_p.W171L	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						CAGTCCATTTGGGGAAATCCT	0.338																																					p.W171L													MDFIC,NS,carcinoma,-1,1	MDFIC	30	1	0			c.G512T												73.0	72.0	72.0					7																	114582420		2203	4300	6503	SO:0001583	missense	29969	exon3			CCATTTGGGGAAA	AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.185G>T	7.37:g.114582420G>T	ENSP00000377126:p.Trp62Leu		Somatic	518	0.0019305019	1		WXS	Illumina HiSeq	Phase_I	538	0.01	6	NM_199072	2	0.00	0		Missense_Mutation	SNP	ENST00000393486.1	37	CCDS55155.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807348	0.31961	.	.	ENSG00000135272	ENST00000257724;ENST00000393486;ENST00000427207;ENST00000498196	.	.	.	5.63	5.63	0.86233	.	0.424962	0.25159	N	0.032688	T	0.63558	0.2521	M	0.63428	1.95	0.80722	D	1	D	0.60575	0.988	P	0.56343	0.796	T	0.57688	-0.7768	9	0.08599	T	0.76	-3.1995	12.5267	0.56089	0.0:0.0:0.8337:0.1663	.	62	Q9P1T7	MDFIC_HUMAN	L	171;62;48;7	.	ENSP00000257724:W171L	W	+	2	0	MDFIC	114369656	1.000000	0.71417	0.998000	0.56505	0.433000	0.31745	3.779000	0.55379	2.814000	0.96858	0.591000	0.81541	TGG			0.338	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059968.4		NM_199072	
TOP1MT	116447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144406735	144406735	+	Missense_Mutation	SNP	C	C	T	rs200437445		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr8:144406735C>T	ENST00000329245.4	-	6	770	c.736G>A	c.(736-738)Gtc>Atc	p.V246I	TOP1MT_ENST00000521193.1_Missense_Mutation_p.V148I|TOP1MT_ENST00000523676.1_Missense_Mutation_p.V148I|TOP1MT_ENST00000519148.1_Missense_Mutation_p.V148I	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	246					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	AGCCACGTGACGGTGTTATCG	0.592																																					p.V246I													TOP1MT,right_lower_lobe,carcinoma,0,1	TOP1MT	0	1	0			c.G736A							C	ILE/VAL	0,4406		0,0,2203	137.0	119.0	125.0		736	3.4	0.0	8		125	1,8599	1.2+/-3.3	0,1,4299	no	missense	TOP1MT	NM_052963.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	246/602	144406735	1,13005	2203	4300	6503	SO:0001583	missense	116447	exon6			ACGTGACGGTGTT	AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.736G>A	8.37:g.144406735C>T	ENSP00000328835:p.Val246Ile		Somatic	87	0	0		WXS	Illumina HiSeq	.	74	0.11	8	NM_052963	56	0.23	13	B7ZAR5|E7ES89|Q86ST4|Q86V82	Missense_Mutation	SNP	ENST00000329245.4	37	CCDS6400.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042457	0.55003	0.0	1.16E-4	ENSG00000184428	ENST00000329245;ENST00000521193;ENST00000519148;ENST00000523676;ENST00000522041;ENST00000519591	T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14	3.44	3.44	0.39384	DNA topoisomerase I, C-terminal, eukaryotic-type (1);DNA topoisomerase I, DNA binding, mixed alpha/beta motif, eukaryotic-type (1);DNA topoisomerase I, DNA binding, eukaryotic-type (2);	0.000000	0.40728	U	0.001040	T	0.68329	0.2989	H	0.94582	3.555	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74023	0.982;0.976	T	0.79210	-0.1897	10	0.87932	D	0	.	13.8723	0.63626	0.0:1.0:0.0:0.0	.	41;246	E7ESI1;Q969P6	.;TOP1M_HUMAN	I	246;148;148;148;148;148	ENSP00000328835:V246I;ENSP00000428369:V148I;ENSP00000429169:V148I;ENSP00000429181:V148I;ENSP00000427998:V148I;ENSP00000429177:V148I	ENSP00000328835:V246I	V	-	1	0	TOP1MT	144478110	1.000000	0.71417	0.011000	0.14972	0.017000	0.09413	6.387000	0.73191	1.432000	0.47375	0.609000	0.83330	GTC	0.001		0.592	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381247.3		NM_052963	
ZNF251	90987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145948392	145948392	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr8:145948392A>G	ENST00000292562.7	-	5	928	c.653T>C	c.(652-654)tTc>tCc	p.F218S	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		ATTATATTTGAAGGTTTTGCT	0.413																																					p.F218S													.	.			0			c.T653C												64.0	67.0	66.0					8																	145948392		1953	4181	6134	SO:0001583	missense	90987	exon5			TATTTGAAGGTTT	AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.653T>C	8.37:g.145948392A>G	ENSP00000292562:p.Phe218Ser		Somatic	215	0	0		WXS	Illumina HiSeq	.	206	0.13	27	NM_138367	10	0.10	1	Q2M219	Missense_Mutation	SNP	ENST00000292562.7	37	CCDS47944.1	.	.	.	.	.	.	.	.	.	.	A	16.69	3.193192	0.58017	.	.	ENSG00000198169	ENST00000292562	T	0.74842	-0.88	2.12	2.12	0.27331	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85669	0.5750	M	0.89904	3.07	0.28859	N	0.895629	D	0.89917	1.0	D	0.76575	0.988	T	0.75772	-0.3200	9	0.87932	D	0	-7.127	5.7087	0.17923	0.7592:0.0:0.0:0.2408	.	218	Q9BRH9	ZN251_HUMAN	S	218	ENSP00000292562:F218S	ENSP00000292562:F218S	F	-	2	0	ZNF251	145919201	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.958000	0.63660	1.202000	0.43218	0.460000	0.39030	TTC			0.413	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382541.1		NM_138367	
HAUS6	54801	broad.mit.edu	37	9	19094323	19094323	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr9:19094323T>C	ENST00000380502.3	-	3	762	c.295A>G	c.(295-297)Agg>Ggg	p.R99G	HAUS6_ENST00000380496.1_5'Flank	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	99					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ACAGAAATCCTTTTTATCCAT	0.313																																					p.R99G													.	HAUS6	66		0			c.A295G												40.0	42.0	41.0					9																	19094323		2203	4298	6501	SO:0001583	missense	54801	exon3			AAATCCTTTTTAT	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.295A>G	9.37:g.19094323T>C	ENSP00000369871:p.Arg99Gly		Somatic	684	0.0014619883	1		WXS	Illumina HiSeq	Phase_I	544	0.01	4	NM_017645	5	0.00	0	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.399386	0.42512	.	.	ENSG00000147874	ENST00000380502	T	0.23950	1.88	4.93	3.79	0.43588	.	0.363197	0.32258	N	0.006358	T	0.12732	0.0309	N	0.08118	0	0.80722	D	1	B	0.15719	0.014	B	0.06405	0.002	T	0.05937	-1.0855	10	0.62326	D	0.03	-0.0377	8.08	0.30739	0.0:0.1:0.0:0.9	.	99	Q7Z4H7	HAUS6_HUMAN	G	99	ENSP00000369871:R99G	ENSP00000369871:R99G	R	-	1	2	HAUS6	19084323	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.344000	0.33941	0.755000	0.32990	0.446000	0.29264	AGG			0.313	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051825.1		NM_017645	
NFX1	4799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33344183	33344183	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr9:33344183C>T	ENST00000379540.3	+	14	2403	c.2341C>T	c.(2341-2343)Cca>Tca	p.P781S	NFX1_ENST00000318524.6_Missense_Mutation_p.P781S|NFX1_ENST00000379521.4_Missense_Mutation_p.P781S	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	781					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GTGTGACCATCCAGGTGAGTA	0.507																																					p.P781S													.	.			0			c.C2341T												168.0	125.0	139.0					9																	33344183		2203	4300	6503	SO:0001583	missense	4799	exon14			GACCATCCAGGTG	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.2341C>T	9.37:g.33344183C>T	ENSP00000368856:p.Pro781Ser		Somatic	156	0	0		WXS	Illumina HiSeq	.	120	0.20	24	NM_147134	50	0.36	18	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395862	0.83011	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.52526	0.66;0.66;0.66	5.49	5.49	0.81192	Zinc finger, NF-X1-type (1);	0.052793	0.85682	D	0.000000	T	0.67420	0.2891	M	0.68728	2.09	0.80722	D	1	D;D;P;D;P	0.89917	1.0;1.0;0.952;1.0;0.911	D;D;P;D;P	0.78314	0.991;0.971;0.78;0.987;0.674	T	0.68179	-0.5477	10	0.54805	T	0.06	-3.1228	16.8552	0.86004	0.0:1.0:0.0:0.0	.	781;665;781;781;781	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	S	781	ENSP00000368856:P781S;ENSP00000368836:P781S;ENSP00000317695:P781S	ENSP00000317695:P781S	P	+	1	0	NFX1	33334183	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	5.920000	0.70017	2.581000	0.87130	0.561000	0.74099	CCA			0.507	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052069.1			
ALDH1B1	219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	38395924	38395924	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr9:38395924C>A	ENST00000377698.3	+	2	332	c.179C>A	c.(178-180)aCc>aAc	p.T60N		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	60					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		GTCAACCCTACCACCGGGGAG	0.597																																					p.T60N													.	.			0			c.C179A												92.0	86.0	88.0					9																	38395924		2203	4300	6503	SO:0001583	missense	219	exon2			ACCCTACCACCGG	M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.179C>A	9.37:g.38395924C>A	ENSP00000366927:p.Thr60Asn		Somatic	51	0	0		WXS	Illumina HiSeq	.	41	0.20	8	NM_000692	4	0.00	0	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	37	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	C	4.858	0.159477	0.09236	.	.	ENSG00000137124	ENST00000377698	T	0.15952	2.38	5.81	2.85	0.33270	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.987507	0.08245	N	0.975452	T	0.20700	0.0498	L	0.36672	1.1	0.09310	N	1	B	0.15473	0.013	B	0.28784	0.094	T	0.43589	-0.9382	10	0.72032	D	0.01	.	15.6745	0.77303	0.0:0.451:0.549:0.0	.	60	P30837	AL1B1_HUMAN	N	60	ENSP00000366927:T60N	ENSP00000366927:T60N	T	+	2	0	ALDH1B1	38385924	0.030000	0.19436	0.095000	0.20976	0.029000	0.11900	2.813000	0.48002	0.327000	0.23409	-0.150000	0.13652	ACC			0.597	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052492.1			
LOC100996643	100996643	broad.mit.edu	37	9	67294000	67294001	+	RNA	INS	-	-	TGT	rs373498420		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr9:67294000_67294001insTGT	ENST00000432011.2	+	0	501																											AGAATTCAGTCTATTTAAATGG	0.371																																					.													.	.			0			.																																											0	.			TTCAGTCTATTTA																													9.37:g.67294000_67294001insTGT			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	12	0.25	3	.	0		0		RNA	INS	ENST00000432011.2	37																																																																																						0.371	RP11-236F9.2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000143981.2			
TMOD1	7111	mdanderson.org	37	9	100325015	100325015	+	Splice_Site	SNP	G	G	T	rs199728770		TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr9:100325015G>T	ENST00000259365.4	+	5	612	c.399G>T	c.(397-399)gcG>gcT	p.A133A	TMOD1_ENST00000375175.1_Splice_Site_p.S6S|TMOD1_ENST00000395211.2_Splice_Site_p.A133A	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	133	Tropomyosin-binding. {ECO:0000255}.				adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)				breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		TCCCTGCAGCGATCCTGGGCA	0.572																																					p.A133A													.	.			0			c.G399T												153.0	138.0	143.0					9																	100325015		2203	4300	6503	SO:0001630	splice_region_variant	7111	exon5			TGCAGCGATCCTG		CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.398-1G>T	9.37:g.100325015G>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001166116	42	0.00	0	B2RB77|Q5T7W3|Q9BUF1	Silent	SNP	ENST00000259365.4	37	CCDS6726.1																																																																																					0.572	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053320.2		NM_003275	Silent
OR5C1	392391	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125551981	125551981	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr9:125551981G>A	ENST00000373680.2	+	1	832	c.770G>A	c.(769-771)gGg>gAg	p.G257E		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						ATGATGTACGGGACACTCATT	0.597																																					p.G257E													OR5C1,NS,carcinoma,-1,1	OR5C1	-1	1	0			c.G770A												98.0	81.0	87.0					9																	125551981		2203	4300	6503	SO:0001583	missense	392391	exon1			TGTACGGGACACT	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.770G>A	9.37:g.125551981G>A	ENSP00000362784:p.Gly257Glu		Somatic	130	0.0076923077	1		WXS	Illumina HiSeq	.	81	0.11	9	NM_001001923	0		0	B2RN54|B9EGT0|Q96RC4	Missense_Mutation	SNP	ENST00000373680.2	37	CCDS35131.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036443	0.54896	.	.	ENSG00000148215	ENST00000373680	T	0.39056	1.1	5.46	5.46	0.80206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37012	U	0.002300	T	0.79782	0.4505	H	0.98833	4.345	0.41448	D	0.987968	D	0.89917	1.0	D	0.81914	0.995	D	0.87852	0.2658	10	0.87932	D	0	.	18.2528	0.90009	0.0:0.0:1.0:0.0	.	257	Q8NGR4	OR5C1_HUMAN	E	257	ENSP00000362784:G257E	ENSP00000362784:G257E	G	+	2	0	OR5C1	124591802	0.481000	0.25941	0.939000	0.37840	0.330000	0.28571	1.389000	0.34453	2.840000	0.97914	0.655000	0.94253	GGG			0.597	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053953.1			
MT-CYB	4519	broad.mit.edu;bcgsc.ca	37	M	14895	14895	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrM:14895T>C	ENST00000361789.2	+	1	149	c.149T>C	c.(148-150)tTc>tCc	p.F50S	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	50					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CACAGGACTATTCCTAGCCAT	0.517																																					p.F50S													.	.			0			c.T149C																																									SO:0001583	missense	4519	exon1			GACTATTCCTAGC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.149T>C	M.37:g.14895T>C	ENSP00000354554:p.Phe50Ser		Somatic	95	0.0105263158	1		WXS	Illumina HiSeq	Phase_I	37	0.49	18	ENST00000361789	0		0	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																						0.517	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024038	
PNPLA4	8228	broad.mit.edu	37	X	7868821	7868821	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrX:7868821A>G	ENST00000381042.4	-	7	838	c.668T>C	c.(667-669)cTt>cCt	p.L223P	PNPLA4_ENST00000537427.1_Missense_Mutation_p.L136P|PNPLA4_ENST00000444736.1_Missense_Mutation_p.L223P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	223					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGGGGGAAAAAGGGCTTGGTT	0.353																																					p.L223P													.	PNPLA4	24		0			c.T668C												57.0	52.0	54.0					X																	7868821		2203	4299	6502	SO:0001583	missense	8228	exon7			GGAAAAAGGGCTT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.668T>C	X.37:g.7868821A>G	ENSP00000370430:p.Leu223Pro		Somatic	364	0	0		WXS	Illumina HiSeq	Phase_I	394	0.01	5	NM_004650	111	0.00	0	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341460	0.41498	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.81078	-1.45;-1.45;-1.45	4.38	4.38	0.52667	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.193685	0.33127	N	0.005243	D	0.89866	0.6839	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90635	0.4570	10	0.87932	D	0	-22.634	9.3053	0.37872	1.0:0.0:0.0:0.0	.	223	P41247	PLPL4_HUMAN	P	223;223;136	ENSP00000370430:L223P;ENSP00000415245:L223P;ENSP00000443157:L136P	ENSP00000370430:L223P	L	-	2	0	PNPLA4	7828821	1.000000	0.71417	0.139000	0.22197	0.388000	0.30384	5.486000	0.66856	1.452000	0.47756	0.481000	0.45027	CTT			0.353	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055687.1		NM_004650	
POLA1	5422	broad.mit.edu	37	X	24833115	24833115	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrX:24833115C>T	ENST00000379059.3	+	30	3313	c.3298C>T	c.(3298-3300)Ctt>Ttt	p.L1100F	POLA1_ENST00000379068.3_Missense_Mutation_p.L1106F	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1100					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TGGCCAGATTCTTTCTGATCA	0.358																																					p.L1100F													.	POLA1	117		0			c.C3298T												62.0	60.0	61.0					X																	24833115		2203	4300	6503	SO:0001583	missense	5422	exon30			CAGATTCTTTCTG		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.3298C>T	X.37:g.24833115C>T	ENSP00000368349:p.Leu1100Phe		Somatic	53	0.2264150943	12		WXS	Illumina HiSeq	Phase_I	51	0.39	20	NM_016937	10	0.00	0	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107188	0.77096	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.18338	2.22;2.22	5.97	5.97	0.96955	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.45716	0.1356	M	0.77406	2.37	0.80722	D	1	D	0.69078	0.997	D	0.68192	0.956	T	0.39396	-0.9616	10	0.62326	D	0.03	-12.6551	19.3344	0.94309	0.0:1.0:0.0:0.0	.	1100	P09884	DPOLA_HUMAN	F	1106;1100	ENSP00000368358:L1106F;ENSP00000368349:L1100F	ENSP00000368349:L1100F	L	+	1	0	POLA1	24743036	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.475000	0.66787	2.519000	0.84933	0.544000	0.68410	CTT			0.358	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056111.1		NM_016937	
CHDC2	286464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	36162793	36162793	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrX:36162793C>A	ENST00000313548.4	+	11	1562	c.1376C>A	c.(1375-1377)aCa>aAa	p.T459K		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	459	CH.					integral component of membrane (GO:0016021)											gtggccagaacaaagagacag	0.443																																					p.T459K													.	.			0			c.C1376A												119.0	103.0	108.0					X																	36162793		2202	4300	6502	SO:0001583	missense	286464	exon11			CCAGAACAAAGAG	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1376C>A	X.37:g.36162793C>A	ENSP00000324767:p.Thr459Lys		Somatic	109	0	0		WXS	Illumina HiSeq	.	97	0.33	32	NM_173695	3	0.33	1		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	C	4.880	0.163553	0.09287	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	0.694	-0.349	0.12609	.	8.372750	0.01088	U	0.005125	T	0.13415	0.0325	N	0.08118	0	0.09310	N	1	B	0.33883	0.43	B	0.17722	0.019	T	0.09037	-1.0693	8	0.33940	T	0.23	.	.	.	.	.	459	Q8N9S7	CX059_HUMAN	K	459	.	ENSP00000324767:T459K	T	+	2	0	CXorf59	36072714	0.223000	0.23663	0.002000	0.10522	0.002000	0.02628	0.441000	0.21611	-0.227000	0.09884	-0.224000	0.12420	ACA			0.443	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_173695	
SUV39H1	6839	mdanderson.org	37	X	48564674	48564674	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrX:48564674G>T	ENST00000376687.3	+	4	1037	c.847G>T	c.(847-849)Gca>Tca	p.A283S	AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000482260.1_3'UTR|SUV39H1_ENST00000453214.2_Missense_Mutation_p.R130S|SUV39H1_ENST00000337852.6_Missense_Mutation_p.A294S	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	283	Mediates interaction with MECOM. {ECO:0000250}.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						CTCAGAGGAGGCAGAGCGGCG	0.597																																					p.A283S													.	.			0			c.G847T												60.0	55.0	57.0					X																	48564674		2203	4300	6503	SO:0001583	missense	6839	exon4			GAGGAGGCAGAGC	AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.847G>T	X.37:g.48564674G>T	ENSP00000365877:p.Ala283Ser		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_003173	18	0.00	0	B2R6E8|B4DST0|Q53G60|Q6FHK6	Missense_Mutation	SNP	ENST00000376687.3	37	CCDS14304.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.82|17.82	3.484208|3.484208	0.63962|0.63962	.|.	.|.	ENSG00000101945|ENSG00000101945	ENST00000337852;ENST00000376687|ENST00000448548;ENST00000453214	D;D|.	0.84873|.	-1.91;-1.91|.	4.39|4.39	4.39|4.39	0.52855|0.52855	SET domain (3);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.73674|0.73674	0.3617|0.3617	M|M	0.85630|0.85630	2.765|2.765	0.34664|0.34664	D|D	0.722947|0.722947	D;D|.	0.60575|.	0.988;0.988|.	D;D|.	0.68483|.	0.937;0.958|.	T|T	0.83346|0.83346	-0.0005|-0.0005	10|5	0.62326|.	D|.	0.03|.	.|.	13.4036|13.4036	0.60898|0.60898	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	294;283|.	B4DST0;O43463|.	.;SUV91_HUMAN|.	S|S	294;283|279;130	ENSP00000337976:A294S;ENSP00000365877:A283S|.	ENSP00000337976:A294S|.	A|R	+|+	1|3	0|2	SUV39H1|SUV39H1	48449618|48449618	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.376000|0.376000	0.30014|0.30014	9.595000|9.595000	0.98260|0.98260	2.024000|2.024000	0.59613|0.59613	0.287000|0.287000	0.19450|0.19450	GCA|AGG			0.597	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058909.1		NM_003173	
FAM104B	90736	mdanderson.org	37	X	55172645	55172645	+	Missense_Mutation	SNP	C	C	G	rs1047042	byFrequency	TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrX:55172645C>G	ENST00000358460.4	-	3	373	c.220G>C	c.(220-222)Gat>Cat	p.D74H	FAM104B_ENST00000489298.1_Missense_Mutation_p.D73H|FAM104B_ENST00000425133.2_Missense_Mutation_p.D75H|FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000332132.4_Missense_Mutation_p.D75H|FAM104B_ENST00000477847.2_Missense_Mutation_p.D71H|FAM104B_ENST00000472571.2_3'UTR			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	74				D -> V (in Ref. 1; BAG61768). {ECO:0000305}.						endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						AAGTTTGCATCGGGTTCAGTA	0.468													C|||	5	0.0013245	0.0023	0.0	3775	,	,		14416	0.0		0.0	False		,,,				2504	0.002				p.D75H													.	.			0			c.G223C												136.0	110.0	119.0					X																	55172645		2203	4300	6503	SO:0001583	missense	90736	exon3			TTGCATCGGGTTC	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.220G>C	X.37:g.55172645C>G	ENSP00000364101:p.Asp74His		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_001166700	160	0.00	0	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	c	3.193	-0.165363	0.06461	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	1.59	-1.04	0.10068	.	0.505297	0.17523	U	0.171170	T	0.25044	0.0608	N	0.14661	0.345	0.09310	N	1	B;P;P	0.46859	0.002;0.774;0.885	B;P;B	0.46479	0.001;0.518;0.241	T	0.15065	-1.0450	10	0.56958	D	0.05	-1.547	4.2247	0.10575	0.0:0.4679:0.0:0.5321	.	75;74;75	Q5XKR9-3;Q5XKR9;Q5XKR9-2	.;F104B_HUMAN;.	H	74;75;75;71;73	ENSP00000364101:D74H;ENSP00000333394:D75H;ENSP00000397188:D75H;ENSP00000421161:D71H;ENSP00000423164:D73H	ENSP00000333394:D75H	D	-	1	0	FAM104B	55189370	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.019000	0.12546	-0.355000	0.08199	-0.556000	0.04195	GAT			0.468	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056851.1		NM_138362	
ARMCX5	64860	broad.mit.edu	37	X	101858297	101858297	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrX:101858297C>T	ENST00000604957.1	+	1	3850	c.1228C>T	c.(1228-1230)Cag>Tag	p.Q410*	ARMCX5_ENST00000536530.1_Nonsense_Mutation_p.Q410*|RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000246174.2_Nonsense_Mutation_p.Q410*|ARMCX5_ENST00000537008.1_Nonsense_Mutation_p.Q410*|RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000541409.1_Nonsense_Mutation_p.Q410*|ARMCX5_ENST00000372742.1_Nonsense_Mutation_p.Q410*	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	410										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						CTCCCCTGTGCAGCTGGCTGG	0.408																																					p.Q410X													.	ARMCX5	55		0			c.C1228T												55.0	55.0	55.0					X																	101858297		2203	4300	6503	SO:0001587	stop_gained	64860	exon3			CCTGTGCAGCTGG		CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1228C>T	X.37:g.101858297C>T	ENSP00000474720:p.Gln410*		Somatic	299	0	0		WXS	Illumina HiSeq	Phase_I	248	0.02	4	NM_022838	83	0.00	0	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Nonsense_Mutation	SNP	ENST00000604957.1	37	CCDS14500.1	.	.	.	.	.	.	.	.	.	.	C	36	5.958381	0.97145	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	.	.	.	3.9	3.9	0.45041	.	0.000000	0.40222	N	0.001143	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-6.6811	10.4314	0.44409	0.0:1.0:0.0:0.0	.	.	.	.	X	410	.	ENSP00000246174:Q410X	Q	+	1	0	ARMCX5	101744953	0.765000	0.28485	0.039000	0.18376	0.021000	0.10359	1.700000	0.37815	2.219000	0.72066	0.529000	0.55759	CAG			0.408	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000469659.1		NM_022838	
MAGEC1	9947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	140994527	140994527	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chrX:140994527C>T	ENST00000285879.4	+	4	1623	c.1337C>T	c.(1336-1338)cCt>cTt	p.P446L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	446										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCAGATTCCTGTGAGCTCC	0.463										HNSCC(15;0.026)																											p.P446L													.	.			0			c.C1337T												96.0	105.0	102.0					X																	140994527		2197	4289	6486	SO:0001583	missense	9947	exon4			AGATTCCTGTGAG	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1337C>T	X.37:g.140994527C>T	ENSP00000285879:p.Pro446Leu		Somatic	267	0	0		WXS	Illumina HiSeq	.	234	0.28	66	NM_005462	4	0.00	0	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	4.507	0.093990	0.08632	.	.	ENSG00000155495	ENST00000285879	T	0.02280	4.36	0.131	0.131	0.14755	.	.	.	.	.	T	0.01222	0.0040	N	0.08118	0	0.09310	N	1	B	0.20459	0.045	B	0.10450	0.005	T	0.47586	-0.9106	9	0.45353	T	0.12	.	2.6709	0.05067	0.0:0.5187:0.0:0.4813	.	446	O60732	MAGC1_HUMAN	L	446	ENSP00000285879:P446L	ENSP00000285879:P446L	P	+	2	0	MAGEC1	140822193	0.001000	0.12720	0.007000	0.13788	0.007000	0.05969	0.243000	0.18106	0.157000	0.19338	0.158000	0.16466	CCT			0.463	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058604.1		NM_005462	
MAPK8IP2	23542	mdanderson.org	37	22	51039298	51039298	+	Silent	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr22:51039298G>T	ENST00000329492.3	+	1	168	c.51G>T	c.(49-51)tcG>tcT	p.S17S	MAPK8IP2_ENST00000341339.4_Silent_p.S17S|MAPK8IP2_ENST00000399912.1_5'UTR|CHKB_ENST00000463053.1_Intron|MAPK8IP2_ENST00000442429.2_Silent_p.S17S|MAPK8IP2_ENST00000008876.5_5'Flank|MAPK8IP2_ENST00000399908.2_5'Flank	NM_012324.3	NP_036456.1	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting protein 2	17					behavioral fear response (GO:0001662)|dendrite morphogenesis (GO:0048813)|MAPK cascade (GO:0000165)|nonassociative learning (GO:0046958)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of signal transduction (GO:0009967)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of JNK cascade (GO:0046328)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of receptor activity (GO:0010469)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal complex assembly (GO:0007172)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|neuronal postsynaptic density (GO:0097481)	beta-amyloid binding (GO:0001540)|kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACTCGCTGTCGCCGCCGGGCT	0.776																																					.													.	.			0			.												7.0	9.0	9.0					22																	51039298		1715	3876	5591	SO:0001819	synonymous_variant	23542	.			GCTGTCGCCGCCG	AL021708	CCDS74886.1	22q13.33	2010-04-06			ENSG00000008735	ENSG00000008735			6883	protein-coding gene	gene with protein product	"""islet-brain 2"", ""JNK-interacting protein 2"""	607755	"""PRKM8 interacting protein-like"""	PRKM8IPL		10490659	Standard	NM_012324		Approved	IB2, JIP2	uc003bmy.3	Q13387	OTTHUMG00000150181	ENST00000329492.3:c.51G>T	22.37:g.51039298G>T			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	.	3	0.00	0	Q96G62|Q99771|Q9NZ59|Q9UKQ4	Silent	SNP	ENST00000329492.3	37																																																																																						0.776	MAPK8IP2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_012324	
DNM1	1759	mdanderson.org	37	9	130965794	130965794	+	Silent	SNP	G	G	T			TCGA-XE-AAO4-01A-11D-A435-10	TCGA-XE-AAO4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b226b1b2-fdac-4e87-9e91-233ce726eb5e	e6598517-60b2-435d-802a-ee3f5101cb12	g.chr9:130965794G>T	ENST00000372923.3	+	1	137	c.45G>T	c.(43-45)cgG>cgT	p.R15R	DNM1_ENST00000475805.1_Silent_p.R15R|DNM1_ENST00000486160.1_Silent_p.R15R|DNM1_ENST00000341179.7_Silent_p.R15R|DNM1_ENST00000393594.3_Silent_p.R15R|CIZ1_ENST00000372948.3_Intron|CIZ1_ENST00000393608.1_Intron	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	15					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						TGGTCAACCGGCTGCAAGACG	0.711																																					.	GBM(113;146 1575 2722 28670 29921)												.	.			0			.												17.0	14.0	15.0					9																	130965794		2189	4274	6463	SO:0001819	synonymous_variant	1759	.			CAACCGGCTGCAA	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.45G>T	9.37:g.130965794G>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	.	0		0	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Silent	SNP	ENST00000372923.3	37	CCDS6895.1																																																																																					0.711	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054367.1		NM_004408	
