#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PTPRF	5792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	44057100	44057100	+	Silent	SNP	G	G	A	rs369903923	byFrequency	TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:44057100G>A	ENST00000359947.4	+	9	1747	c.1407G>A	c.(1405-1407)gcG>gcA	p.A469A	PTPRF_ENST00000372413.3_Silent_p.A469A|PTPRF_ENST00000372414.3_Silent_p.A469A|PTPRF_ENST00000438120.1_Silent_p.A469A|PTPRF_ENST00000422171.2_5'Flank	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	469	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACACCGACGCGGGGCTCCTCA	0.701													G|||	2	0.000399361	0.0	0.0	5008	,	,		15376	0.0		0.0	False		,,,				2504	0.002				p.A469A													.	.			0			c.G1407A												9.0	10.0	10.0					1																	44057100		2183	4273	6456	SO:0001819	synonymous_variant	5792	exon9			CGACGCGGGGCTC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1407G>A	1.37:g.44057100G>A			Somatic	36	0	0		WXS	Illumina HiSeq	.	36	0.22	8	NM_002840	8	0.25	2	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.451|5.451	0.268216|0.268216	0.10349|0.10349	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568|ENST00000429895	.|.	.|.	.|.	5.62|5.62	-11.2|-11.2	0.00127|0.00127	.|.	.|.	.|.	.|.	.|.	T|T	0.47097|0.47097	0.1427|0.1427	.|.	.|.	.|.	0.47009|0.47009	D|D	0.999285|0.999285	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.70335|0.70335	-0.4900|-0.4900	4|4	.|.	.|.	.|.	.|.	9.6623|9.6623	0.39962|0.39962	0.114:0.2523:0.5322:0.1014|0.114:0.2523:0.5322:0.1014	.|.	.|.	.|.	.|.	R|Q	137|126	.|.	.|.	G|R	+|+	1|2	0|0	PTPRF|PTPRF	43829687|43829687	0.024000|0.024000	0.19004|0.19004	0.000000|0.000000	0.03702|0.03702	0.475000|0.475000	0.33008|0.33008	-0.636000|-0.636000	0.05465|0.05465	-5.194000|-5.194000	0.00019|0.00019	-0.440000|-0.440000	0.05779|0.05779	GGG|CGG			0.701	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000019710.1			
CPT2	1376	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	53676901	53676902	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:53676901_53676902delGA	ENST00000371486.3	+	4	2070_2071	c.1555_1556delGA	c.(1555-1557)gagfs	p.E519fs	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	519					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	CTTTGTCAGGGAGCCCTCCAGG	0.589																																					p.518_519del													.	CPT2	34		0			c.1554_1555del																																									SO:0001589	frameshift_variant	1376	exon4			GTCAGGGAGCCCT	BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.1555_1556delGA	1.37:g.53676901_53676902delGA	ENSP00000360541:p.Glu519fs		Somatic	81	0	0		WXS	Illumina HiSeq	.	95	0.35	33	NM_000098	9	0.00	0	B2R6S0|Q5SW68|Q9BQ26	Frame_Shift_Del	DEL	ENST00000371486.3	37	CCDS575.1																																																																																					0.589	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000024757.1		NM_000098	
WDR78	79819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67313188	67313188	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:67313188G>A	ENST00000371026.3	-	8	1325	c.1270C>T	c.(1270-1272)Cgt>Tgt	p.R424C	WDR78_ENST00000431318.1_Missense_Mutation_p.R170C|WDR78_ENST00000371023.3_Missense_Mutation_p.R424C	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	424					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						GGAAGCTGACGATAAGCTGCA	0.358																																					p.R424C													.	.			0			c.C1270T												58.0	59.0	58.0					1																	67313188		2203	4300	6503	SO:0001583	missense	79819	exon8			GCTGACGATAAGC	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1270C>T	1.37:g.67313188G>A	ENSP00000360065:p.Arg424Cys		Somatic	215	0	0		WXS	Illumina HiSeq	.	213	0.19	40	NM_207014	3	0.33	1	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	ENST00000371026.3	37	CCDS635.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875509	0.72180	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352;ENST00000371023	T;T;T;T	0.78003	-0.32;-1.14;-0.97;1.02	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.86108	0.5854	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.992;0.992	D	0.87665	0.2537	10	0.87932	D	0	-17.0667	17.478	0.87666	0.0:0.0:1.0:0.0	.	170;424;424	Q5VTH9-3;A0AVI9;Q5VTH9	.;.;WDR78_HUMAN	C	424;170;190;424	ENSP00000360065:R424C;ENSP00000393182:R170C;ENSP00000433682:R190C;ENSP00000360062:R424C	ENSP00000360062:R424C	R	-	1	0	WDR78	67085776	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.638000	0.67861	2.496000	0.84212	0.455000	0.32223	CGT			0.358	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025404.1		NM_024763	
NRAS	4893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	C	rs11554290	byFrequency	TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:115256529T>C	ENST00000369535.4	-	3	435	c.182A>G	c.(181-183)cAa>cGa	p.Q61R		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61R				Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,-1,2068	NRAS	-1	2068	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	c.A182G												180.0	156.0	164.0					1																	115256529		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TCTTCTTGTCCAG	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>G	1.37:g.115256529T>C	ENSP00000358548:p.Gln61Arg		Somatic	137	0	0		WXS	Illumina HiSeq	.	210	0.19	39	NM_002524	15	0.00	0	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004139	0.74932	.	.	ENSG00000213281	ENST00000369535	D	0.83673	-1.75	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.86489	0.5945	M	0.92604	3.325	0.80722	D	1	B	0.28512	0.214	B	0.39590	0.304	D	0.88255	0.2919	10	0.66056	D	0.02	.	15.0132	0.71565	0.0:0.0:0.0:1.0	rs11554290;rs11554290	61	P01111	RASN_HUMAN	R	61	ENSP00000358548:Q61R	ENSP00000358548:Q61R	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA			0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033395.2		NM_002524	
FLG2	388698	hgsc.bcm.edu	37	1	152328051	152328051	+	Silent	SNP	T	T	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:152328051T>C	ENST00000388718.5	-	3	2283	c.2211A>G	c.(2209-2211)tcA>tcG	p.S737S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	737	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCTGAGCCTGATCCATGTT	0.502																																					p.S737S													FLG2,NS,carcinoma,-1,1	FLG2	-1	1	0			c.A2211G												313.0	309.0	310.0					1																	152328051		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			TGAGCCTGATCCA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2211A>G	1.37:g.152328051T>C			Somatic	158	0	0		WXS	Illumina HiSeq	.	172	0.04	7	NM_001014342	0		0	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																					0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034018.5		NM_001014342	
LOR	4014	broad.mit.edu	37	1	153233515	153233515	+	Silent	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:153233515C>T	ENST00000368742.3	+	2	147	c.90C>T	c.(88-90)ggC>ggT	p.G30G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	30					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gcggcagcggcggtggtggct	0.697																																					p.G30G													.	LOR	19		0			c.C90T												6.0	8.0	8.0					1																	153233515		1962	3919	5881	SO:0001819	synonymous_variant	4014	exon2			CAGCGGCGGTGGT	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.90C>T	1.37:g.153233515C>T			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	102	0.06	6	NM_000427	0		0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																					0.697	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039107.1		NM_000427	
SHE	126669	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	154461552	154461554	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:154461552_154461554delCTT	ENST00000304760.2	-	3	1083_1085	c.997_999delAAG	c.(997-999)aagdel	p.K333del		NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	333										breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CGATCTGCTCCTTCTTCCACTCC	0.675																																					p.333_334del													.	SHE	41		0			c.998_1000del																																									SO:0001651	inframe_deletion	126669	exon3			CTGCTCCTTCTTC	AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.997_999delAAG	1.37:g.154461555_154461557delCTT	ENSP00000307369:p.Lys333del		Somatic	121	0	0		WXS	Illumina HiSeq	.	155	0.15	24	NM_001010846	15	0.00	0	Q8TEQ5	In_Frame_Del	DEL	ENST00000304760.2	37	CCDS30877.1																																																																																					0.675	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087910.2		NM_001010846	
KIRREL	55243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	157963501	157963501	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:157963501C>G	ENST00000359209.6	+	1	102	c.35C>G	c.(34-36)tCc>tGc	p.S12C	KIRREL_ENST00000392272.2_Missense_Mutation_p.S12C|KIRREL_ENST00000368173.3_Missense_Mutation_p.S12C|KIRREL_ENST00000416935.2_Missense_Mutation_p.S12C|KIRREL_ENST00000360089.4_5'UTR			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	12					excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CTCACTCTCTCCGATACTTTC	0.721																																					p.S12C													.	.			0			c.C35G												21.0	26.0	24.0					1																	157963501		692	1591	2283	SO:0001583	missense	55243	exon1			CTCTCTCCGATAC	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.35C>G	1.37:g.157963501C>G	ENSP00000352138:p.Ser12Cys		Somatic	241	0	0		WXS	Illumina HiSeq	.	342	0.13	44	NM_018240	0		0	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	C	11.22	1.573715	0.28092	.	.	ENSG00000183853	ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935	T;T;T;T	0.69685	-0.42;0.2;-0.04;0.02	3.69	1.76	0.24704	.	.	.	.	.	T	0.42877	0.1222	L	0.29908	0.895	0.19575	N	0.999961	P;P	0.46578	0.88;0.88	P;P	0.52481	0.7;0.7	T	0.25950	-1.0117	9	0.44086	T	0.13	-4.515	4.0996	0.10007	0.2304:0.6448:0.0:0.1248	.	12;12	B4DN67;Q96J84	.;KIRR1_HUMAN	C	12	ENSP00000357155:S12C;ENSP00000376098:S12C;ENSP00000352138:S12C;ENSP00000389674:S12C	ENSP00000352138:S12C	S	+	2	0	KIRREL	156230125	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	0.962000	0.29280	0.238000	0.21222	0.313000	0.20887	TCC			0.721	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000058342.3		NM_018240	
ABL2	27	broad.mit.edu	37	1	179198478	179198478	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:179198478G>T	ENST00000502732.1	-	1	258	c.55C>A	c.(55-57)Ccc>Acc	p.P19T	ABL2_ENST00000367623.4_Missense_Mutation_p.P19T|ABL2_ENST00000511413.1_Missense_Mutation_p.P19T|ABL2_ENST00000392043.3_Missense_Mutation_p.P19T|ABL2_ENST00000507173.1_Missense_Mutation_p.P19T	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	19	CAP.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	ATCCCGCGGGGCTGAGGCTGC	0.736			T	ETV6	AML																																p.P19T				Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	ABL2	307		0			c.C55A												5.0	7.0	6.0					1																	179198478		2097	4097	6194	SO:0001583	missense	27	exon1			CGCGGGGCTGAGG	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.55C>A	1.37:g.179198478G>T	ENSP00000427562:p.Pro19Thr		Somatic	61	0.0327868852	2		WXS	Illumina HiSeq	Phase_I	98	0.07	7	NM_001168238	3	0.00	0	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360684	0.61403	.	.	ENSG00000143322	ENST00000502732;ENST00000367623;ENST00000507173;ENST00000511413;ENST00000392043	T;T;T;T;T	0.74421	-0.82;-0.83;-0.79;-0.8;-0.84	3.96	1.76	0.24704	.	.	.	.	.	T	0.55784	0.1942	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B	0.20780	0.048;0.048;0.048;0.009;0.028	B;B;B;B;B	0.19391	0.025;0.005;0.005;0.003;0.011	T	0.39881	-0.9592	9	0.14656	T	0.56	.	9.5389	0.39240	0.0:0.4218:0.5782:0.0	.	19;19;19;19;19	P42684-6;P42684-7;P42684-5;P42684-8;P42684	.;.;.;.;ABL2_HUMAN	T	19	ENSP00000427562:P19T;ENSP00000356595:P19T;ENSP00000423413:P19T;ENSP00000424697:P19T;ENSP00000375897:P19T	ENSP00000356595:P19T	P	-	1	0	ABL2	177465101	1.000000	0.71417	0.998000	0.56505	0.828000	0.46876	1.850000	0.39328	0.713000	0.32060	0.205000	0.17691	CCC			0.736	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000085174.3		NM_005158	
RAB3GAP2	25782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220340992	220340992	+	Silent	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:220340992C>T	ENST00000358951.2	-	25	2948	c.2832G>A	c.(2830-2832)aaG>aaA	p.K944K		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	944					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TAAATATCCACTTGGCTACAC	0.398																																					p.K944K													.	.			0			c.G2832A												154.0	161.0	158.0					1																	220340992		2203	4300	6503	SO:0001819	synonymous_variant	25782	exon25			TATCCACTTGGCT	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2832G>A	1.37:g.220340992C>T			Somatic	175	0	0		WXS	Illumina HiSeq	.	211	0.17	36	NM_012414	1	0.00	0	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	ENST00000358951.2	37	CCDS31028.1																																																																																					0.398	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090205.2		NM_012414	
FMN2	56776	broad.mit.edu	37	1	240371517	240371517	+	Silent	SNP	T	T	A	rs369474345		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr1:240371517T>A	ENST00000319653.9	+	5	3635	c.3405T>A	c.(3403-3405)ctT>ctA	p.L1135L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1135	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCCCCCTCTTCCCGGAGCGG	0.706																																					p.L1135L													FMN2,NS,carcinoma,+2,1	FMN2	451	1	0			c.T3405A							T		30,4102		0,30,2036	6.0	8.0	7.0		3405	-6.6	0.0	1		7	19,8117		0,19,4049	no	coding-synonymous	FMN2	NM_020066.4		0,49,6085	AA,AT,TT		0.2335,0.726,0.3994		1135/1723	240371517	49,12219	2066	4068	6134	SO:0001819	synonymous_variant	56776	exon5			CCCTCTTCCCGGA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3405T>A	1.37:g.240371517T>A			Somatic	66	0.0303030303	2		WXS	Illumina HiSeq	Phase_I	98	0.07	7	NM_020066	3	0.00	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																					0.706	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
PITRM1	10531	hgsc.bcm.edu;ucsc.edu	37	10	3190094	3190094	+	Intron	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr10:3190094C>T	ENST00000224949.4	-	18	2104				PITRM1-AS1_ENST00000601046.1_RNA|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Intron|PITRM1_ENST00000451104.2_Intron|PITRM1-AS1_ENST00000441377.1_RNA|PITRM1_ENST00000380994.1_Intron|PITRM1_ENST00000464395.1_5'UTR			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1						positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						ACAACACACACGAGTAAAACT	0.313																																					.													.	.			0			.																																									SO:0001627	intron_variant	100507034	.			CACACACGAGTAA	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.2069+84G>A	10.37:g.3190094C>T			Somatic	52	0	0		WXS	Illumina HiSeq	.	48	0.19	9	.	8	0.13	1	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	RNA	SNP	ENST00000224949.4	37	CCDS59208.1																																																																																					0.313	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000046469.2			
FOLH1	2346	bcgsc.ca	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																					p.Y277Y													.	FOLH1	141		0			c.T831C												61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346	exon7			ATAAGCATATTCT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			Somatic	216	0.0092592593	2		WXS	Illumina HiSeq	Phase_1	183	0.05	10	NM_004476	0		0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																					0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390896.1		NM_004476	
RPS6KA4	8986	bcgsc.ca	37	11	64136183	64136183	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr11:64136183G>T	ENST00000334205.4	+	12	1407	c.1342G>T	c.(1342-1344)Gcg>Tcg	p.A448S	RPS6KA4_ENST00000294261.4_Intron|RPS6KA4_ENST00000528057.1_Missense_Mutation_p.A441S|MIR1237_ENST00000408346.1_RNA	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	448	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						CAGGCTGGAGGCGAACACGCA	0.706																																					p.A448S													.	RPS6KA4	85		0			c.G1342T												22.0	21.0	21.0					11																	64136183		2179	4285	6464	SO:0001583	missense	8986	exon12			CTGGAGGCGAACA	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.1342G>T	11.37:g.64136183G>T	ENSP00000333896:p.Ala448Ser		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_1	44	0.09	4	NM_003942	16	0.00	0	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	ENST00000334205.4	37	CCDS8073.1	.	.	.	.	.	.	.	.	.	.	g	10.80	1.451623	0.26074	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000530504	T;T;T	0.64085	-0.08;-0.08;-0.08	3.97	2.02	0.26589	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.378271	0.28067	N	0.016729	T	0.35799	0.0944	N	0.13140	0.3	0.80722	D	1	B;B;B	0.31413	0.322;0.025;0.011	B;B;B	0.28139	0.086;0.038;0.037	T	0.08932	-1.0698	10	0.10111	T	0.7	.	8.1651	0.31222	0.2117:0.0:0.7883:0.0	.	441;448;442	E9PJN1;O75676;O75676-2	.;KS6A4_HUMAN;.	S	441;448;426	ENSP00000435580:A441S;ENSP00000333896:A448S;ENSP00000432945:A426S	ENSP00000333896:A448S	A	+	1	0	RPS6KA4	63892759	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	4.609000	0.61148	0.889000	0.36185	0.455000	0.32223	GCG			0.706	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106246.2		NM_003942	
ADRBK1	156	mdanderson.org	37	11	67049967	67049967	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr11:67049967G>T	ENST00000308595.5	+	13	1404	c.1114G>T	c.(1114-1116)Gcc>Tcc	p.A372S	ADRBK1_ENST00000526285.1_Intron|ADRBK1_ENST00000527176.1_3'UTR	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	372	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	CGACAGCAGTGCCGACTGGTT	0.647																																					p.A372S													.	.			0			c.G1114T												92.0	90.0	91.0					11																	67049967		2200	4295	6495	SO:0001583	missense	156	exon13			AGCAGTGCCGACT	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.1114G>T	11.37:g.67049967G>T	ENSP00000312262:p.Ala372Ser		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_001619	84	0.00	0	B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	ENST00000308595.5	37	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207098	0.58343	.	.	ENSG00000173020	ENST00000308595	T	0.21932	1.98	5.7	4.8	0.61643	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.28764	0.0713	N	0.12637	0.245	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.25606	-1.0127	10	0.66056	D	0.02	-11.5913	14.6579	0.68847	0.0696:0.0:0.9304:0.0	.	372	P25098	ARBK1_HUMAN	S	372	ENSP00000312262:A372S	ENSP00000312262:A372S	A	+	1	0	ADRBK1	66806543	1.000000	0.71417	0.096000	0.21009	0.086000	0.17979	7.641000	0.83368	1.419000	0.47118	-0.136000	0.14681	GCC			0.647	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393153.1		NM_001619	
SSH3	54961	mdanderson.org	37	11	67074850	67074850	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr11:67074850G>T	ENST00000308127.4	+	6	723	c.545G>T	c.(544-546)aGc>aTc	p.S182I	SSH3_ENST00000308298.7_Missense_Mutation_p.S182I|SSH3_ENST00000376757.5_Missense_Mutation_p.S182I|SSH3_ENST00000532181.1_3'UTR	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	182					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			AGGGGCTTCAGCGTGACGTCT	0.602																																					p.S182I													.	.			0			c.G545T												52.0	47.0	49.0					11																	67074850		2200	4295	6495	SO:0001583	missense	54961	exon6			GCTTCAGCGTGAC	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.545G>T	11.37:g.67074850G>T	ENSP00000312081:p.Ser182Ile		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_017857	2	0.00	0	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	37	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	G	8.767	0.924979	0.18056	.	.	ENSG00000172830	ENST00000308127;ENST00000308298;ENST00000376757	T;T;T	0.52983	0.64;0.64;0.64	4.65	1.55	0.23275	.	0.254272	0.29028	N	0.013370	T	0.42314	0.1197	M	0.75085	2.285	0.35343	D	0.786686	B;B	0.12630	0.006;0.003	B;B	0.12837	0.008;0.008	T	0.52003	-0.8633	10	0.62326	D	0.03	-11.6813	4.9324	0.13923	0.0853:0.148:0.6142:0.1525	.	36;182	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	I	182	ENSP00000312081:S182I;ENSP00000310055:S182I;ENSP00000365948:S182I	ENSP00000312081:S182I	S	+	2	0	SSH3	66831426	0.997000	0.39634	0.999000	0.59377	0.258000	0.26162	2.417000	0.44653	1.091000	0.41335	-0.475000	0.04921	AGC			0.602	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393167.1		NM_018276	
LRP5	4041	mdanderson.org	37	11	68174054	68174054	+	Missense_Mutation	SNP	G	G	A	rs147792724		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr11:68174054G>A	ENST00000294304.7	+	9	1970	c.1864G>A	c.(1864-1866)Gca>Aca	p.A622T		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	622	EGF-like 2.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CACACCCCACGCAACCCGGTG	0.607																																					p.A622T													.	.			0			c.G1864A												72.0	64.0	67.0					11																	68174054		2200	4294	6494	SO:0001583	missense	4041	exon9			CCCCACGCAACCC	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.1864G>A	11.37:g.68174054G>A	ENSP00000294304:p.Ala622Thr		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_002335	2	0.00	0	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723367	0.48728	.	.	ENSG00000162337	ENST00000294304	D	0.96136	-3.92	4.11	3.19	0.36642	Epidermal growth factor-like (1);	0.303979	0.22354	U	0.061162	D	0.86171	0.5869	N	0.05414	-0.055	0.30384	N	0.781709	P;P	0.39883	0.693;0.693	B;B	0.26517	0.07;0.07	D	0.83599	0.0127	10	0.36615	T	0.2	.	13.6396	0.62241	0.0:0.0:0.8441:0.1559	.	622;622	Q9UES7;O75197	.;LRP5_HUMAN	T	622	ENSP00000294304:A622T	ENSP00000294304:A622T	A	+	1	0	LRP5	67930630	1.000000	0.71417	0.384000	0.26145	0.432000	0.31715	7.500000	0.81588	1.086000	0.41228	-0.277000	0.10078	GCA			0.607	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395088.1		NM_002335	
SIAE	54414	mdanderson.org	37	11	124518072	124518072	+	Splice_Site	SNP	C	C	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr11:124518072C>A	ENST00000263593.3	-	6	895		c.e6-1		SIAE_ENST00000545756.1_Splice_Site			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase						carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		TGGAATGGACCTGAAATCATA	0.438																																					.													.	.			0			c.618-1G>T												150.0	128.0	135.0					11																	124518072		2201	4299	6500	SO:0001630	splice_region_variant	54414	exon9			ATGGACCTGAAAT	AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.723-1G>T	11.37:g.124518072C>A			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001199922	2	0.00	0	B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Splice_Site	SNP	ENST00000263593.3	37	CCDS8449.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018804	0.54576	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5	0.84254	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIAE	124023282	0.278000	0.24230	0.568000	0.28447	0.277000	0.26821	2.236000	0.43052	2.503000	0.84419	0.655000	0.94253	.			0.438	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387070.1		NM_170601	Intron
CACNA1C	775	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2786957	2786957	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr12:2786957A>C	ENST00000347598.4	+	43	5159	c.5159A>C	c.(5158-5160)gAt>gCt	p.D1720A	CACNA1C_ENST00000399638.1_Missense_Mutation_p.D1700A|CACNA1C_ENST00000399603.1_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399621.1_Missense_Mutation_p.D1691A|CACNA1C_ENST00000406454.3_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399601.1_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399617.1_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399641.1_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399655.1_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399591.1_Missense_Mutation_p.D1680A|CACNA1C_ENST00000399606.1_Missense_Mutation_p.D1692A|CACNA1C_ENST00000402845.3_Missense_Mutation_p.D1691A|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399637.1_Missense_Mutation_p.D1691A|CACNA1C_ENST00000399595.1_Missense_Mutation_p.D1680A|CACNA1C_ENST00000399644.1_Missense_Mutation_p.D1672A|CACNA1C_ENST00000344100.3_Missense_Mutation_p.D1713A|CACNA1C_ENST00000399629.1_Missense_Mutation_p.D1689A|CACNA1C_ENST00000327702.7_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399649.1_Missense_Mutation_p.D1678A|CACNA1C_ENST00000335762.5_Missense_Mutation_p.D1697A|CACNA1C_ENST00000399634.1_Missense_Mutation_p.D1672A|CACNA1C_ENST00000399597.1_Missense_Mutation_p.D1672A	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1720					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATCTCTGGAGATCTCACCGCT	0.602																																					p.D1720A													.	CACNA1C	1023		0			c.A5159C												52.0	60.0	57.0					12																	2786957		2135	4245	6380	SO:0001583	missense	775	exon43			CTGGAGATCTCAC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5159A>C	12.37:g.2786957A>C	ENSP00000266376:p.Asp1720Ala		Somatic	182	0.0054945055	1		WXS	Illumina HiSeq	Phase_I	322	0.11	36	NM_199460	9	0.00	0	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	A	15.59	2.878273	0.51801	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97731	-4.5;-4.47;-4.45;-4.49;-4.44;-4.41;-4.3;-4.41;-4.47;-4.4;-4.41;-4.47;-4.5;-4.39;-4.36;-4.5;-4.39;-4.45;-4.41;-4.42;-4.39;-4.51	4.6	3.46	0.39613	.	0.529132	0.20529	N	0.090541	D	0.98482	0.9494	M	0.85462	2.755	0.80722	D	1	P;P;P;D;P;P;P;P;P;B;P;P;P;P;P;P;D;D;P;B;D;P;P;P;P	0.71674	0.855;0.837;0.837;0.967;0.743;0.889;0.867;0.889;0.911;0.443;0.889;0.837;0.859;0.886;0.748;0.819;0.998;0.991;0.889;0.389;0.997;0.889;0.889;0.867;0.837	P;P;P;P;P;P;P;P;P;P;P;P;B;P;B;P;D;D;P;B;D;P;P;P;P	0.80764	0.616;0.547;0.558;0.858;0.547;0.731;0.637;0.731;0.786;0.598;0.731;0.558;0.406;0.782;0.355;0.611;0.994;0.954;0.731;0.343;0.942;0.731;0.731;0.637;0.558	D	0.98333	1.0534	10	0.72032	D	0.01	.	10.1042	0.42524	0.9203:0.0:0.0797:0.0	.	363;1713;1669;1720;1672;1691;1672;1689;1700;1672;1692;1672;1632;1720;1672;1672;1672;1680;1678;1680;1661;1691;1691;1672;1672	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	A	1697;1672;1672;1700;1672;1691;1691;1680;1672;1720;1692;1672;1713;1689;1672;1678;1691;1672;1672;1672;1672;1680;1502	ENSP00000336982:D1697A;ENSP00000382563:D1672A;ENSP00000382552:D1672A;ENSP00000382547:D1700A;ENSP00000382506:D1672A;ENSP00000382530:D1691A;ENSP00000382546:D1691A;ENSP00000382500:D1680A;ENSP00000382549:D1672A;ENSP00000266376:D1720A;ENSP00000382515:D1692A;ENSP00000382510:D1672A;ENSP00000341092:D1713A;ENSP00000382537:D1689A;ENSP00000329877:D1672A;ENSP00000382557:D1678A;ENSP00000385724:D1691A;ENSP00000382512:D1672A;ENSP00000382542:D1672A;ENSP00000382526:D1672A;ENSP00000385896:D1672A;ENSP00000382504:D1680A	ENSP00000323129:D1502A	D	+	2	0	CACNA1C	2657218	1.000000	0.71417	0.749000	0.31150	0.214000	0.24535	7.243000	0.78219	0.800000	0.34041	0.260000	0.18958	GAT			0.602	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317035.1		NM_000719	
HEBP1	50865	broad.mit.edu	37	12	13154583	13154583	+	5'Flank	DEL	G	G	-	rs398076428|rs59113920	byFrequency	TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr12:13154583delG	ENST00000014930.4	-	0	0				RP11-377D9.3_ENST00000543321.1_lincRNA|HEBP1_ENST00000536942.1_5'Flank	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1						circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		TCTGCTGAGCGGGGGCCCCCG	0.731													GGGG|GGGGG|GGGG|insertion	2433	0.485823	0.3949	0.4986	5008	,	,		11429	0.378		0.6064	False		,,,				2504	0.5869				.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			CTGAGCGGGGGCC	AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771		12.37:g.13154583delG	Exception_encountered		Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	10	0.50	5	.	0		0	A8K1G2|Q9Y5Z5	RNA	DEL	ENST00000014930.4	37	CCDS31749.1																																																																																					0.731	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401001.1			
PXN	5829	mdanderson.org	37	12	120659500	120659500	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr12:120659500G>T	ENST00000228307.7	-	6	898	c.757C>A	c.(757-759)Cag>Aag	p.Q253K	PXN_ENST00000424649.2_Missense_Mutation_p.Q253K|PXN_ENST00000458477.2_Missense_Mutation_p.Q120K|PXN_ENST00000397506.3_5'Flank|PXN_ENST00000267257.7_Missense_Mutation_p.Q253K|PXN_ENST00000536957.1_Missense_Mutation_p.Q251K|PXN_ENST00000538144.1_5'UTR	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	253					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTGTCTGCTGTTGGGTGGAG	0.637																																					p.Q253K													.	.			0			c.C757A												72.0	97.0	88.0					12																	120659500		2182	4270	6452	SO:0001583	missense	5829	exon6			TCTGCTGTTGGGT	U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.757C>A	12.37:g.120659500G>T	ENSP00000228307:p.Gln253Lys		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001080855	21	0.00	0	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	ENST00000228307.7	37	CCDS44997.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805026	0.70682	.	.	ENSG00000089159	ENST00000458477;ENST00000228307;ENST00000424649;ENST00000536957;ENST00000267257;ENST00000541856	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.49474	0.1559	M	0.64997	1.995	0.80722	D	1	B;B;B	0.33807	0.016;0.426;0.122	B;B;B	0.38985	0.009;0.287;0.11	T	0.46735	-0.9170	10	0.45353	T	0.12	-11.4069	19.5972	0.95546	0.0:0.0:1.0:0.0	.	253;253;253	P49023-2;P49023-3;P49023	.;.;PAXI_HUMAN	K	120;253;253;251;253;12	ENSP00000395536:Q120K;ENSP00000228307:Q253K;ENSP00000391283:Q253K;ENSP00000443887:Q251K;ENSP00000267257:Q253K	ENSP00000228307:Q253K	Q	-	1	0	PXN	119143883	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.197000	0.77814	2.629000	0.89072	0.591000	0.81541	CAG			0.637	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000402679.4		NM_002859	
GSX1	219409	broad.mit.edu;mdanderson.org	37	13	28367938	28367938	+	Silent	SNP	C	C	G			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr13:28367938C>G	ENST00000302945.2	+	2	696	c.648C>G	c.(646-648)ggC>ggG	p.G216G		NM_145657.1	NP_663632.1	Q9H4S2	GSX1_HUMAN	GS homeobox 1	216	Poly-Gly.				adenohypophysis development (GO:0021984)|hypothalamus development (GO:0021854)|neuron fate commitment (GO:0048663)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		gcggcggcggcgggggtgccg	0.627																																					p.G216G													.	GSX1	20		0			c.C648G												32.0	33.0	32.0					13																	28367938		2202	4300	6502	SO:0001819	synonymous_variant	219409	exon2			CGGCGGCGGGGGT	AB044157	CCDS9326.1	13q12.2	2012-03-09		2007-07-26	ENSG00000169840	ENSG00000169840		"""Homeoboxes / ANTP class : HOXL subclass"""	20374	protein-coding gene	gene with protein product				GSH1			Standard	NM_145657		Approved	Gsh-1	uc001urr.1	Q9H4S2	OTTHUMG00000016637	ENST00000302945.2:c.648C>G	13.37:g.28367938C>G			Somatic	85	0.0117647059	1		WXS	Illumina HiSeq	Phase_I	71	0.04	3	NM_145657	0		0	Q9UD62	Silent	SNP	ENST00000302945.2	37	CCDS9326.1																																																																																					0.627	GSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044309.2		NM_145657	
SCEL	8796	mdanderson.org	37	13	78167651	78167651	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr13:78167651G>T	ENST00000349847.3	+	12	779	c.695G>T	c.(694-696)aGt>aTt	p.S232I	SCEL_ENST00000535157.1_Missense_Mutation_p.S210I|SCEL_ENST00000377246.3_Intron	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	232					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		GTTTGAAGGAGTCAGGATCTT	0.363																																					p.S232I													.	.			0			c.G695T												139.0	127.0	131.0					13																	78167651		2203	4300	6503	SO:0001583	missense	8796	exon12			GAAGGAGTCAGGA	AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.695G>T	13.37:g.78167651G>T	ENSP00000302579:p.Ser232Ile		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_144777	0		0	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	37	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.698178	0.48307	.	.	ENSG00000136155	ENST00000535157;ENST00000349847	T;T	0.24908	1.83;1.83	5.36	1.43	0.22495	.	0.297094	0.29515	N	0.011925	T	0.23451	0.0567	L	0.57536	1.79	0.23254	N	0.998036	P;B	0.44380	0.834;0.23	B;B	0.40285	0.325;0.165	T	0.10989	-1.0606	10	0.62326	D	0.03	-5.1849	8.2896	0.31950	0.0892:0.4653:0.4455:0.0	.	210;232	F5H651;O95171	.;SCEL_HUMAN	I	210;232	ENSP00000437895:S210I;ENSP00000302579:S232I	ENSP00000302579:S232I	S	+	2	0	SCEL	77065652	0.904000	0.30761	0.977000	0.42913	0.970000	0.65996	0.046000	0.14035	0.268000	0.21939	0.655000	0.94253	AGT			0.363	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000045339.2		NM_144777	
RP11-597A11.1	0	broad.mit.edu	37	14	20086237	20086237	+	RNA	DEL	T	T	-	rs569592353|rs373441912	byFrequency	TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr14:20086237delT	ENST00000548261.1	+	0	51																											GGTGTGTGTGTGGGGGGGTAT	0.388													|||unknown(STR2?)	915	0.182708	0.2443	0.1686	5008	,	,		35626	0.1429		0.1511	False		,,,				2504	0.183				.													.	.			0			.																																											0	.			TGTGTGTGGGGGG																													14.37:g.20086237delT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0		RNA	DEL	ENST00000548261.1	37																																																																																						0.388	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
IGHV3-53	28420	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	107048842	107048842	+	RNA	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr14:107048842G>T	ENST00000390627.2	-	0	398									immunoglobulin heavy variable 3-53																		CCCTTCCCTGGAGCCTGGCGG	0.577																																					.													.	.			0			.												107.0	123.0	117.0					14																	107048842		2058	4234	6292			0	.			TCCCTGGAGCCTG	M99679		14q32.33	2012-02-08			ENSG00000211967	ENSG00000211967		"""Immunoglobulins / IGH locus"""	5610	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151966		14.37:g.107048842G>T			Somatic	234	0.0042735043	1		WXS	Illumina HiSeq	Phase_I	276	0.08	21	.	15	0.00	0		RNA	SNP	ENST00000390627.2	37																																																																																						0.577	IGHV3-53-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000324612.1		NG_001019	
RASL12	51285	broad.mit.edu	37	15	65360091	65360091	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr15:65360091C>A	ENST00000220062.4	-	1	359	c.83G>T	c.(82-84)cGc>cTc	p.R28L	RASL12_ENST00000421977.3_Missense_Mutation_p.R28L|RASL12_ENST00000434605.2_Intron	NM_016563.2	NP_057647.1	Q9NYN1	RASLC_HUMAN	RAS-like, family 12	28					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			lung(1)|ovary(1)|skin(1)|urinary_tract(1)	4						AGCCCCGCGGCGCCCCAGGAT	0.731																																					p.R28L													.	RASL12	32		0			c.G83T																																									SO:0001583	missense	51285	exon1			CCGCGGCGCCCCA	AF233588	CCDS10200.1	15q11.2-q22.33	2014-05-09			ENSG00000103710	ENSG00000103710			30289	protein-coding gene	gene with protein product	"""Ras family member Ris"""					12107412	Standard	NM_016563		Approved	RIS	uc002aoi.1	Q9NYN1	OTTHUMG00000133115	ENST00000220062.4:c.83G>T	15.37:g.65360091C>A	ENSP00000220062:p.Arg28Leu		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	40	0.10	4	NM_016563	0		0	B2RC29|B4DJW2|B4DU82	Missense_Mutation	SNP	ENST00000220062.4	37	CCDS10200.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816062	0.50527	.	.	ENSG00000103710	ENST00000220062;ENST00000421977	T;T	0.79033	-1.05;-1.23	4.45	4.45	0.53987	Small GTP-binding protein domain (1);	0.444646	0.22622	N	0.057689	T	0.61060	0.2317	N	0.11560	0.145	0.80722	D	1	B;B	0.21381	0.055;0.001	B;B	0.15484	0.013;0.001	T	0.58261	-0.7667	10	0.33141	T	0.24	.	15.4278	0.75069	0.0:1.0:0.0:0.0	.	28;28	B4DJW2;Q9NYN1	.;RASLC_HUMAN	L	28	ENSP00000220062:R28L;ENSP00000390028:R28L	ENSP00000220062:R28L	R	-	2	0	RASL12	63147144	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.937000	0.40193	2.319000	0.78375	0.555000	0.69702	CGC			0.731	RASL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256782.2		NM_016563	
SKOR1	390598	bcgsc.ca	37	15	68117890	68117890	+	5'UTR	SNP	G	G	T	rs375168768		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr15:68117890G>T	ENST00000380035.2	+	0	8				SKOR1_ENST00000554240.1_Intron|SKOR1_ENST00000341418.5_Intron|SKOR1_ENST00000389002.1_5'Flank|SKOR1_ENST00000554054.1_5'UTR			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1						negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						CCGGCTGCGAGGGTTgccgaa	0.672																																					.													.	SKOR1	144		0			.												28.0	24.0	25.0					15																	68117890		2140	4213	6353	SO:0001623	5_prime_UTR_variant	390598	.			CTGCGAGGGTTGC		CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.-51G>T	15.37:g.68117890G>T			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_1	66	0.06	4	.	0		0	A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	ENST00000380035.2	37																																																																																						0.672	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000410832.1		NM_001031807	
MAPK8IP3	23162	mdanderson.org	37	16	1817699	1817699	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr16:1817699G>T	ENST00000250894.4	+	27	3526	c.3369G>T	c.(3367-3369)caG>caT	p.Q1123H	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.Q1117H	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1123					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						AGCATCTACAGGACGTGGACA	0.642																																					p.Q1123H													.	.			0			c.G3369T												31.0	35.0	34.0					16																	1817699		2143	4277	6420	SO:0001583	missense	23162	exon27			TCTACAGGACGTG	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3369G>T	16.37:g.1817699G>T	ENSP00000250894:p.Gln1123His		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_015133	57	0.00	0	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	ENST00000250894.4	37	CCDS10442.2	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631698	0.67015	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.32272	1.46;1.46	3.52	2.56	0.30785	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	M	0.90977	3.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.87578	0.998;0.998;0.993	T	0.66019	-0.6027	10	0.87932	D	0	-21.3828	10.4544	0.44542	0.0984:0.0:0.9016:0.0	.	1124;1117;1123	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	H	1123;1117	ENSP00000250894:Q1123H;ENSP00000348290:Q1117H	ENSP00000250894:Q1123H	Q	+	3	2	MAPK8IP3	1757700	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	4.981000	0.63819	0.697000	0.31718	-0.258000	0.10820	CAG			0.642	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250508.2		NM_001040439	
SLC9A3R2	9351	mdanderson.org	37	16	2079697	2079697	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr16:2079697C>T	ENST00000424542.2	+	2	466	c.328C>T	c.(328-330)Cga>Tga	p.R110*	SLC9A3R2_ENST00000432365.2_Nonsense_Mutation_p.R110*|SLC9A3R2_ENST00000563587.1_Nonsense_Mutation_p.R4*	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2	110					negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)	2						GATGGCCCAGCGAGGGCTCCC	0.682																																					p.R110X	Ovarian(69;105 1552 17724 23473)												.	.			0			c.C328T												20.0	29.0	26.0					16																	2079697		1960	4082	6042	SO:0001587	stop_gained	9351	exon2			GCCCAGCGAGGGC	AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956	ENST00000424542.2:c.328C>T	16.37:g.2079697C>T	ENSP00000408005:p.Arg110*		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_004785	8	0.00	0	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Nonsense_Mutation	SNP	ENST00000424542.2	37	CCDS45382.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595730	0.66219	.	.	ENSG00000065054	ENST00000424542;ENST00000432365	.	.	.	4.86	2.78	0.32641	.	1.211850	0.05801	N	0.612125	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-15.1188	7.573	0.27920	0.3567:0.4903:0.1531:0.0	.	.	.	.	X	110	.	ENSP00000408005:R110X	R	+	1	2	SLC9A3R2	2019698	0.088000	0.21588	0.821000	0.32701	0.866000	0.49608	1.097000	0.30988	0.400000	0.25396	0.561000	0.74099	CGA			0.682	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434448.1			
GSPT1	2935	broad.mit.edu	37	16	12009530	12009531	+	Intron	INS	-	-	CCG	rs71408216|rs374901734		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr16:12009530_12009531insCCG	ENST00000420576.2	-	1	41				GSPT1_ENST00000434724.2_In_Frame_Ins_p.16_16G>GG|AC007216.1_ENST00000583357.1_RNA|GSPT1_ENST00000439887.2_In_Frame_Ins_p.16_16G>GG	NM_001130007.1	NP_001123479.1	P15170	ERF3A_HUMAN	G1 to S phase transition 1						G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						cgctgctgctcccgccgccgcc	0.772																																					p.G16delinsGG													.	GSPT1	71		0			c.48_49insCGG																																									SO:0001627	intron_variant	2935	exon1			GCTGCTCCCGCCG	BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000420576.2:c.61+367->CGG	16.37:g.12009537_12009539dupCCG			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_001130006	0		0	J3KQG6|Q96GF2	In_Frame_Ins	INS	ENST00000420576.2	37	CCDS45414.1																																																																																					0.772	GSPT1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000421514.1		NM_002094	
USP31	57478	mdanderson.org	37	16	23160065	23160065	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr16:23160065G>A	ENST00000219689.7	-	1	526	c.527C>T	c.(526-528)gCg>gTg	p.A176V		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	129	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		GCCGCGGCCCGCAGGCTGCTC	0.746																																					p.A176V													.	.			0			c.C527T												3.0	4.0	4.0					16																	23160065		1783	3683	5466	SO:0001583	missense	57478	exon1			CGGCCCGCAGGCT	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.527C>T	16.37:g.23160065G>A	ENSP00000219689:p.Ala176Val		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_020718	0		0	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	G	2.514	-0.312310	0.05422	.	.	ENSG00000103404	ENST00000219689	T	0.30448	1.53	3.45	-1.08	0.09936	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.315100	0.05262	N	0.515859	T	0.12860	0.0312	N	0.04090	-0.28	0.09310	N	0.999995	B	0.11235	0.004	B	0.06405	0.002	T	0.18871	-1.0323	10	0.40728	T	0.16	-0.5263	1.7995	0.03068	0.1908:0.159:0.4873:0.163	.	176	Q70CQ4	UBP31_HUMAN	V	176	ENSP00000219689:A176V	ENSP00000219689:A176V	A	-	2	0	USP31	23067566	1.000000	0.71417	0.001000	0.08648	0.079000	0.17450	1.747000	0.38298	-0.435000	0.07264	0.411000	0.27672	GCG			0.746	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211607.1		NM_020718	
ZDHHC1	29800	mdanderson.org	37	16	67428910	67428910	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr16:67428910G>T	ENST00000348579.2	-	10	1566	c.1225C>A	c.(1225-1227)Cgt>Agt	p.R409S	ZDHHC1_ENST00000566075.1_5'UTR|TPPP3_ENST00000290942.5_5'Flank|TPPP3_ENST00000562206.1_5'Flank|TPPP3_ENST00000393957.2_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	409					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		CTCACCCGACGCCGGATCCGA	0.632																																					p.R409S													.	.			0			c.C1225A												18.0	23.0	21.0					16																	67428910		2194	4299	6493	SO:0001583	missense	29800	exon10			CCCGACGCCGGAT	U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.1225C>A	16.37:g.67428910G>T	ENSP00000340299:p.Arg409Ser		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_013304	9	0.00	0	O15461	Missense_Mutation	SNP	ENST00000348579.2	37	CCDS10836.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.679777	0.29783	.	.	ENSG00000159714	ENST00000348579	T	0.43688	0.94	3.32	0.383	0.16239	.	3.063890	0.02275	U	0.068806	T	0.27900	0.0687	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16305	-1.0407	10	0.25751	T	0.34	.	8.4123	0.32651	0.0:0.0:0.602:0.398	.	409	Q8WTX9	ZDHC1_HUMAN	S	409	ENSP00000340299:R409S	ENSP00000340299:R409S	R	-	1	0	ZDHHC1	65986411	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.221000	0.17680	0.053000	0.16036	0.313000	0.20887	CGT			0.632	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268845.1		NM_013304	
DUS2	54920	mdanderson.org	37	16	68112813	68112813	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr16:68112813C>T	ENST00000565263.1	+	17	1900	c.1406C>T	c.(1405-1407)gCa>gTa	p.A469V	DUS2_ENST00000432752.1_Missense_Mutation_p.A434V|RP11-67A1.2_ENST00000548144.1_RNA|DUS2_ENST00000358896.6_Missense_Mutation_p.A469V	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	469					negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)										CAGGAGCTAGCACAACCTGGG	0.607																																					p.A469V													.	.			0			c.C1406T												67.0	71.0	70.0					16																	68112813		2198	4300	6498	SO:0001583	missense	54920	exon16			AGCTAGCACAACC		CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.1406C>T	16.37:g.68112813C>T	ENSP00000455229:p.Ala469Val		Somatic	53	0.0188679245	1		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001271762	73	0.00	0	A8K3G3|Q4H4D9	Missense_Mutation	SNP	ENST00000565263.1	37	CCDS10859.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.762954	0.31228	.	.	ENSG00000167264	ENST00000358896;ENST00000432752	T;T	0.32272	1.47;1.46	5.02	1.98	0.26296	.	0.840801	0.10951	N	0.616126	T	0.18341	0.0440	N	0.24115	0.695	0.09310	N	1	B;B	0.13594	0.008;0.008	B;B	0.14578	0.011;0.011	T	0.25433	-1.0132	10	0.54805	T	0.06	.	3.2452	0.06794	0.3145:0.4481:0.1525:0.0849	.	434;469	E7EUN9;Q9NX74	.;DUS2L_HUMAN	V	469;434	ENSP00000351769:A469V;ENSP00000409498:A434V	ENSP00000351769:A469V	A	+	2	0	DUS2L	66670314	0.000000	0.05858	0.011000	0.14972	0.777000	0.43975	-0.088000	0.11198	0.292000	0.22492	0.655000	0.94253	GCA			0.607	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268869.2		NM_017803	
CHST4	10164	mdanderson.org	37	16	71571131	71571131	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr16:71571131T>C	ENST00000338482.5	+	3	894	c.551T>C	c.(550-552)cTg>cCg	p.L184P	CHST4_ENST00000539698.3_Missense_Mutation_p.L184P|RP11-510M2.5_ENST00000568523.1_RNA|ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000572450.1_Missense_Mutation_p.L184P			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	184					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						TTCTTCAACCTGCAGTCCCTC	0.627																																					p.L184P													.	.			0			c.T551C												84.0	84.0	84.0					16																	71571131		2198	4300	6498	SO:0001583	missense	10164	exon2			TCAACCTGCAGTC	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.551T>C	16.37:g.71571131T>C	ENSP00000341206:p.Leu184Pro		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001166395	0		0	Q8IV46|Q9Y5R3	Missense_Mutation	SNP	ENST00000338482.5	37	CCDS10902.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987484	0.74589	.	.	ENSG00000140835	ENST00000338482;ENST00000539698	D;D	0.84442	-1.85;-1.85	5.65	5.65	0.86999	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000003	D	0.93848	0.8032	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95056	0.8191	10	0.87932	D	0	-12.3149	13.8294	0.63370	0.0:0.0:0.0:1.0	.	184	Q8NCG5	CHST4_HUMAN	P	184	ENSP00000341206:L184P;ENSP00000441204:L184P	ENSP00000341206:L184P	L	+	2	0	CHST4	70128632	1.000000	0.71417	0.999000	0.59377	0.725000	0.41563	8.040000	0.89188	2.149000	0.67028	0.533000	0.62120	CTG			0.627	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268992.4		NM_005769	
PFAS	5198	broad.mit.edu	37	17	8167575	8167576	+	Frame_Shift_Ins	INS	-	-	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr17:8167575_8167576insA	ENST00000314666.6	+	16	1970_1971	c.1837_1838insA	c.(1837-1839)cagfs	p.Q613fs	PFAS_ENST00000585319.1_3'UTR|PFAS_ENST00000545834.1_Frame_Shift_Ins_p.Q189fs	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	613					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	AAGAAATGGCCAGGGGGATGCC	0.604																																					p.Q613fs													.	PFAS	91		0			c.1837_1838insA																																									SO:0001589	frameshift_variant	5198	exon16			AATGGCCAGGGGG	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.1838dupA	17.37:g.8167576_8167576dupA	ENSP00000313490:p.Gln613fs		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	84	0.10	8	NM_012393	17	0.00	0	A6H8V8	Frame_Shift_Ins	INS	ENST00000314666.6	37	CCDS11136.1																																																																																					0.604	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226994.2			
PIK3R5	23533	mdanderson.org	37	17	8812424	8812424	+	Silent	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr17:8812424G>T	ENST00000447110.1	-	3	295	c.171C>A	c.(169-171)atC>atA	p.I57I	PIK3R5_ENST00000581552.1_Silent_p.I57I|PIK3R5_ENST00000584803.1_Silent_p.I57I	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	57	Heterodimerization. {ECO:0000250}.				blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GCTCAAGGAGGATAAGGAAGT	0.592																																					p.I57I	NSCLC(18;589 615 7696 20311 50332)												.	.			0			c.C171A												38.0	32.0	34.0					17																	8812424		2203	4300	6503	SO:0001819	synonymous_variant	23533	exon3			AAGGAGGATAAGG	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.171C>A	17.37:g.8812424G>T			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001142633	0		0	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Silent	SNP	ENST00000447110.1	37	CCDS11147.1																																																																																					0.592	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000227003.2		NM_014308	
DHRS7C	201140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	9683343	9683343	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr17:9683343G>A	ENST00000330255.5	-	3	292	c.280C>T	c.(280-282)Cca>Tca	p.P94S	DHRS7C_ENST00000571134.1_Missense_Mutation_p.P93S	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	94					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						ACCAGCTTTGGGGTGAATGTC	0.507																																					p.P94S													.	.			0			c.C280T												61.0	61.0	61.0					17																	9683343		2039	4197	6236	SO:0001583	missense	201140	exon3			GCTTTGGGGTGAA		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.280C>T	17.37:g.9683343G>A	ENSP00000327975:p.Pro94Ser		Somatic	113	0	0		WXS	Illumina HiSeq	.	85	0.19	16	NM_001220493	0		0	B7ZW74|B9EJH3	Missense_Mutation	SNP	ENST00000330255.5	37	CCDS56020.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902524	0.72754	.	.	ENSG00000184544	ENST00000330255	D	0.87334	-2.24	5.48	5.48	0.80851	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92192	0.7524	M	0.68952	2.095	0.58432	D	0.999999	D;D	0.69078	0.997;0.981	D;P	0.63283	0.913;0.796	D	0.92631	0.6116	10	0.66056	D	0.02	.	18.1339	0.89610	0.0:0.0:1.0:0.0	.	94;90	A6NNS2;B9EJH3	DRS7C_HUMAN;.	S	94	ENSP00000327975:P94S	ENSP00000327975:P94S	P	-	1	0	DHRS7C	9624068	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.450000	0.80656	2.567000	0.86603	0.655000	0.94253	CCA			0.507	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000439863.1		XM_113912	
MIEF2	125170	broad.mit.edu;mdanderson.org	37	17	18167776	18167776	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr17:18167776C>G	ENST00000323019.4	+	4	1274	c.1063C>G	c.(1063-1065)Cgg>Ggg	p.R355G	MIEF2_ENST00000395706.2_Missense_Mutation_p.R366G|MIEF2_ENST00000395704.4_3'UTR	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	355					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											GACTCGCCGGCGGCTGCTGCT	0.692																																					p.R366G													.	SMCR7	20		0			c.C1096G												29.0	36.0	34.0					17																	18167776		2186	4272	6458	SO:0001583	missense	0	exon4			CGCCGGCGGCTGC	BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.1063C>G	17.37:g.18167776C>G	ENSP00000323591:p.Arg355Gly		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	17	0.18	3	NM_148886	3	0.00	0	J3KPT3|Q6ZRD4|Q96N07	Missense_Mutation	SNP	ENST00000323019.4	37	CCDS11193.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281060	0.23392	.	.	ENSG00000177427	ENST00000323019;ENST00000395706	T;T	0.08370	3.1;3.1	5.45	4.46	0.54185	.	0.565319	0.19845	N	0.104766	T	0.18299	0.0439	L	0.54323	1.7	0.09310	N	1	D	0.63046	0.992	D	0.64506	0.926	T	0.08391	-1.0724	10	0.23891	T	0.37	-46.6051	8.839	0.35131	0.1776:0.7427:0.0:0.0797	.	355	Q96C03	MID49_HUMAN	G	355;366	ENSP00000323591:R355G;ENSP00000379057:R366G	ENSP00000323591:R355G	R	+	1	2	SMCR7	18108501	0.001000	0.12720	0.844000	0.33320	0.146000	0.21551	0.143000	0.16115	1.199000	0.43173	0.462000	0.41574	CGG			0.692	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132060.2		NM_139162	
CCDC144NL-AS1	440416	broad.mit.edu	37	17	20806171	20806171	+	RNA	SNP	C	C	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr17:20806171C>A	ENST00000577537.1	+	0	1355				RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000439794.2_RNA|RP11-344E13.3_ENST00000417232.2_RNA|RP11-344E13.3_ENST00000577860.1_RNA																							ACAATTCATTCGttttttaaa	0.328																																					.													.	.			0			.																																											0	.			TTCATTCGTTTTT																													17.37:g.20806171C>A			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	5	0.40	2	.	33	0.00	0		RNA	SNP	ENST00000577537.1	37																																																																																						0.328	RP11-344E13.3-001	KNOWN	basic	antisense	antisense		OTTHUMT00000444041.1			
PSMD11	5717	broad.mit.edu	37	17	30771555	30771555	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr17:30771555C>T	ENST00000261712.3	+	1	277	c.14C>T	c.(13-15)gCg>gTg	p.A5V	PSMD11_ENST00000457654.2_Missense_Mutation_p.A5V	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			gcggcggcggcggtggtggAG	0.701																																					p.A5V	Ovarian(130;1038 1716 9294 11987 19279)												.	PSMD11	41		0			c.C14T												18.0	18.0	18.0					17																	30771555		2186	4270	6456	SO:0001583	missense	5717	exon1			CGGCGGCGGTGGT	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.14C>T	17.37:g.30771555C>T	ENSP00000261712:p.Ala5Val		Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	232	0.02	5	NM_002815	11	0.00	0	A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	ENST00000261712.3	37	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999150	0.74818	.	.	ENSG00000108671	ENST00000261712	.	.	.	5.25	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.24928	0.0605	N	0.08118	0	0.53688	D	0.999975	P;B	0.37038	0.579;0.212	B;B	0.33392	0.163;0.049	T	0.08086	-1.0739	9	0.27785	T	0.31	-19.5166	11.4424	0.50105	0.0:0.9133:0.0:0.0867	.	5;5	B4DTS5;O00231	.;PSD11_HUMAN	V	5	.	ENSP00000261712:A5V	A	+	2	0	PSMD11	27795668	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.945000	0.75947	1.455000	0.47813	0.558000	0.71614	GCG			0.701	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256252.2		NM_002815	
KRT36	8689	mdanderson.org	37	17	39644941	39644941	+	Silent	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr17:39644941G>T	ENST00000328119.6	-	2	494	c.495C>A	c.(493-495)gtC>gtA	p.V165V	KRT36_ENST00000393986.2_Silent_p.V115V	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	165	Coil 1B.|Rod.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				CAATCTGCAGGACCAGCCTGG	0.577																																					p.V165V													.	.			0			c.C495A												130.0	119.0	123.0					17																	39644941		2203	4300	6503	SO:0001819	synonymous_variant	8689	exon2			CTGCAGGACCAGC	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.495C>A	17.37:g.39644941G>T			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_003771	0		0	Q86XG4	Silent	SNP	ENST00000328119.6	37	CCDS11395.1																																																																																					0.577	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259508.1		NM_003771	
ATP8B3	148229	broad.mit.edu	37	19	1799763	1799764	+	Intron	INS	-	-	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr19:1799763_1799764insA	ENST00000310127.6	-	14	1791				ATP8B3_ENST00000526092.2_Frame_Shift_Ins_p.E526fs|ATP8B3_ENST00000525591.1_Intron|ATP8B3_ENST00000539485.1_Intron	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gactctgcctcaaaaaaaaaaa	0.545																																					.													.	ATP8B3	108		0			.																																									SO:0001627	intron_variant	148229	.			CTGCCTCAAAAAA	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1552+181->T	19.37:g.1799774_1799774dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	7	0.00	0	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Frame_Shift_Ins	INS	ENST00000310127.6	37	CCDS45901.1																																																																																					0.545	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000388279.1		NM_138813	
CACTIN	58509	mdanderson.org	37	19	3612401	3612401	+	Silent	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr19:3612401G>A	ENST00000429344.2	-	10	1849	c.1797C>T	c.(1795-1797)agC>agT	p.S599S	CACTIN-AS1_ENST00000592274.1_RNA|CACTIN_ENST00000221899.3_Silent_p.S531S|CACTIN_ENST00000248420.5_Silent_p.S599S	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	599					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CGGCGCTCTCGCTGGCGTCTC	0.721																																					p.S599S													.	.			0			c.C1797T												15.0	16.0	16.0					19																	3612401		2100	4211	6311	SO:0001819	synonymous_variant	58509	exon10			GCTCTCGCTGGCG	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.1797C>T	19.37:g.3612401G>A			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001080543	80	0.00	0	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Silent	SNP	ENST00000429344.2	37	CCDS45920.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493117	0.26774	.	.	ENSG00000226800	ENST00000447295	.	.	.	3.56	-1.23	0.09465	.	.	.	.	.	T	0.50069	0.1594	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37911	-0.9685	5	0.24483	T	0.36	.	8.1269	0.31003	0.4915:0.0:0.5085:0.0	.	.	.	.	T	225	.	ENSP00000412459:A225T	A	+	1	0	C19orf29OS	3563401	0.930000	0.31532	0.998000	0.56505	0.736000	0.42039	0.099000	0.15210	-0.001000	0.14495	-0.275000	0.10095	GCT			0.721	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000457370.2			
CD320	51293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8367841	8367841	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr19:8367841C>T	ENST00000301458.5	-	4	590	c.526G>A	c.(526-528)Ggg>Agg	p.G176R	CD320_ENST00000596246.1_5'Flank|CD320_ENST00000537716.2_Missense_Mutation_p.G134R	NM_016579.3	NP_057663.1	Q9NPF0	CD320_HUMAN	CD320 molecule	176					cobalamin metabolic process (GO:0009235)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)	6						GTGGCATCCCCTTCCGGGAGG	0.622																																					p.G176R													.	.			0			c.G526A												28.0	28.0	28.0					19																	8367841		2203	4300	6503	SO:0001583	missense	51293	exon4			CATCCCCTTCCGG	AF161254	CCDS12198.1, CCDS54210.1	19p13.3-p13.2	2008-02-05	2006-03-28			ENSG00000167775		"""CD molecules"""	16692	protein-coding gene	gene with protein product	"""8D6 antigen"""	606475	"""CD320 antigen"""			10727470	Standard	NM_016579		Approved	8D6, 8D6A	uc002mjj.2	Q9NPF0		ENST00000301458.5:c.526G>A	19.37:g.8367841C>T	ENSP00000301458:p.Gly176Arg		Somatic	65	0	0		WXS	Illumina HiSeq	.	106	0.23	24	NM_016579	212	0.23	49	B2RDS5|D6W668|F5H6D3|Q53HF7	Missense_Mutation	SNP	ENST00000301458.5	37	CCDS12198.1	.	.	.	.	.	.	.	.	.	.	C	9.883	1.202152	0.22121	.	.	ENSG00000167775	ENST00000323539;ENST00000301458;ENST00000537716	D;D	0.96651	-3.04;-4.08	3.86	0.486	0.16836	.	0.831838	0.10368	N	0.683179	D	0.88680	0.6502	N	0.17082	0.46	0.09310	N	1	B;B	0.32101	0.356;0.107	B;B	0.27170	0.077;0.035	T	0.80569	-0.1324	10	0.24483	T	0.36	-4.4677	4.2189	0.10547	0.0:0.57:0.2175:0.2125	.	134;176	F5H6D3;Q9NPF0	.;CD320_HUMAN	R	7;176;134	ENSP00000301458:G176R;ENSP00000437697:G134R	ENSP00000301458:G176R	G	-	1	0	CD320	8273841	0.000000	0.05858	0.003000	0.11579	0.035000	0.12851	-0.080000	0.11339	0.209000	0.20645	0.655000	0.94253	GGG			0.622	CD320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461366.1		NM_016579	
RFX1	5989	mdanderson.org	37	19	14074032	14074032	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr19:14074032G>T	ENST00000254325.4	-	19	2860	c.2626C>A	c.(2626-2628)Cac>Aac	p.H876N		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	876	Necessary for dimerization.				immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CGGATGAGGTGGAAGGAACCG	0.667																																					p.H876N													.	.			0			c.C2626A												74.0	58.0	64.0					19																	14074032		2203	4300	6503	SO:0001583	missense	5989	exon19			TGAGGTGGAAGGA		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2626C>A	19.37:g.14074032G>T	ENSP00000254325:p.His876Asn		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_002918	34	0.00	0		Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	g	32	5.133269	0.94517	.	.	ENSG00000132005	ENST00000254325	T	0.48522	0.81	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.67420	0.2891	M	0.83312	2.635	0.80722	D	1	P	0.47253	0.892	P	0.56648	0.803	T	0.70063	-0.4975	10	0.44086	T	0.13	-33.0247	17.1643	0.86811	0.0:0.0:1.0:0.0	.	876	P22670	RFX1_HUMAN	N	876	ENSP00000254325:H876N	ENSP00000254325:H876N	H	-	1	0	RFX1	13935032	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.670000	0.98625	2.360000	0.80028	0.430000	0.28490	CAC			0.667	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458510.1		NM_002918	
SLC27A1	376497	mdanderson.org	37	19	17581367	17581367	+	Silent	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr19:17581367G>A	ENST00000252595.7	+	1	115	c.18G>A	c.(16-18)gcG>gcA	p.A6A	SLC27A1_ENST00000442725.1_Silent_p.A6A|SLC27A1_ENST00000598424.1_5'UTR	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	6					adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CTCCGGGTGCGGGCGCGGCCT	0.781																																					p.A6A													.	.			0			c.G18A												4.0	5.0	5.0					19																	17581367		1880	3738	5618	SO:0001819	synonymous_variant	376497	exon1			GGGTGCGGGCGCG	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.18G>A	19.37:g.17581367G>A			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_198580	0		0	A6NIH2|B7Z662	Silent	SNP	ENST00000252595.7	37	CCDS32953.1																																																																																					0.781	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464145.1		NM_198580	
FAM71E2	284418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55870472	55870472	+	Silent	SNP	C	C	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr19:55870472C>A	ENST00000424985.3	-	9	1957	c.1764G>T	c.(1762-1764)ccG>ccT	p.P588P	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.R138L	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	588										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						CCGTCACCACCGGCTCCGGTT	0.617																																					p.P588P													.	.			0			c.G1764T												20.0	18.0	19.0					19																	55870472		692	1591	2283	SO:0001819	synonymous_variant	284418	exon9			CACCACCGGCTCC	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.1764G>T	19.37:g.55870472C>A			Somatic	141	0	0		WXS	Illumina HiSeq	.	141	0.12	17	NM_001145402	0		0	Q8ND99	Silent	SNP	ENST00000424985.3	37																																																																																						0.617	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000409063.4		NM_001145402	
KIF3C	3797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	26203245	26203245	+	Nonsense_Mutation	SNP	G	G	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr2:26203245G>C	ENST00000264712.3	-	1	2121	c.1542C>G	c.(1540-1542)taC>taG	p.Y514*	KIF3C_ENST00000405914.1_Nonsense_Mutation_p.Y514*	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	514					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCTTACCTTGTACTTGGCCG	0.617																																					p.Y514X													.	.			0			c.C1542G												45.0	44.0	44.0					2																	26203245		2203	4300	6503	SO:0001587	stop_gained	3797	exon1			TACCTTGTACTTG		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1542C>G	2.37:g.26203245G>C	ENSP00000264712:p.Tyr514*		Somatic	55	0	0		WXS	Illumina HiSeq	.	104	0.15	16	NM_002254	7	0.14	1	O43544|Q4ZG18|Q53SX5|Q562F7	Nonsense_Mutation	SNP	ENST00000264712.3	37	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	G	44	11.232290	0.99534	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	.	.	.	5.62	5.62	0.85841	.	0.172876	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	18.223	0.89907	0.0:0.0:1.0:0.0	.	.	.	.	X	514;320;514	.	ENSP00000264712:Y514X	Y	-	3	2	KIF3C	26056749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.627000	0.67784	2.653000	0.90120	0.655000	0.94253	TAC			0.617	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211611.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89100923	89100924	+	RNA	INS	-	-	G	rs369765448		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr2:89100923_89100924insG	ENST00000393525.3	+	0	1397_1398									ankyrin repeat domain 36B pseudogene 2																		AATATAAAAAAGATACATATGA	0.282																																					.													.	.			0			.																																											0	.			TAAAAAAGATACA			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89100924_89100924dupG			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	8	0.63	5	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.282	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
FER1L5	90342	broad.mit.edu	37	2	97362036	97362036	+	RNA	DEL	T	T	-			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr2:97362036delT	ENST00000457909.1	+	0	3586							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						cttttcaatcttttttttttt	0.458																																					.													.	FER1L5	113		0			.																																											90342	.			TCAATCTTTTTTT	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97362036delT			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	Q17RH2|Q6ZU24	RNA	DEL	ENST00000457909.1	37																																																																																						0.458	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene		OTTHUMT00000339030.1		NM_001077400	
GPR45	11250	mdanderson.org	37	2	105859003	105859003	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr2:105859003C>T	ENST00000258456.1	+	1	804	c.688C>T	c.(688-690)Cac>Tac	p.H230Y		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						CGTGCGCGTGCACAACCAGTC	0.652																																					p.H230Y													.	.			0			c.C688T												76.0	78.0	77.0					2																	105859003		2203	4300	6503	SO:0001583	missense	11250	exon1			CGCGTGCACAACC	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.688C>T	2.37:g.105859003C>T	ENSP00000258456:p.His230Tyr		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_007227	0		0	Q6NWS4|Q6NXU6	Missense_Mutation	SNP	ENST00000258456.1	37	CCDS2066.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123375	0.77436	.	.	ENSG00000135973	ENST00000258456	T	0.37915	1.17	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.057139	0.64402	D	0.000001	T	0.55369	0.1916	M	0.80183	2.485	0.54753	D	0.999983	P	0.37636	0.603	P	0.47376	0.545	T	0.61505	-0.7049	10	0.72032	D	0.01	-29.3292	18.125	0.89583	0.0:1.0:0.0:0.0	.	230	Q9Y5Y3	GPR45_HUMAN	Y	230	ENSP00000258456:H230Y	ENSP00000258456:H230Y	H	+	1	0	GPR45	105225435	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	4.909000	0.63314	2.373000	0.80994	0.462000	0.41574	CAC			0.652	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253348.1		NM_007227	
ANKRD30BL	554226	broad.mit.edu	37	2	132919099	132919099	+	Silent	SNP	C	C	T	rs199974298		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr2:132919099C>T	ENST00000409867.1	-	1	429	c.180G>A	c.(178-180)aaG>aaA	p.K60K	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	60										endometrium(1)|kidney(3)	4						CCATTGTCGTCTTCTTCATCA	0.582																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			TGTCGTCTTCTTC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.180G>A	2.37:g.132919099C>T			Somatic	87	0.0114942529	1		WXS	Illumina HiSeq	Phase_I	64	0.09	6	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
ANKRD30BL	554226	bcgsc.ca	37	2	132919171	132919171	+	Silent	SNP	A	A	G	rs199695856		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr2:132919171A>G	ENST00000409867.1	-	1	357	c.108T>C	c.(106-108)caT>caC	p.H36H	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	36										endometrium(1)|kidney(3)	4						TGAGATCCCCATGGTGAATCA	0.582																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			ATCCCCATGGTGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.108T>C	2.37:g.132919171A>G			Somatic	141	0.0212765957	3		WXS	Illumina HiSeq	Phase_1	158	0.10	16	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
C20orf144	128864	mdanderson.org	37	20	32251487	32251487	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr20:32251487G>C	ENST00000375222.3	+	2	338	c.276G>C	c.(274-276)agG>agC	p.R92S	ACTL10_ENST00000330271.4_5'Flank|NECAB3_ENST00000246190.6_Intron|NECAB3_ENST00000375238.4_Intron|NECAB3_ENST00000606525.1_5'Flank	NM_080825.3	NP_543015.1	Q9BQM9	CT144_HUMAN	chromosome 20 open reading frame 144	92										lung(1)	1						GCGAGCCGAGGATGCCGGTAC	0.741																																					p.R92S													.	.			0			c.G276C												4.0	5.0	5.0					20																	32251487		1646	3432	5078	SO:0001583	missense	128864	exon2			GCCGAGGATGCCG	AL121906	CCDS13223.1	20q11.22	2012-07-17			ENSG00000149609	ENSG00000149609			16137	protein-coding gene	gene with protein product	"""bcl-2-like protein from testis"""					11780052	Standard	NM_080825		Approved	dJ63M2.6, bclt	uc002wzs.2	Q9BQM9	OTTHUMG00000032263	ENST00000375222.3:c.276G>C	20.37:g.32251487G>C	ENSP00000364370:p.Arg92Ser		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	11	0.09	1	NM_080825	0		0	Q1AHR2	Missense_Mutation	SNP	ENST00000375222.3	37	CCDS13223.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049999	0.36181	.	.	ENSG00000149609	ENST00000375222	T	0.44482	0.92	3.8	2.82	0.32997	.	0.256135	0.27495	N	0.019104	T	0.21186	0.0510	N	0.08118	0	0.09310	N	0.999998	B	0.15473	0.013	B	0.17098	0.017	T	0.15122	-1.0448	10	0.45353	T	0.12	-11.5584	7.6402	0.28290	0.1214:0.0:0.8786:0.0	.	92	Q9BQM9	CT144_HUMAN	S	92	ENSP00000364370:R92S	ENSP00000364370:R92S	R	+	3	2	C20orf144	31715148	0.906000	0.30813	0.063000	0.19743	0.029000	0.11900	1.262000	0.32992	0.913000	0.36797	0.400000	0.26472	AGG			0.741	C20orf144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078714.2		NM_080825	
BAGE2	85319	broad.mit.edu	37	21	11088494	11088494	+	RNA	DEL	G	G	-	rs2987469|rs372869598		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr21:11088494delG	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ttttgttgttgttgttttttt	0.408																																					.													.	.			0			.																																											85319	.			GTTGTTGTTGTTT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11088494delG			Somatic	5	0.2	1		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.408	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
SPECC1L	23384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24718079	24718079	+	Silent	SNP	A	A	T	rs551676689		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr22:24718079A>T	ENST00000314328.9	+	5	1416	c.1131A>T	c.(1129-1131)atA>atT	p.I377I	SPECC1L_ENST00000437398.1_Silent_p.I377I|SPECC1L_ENST00000541492.1_Silent_p.I377I|SPECC1L_ENST00000416735.1_Intron|SPECC1L-ADORA2A_ENST00000358654.2_Silent_p.I377I	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	377					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						TCCCCAGCATAGAGCGCTCCC	0.562													A|||	1	0.000199681	0.0	0.0014	5008	,	,		21152	0.0		0.0	False		,,,				2504	0.0				p.I377I													.	.			0			c.A1131T												48.0	51.0	50.0					22																	24718079		2203	4300	6503	SO:0001819	synonymous_variant	23384	exon4			CAGCATAGAGCGC	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1131A>T	22.37:g.24718079A>T			Somatic	46	0	0		WXS	Illumina HiSeq	.	77	0.18	14	NM_001145468	11	0.09	1	B7Z758|F5H1H6|O15081	Silent	SNP	ENST00000314328.9	37	CCDS33619.1																																																																																					0.562	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319986.2		NM_015330	
Unknown	0	bcgsc.ca	37	22	34985577	34985577	+	IGR	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr22:34985577C>T								LL22NC03-13G6.2 (380326 upstream) : RP1-288L1.5 (113539 downstream)																							TGTCCAAGTGCCCACGGAACT	0.582																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CAAGTGCCCACGG																													22.37:g.34985577C>T			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_1	37	0.11	4	.	0		0		RNA	SNP		37																																																																																					0	0.582										
SHANK3	85358	mdanderson.org	37	22	51169200	51169200	+	Silent	SNP	C	C	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr22:51169200C>A	ENST00000414786.2	+	23	4868	c.4641C>A	c.(4639-4641)ccC>ccA	p.P1547P	SHANK3_ENST00000262795.3_Silent_p.P1568P|SHANK3_ENST00000445220.2_Silent_p.P1563P			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1552					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		AGCGCAgccccgggggcccgg	0.746																																					p.P1538P													.	.			0			c.C4614A												1.0	1.0	1.0					22																	51169200		482	1067	1549	SO:0001819	synonymous_variant	85358	exon22			CAGCCCCGGGGGC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4641C>A	22.37:g.51169200C>A			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_033517	10	0.00	0	D7UT47|Q8TET3	Silent	SNP	ENST00000414786.2	37																																																																																						0.746	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000316674.2		NM_001080420	
CFAP44	55779	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	3	113115497	113115497	+	Silent	SNP	T	T	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr3:113115497T>C	ENST00000295868.2	-	14	1809	c.1647A>G	c.(1645-1647)aaA>aaG	p.K549K	WDR52_ENST00000393845.2_Silent_p.K549K|WDR52_ENST00000475568.1_5'UTR	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TCGTGAGCCCTTTTGGATCAT	0.378																																					p.K549K													.	.			0			c.A1647G												89.0	92.0	91.0					3																	113115497		2203	4300	6503	SO:0001819	synonymous_variant	55779	exon14			GAGCCCTTTTGGA																												ENST00000295868.2:c.1647A>G	3.37:g.113115497T>C			Somatic	103	0	0		WXS	Illumina HiSeq	.	98	0.04	4	NM_001164496	10	0.00	0		Silent	SNP	ENST00000295868.2	37	CCDS2972.1																																																																																					0.378	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354128.3			
EEFSEC	60678	mdanderson.org	37	3	127872594	127872594	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr3:127872594G>C	ENST00000254730.6	+	1	298	c.244G>C	c.(244-246)Ggc>Cgc	p.G82R	EEFSEC_ENST00000483457.1_Missense_Mutation_p.G82R|RUVBL1_ENST00000464873.1_5'UTR	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	82	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						GCCCGAGCCCGGCGAGCCACT	0.741																																					p.G82R													.	.			0			c.G244C												3.0	5.0	4.0					3																	127872594		1797	3775	5572	SO:0001583	missense	60678	exon1			GAGCCCGGCGAGC		CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.244G>C	3.37:g.127872594G>C	ENSP00000254730:p.Gly82Arg		Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	9	0.11	1	NM_021937	7	0.00	0	Q96HZ6	Missense_Mutation	SNP	ENST00000254730.6	37	CCDS33849.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437941	0.43326	.	.	ENSG00000132394	ENST00000254730;ENST00000483457	T;T	0.69926	-0.44;-0.44	3.99	3.09	0.35607	Protein synthesis factor, GTP-binding (1);	0.482842	0.20710	N	0.087118	T	0.70631	0.3246	M	0.77103	2.36	0.28474	N	0.915286	P;P	0.36647	0.563;0.519	B;B	0.43728	0.429;0.355	T	0.66464	-0.5917	10	0.52906	T	0.07	-14.095	10.4604	0.44577	0.1008:0.0:0.8992:0.0	.	82;82	C9J8T0;P57772	.;SELB_HUMAN	R	82	ENSP00000254730:G82R;ENSP00000417660:G82R	ENSP00000254730:G82R	G	+	1	0	EEFSEC	129355284	0.832000	0.29368	0.042000	0.18584	0.076000	0.17211	3.487000	0.53222	0.769000	0.33313	0.585000	0.79938	GGC			0.741	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356738.2		NM_021937	
TFP1	100129696	broad.mit.edu	37	3	133423291	133423292	+	RNA	INS	-	-	A	rs533095507		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr3:133423291_133423292insA	ENST00000460564.1	+	0	381									transferrin pseudogene 1																		GGAGCTAGTAGAAAAAAAAAGT	0.381																																					.													.	.			0			.																																											0	.			CTAGTAGAAAAAA	M22375		3q22	2012-10-02	2010-07-20	2010-07-20	ENSG00000242337	ENSG00000242337			11759	pseudogene	pseudogene			"""transferrin pseudogene"""	TFP			Standard	NG_008673		Approved				OTTHUMG00000159751		3.37:g.133423300_133423300dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000460564.1	37																																																																																						0.381	TFP1-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000357168.1		NG_008673	
ZBTB38	253461	broad.mit.edu	37	3	141164031	141164031	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr3:141164031T>G	ENST00000514251.1	+	4	3080	c.2801T>G	c.(2800-2802)aTg>aGg	p.M934R	ZBTB38_ENST00000321464.5_Missense_Mutation_p.M935R|ZBTB38_ENST00000441582.2_Missense_Mutation_p.M934R					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						TTGAAAAAAATGAGGAAAGTC	0.493																																					p.M934R													.	ZBTB38	92		0			c.T2801G												46.0	45.0	45.0					3																	141164031		1865	4116	5981	SO:0001583	missense	253461	exon8			AAAAAATGAGGAA	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.2801T>G	3.37:g.141164031T>G	ENSP00000426387:p.Met934Arg		Somatic	163	0.0122699387	2		WXS	Illumina HiSeq	Phase_I	176	0.05	8	NM_001080412	0		0		Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	.	.	.	.	.	.	.	.	.	.	T	8.742	0.919285	0.17982	.	.	ENSG00000177311	ENST00000514251;ENST00000441582;ENST00000321464	T;T;T	0.08458	3.09;3.09;3.09	5.37	5.37	0.77165	.	0.369710	0.29466	N	0.012079	T	0.08403	0.0209	L	0.29908	0.895	0.44515	D	0.997468	B;B	0.33379	0.41;0.41	B;B	0.35550	0.205;0.205	T	0.39313	-0.9620	9	.	.	.	-14.9439	15.3825	0.74669	0.0:0.0:0.0:1.0	.	935;934	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	R	934;934;935	ENSP00000426387:M934R;ENSP00000406955:M934R;ENSP00000372635:M935R	.	M	+	2	0	ZBTB38	142646721	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	1.674000	0.37544	2.042000	0.60477	0.528000	0.53228	ATG			0.493	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359329.2			
USP13	8975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	179439252	179439252	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr3:179439252G>C	ENST00000263966.3	+	8	1434	c.963G>C	c.(961-963)caG>caC	p.Q321H	USP13_ENST00000496897.1_Missense_Mutation_p.Q256H|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	321					autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			AAGTGATCCAGGAGTCGGGCA	0.498																																					p.Q321H													.	.			0			c.G963C												129.0	114.0	119.0					3																	179439252		2203	4300	6503	SO:0001583	missense	8975	exon8			GATCCAGGAGTCG	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.963G>C	3.37:g.179439252G>C	ENSP00000263966:p.Gln321His		Somatic	164	0	0		WXS	Illumina HiSeq	.	218	0.19	42	NM_003940	4	0.00	0	A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	ENST00000263966.3	37	CCDS3235.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768009	0.69878	.	.	ENSG00000058056	ENST00000263966;ENST00000496897	T;T	0.15603	2.42;2.41	6.03	2.32	0.28847	.	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	M	0.85462	2.755	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.984	T	0.13308	-1.0514	10	0.49607	T	0.09	-19.4637	8.9909	0.36024	0.4112:0.0:0.5888:0.0	.	321;321	Q92995;A8K2S3	UBP13_HUMAN;.	H	321;256	ENSP00000263966:Q321H;ENSP00000417146:Q256H	ENSP00000263966:Q321H	Q	+	3	2	USP13	180921946	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	2.406000	0.44557	0.153000	0.19213	0.655000	0.94253	CAG			0.498	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349617.1			
MUC4	4585	broad.mit.edu	37	3	195512110	195512110	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr3:195512110T>G	ENST00000463781.3	-	2	6800	c.6341A>C	c.(6340-6342)cAt>cCt	p.H2114P	MUC4_ENST00000475231.1_Missense_Mutation_p.H2114P|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATCGGTGTCATGAAGAGCGGT	0.562																																					p.H2114P													.	MUC4	1505		0			c.A6341C												78.0	67.0	70.0					3																	195512110		691	1590	2281	SO:0001583	missense	4585	exon2			GTGTCATGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6341A>C	3.37:g.195512110T>G	ENSP00000417498:p.His2114Pro		Somatic	403	0.0049627792	2		WXS	Illumina HiSeq	Phase_I	427	0.03	11	NM_018406	15	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	t	1.517	-0.548047	0.04024	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.53;1.53	.	.	.	.	.	.	.	.	T	0.07143	0.0181	N	0.02539	-0.55	0.09310	N	1	P	0.42993	0.797	B	0.34452	0.183	T	0.20571	-1.0271	7	.	.	.	.	1.7551	0.02980	0.2999:0.0:0.2998:0.4003	.	2114	E7ESK3	.	P	2114	ENSP00000417498:H2114P;ENSP00000420243:H2114P	.	H	-	2	0	MUC4	196996505	.	.	0.009000	0.14445	0.008000	0.06430	.	.	-2.179000	0.00767	-2.418000	0.00219	CAT			0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
NR3C2	4306	broad.mit.edu;mdanderson.org	37	4	149356894	149356894	+	Silent	SNP	A	A	G			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr4:149356894A>G	ENST00000358102.3	-	2	1481	c.1119T>C	c.(1117-1119)ccT>ccC	p.P373P	NR3C2_ENST00000512865.1_Silent_p.P373P|NR3C2_ENST00000355292.3_Silent_p.P373P|NR3C2_ENST00000344721.4_Silent_p.P373P|NR3C2_ENST00000511528.1_Silent_p.P373P	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	373	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TCTTAGGAAAAGGGACCTCTT	0.493																																					p.P373P	Melanoma(27;428 957 40335 51025 51111)												.	NR3C2	94		0			c.T1119C												101.0	99.0	99.0					4																	149356894		2203	4300	6503	SO:0001819	synonymous_variant	0	exon2			AGGAAAAGGGACC	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1119T>C	4.37:g.149356894A>G			Somatic	124	0.0080645161	1		WXS	Illumina HiSeq	Phase_I	101	0.04	4	NM_001166104	0		0	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	ENST00000358102.3	37	CCDS3772.1																																																																																					0.493	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364986.1			
CHD1	1105	broad.mit.edu;mdanderson.org	37	5	98239547	98239547	+	Silent	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr5:98239547C>T	ENST00000284049.3	-	3	470	c.321G>A	c.(319-321)caG>caA	p.Q107Q		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	107					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	gctgctgctgctgttgctgct	0.393																																					p.Q107Q													.	CHD1	137		0			c.G321A												104.0	99.0	100.0					5																	98239547		2203	4300	6503	SO:0001819	synonymous_variant	1105	exon3			CTGCTGCTGTTGC	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.321G>A	5.37:g.98239547C>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	60	0.07	4	NM_001270	2	0.00	0	Q17RZ3	Silent	SNP	ENST00000284049.3	37	CCDS34204.1																																																																																					0.393	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370295.1		NM_001270	
SHROOM1	134549	mdanderson.org	37	5	132161737	132161737	+	Silent	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr5:132161737G>T	ENST00000378679.3	-	4	900	c.96C>A	c.(94-96)gcC>gcA	p.A32A	SHROOM1_ENST00000319854.3_Silent_p.A32A|SHROOM1_ENST00000378676.1_Silent_p.A32A|SHROOM1_ENST00000488072.1_5'Flank	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	32					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGAGCTGTAGGCCGAGTCCG	0.701																																					p.A32A													.	.			0			c.C96A												6.0	7.0	7.0					5																	132161737		2103	4223	6326	SO:0001819	synonymous_variant	134549	exon1			GCTGTAGGCCGAG	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.96C>A	5.37:g.132161737G>T			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_133456	5	0.00	0	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Silent	SNP	ENST00000378679.3	37	CCDS54902.1																																																																																					0.701	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000133033.1		NM_133456	
HARS2	23438	mdanderson.org	37	5	140071284	140071284	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr5:140071284C>A	ENST00000230771.3	+	1	274	c.51C>A	c.(49-51)agC>agA	p.S17R	HARS_ENST00000448240.1_5'Flank|HARS2_ENST00000437649.2_Missense_Mutation_p.S17R|HARS2_ENST00000448069.2_Missense_Mutation_p.S17R|HARS_ENST00000457527.2_5'Flank|HARS_ENST00000438307.2_5'Flank|HARS2_ENST00000502303.1_Intron|HARS2_ENST00000432671.2_Missense_Mutation_p.S17R|HARS_ENST00000431330.2_5'Flank|HARS_ENST00000504156.1_5'UTR|HARS_ENST00000307633.3_5'Flank|HARS2_ENST00000508522.1_Missense_Mutation_p.S17R|HARS2_ENST00000435019.2_Missense_Mutation_p.S17R|HARS_ENST00000415192.2_5'Flank	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	17					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTGCTCAGCCAGCTCCTGC	0.657																																					p.S17R													.	.			0			c.C51A												8.0	9.0	8.0					5																	140071284		2154	4194	6348	SO:0001583	missense	23438	exon1			GCTCAGCCAGCTC	U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.51C>A	5.37:g.140071284C>A	ENSP00000230771:p.Ser17Arg		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	43	0.09	4	NM_012208	3	0.00	0	B4DDY8	Missense_Mutation	SNP	ENST00000230771.3	37	CCDS4238.1	.	.	.	.	.	.	.	.	.	.	c	14.84	2.656003	0.47467	.	.	ENSG00000112855	ENST00000230771;ENST00000509299;ENST00000503873;ENST00000435019;ENST00000437649;ENST00000432671;ENST00000508522;ENST00000448069	T;T;T;T;T;T	0.45276	1.09;0.98;1.11;0.94;0.94;0.9	5.72	4.85	0.62838	.	0.587506	0.19054	N	0.123956	T	0.24314	0.0589	N	0.08118	0	0.22710	N	0.998829	B;B;B	0.19583	0.0;0.0;0.037	B;B;B	0.17098	0.0;0.0;0.017	T	0.13548	-1.0505	10	0.27785	T	0.31	0.8277	13.0802	0.59109	0.0:0.8388:0.1612:0.0	.	17;17;17	B4DQ67;B4DDY8;P49590	.;.;SYHM_HUMAN	R	17	ENSP00000230771:S17R;ENSP00000412887:S17R;ENSP00000411708:S17R;ENSP00000415007:S17R;ENSP00000423616:S17R;ENSP00000407105:S17R	ENSP00000230771:S17R	S	+	3	2	HARS2	140051468	0.544000	0.26441	0.960000	0.40013	0.451000	0.32288	1.369000	0.34227	1.550000	0.49438	0.655000	0.94253	AGC			0.657	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251670.2		NM_012208	
RUFY1	80230	mdanderson.org	37	5	179021943	179021943	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr5:179021943G>T	ENST00000319449.4	+	12	1502	c.1490G>T	c.(1489-1491)aGc>aTc	p.S497I	RP11-1379J22.2_ENST00000500262.1_RNA|RUFY1_ENST00000393438.2_Missense_Mutation_p.S389I|RUFY1_ENST00000377001.2_3'UTR|RUFY1_ENST00000437570.2_Missense_Mutation_p.S389I	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	497					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTATGTCCAGCATGAAACAA	0.463										HNSCC(44;0.11)																											p.S497I													.	.			0			c.G1490T												105.0	94.0	98.0					5																	179021943		2203	4300	6503	SO:0001583	missense	80230	exon12			TGTCCAGCATGAA	AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1490G>T	5.37:g.179021943G>T	ENSP00000325594:p.Ser497Ile		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_025158	29	0.00	0	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	37	CCDS4445.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.34|12.34	1.908058|1.908058	0.33721|0.33721	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000502434|ENST00000319449;ENST00000437570;ENST00000393438;ENST00000360569	.|T;T;T	.|0.52526	.|0.66;0.68;0.68	5.1|5.1	0.786|0.786	0.18590|0.18590	.|.	.|0.241708	.|0.48286	.|D	.|0.000192	T|T	0.30355|0.30355	0.0762|0.0762	L|L	0.35414|0.35414	1.06|1.06	0.80722|0.80722	D|D	1|1	.|B	.|0.11235	.|0.004	.|B	.|0.09377	.|0.004	T|T	0.05435|0.05435	-1.0885|-1.0885	5|10	.|0.37606	.|T	.|0.19	-5.9387|-5.9387	5.9382|5.9382	0.19177|0.19177	0.2871:0.3354:0.3774:0.0|0.2871:0.3354:0.3774:0.0	.|.	.|497	.|Q96T51	.|RUFY1_HUMAN	H|I	174|497;389;389;99	.|ENSP00000325594:S497I;ENSP00000390025:S389I;ENSP00000377087:S389I	.|ENSP00000325594:S497I	Q|S	+|+	3|2	2|0	RUFY1|RUFY1	178954549|178954549	0.402000|0.402000	0.25311|0.25311	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	1.865000|1.865000	0.39479|0.39479	0.272000|0.272000	0.22027|0.22027	0.550000|0.550000	0.68814|0.68814	CAG|AGC			0.463	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000253505.2		NM_001040451	
ITPR3	3710	mdanderson.org	37	6	33655317	33655317	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr6:33655317G>T	ENST00000374316.5	+	47	7300	c.6240G>T	c.(6238-6240)gaG>gaT	p.E2080D	ITPR3_ENST00000605930.1_Missense_Mutation_p.E2080D			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2080					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TTCAAGAGGAGGAGGCCGAGG	0.632																																					p.E2080D													.	.			0			c.G6240T												56.0	53.0	54.0					6																	33655317		2203	4300	6503	SO:0001583	missense	3710	exon46			AGAGGAGGAGGCC	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6240G>T	6.37:g.33655317G>T	ENSP00000363435:p.Glu2080Asp		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_002224	40	0.00	0	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	5.775	0.327361	0.10956	.	.	ENSG00000096433	ENST00000374316	D	0.91996	-2.95	4.94	3.16	0.36331	.	0.269270	0.37669	N	0.001996	D	0.86306	0.5901	N	0.22421	0.69	0.36689	D	0.879498	P;D	0.58970	0.788;0.984	B;D	0.68192	0.287;0.956	T	0.82713	-0.0321	10	0.19147	T	0.46	-33.1347	8.5546	0.33474	0.3084:0.0:0.6916:0.0	.	2080;1750	Q14573;Q59ES2	ITPR3_HUMAN;.	D	2080	ENSP00000363435:E2080D	ENSP00000363435:E2080D	E	+	3	2	ITPR3	33763295	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	0.974000	0.29436	0.613000	0.30089	-0.258000	0.10820	GAG			0.632	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040204.2		NM_002224	
KLC4	89953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43034061	43034061	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr6:43034061G>A	ENST00000394056.2	+	6	1084	c.589G>A	c.(589-591)Gct>Act	p.A197T	KLC4_ENST00000347162.5_Missense_Mutation_p.A197T|KLC4_ENST00000259708.3_Missense_Mutation_p.A215T|KLC4_ENST00000458460.2_Missense_Mutation_p.A197T|KLC4_ENST00000394058.1_Missense_Mutation_p.A197T|KLC4_ENST00000453940.2_Missense_Mutation_p.A120T|KLC4_ENST00000479388.1_Missense_Mutation_p.A197T			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	197						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			TGGTCAAGGTGCTACAGCAGC	0.537																																					p.A215T													.	.			0			c.G643A												211.0	180.0	190.0					6																	43034061		2203	4300	6503	SO:0001583	missense	89953	exon5			CAAGGTGCTACAG	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.589G>A	6.37:g.43034061G>A	ENSP00000377620:p.Ala197Thr		Somatic	95	0	0		WXS	Illumina HiSeq	.	69	0.28	19	NM_201523	12	0.58	7	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	37	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.530223	0.00951	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000479632;ENST00000470728;ENST00000458460;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	2.57	0.502	0.16932	Rabaptin, GTPase-Rab5 binding (1);	0.994140	0.08162	N	0.988365	T	0.11793	0.0287	L	0.39245	1.2	0.09310	N	1	B;B;B;B	0.21071	0.051;0.0;0.0;0.0	B;B;B;B	0.17433	0.018;0.0;0.0;0.001	T	0.31861	-0.9928	10	0.32370	T	0.25	-12.0738	3.7763	0.08661	0.3767:0.0:0.4398:0.1835	.	120;215;197;197	B4DME9;Q9NSK0-3;Q9NSK0;Q96EG6	.;.;KLC4_HUMAN;.	T	197;120;110;175;197;215;197;197;197	ENSP00000340221:A197T;ENSP00000395806:A120T;ENSP00000419784:A110T;ENSP00000417652:A175T;ENSP00000410358:A197T;ENSP00000259708:A215T;ENSP00000418031:A197T;ENSP00000377620:A197T;ENSP00000377622:A197T	ENSP00000259708:A215T	A	+	1	0	KLC4	43142039	0.972000	0.33761	0.155000	0.22561	0.129000	0.20672	3.384000	0.52478	-0.391000	0.07763	-2.704000	0.00135	GCT			0.537	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040579.2		NM_138343	
HERPUD2	64224	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	35674032	35674033	+	Frame_Shift_Ins	INS	-	-	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr7:35674032_35674033insT	ENST00000396081.1	-	7	1752_1753	c.948_949insA	c.(946-951)caagctfs	p.A317fs	HERPUD2_ENST00000426180.1_5'UTR|HERPUD2_ENST00000311350.3_Frame_Shift_Ins_p.A317fs	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	317					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						AACCATCCAGCTTGGTGTCTGT	0.347																																					p.A317fs													.	HERPUD2	47		0			c.949_950insA																																									SO:0001589	frameshift_variant	64224	exon8			ATCCAGCTTGGTG	BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.949dupA	7.37:g.35674034_35674034dupT	ENSP00000379390:p.Ala317fs		Somatic	146	0	0		WXS	Illumina HiSeq	.	161	0.16	25	NM_022373	15	0.00	0	A4D1Y8|Q9H6F9	Frame_Shift_Ins	INS	ENST00000396081.1	37	CCDS5446.1																																																																																					0.347	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250584.1		NM_022373	
LOC101927126	101927126	broad.mit.edu	37	7	75729556	75729557	+	RNA	INS	-	-	A	rs61650407|rs57445555	byFrequency	TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr7:75729556_75729557insA	ENST00000434037.1	-	0	424																											CAGATATAATTAAAAAAAAACC	0.421														2570	0.513179	0.5666	0.4914	5008	,	,		19178	0.3681		0.5507	False		,,,				2504	0.5675				.													.	.			0			.																																											0	.			TATAATTAAAAAA																													7.37:g.75729565_75729565dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	5	0.40	2	.	0		0		RNA	INS	ENST00000434037.1	37																																																																																						0.421	AC005077.12-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344843.1			
DPY19L2P2	349152	broad.mit.edu	37	7	102916153	102916153	+	RNA	DEL	A	A	-	rs200650237		TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr7:102916153delA	ENST00000312132.4	-	0	705							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										AGAAAGCCATAAAAAAGAAAA	0.229																																					.													.	.			0			.																																											0	.			AGCCATAAAAAAG	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102916153delA			Somatic	51	0.0588235294	3		WXS	Illumina HiSeq	Phase_I	81	0.11	9	.	1	0.00	0	Q8N9V4|Q8ND62	RNA	DEL	ENST00000312132.4	37																																																																																						0.229	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000347877.1		NM_182634	
C7orf55-LUC7L2	100996928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139091951	139091951	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr7:139091951G>A	ENST00000354926.4	+	6	896	c.542G>A	c.(541-543)aGt>aAt	p.S181N	C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.S178N|LUC7L2_ENST00000541515.3_Missense_Mutation_p.S247N|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.S180N	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		CCAGCTTCCAGTTTTCAGCAG	0.363																																					p.S247N													.	.			0			c.G740A												80.0	75.0	76.0					7																	139091951		1814	4072	5886	SO:0001583	missense	100996928	exon7			CTTCCAGTTTTCA		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.542G>A	7.37:g.139091951G>A	ENSP00000347005:p.Ser181Asn		Somatic	77	0	0		WXS	Illumina HiSeq	.	107	0.13	14	NM_001244584	245	0.23	56		Missense_Mutation	SNP	ENST00000354926.4	37	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833342	0.71258	.	.	ENSG00000146963	ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.45276	1.48;1.48;1.48;0.9	5.84	5.84	0.93424	.	0.035925	0.85682	D	0.000000	T	0.59390	0.2190	M	0.77313	2.365	0.47905	D	0.999540	B;B;B;B	0.32968	0.392;0.392;0.34;0.392	P;P;B;P	0.45276	0.475;0.475;0.343;0.475	T	0.54873	-0.8228	9	0.36615	T	0.2	-17.7467	20.1336	0.98010	0.0:0.0:1.0:0.0	.	247;178;180;181	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	N	178;247;181;181;180	ENSP00000441604:S178N;ENSP00000440222:S247N;ENSP00000347005:S181N;ENSP00000263545:S180N	ENSP00000263545:S180N	S	+	2	0	LUC7L2	138742491	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.948000	0.87774	2.767000	0.95098	0.591000	0.81541	AGT			0.363	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323618.2			
REPIN1	29803	mdanderson.org	37	7	150069937	150069937	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr7:150069937G>T	ENST00000425389.2	+	1	1685	c.1607G>T	c.(1606-1608)aGc>aTc	p.S536I	RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000397281.2_Missense_Mutation_p.S536I|REPIN1_ENST00000444957.1_Missense_Mutation_p.S536I|REPIN1_ENST00000540729.1_Missense_Mutation_p.S536I|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000489432.2_Missense_Mutation_p.S593I	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	536					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CACCGCAAGAGCCACATCCGG	0.647																																					p.S593I													.	.			0			c.G1778T												43.0	50.0	47.0					7																	150069937		2196	4297	6493	SO:0001583	missense	29803	exon3			GCAAGAGCCACAT	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.1607G>T	7.37:g.150069937G>T	ENSP00000388287:p.Ser536Ile		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001099695	82	0.00	0	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	ENST00000425389.2	37	CCDS43677.1	.	.	.	.	.	.	.	.	.	.	G	3.442	-0.113806	0.06881	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000425389	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	3.95	3.95	0.45737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26376	0.0644	N	0.16790	0.44	0.80722	D	1	B;D	0.53462	0.091;0.96	B;P	0.49192	0.021;0.602	T	0.24621	-1.0155	9	0.02654	T	1	-23.5328	7.3806	0.26854	0.1168:0.0:0.8832:0.0	.	593;536	C9J3L7;Q9BWE0	.;REPI1_HUMAN	I	536;536;536;593;536	ENSP00000445016:S536I;ENSP00000380451:S536I;ENSP00000407714:S536I;ENSP00000417291:S593I;ENSP00000388287:S536I	ENSP00000380451:S536I	S	+	2	0	REPIN1	149700870	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	0.017000	0.13399	2.059000	0.61396	0.563000	0.77884	AGC			0.647	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000376940.1		NM_014374	
TMEM176A	55365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150501507	150501507	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr7:150501507G>A	ENST00000484928.1	+	6	1194	c.613G>A	c.(613-615)Gca>Aca	p.A205T	TMEM176A_ENST00000004103.3_Missense_Mutation_p.A205T|TMEM176A_ENST00000461345.1_Missense_Mutation_p.A146T			Q96HP8	T176A_HUMAN	transmembrane protein 176A	205					negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGCTTCTGGCATCTCTGAC	0.562																																					p.A205T													.	.			0			c.G613A												170.0	151.0	157.0					7																	150501507		2203	4300	6503	SO:0001583	missense	55365	exon6			CTTCTGGCATCTC	AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.613G>A	7.37:g.150501507G>A	ENSP00000417626:p.Ala205Thr		Somatic	102	0	0		WXS	Illumina HiSeq	.	94	0.18	17	NM_018487	120	0.01	1	D3DX00|Q9NYC7	Missense_Mutation	SNP	ENST00000484928.1	37	CCDS5909.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802161	0.31869	.	.	ENSG00000002933	ENST00000484928;ENST00000004103;ENST00000461345;ENST00000475536	T;T;T;T	0.02345	4.33;4.33;4.33;4.33	4.79	3.84	0.44239	.	0.719183	0.13451	N	0.386930	T	0.06872	0.0175	L	0.57536	1.79	0.19575	N	0.999963	P	0.52316	0.952	P	0.51266	0.664	T	0.26121	-1.0112	10	0.52906	T	0.07	-6.1259	8.2357	0.31625	0.125:0.0:0.875:0.0	.	205	Q96HP8	T176A_HUMAN	T	205;205;146;157	ENSP00000417626:A205T;ENSP00000004103:A205T;ENSP00000420818:A146T;ENSP00000417834:A157T	ENSP00000004103:A205T	A	+	1	0	TMEM176A	150132440	0.391000	0.25221	0.808000	0.32385	0.154000	0.21943	1.186000	0.32078	1.019000	0.39547	0.655000	0.94253	GCA			0.562	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350222.1		NM_018487	
PLEC	5339	mdanderson.org	37	8	144992766	144992766	+	Silent	SNP	C	C	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chr8:144992766C>T	ENST00000322810.4	-	32	11803	c.11634G>A	c.(11632-11634)cgG>cgA	p.R3878R	PLEC_ENST00000398774.2_Silent_p.R3709R|PLEC_ENST00000436759.2_Silent_p.R3768R|PLEC_ENST00000354589.3_Silent_p.R3741R|PLEC_ENST00000345136.3_Silent_p.R3741R|PLEC_ENST00000527096.1_Silent_p.R3764R|PLEC_ENST00000357649.2_Silent_p.R3745R|PLEC_ENST00000354958.2_Silent_p.R3719R|PLEC_ENST00000356346.3_Silent_p.R3727R	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3878	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCACAGTCAGCCGCTCCCCCT	0.697																																					p.R3878R													.	.			0			c.G11634A												15.0	19.0	18.0					8																	144992766		1956	4068	6024	SO:0001819	synonymous_variant	5339	exon32			AGTCAGCCGCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11634G>A	8.37:g.144992766C>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_201380	64	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																					0.697	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
COL4A6	1288	broad.mit.edu;mdanderson.org	37	X	107457453	107457453	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chrX:107457453G>T	ENST00000372216.4	-	6	433	c.333C>A	c.(331-333)caC>caA	p.H111Q	COL4A6_ENST00000394872.2_Missense_Mutation_p.H109Q|COL4A6_ENST00000334504.7_Missense_Mutation_p.H110Q|COL4A6_ENST00000538570.1_Missense_Mutation_p.H110Q|COL4A6_ENST00000545689.1_Missense_Mutation_p.H110Q	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	111	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GTTGTCCAGGGTGGCCCTGTT	0.517									Alport syndrome with Diffuse Leiomyomatosis																												p.H111Q	Melanoma(87;1895 1945 2589 7165)												.	COL4A6	270		0			c.C333A												83.0	76.0	78.0					X																	107457453		2203	4300	6503	SO:0001583	missense	1288	exon6	Familial Cancer Database		TCCAGGGTGGCCC	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.333C>A	X.37:g.107457453G>T	ENSP00000361290:p.His111Gln		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	63	0.06	4	NM_001847	2	0.00	0	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	G	6.732	0.503853	0.12822	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.93426	-3.17;-3.17;-3.22;-3.17;-3.17	4.92	3.13	0.36017	.	0.000000	0.42682	D	0.000669	D	0.90504	0.7025	L	0.33245	0.995	0.54753	D	0.99998	P;P;P;P	0.52061	0.911;0.95;0.928;0.911	P;P;P;P	0.53593	0.61;0.61;0.73;0.61	D	0.85440	0.1154	10	0.10636	T	0.68	.	10.1673	0.42888	0.1907:0.0:0.8093:0.0	.	110;110;111;110	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	Q	111;110;109;110;110;110	ENSP00000361290:H111Q;ENSP00000334733:H110Q;ENSP00000378340:H109Q;ENSP00000443707:H110Q;ENSP00000445236:H110Q	ENSP00000334733:H110Q	H	-	3	2	COL4A6	107344109	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	1.339000	0.33885	0.538000	0.28769	-1.483000	0.00984	CAC			0.517	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057875.2			
HAUS7	55559	mdanderson.org	37	X	152721206	152721206	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO6-01A-31D-A435-10	TCGA-XE-AAO6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2979e53-eb2f-43a8-853a-f90da33bbd9f	9ef93c95-4322-4957-bf77-80f23f328b8c	g.chrX:152721206G>T	ENST00000370211.4	-	8	797	c.754C>A	c.(754-756)Caa>Aaa	p.Q252K	TREX2_ENST00000338525.2_5'UTR|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000370212.3_Missense_Mutation_p.Q252K|TREX2_ENST00000334497.2_5'UTR|HAUS7_ENST00000484394.1_5'UTR|HAUS7_ENST00000421080.2_Intron|TREX2_ENST00000370232.1_Intron	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	252					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						GCAGCCCCTTGCTCATGCTGT	0.607																																					p.Q252K													.	.			0			c.C754A												48.0	50.0	49.0					X																	152721206		2203	4300	6503	SO:0001583	missense	55559	exon8			CCCCTTGCTCATG	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.754C>A	X.37:g.152721206G>T	ENSP00000359230:p.Gln252Lys		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_017518	104	0.00	0	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	ENST00000370211.4	37	CCDS35438.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.133|0.133	-1.111290|-1.111290	0.01813|0.01813	.|.	.|.	ENSG00000213397|ENSG00000213397	ENST00000370211;ENST00000370219;ENST00000370212|ENST00000435662	T;T;T|.	0.23552|.	1.9;1.9;1.9|.	4.8|4.8	-0.682|-0.682	0.11339|0.11339	.|.	1.613170|.	0.04121|.	N|.	0.316254|.	T|T	0.36799|0.36799	0.0980|0.0980	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	1|1	B;B|.	0.18013|.	0.002;0.025|.	B;B|.	0.16722|.	0.002;0.016|.	T|T	0.34601|0.34601	-0.9822|-0.9822	10|5	0.27082|.	T|.	0.32|.	1.5548|1.5548	8.6788|8.6788	0.34196|0.34196	0.0:0.5749:0.1878:0.2373|0.0:0.5749:0.1878:0.2373	.|.	252;252|.	Q99871;Q99871-2|.	HAUS7_HUMAN;.|.	K|R	242;252;252|35	ENSP00000359230:Q242K;ENSP00000359239:Q252K;ENSP00000359231:Q252K|.	ENSP00000359230:Q242K|.	Q|S	-|-	1|3	0|2	HAUS7|HAUS7	152374400|152374400	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.019000|0.019000	0.09904|0.09904	0.132000|0.132000	0.15891|0.15891	-0.217000|-0.217000	0.10033|0.10033	0.292000|0.292000	0.19580|0.19580	CAA|AGC			0.607	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000060963.2		NM_017518	
