#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
RNF207	388591	mdanderson.org	37	1	6266729	6266729	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:6266729G>T	ENST00000377939.4	+	2	261	c.134G>T	c.(133-135)tGt>tTt	p.C45F	RNF207_ENST00000377948.2_5'UTR|RP1-120G22.11_ENST00000455744.1_RNA	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	45						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CACGACTTCTGTGCCGGCTGC	0.677																																					p.C45F													.	.			0			c.G134T												47.0	47.0	47.0					1																	6266729		2200	4300	6500	SO:0001583	missense	388591	exon2			ACTTCTGTGCCGG	AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.134G>T	1.37:g.6266729G>T	ENSP00000367173:p.Cys45Phe		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_207396	3	0.00	0	A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Missense_Mutation	SNP	ENST00000377939.4	37	CCDS59.2	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923391	0.52653	.	.	ENSG00000158286	ENST00000377939	D	0.98362	-4.89	3.8	3.8	0.43715	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.56097	U	0.000025	D	0.99420	0.9795	H	0.99074	4.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.97900	1.0302	10	0.87932	D	0	-19.602	14.8188	0.70055	0.0:0.0:1.0:0.0	.	45;45	Q6ZRF8;Q6ZRF8-2	RN207_HUMAN;.	F	45	ENSP00000367173:C45F	ENSP00000367173:C45F	C	+	2	0	RNF207	6189316	1.000000	0.71417	0.986000	0.45419	0.213000	0.24496	6.449000	0.73473	1.957000	0.56846	0.313000	0.20887	TGT			0.677	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000003669.2		NM_207396	
CROCC	9696	broad.mit.edu	37	1	17185383	17185384	+	lincRNA	INS	-	-	C	rs112074527		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:17185383_17185384insC	ENST00000414128.1	+	0	646				MIR3675_ENST00000583661.1_RNA																							ACTAAATTTTTAGTGCAATAAT	0.465																																					.													.	.			0			.																																											0	.			AATTTTTAGTGCA																													1.37:g.17185383_17185384insC			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	INS	ENST00000414128.1	37																																																																																						0.465	RP11-108M9.2-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	lincRNA		OTTHUMT00000006253.1			
ATP13A2	23400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17318882	17318882	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:17318882G>A	ENST00000326735.8	-	18	1894	c.1861C>T	c.(1861-1863)Cca>Tca	p.P621S	ATP13A2_ENST00000341676.5_Missense_Mutation_p.P616S|ATP13A2_ENST00000452699.1_Missense_Mutation_p.P616S|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	621					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		ACGCTGACTGGCACCGGGGGC	0.687																																					p.P621S													.	.			0			c.C1861T												28.0	31.0	30.0					1																	17318882		2203	4298	6501	SO:0001583	missense	23400	exon18			TGACTGGCACCGG	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1861C>T	1.37:g.17318882G>A	ENSP00000327214:p.Pro621Ser		Somatic	78	0	0		WXS	Illumina HiSeq	.	80	0.10	8	NM_022089	183	0.23	42	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	3.849	-0.032299	0.07543	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699	T;T;T	0.69306	-0.39;-0.39;-0.39	5.46	3.53	0.40419	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.150618	0.44285	D	0.000465	T	0.62624	0.2443	L	0.28274	0.84	0.40801	D	0.983349	P;D;B	0.58268	0.621;0.982;0.072	P;P;B	0.58620	0.688;0.842;0.105	T	0.56481	-0.7972	10	0.17369	T	0.5	-9.0708	9.5303	0.39189	0.0789:0.144:0.7771:0.0	.	616;616;621	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	S	621;616;616	ENSP00000327214:P621S;ENSP00000341115:P616S;ENSP00000413307:P616S	ENSP00000327214:P621S	P	-	1	0	ATP13A2	17191469	0.976000	0.34144	0.032000	0.17829	0.037000	0.13140	1.800000	0.38833	0.639000	0.30564	0.313000	0.20887	CCA			0.687	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000006617.1		NM_022089	
EIF4G3	8672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	21299496	21299496	+	Splice_Site	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:21299496G>A	ENST00000264211.8	-	5	616	c.422C>T	c.(421-423)aCt>aTt	p.T141I	EIF4G3_ENST00000400422.1_Splice_Site_p.T141I|EIF4G3_ENST00000374935.3_Splice_Site_p.T141I|EIF4G3_ENST00000356916.3_Splice_Site_p.T152I|EIF4G3_ENST00000374937.3_Splice_Site_p.T148I|EIF4G3_ENST00000602326.1_Splice_Site_p.T148I|EIF4G3_ENST00000536266.1_5'UTR|EIF4G3_ENST00000374927.4_Splice_Site_p.T141I	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	141	PABPC1-binding.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		ATCTCTTACAGTTTTTTTCTC	0.363																																					p.T152I													.	.			0			c.C455T												30.0	33.0	32.0					1																	21299496		2199	4299	6498	SO:0001630	splice_region_variant	8672	exon11			CTTACAGTTTTTT	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.423+1C>T	1.37:g.21299496G>A			Somatic	64	0	0		WXS	Illumina HiSeq	.	69	0.19	13	NM_001198803	61	0.30	18	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508464	0.85282	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000374937;ENST00000356916;ENST00000374927;ENST00000537059;ENST00000438975;ENST00000411888	T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9	6.05	6.05	0.98169	.	0.328143	0.36134	N	0.002769	T	0.44685	0.1305	L	0.37850	1.14	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;0.966;1.0;0.999;0.981	D;D;P;D;D;P	0.83275	0.974;0.99;0.543;0.996;0.99;0.77	T	0.06899	-1.0801	10	0.42905	T	0.14	-8.835	20.1963	0.98243	0.0:0.0:1.0:0.0	.	141;337;141;267;148;141	B4DXR2;Q59GJ0;Q504Z1;B1AN89;B9EGQ7;O43432	.;.;.;.;.;IF4G3_HUMAN	I	141;338;141;141;148;267;141;152;141;179	ENSP00000264211:T141I;ENSP00000383274:T141I;ENSP00000364071:T141I;ENSP00000364073:T148I;ENSP00000364062:T141I;ENSP00000395381:T141I;ENSP00000396083:T179I	ENSP00000264211:T141I	T	-	2	0	EIF4G3	21172083	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.753000	0.91637	2.878000	0.98634	0.650000	0.86243	ACT			0.363	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000007467.3		NM_003760	Missense_Mutation
EPHB2	2048	mdanderson.org	37	1	23111394	23111394	+	Silent	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:23111394G>T	ENST00000400191.3	+	3	654	c.636G>T	c.(634-636)tcG>tcT	p.S212S	EPHB2_ENST00000374632.3_Silent_p.S212S|EPHB2_ENST00000374630.3_Silent_p.S212S|EPHB2_ENST00000374627.1_Silent_p.S206S|EPHB2_ENST00000544305.1_Silent_p.S212S	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	212	Cys-rich.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.S212S(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AAACCCTGTCGGGGGCTGAGA	0.622																																					p.S212S													EPHB2,NS,NS,0,1	EPHB2	0	1	1	Substitution - coding silent(1)	pancreas(1)	c.G636T												43.0	43.0	43.0					1																	23111394		2203	4300	6503	SO:0001819	synonymous_variant	2048	exon3			CCTGTCGGGGGCT	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.636G>T	1.37:g.23111394G>T			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_004442	13	0.00	0	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	ENST00000400191.3	37																																																																																						0.622	EPHB2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000008060.2		NM_017449	
RAB42	115273	hgsc.bcm.edu;bcgsc.ca	37	1	28920547	28920547	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:28920547delG	ENST00000373826.3	+	2	542	c.236delG	c.(235-237)tggfs	p.W79fs	TAF12_ENST00000471683.1_Intron|RAB42_ENST00000465518.1_3'UTR	NM_152304.1	NP_689517.1	Q8N4Z0	RAB42_HUMAN	RAB42, member RAS oncogene family	79					small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00618)|all_lung(284;0.00909)|Breast(348;0.0249)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0577)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00298)|KIRC - Kidney renal clear cell carcinoma(1967;0.00948)|BRCA - Breast invasive adenocarcinoma(304;0.0213)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGAGGGCTGGGGGGGTGTC	0.582																																					p.W192fs													.,1	.	10	1	0			c.574delT												28.0	31.0	30.0					1																	28920547		2203	4300	6503	SO:0001589	frameshift_variant	115273	exon2			AGGGCTGGGGGGG	BC033175	CCDS325.1	1p35.3	2014-02-12	2006-04-28		ENSG00000188060	ENSG00000188060		"""RAB, member RAS oncogene"""	28702	protein-coding gene	gene with protein product			"""RAB42, member RAS homolog family"""				Standard	NM_152304		Approved	MGC45806	uc001bqv.3	Q8N4Z0	OTTHUMG00000003656	ENST00000373826.3:c.236delG	1.37:g.28920547delG	ENSP00000362932:p.Trp79fs		Somatic	76	0	0		WXS	Illumina HiSeq	.	69	0.19	13	NM_001193532	44	0.00	0	B2R5G2	Frame_Shift_Del	DEL	ENST00000373826.3	37	CCDS325.1																																																																																					0.582	RAB42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010371.1		NM_152304	
GUCA2B	2981	mdanderson.org	37	1	42619175	42619175	+	Silent	SNP	G	G	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:42619175G>C	ENST00000372581.1	+	1	84	c.54G>C	c.(52-54)ctG>ctC	p.L18L		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	18					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGGTCCTCCTGCTGCTGCTGC	0.652																																					p.L18L													.	.			0			c.G54C												70.0	56.0	61.0					1																	42619175		2203	4300	6503	SO:0001819	synonymous_variant	2981	exon1			CCTCCTGCTGCTG	BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.54G>C	1.37:g.42619175G>C			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_007102	0		0	Q52LV0	Silent	SNP	ENST00000372581.1	37	CCDS464.1																																																																																					0.652	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000018307.1		NM_007102	
USP1	7398	broad.mit.edu;mdanderson.org	37	1	62916589	62916589	+	Missense_Mutation	SNP	T	T	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:62916589T>G	ENST00000339950.4	+	9	3110	c.2295T>G	c.(2293-2295)aaT>aaG	p.N765K	USP1_ENST00000371146.1_Missense_Mutation_p.N765K	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	765	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		ACTTTCTGAATTCTCTTTCCC	0.343																																					p.N765K	Ovarian(122;1846 2315 3982 19504)												.	USP1	51		0			c.T2295G												107.0	114.0	112.0					1																	62916589		2203	4300	6503	SO:0001583	missense	7398	exon9			TCTGAATTCTCTT		CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.2295T>G	1.37:g.62916589T>G	ENSP00000343526:p.Asn765Lys		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	53	0.11	6	NM_001017415	186	0.32	60	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	ENST00000339950.4	37	CCDS621.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.871200	0.33069	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.28895	1.59;1.59	5.65	5.65	0.86999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (1);	0.205158	0.51477	D	0.000091	T	0.17492	0.0420	N	0.24115	0.695	0.35691	D	0.814834	P	0.49185	0.92	B	0.39152	0.292	T	0.14090	-1.0485	10	0.10636	T	0.68	-23.0937	11.1045	0.48194	0.0:0.071:0.0:0.929	.	765	O94782	UBP1_HUMAN	K	765	ENSP00000360188:N765K;ENSP00000343526:N765K	ENSP00000343526:N765K	N	+	3	2	USP1	62689177	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.821000	0.39041	2.371000	0.80710	0.533000	0.62120	AAT			0.343	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000024881.1		NM_001017415	
NRAS	4893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	C	rs11554290	byFrequency	TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:115256529T>C	ENST00000369535.4	-	3	435	c.182A>G	c.(181-183)cAa>cGa	p.Q61R		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61R				Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,-1,2068	NRAS	-1	2068	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	c.A182G												180.0	156.0	164.0					1																	115256529		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TCTTCTTGTCCAG	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>G	1.37:g.115256529T>C	ENSP00000358548:p.Gln61Arg		Somatic	97	0	0		WXS	Illumina HiSeq	.	101	0.18	18	NM_002524	156	0.32	50	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004139	0.74932	.	.	ENSG00000213281	ENST00000369535	D	0.83673	-1.75	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.86489	0.5945	M	0.92604	3.325	0.80722	D	1	B	0.28512	0.214	B	0.39590	0.304	D	0.88255	0.2919	10	0.66056	D	0.02	.	15.0132	0.71565	0.0:0.0:0.0:1.0	rs11554290;rs11554290	61	P01111	RASN_HUMAN	R	61	ENSP00000358548:Q61R	ENSP00000358548:Q61R	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA			0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033395.2		NM_002524	
NBPF12	149013	broad.mit.edu	37	1	146397444	146397444	+	Silent	SNP	A	A	G	rs372924549		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:146397444A>G	ENST00000442909.2	+	6	1097	c.261A>G	c.(259-261)aaA>aaG	p.K87K	NBPF12_ENST00000309471.8_Intron|NBPF12_ENST00000446760.2_Silent_p.K87K			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				ovary(2)	2						AGCAGCTGAAACAAGCTGAGG	0.512																																					.													.	.			0			.																																									SO:0001819	synonymous_variant	149013	.			GCTGAAACAAGCT	BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.261A>G	1.37:g.146397444A>G			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	8	0.25	2	.	20	0.00	0	O95877	Silent	SNP	ENST00000442909.2	37																																																																																						0.512	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000102086.3		XM_003119146	
IVL	3713	broad.mit.edu	37	1	152883337	152883337	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:152883337A>G	ENST00000368764.3	+	2	1128	c.1064A>G	c.(1063-1065)cAc>cGc	p.H355R	IVL_ENST00000392667.2_Missense_Mutation_p.H209R			P07476	INVO_HUMAN	involucrin	355	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			cagctggagcacctggagcac	0.652																																					p.H355R													.	IVL	100		0			c.A1064G												15.0	15.0	15.0					1																	152883337		2104	4126	6230	SO:0001583	missense	3713	exon2			TGGAGCACCTGGA	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1064A>G	1.37:g.152883337A>G	ENSP00000357753:p.His355Arg		Somatic	97	0.0103092784	1		WXS	Illumina HiSeq	Phase_I	79	0.05	4	NM_005547	0		0	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	A	4.310	0.056741	0.08339	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.13778	2.89;2.56	2.26	2.26	0.28386	.	.	.	.	.	T	0.02571	0.0078	L	0.36672	1.1	0.09310	N	1	P	0.37015	0.578	B	0.30572	0.117	T	0.38001	-0.9681	9	0.15066	T	0.55	.	6.5447	0.22400	1.0:0.0:0.0:0.0	.	355	P07476	INVO_HUMAN	R	355;209	ENSP00000357753:H355R;ENSP00000376435:H209R	ENSP00000357753:H355R	H	+	2	0	IVL	151149961	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.860000	0.04272	1.316000	0.45131	0.456000	0.33151	CAC			0.652	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034664.1		NM_005547	
FMN2	56776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	240371435	240371435	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr1:240371435C>T	ENST00000319653.9	+	5	3553	c.3323C>T	c.(3322-3324)cCt>cTt	p.P1108L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1108	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GTGGGCATACCTCCTCCGCCC	0.731																																					p.P1108L													FMN2,NS,carcinoma,-1,2	FMN2	-1	2	0			c.C3323T												8.0	11.0	10.0					1																	240371435		2057	4148	6205	SO:0001583	missense	56776	exon5			GCATACCTCCTCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3323C>T	1.37:g.240371435C>T	ENSP00000318884:p.Pro1108Leu		Somatic	77	0	0		WXS	Illumina HiSeq	.	71	0.25	18	NM_020066	8	0.63	5	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	c	10.20	1.284780	0.23392	.	.	ENSG00000155816	ENST00000319653	T	0.65549	-0.16	3.58	2.63	0.31362	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (2);	0.000000	0.53938	D	0.000045	T	0.79569	0.4468	M	0.90542	3.125	0.80722	D	1	D	0.63046	0.992	D	0.65323	0.934	T	0.82489	-0.0432	9	.	.	.	.	11.942	0.52907	0.1753:0.8246:0.0:0.0	.	1108	Q9NZ56	FMN2_HUMAN	L	1108	ENSP00000318884:P1108L	.	P	+	2	0	FMN2	238438058	0.052000	0.20516	0.003000	0.11579	0.013000	0.08279	1.620000	0.36976	0.802000	0.34089	0.484000	0.47621	CCT			0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
WAC	51322	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	28822948	28822948	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr10:28822948C>G	ENST00000354911.4	+	2	224	c.63C>G	c.(61-63)gaC>gaG	p.D21E	WAC_ENST00000428935.1_5'UTR|WAC_ENST00000375646.1_5'UTR|WAC_ENST00000347934.4_Missense_Mutation_p.D21E|WAC-AS1_ENST00000527986.1_RNA|WAC_ENST00000375664.4_5'UTR|WAC-AS1_ENST00000528337.1_RNA|WAC_ENST00000532233.1_3'UTR	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	21					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						GGAGGGGGGACTCGCAGCCTT	0.667																																					p.D21E													.	WAC	77		0			c.C63G												24.0	30.0	28.0					10																	28822948		2202	4297	6499	SO:0001583	missense	51322	exon2			GGGGGACTCGCAG	AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.63C>G	10.37:g.28822948C>G	ENSP00000346986:p.Asp21Glu		Somatic	152	0.0131578947	2		WXS	Illumina HiSeq	Phase_I	134	0.19	26	NM_100486	224	0.24	54	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	ENST00000354911.4	37	CCDS7159.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723946	0.68959	.	.	ENSG00000095787	ENST00000347934;ENST00000354911	T;T	0.26957	1.73;1.7	4.87	4.87	0.63330	.	0.267742	0.41194	N	0.000932	T	0.37544	0.1007	L	0.27053	0.805	0.80722	D	1	D;B	0.61697	0.99;0.02	D;B	0.70935	0.971;0.029	T	0.09707	-1.0662	10	0.42905	T	0.14	-2.0981	16.3759	0.83392	0.0:1.0:0.0:0.0	.	21;21	Q9BTA9-5;Q9BTA9	.;WAC_HUMAN	E	21	ENSP00000311106:D21E;ENSP00000346986:D21E	ENSP00000311106:D21E	D	+	3	2	WAC	28862954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.098000	0.57748	2.528000	0.85240	0.655000	0.94253	GAC			0.667	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000047371.1		NM_100264	
FZD8	8325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	35930262	35930262	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr10:35930262C>G	ENST00000374694.1	-	1	100	c.96G>C	c.(94-96)gaG>gaC	p.E32D	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	32	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						GGCATGCCAGCTCCTTGGCCG	0.627																																					p.E32D													.	.			0			c.G96C												93.0	74.0	81.0					10																	35930262		2203	4300	6503	SO:0001583	missense	8325	exon1			TGCCAGCTCCTTG	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.96G>C	10.37:g.35930262C>G	ENSP00000363826:p.Glu32Asp		Somatic	51	0	0		WXS	Illumina HiSeq	.	41	0.27	11	NM_031866	42	0.64	27		Missense_Mutation	SNP	ENST00000374694.1	37	CCDS7192.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.564453	0.27915	.	.	ENSG00000177283	ENST00000374694	T	0.81078	-1.45	3.92	2.02	0.26589	Frizzled domain (3);	0.000000	0.64402	U	0.000003	T	0.56630	0.1998	N	0.05306	-0.075	0.41380	D	0.987541	P	0.36027	0.533	B	0.34536	0.185	T	0.47222	-0.9134	10	0.15499	T	0.54	.	9.7044	0.40207	0.0:0.8231:0.0:0.1769	.	32	Q9H461	FZD8_HUMAN	D	32	ENSP00000363826:E32D	ENSP00000363826:E32D	E	-	3	2	FZD8	35970268	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	2.244000	0.43124	0.267000	0.21916	0.462000	0.41574	GAG			0.627	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047575.2		NM_031866	
HSD17B7P2	158160	broad.mit.edu	37	10	38652034	38652035	+	RNA	INS	-	-	TT	rs576865685|rs371516054		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr10:38652034_38652035insTT	ENST00000494540.1	+	0	413					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		CTGTTTAACTCTTTTTTTGACA	0.347																																					.													.	.			0			.																																											0	.			TTAACTCTTTTTT			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38652039_38652040dupTT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	5	0.40	2	.	0		0		RNA	INS	ENST00000494540.1	37																																																																																						0.347	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000047631.2		NR_003086	
FAM149B1	317662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	74994957	74994957	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr10:74994957C>T	ENST00000242505.6	+	12	1657	c.1483C>T	c.(1483-1485)Cat>Tat	p.H495Y		NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	495										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						GCAGAAACCCCATGGCGACTC	0.468																																					p.H495Y													.	.			0			c.C1483T												52.0	43.0	46.0					10																	74994957		692	1591	2283	SO:0001583	missense	317662	exon12			AAACCCCATGGCG	AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.1483C>T	10.37:g.74994957C>T	ENSP00000242505:p.His495Tyr		Somatic	80	0	0		WXS	Illumina HiSeq	.	74	0.15	11	NM_173348	67	0.27	18	Q9Y2I0	Missense_Mutation	SNP	ENST00000242505.6	37	CCDS44435.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454123	0.84209	.	.	ENSG00000138286	ENST00000242505	T	0.48201	0.82	6.01	6.01	0.97437	.	0.442204	0.26133	N	0.026142	T	0.53948	0.1828	L	0.50333	1.59	0.80722	D	1	D;P;D	0.56746	0.977;0.936;0.962	P;B;P	0.50352	0.574;0.435;0.638	T	0.55704	-0.8099	10	0.87932	D	0	-5.8688	16.0212	0.80493	0.0:1.0:0.0:0.0	.	473;495;487	B4E0M2;Q96BN6;Q96BN6-2	.;F149B_HUMAN;.	Y	495	ENSP00000242505:H495Y	ENSP00000242505:H495Y	H	+	1	0	FAM149B1	74664963	0.073000	0.21202	0.642000	0.29436	0.231000	0.25187	3.596000	0.54024	2.861000	0.98227	0.650000	0.86243	CAT			0.468	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000145438.1		NM_173348	
DGKZ	8525	mdanderson.org	37	11	46387955	46387955	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr11:46387955G>T	ENST00000454345.1	+	2	274	c.149G>T	c.(148-150)cGc>cTc	p.R50L	DGKZ_ENST00000343674.6_Intron|DGKZ_ENST00000395574.3_Intron|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000525434.1_3'UTR|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000532868.2_Intron|DGKZ_ENST00000318201.8_Intron|DGKZ_ENST00000421244.2_Intron|DGKZ_ENST00000456247.2_Intron|DGKZ_ENST00000527911.1_Intron	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	50					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GCACAGCGGCGCCGCTCCAGC	0.751																																					p.R50L													.	.			0			c.G149T												6.0	8.0	7.0					11																	46387955		1851	3895	5746	SO:0001583	missense	8525	exon2			AGCGGCGCCGCTC	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.149G>T	11.37:g.46387955G>T	ENSP00000412178:p.Arg50Leu		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001105540	14	0.00	0	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	.	.	.	.	.	.	.	.	.	.	G	35	5.415893	0.96092	.	.	ENSG00000149091	ENST00000454345	T	0.79749	-1.3	4.44	4.44	0.53790	.	1.379370	0.05662	N	0.587194	D	0.87257	0.6132	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.80034	-0.1551	10	0.87932	D	0	.	17.4629	0.87624	0.0:0.0:1.0:0.0	.	50	Q13574	DGKZ_HUMAN	L	50	ENSP00000412178:R50L	ENSP00000412178:R50L	R	+	2	0	DGKZ	46344531	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.026000	0.76455	2.186000	0.69663	0.563000	0.77884	CGC			0.751	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000389772.1		NM_001105540	
AMBRA1	55626	mdanderson.org	37	11	46419165	46419165	+	Silent	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr11:46419165G>T	ENST00000458649.2	-	18	4150	c.3732C>A	c.(3730-3732)acC>acA	p.T1244T	AMBRA1_ENST00000426438.1_Silent_p.T1215T|AMBRA1_ENST00000314845.3_Silent_p.T1154T|AMBRA1_ENST00000534300.1_Silent_p.T1184T|AMBRA1_ENST00000533727.1_Silent_p.T1125T|AMBRA1_ENST00000528950.1_Silent_p.T1215T|AMBRA1_ENST00000298834.3_Silent_p.T1184T			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1244					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GGGTTGGCTGGGTTGGCTCCC	0.657																																					p.T1247T													.	.			0			c.C3741A												59.0	62.0	61.0					11																	46419165		2202	4299	6501	SO:0001819	synonymous_variant	55626	exon20			TGGCTGGGTTGGC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3732C>A	11.37:g.46419165G>T			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001267782	93	0.00	0	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	ENST00000458649.2	37																																																																																						0.657	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000390103.1		NM_017749	
SMTNL1	219537	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57309031	57309031	+	5'Flank	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr11:57309031G>A	ENST00000399154.2	+	0	0				SMTNL1_ENST00000527972.1_5'Flank|SMTNL1_ENST00000457912.1_Splice_Site			A8MU46	SMTL1_HUMAN	smoothelin-like 1						negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GCCAGGGAGAGTACGGCTCCA	0.522																																					.													.	.			0			.												108.0	113.0	111.0					11																	57309031		1980	4157	6137	SO:0001631	upstream_gene_variant	219537	.			GGGAGAGTACGGC	BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46			11.37:g.57309031G>A	Exception_encountered		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	73	0.16	12	.	0		0		Splice_Site	SNP	ENST00000399154.2	37		.	.	.	.	.	.	.	.	.	.	G	5.704	0.314378	0.10789	.	.	ENSG00000214872	ENST00000457912	.	.	.	3.65	1.1	0.20463	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.7432	0.13024	0.4695:0.0:0.5305:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMTNL1	57065607	0.000000	0.05858	0.015000	0.15790	0.060000	0.15804	-0.151000	0.10175	0.260000	0.21731	0.650000	0.86243	.			0.522	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				XM_166203	
VWCE	220001	mdanderson.org	37	11	61048319	61048319	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr11:61048319C>T	ENST00000335613.5	-	8	1562	c.1176G>A	c.(1174-1176)atG>atA	p.M392I		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	392	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TTGATTCATGCATGGCTCCCA	0.662																																					p.M392I													.	.			0			c.G1176A												13.0	15.0	14.0					11																	61048319		2203	4296	6499	SO:0001583	missense	220001	exon8			TTCATGCATGGCT	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1176G>A	11.37:g.61048319C>T	ENSP00000334186:p.Met392Ile		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_152718	13	0.00	0	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	C	4.603	0.111991	0.08831	.	.	ENSG00000167992	ENST00000335613	T	0.70164	-0.46	5.65	1.14	0.20703	von Willebrand factor, type C (3);	1.337170	0.04805	N	0.434238	T	0.43942	0.1270	N	0.12637	0.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25676	-1.0125	10	0.35671	T	0.21	.	0.3031	0.00276	0.2432:0.3119:0.1686:0.2764	.	392	Q96DN2	VWCE_HUMAN	I	392	ENSP00000334186:M392I	ENSP00000334186:M392I	M	-	3	0	VWCE	60804895	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	-0.301000	0.08232	0.235000	0.21160	-0.345000	0.07892	ATG			0.662	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398811.1		NM_152718	
RBM4	5936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66411186	66411186	+	Silent	SNP	T	T	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr11:66411186T>A	ENST00000409406.1	+	2	1455	c.678T>A	c.(676-678)cgT>cgA	p.R226R	RBM4_ENST00000506523.2_Intron|RBM14-RBM4_ENST00000412278.2_Silent_p.R201R|RBM4_ENST00000396053.4_Intron|RBM4_ENST00000408993.2_Silent_p.R226R|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000530235.1_Intron|RBM4_ENST00000514361.3_Silent_p.R201R|RBM4_ENST00000578778.1_Intron|RBM4_ENST00000310092.7_Silent_p.R226R|RBM4_ENST00000398692.4_Intron|RBM4_ENST00000503028.2_Silent_p.R226R			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	226	Interaction with TNPO3.				cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		AGCGCTGCCGTGCTGCCCGGT	0.557																																					p.R226R													.	.			0			c.T678A												57.0	62.0	60.0					11																	66411186		2090	4217	6307	SO:0001819	synonymous_variant	5936	exon3			CTGCCGTGCTGCC	U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000409406.1:c.678T>A	11.37:g.66411186T>A			Somatic	51	0	0		WXS	Illumina HiSeq	.	51	0.22	11	NM_002896	261	0.36	93	B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	Silent	SNP	ENST00000409406.1	37	CCDS41676.1																																																																																					0.557	RBM4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334212.1		NM_002896	
KDM2A	22992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67022423	67022423	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr11:67022423G>A	ENST00000529006.2	+	21	3832	c.3386G>A	c.(3385-3387)tGc>tAc	p.C1129Y	KDM2A_ENST00000308783.5_Missense_Mutation_p.C587Y|KDM2A_ENST00000530342.1_Missense_Mutation_p.C690Y|KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	1129					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CTTCGAGGATGCAAGCAGATC	0.498																																					p.C1129Y													.	.			0			c.G3386A												94.0	90.0	92.0					11																	67022423		2034	4201	6235	SO:0001583	missense	22992	exon21			GAGGATGCAAGCA	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.3386G>A	11.37:g.67022423G>A	ENSP00000432786:p.Cys1129Tyr		Somatic	99	0	0		WXS	Illumina HiSeq	.	64	0.14	9	NM_012308	253	0.26	65	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665266	0.88251	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000308783	T;T;T	0.22539	1.95;1.95;1.95	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.58793	0.2147	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.85130	0.997;0.986	T	0.68819	-0.5308	10	0.87932	D	0	-15.1361	19.1899	0.93660	0.0:0.0:1.0:0.0	.	690;1129	E9PIL6;Q9Y2K7	.;KDM2A_HUMAN	Y	1129;690;587	ENSP00000432786:C1129Y;ENSP00000435776:C690Y;ENSP00000309302:C587Y	ENSP00000309302:C587Y	C	+	2	0	KDM2A	66778999	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.591000	0.98241	2.760000	0.94817	0.655000	0.94253	TGC			0.498	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393140.2		NM_012308	
APLP2	334	mdanderson.org	37	11	130013286	130013286	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr11:130013286G>T	ENST00000263574.5	+	18	2307	c.2235G>T	c.(2233-2235)atG>atT	p.M745I	APLP2_ENST00000543137.1_Missense_Mutation_p.M640I|APLP2_ENST00000528499.1_Missense_Mutation_p.M677I|APLP2_ENST00000539648.1_Missense_Mutation_p.M533I|APLP2_ENST00000338167.5_Missense_Mutation_p.M733I|APLP2_ENST00000278756.7_Missense_Mutation_p.M743I|APLP2_ENST00000345598.5_Missense_Mutation_p.M504I	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	745					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TGAACAAGATGCAGAACCATG	0.562																																					p.M745I													.	.			0			c.G2235T												157.0	134.0	142.0					11																	130013286		2201	4297	6498	SO:0001583	missense	334	exon18			CAAGATGCAGAAC	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.2235G>T	11.37:g.130013286G>T	ENSP00000263574:p.Met745Ile		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001642	940	0.00	0	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000263574.5	37	CCDS8486.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974917	0.92919	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	D;D;D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17;-4.17;-4.17	5.8	5.8	0.92144	Beta-amyloid precursor protein C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97955	0.9327	M	0.74467	2.265	0.80722	D	1	D;D;D;D;D;D;D	0.65815	0.962;0.991;0.987;0.989;0.995;0.992;0.982	D;D;D;D;D;D;D	0.77004	0.946;0.989;0.961;0.986;0.989;0.919;0.961	D	0.97762	1.0221	9	.	.	.	-32.2726	19.0512	0.93046	0.0:0.0:1.0:0.0	.	533;745;689;504;671;677;733	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	I	677;533;745;504;733;743;640	ENSP00000435914:M677I;ENSP00000443728:M533I;ENSP00000263574:M745I;ENSP00000263575:M504I;ENSP00000345444:M733I;ENSP00000278756:M743I;ENSP00000444122:M640I	.	M	+	3	0	APLP2	129518496	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.340000	0.97038	2.735000	0.93741	0.655000	0.94253	ATG			0.562	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000386109.1		NM_001642	
PRB3	5544	broad.mit.edu	37	12	11420721	11420721	+	Silent	SNP	A	A	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr12:11420721A>G	ENST00000279573.7	-	3	597	c.462T>C	c.(460-462)ggT>ggC	p.G154G	PRB3_ENST00000538488.1_Silent_p.G133G|PRB3_ENST00000440870.3_Intron|PRB3_ENST00000381842.3_Silent_p.G154G			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	154	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			GAGGCGGGGGACCTTGGGACT	0.647																																					p.G154G													.	PRB3	84		0			c.T462C												11.0	10.0	10.0					12																	11420721		971	2410	3381	SO:0001819	synonymous_variant	5544	exon3			CGGGGGACCTTGG			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.462T>C	12.37:g.11420721A>G			Somatic	136	0.1029411765	14		WXS	Illumina HiSeq	Phase_I	199	0.12	24	NM_006249	0		0	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	RNA	SNP	ENST00000279573.7	37																																																																																						0.647	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000402119.5		NM_006249	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	26636703	26636703	+	Silent	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr12:26636703C>T	ENST00000381340.3	-	42	6356	c.5940G>A	c.(5938-5940)aaG>aaA	p.K1980K		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1980					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GCGCTACATTCTTCTCATTGA	0.478																																					p.K1980K													ITPR2,NS,carcinoma,-1,1	ITPR2	-1	1	0			c.G5940A												162.0	157.0	158.0					12																	26636703		1891	4118	6009	SO:0001819	synonymous_variant	3709	exon42			TACATTCTTCTCA	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5940G>A	12.37:g.26636703C>T			Somatic	185	0.0054054054	1		WXS	Illumina HiSeq	.	253	0.11	27	NM_002223	38	0.00	0	O94773	Silent	SNP	ENST00000381340.3	37	CCDS41764.1																																																																																					0.478	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402732.1		NM_002223	
PLEKHA8P1	51054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	45567287	45567287	+	RNA	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr12:45567287C>T	ENST00000256692.5	-	0	1398					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CACAAGAGGGCTTCAGTCGCT	0.448																																					.													PLEKHA8P1,NS,carcinoma,+2,1	PLEKHA8P1	2	1	0			.												80.0	80.0	80.0					12																	45567287		2203	4300	6503			51054	.			AGAGGGCTTCAGT	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567287C>T			Somatic	105	0	0		WXS	Illumina HiSeq	.	117	0.08	9	.	46	0.13	6		RNA	SNP	ENST00000256692.5	37																																																																																						0.448	PLEKHA8P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000404814.1		NR_037144	
HOXC13	3229	mdanderson.org	37	12	54333053	54333053	+	Silent	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr12:54333053C>T	ENST00000243056.3	+	1	519	c.363C>T	c.(361-363)taC>taT	p.Y121Y	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	121					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CCCTGGGCTACGGCTACCCCT	0.711			T	NUP98	AML																																p.Y121Y				Dom	yes		12	12q13.3	3229	homeo box C13		L	.	.			0			c.C363T												3.0	5.0	4.0					12																	54333053		1776	3704	5480	SO:0001819	synonymous_variant	3229	exon1			GGGCTACGGCTAC		CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.363C>T	12.37:g.54333053C>T			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	42	0.10	4	NM_017410	0		0	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Silent	SNP	ENST00000243056.3	37	CCDS8865.1																																																																																					0.711	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358865.2			
POLE	5426	mdanderson.org	37	12	133209345	133209345	+	Missense_Mutation	SNP	C	C	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr12:133209345C>A	ENST00000320574.5	-	44	6084	c.6041G>T	c.(6040-6042)gGg>gTg	p.G2014V	POLE_ENST00000535270.1_Missense_Mutation_p.G1987V|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	2014					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GCGCCTCAGCCCGTCCTTCAT	0.672								DNA polymerases (catalytic subunits)																													p.G2014V													POLE_ENST00000320574,right_lower_lobe,carcinoma,+1,2	POLE_ENST00000320574	1	2	0			c.G6041T												40.0	40.0	40.0					12																	133209345		2203	4298	6501	SO:0001583	missense	5426	exon44			CTCAGCCCGTCCT		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.6041G>T	12.37:g.133209345C>A	ENSP00000322570:p.Gly2014Val		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	23	0.17	4	NM_006231	177	0.00	0	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.366480	0.24771	.	.	ENSG00000177084	ENST00000434528;ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.44482	0.92;0.92;0.92	5.58	4.36	0.52297	.	0.172250	0.53938	D	0.000053	T	0.23094	0.0558	N	0.08118	0	0.50171	D	0.999857	B;B	0.17852	0.019;0.024	B;B	0.20184	0.01;0.028	T	0.03887	-1.0995	10	0.34782	T	0.22	.	9.9765	0.41786	0.0:0.0904:0.0:0.9096	.	2014;224	Q07864;B3KS74	DPOE1_HUMAN;.	V	224;2014;2025;1987	ENSP00000322570:G2014V;ENSP00000406383:G2025V;ENSP00000445753:G1987V	ENSP00000322570:G2014V	G	-	2	0	POLE	131719418	1.000000	0.71417	0.446000	0.26920	0.162000	0.22319	4.927000	0.63440	0.846000	0.35142	0.478000	0.44815	GGG			0.672	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397689.2		NM_006231	
TPTE2P1	646405	broad.mit.edu	37	13	25525327	25525328	+	RNA	INS	-	-	A	rs199760566|rs139677331		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr13:25525327_25525328insA	ENST00000429698.1	-	0	374							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		CTTCAAAAAAGAAAAAAAAAAC	0.252																																					.													.	.			0			.																																											0	.			AAAAAAGAAAAAA			13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25525337_25525337dupA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0	B3KST4|B4DMH9	RNA	INS	ENST00000429698.1	37																																																																																						0.252	TPTE2P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000044206.1			
FAM155A	728215	mdanderson.org	37	13	108518661	108518661	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr13:108518661T>C	ENST00000375915.2	-	1	422	c.284A>G	c.(283-285)cAg>cGg	p.Q95R		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	95	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ctgccgccgctgctgctgctg	0.731																																					p.Q95R													FAM155A,NS,carcinoma,0,2	FAM155A	0	2	0			c.A284G												8.0	11.0	10.0					13																	108518661		1836	3781	5617	SO:0001583	missense	728215	exon1			CGCCGCTGCTGCT	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.284A>G	13.37:g.108518661T>C	ENSP00000365080:p.Gln95Arg		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001080396	1	0.00	0	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	T	0.110	-1.140286	0.01728	.	.	ENSG00000204442	ENST00000375915	T	0.57436	0.4	5.23	3.12	0.35913	Armadillo-like helical (1);	0.660669	0.12437	N	0.469027	T	0.30417	0.0764	N	0.25332	0.735	0.19300	N	0.999978	B	0.02656	0.0	B	0.01281	0.0	T	0.27806	-1.0063	10	0.07030	T	0.85	.	3.3913	0.07290	0.0:0.517:0.2156:0.2674	.	95	B1AL88	F155A_HUMAN	R	95	ENSP00000365080:Q95R	ENSP00000365080:Q95R	Q	-	2	0	FAM155A	107316662	0.206000	0.23470	1.000000	0.80357	0.982000	0.71751	0.127000	0.15790	1.195000	0.43115	-0.181000	0.13052	CAG			0.731	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045736.2		NM_001080396	
CMTM5	116173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23847656	23847656	+	Silent	SNP	C	C	T	rs371218018		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr14:23847656C>T	ENST00000339180.4	+	2	441	c.225C>T	c.(223-225)ttC>ttT	p.F75F	CMTM5_ENST00000359320.3_Silent_p.F75F|CMTM5_ENST00000555731.1_Intron|CMTM5_ENST00000342473.4_Intron|CMTM5_ENST00000382809.2_Silent_p.F75F|CMTM5_ENST00000397227.3_Intron			Q96DZ9	CKLF5_HUMAN	CKLF-like MARVEL transmembrane domain containing 5	75	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	8	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		CCTTCCTCTTCCTCTATGCCA	0.582																																					p.F75F													.	.			0			c.C225T							C	,	1,4405	2.1+/-5.4	0,1,2202	251.0	210.0	224.0		225,225	5.9	1.0	14		224	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CMTM5	NM_001037288.1,NM_138460.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	75/126,75/157	23847656	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	116173	exon2			CCTCTTCCTCTAT	BC013109	CCDS9598.1, CCDS32050.1, CCDS73617.1, CCDS73618.1, CCDS73619.1	14q11.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000166091	ENSG00000166091			19176	protein-coding gene	gene with protein product		607888	"""chemokine-like factor super family 5"", ""chemokine-like factor superfamily 5"""	CKLFSF5			Standard	NM_138460		Approved	FLJ37521	uc001wjs.3	Q96DZ9	OTTHUMG00000028751	ENST00000339180.4:c.225C>T	14.37:g.23847656C>T			Somatic	135	0	0		WXS	Illumina HiSeq	.	144	0.18	26	NM_138460	0		0	E9PH91|Q5PY48	Silent	SNP	ENST00000339180.4	37																																																																																						0.582	CMTM5-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000133708.2			
PSMA6	5687	broad.mit.edu	37	14	35782215	35782216	+	Frame_Shift_Ins	INS	-	-	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr14:35782215_35782216insA	ENST00000261479.4	+	5	658_659	c.538_539insA	c.(538-540)gaafs	p.E180fs	PSMA6_ENST00000555764.1_Frame_Shift_Ins_p.E101fs|PSMA6_ENST00000540871.1_Frame_Shift_Ins_p.E161fs|KIAA0391_ENST00000557565.1_3'UTR|PSMA6_ENST00000556506.1_Frame_Shift_Ins_p.E180fs|PSMA6_ENST00000553809.1_Frame_Shift_Ins_p.E186fs	NM_002791.1	NP_002782.1	P60900	PSA6_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 6	180					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of inflammatory response (GO:0050727)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|myofibril (GO:0030016)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)|sarcomere (GO:0030017)	endopeptidase activity (GO:0004175)|NF-kappaB binding (GO:0051059)|purine ribonucleoside triphosphate binding (GO:0035639)|RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			kidney(2)|large_intestine(1)|lung(5)|prostate(1)|urinary_tract(1)	10	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		CAGCTTCCTTGAAAAAAAAGTG	0.406																																					p.E180fs													.	PSMA6	18		0			c.538_539insA																																									SO:0001589	frameshift_variant	5687	exon5			TTCCTTGAAAAAA	X59417	CCDS9655.1, CCDS61437.1, CCDS61438.1	14q13	2003-03-12			ENSG00000100902	ENSG00000100902		"""Proteasome (prosome, macropain) subunits"""	9535	protein-coding gene	gene with protein product		602855				1888762, 8811196	Standard	NM_002791		Approved	IOTA, PROS27, p27K, MGC22756, MGC2333, MGC23846	uc001wtd.3	P60900	OTTHUMG00000140221	ENST00000261479.4:c.546dupA	14.37:g.35782223_35782223dupA	ENSP00000261479:p.Glu180fs		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	100	0.08	8	NM_002791	850	0.00	0	B2R7J9|B4DQR4|B4DXJ9|P34062|Q6IB60	Frame_Shift_Ins	INS	ENST00000261479.4	37	CCDS9655.1																																																																																					0.406	PSMA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000276684.1			
SYNE3	161176	mdanderson.org	37	14	95918708	95918708	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr14:95918708C>T	ENST00000334258.5	-	6	1164	c.1150G>A	c.(1150-1152)Gcg>Acg	p.A384T	SYNE3_ENST00000557275.1_Missense_Mutation_p.A384T|SYNE3_ENST00000554873.1_Missense_Mutation_p.A141T|SYNE3_ENST00000553340.1_Missense_Mutation_p.A384T	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	384					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GAGGCCAGCGCCGCCCGTGTT	0.627											OREG0022900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A384T													.	.			0			c.G1150A												50.0	48.0	49.0					14																	95918708		2203	4299	6502	SO:0001583	missense	161176	exon6			CCAGCGCCGCCCG	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1150G>A	14.37:g.95918708C>T	ENSP00000334308:p.Ala384Thr		Somatic	20	0	0	1316	WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_152592	1	0.00	0	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.840413	0.32513	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.34472	3.49;1.36;3.49;2.88	4.68	2.86	0.33363	.	0.172136	0.27792	N	0.017823	T	0.36826	0.0981	M	0.73598	2.24	0.09310	N	0.99999	B;B;B	0.25235	0.121;0.121;0.074	B;B;B	0.22601	0.04;0.032;0.018	T	0.27157	-1.0082	10	0.40728	T	0.16	-8.9898	10.7232	0.46052	0.0:0.8418:0.0:0.1582	.	384;384;384	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	T	384;141;384;384	ENSP00000334308:A384T;ENSP00000452154:A141T;ENSP00000450562:A384T;ENSP00000450774:A384T	ENSP00000334308:A384T	A	-	1	0	C14orf49	94988461	0.156000	0.22821	0.012000	0.15200	0.041000	0.13682	0.711000	0.25764	0.525000	0.28522	0.462000	0.41574	GCG			0.627	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000420529.2		NM_152592	
CHRM5	1133	broad.mit.edu	37	15	34355354	34355354	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr15:34355354A>G	ENST00000383263.5	+	3	1106	c.436A>G	c.(436-438)Agg>Ggg	p.R146G	CHRM5_ENST00000557872.1_Missense_Mutation_p.R146G	NM_012125.3	NP_036257.1	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	146					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|dopamine transport (GO:0015872)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|gastric acid secretion (GO:0001696)|metabolic process (GO:0008152)|regulation of phosphatidylinositol dephosphorylation (GO:0060304)|transmission of nerve impulse (GO:0019226)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	20		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Imipramine(DB00458)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Ziprasidone(DB00246)	TACTCCGAAAAGGGCTGGCAT	0.537																																					p.R146G													.	CHRM5	59		0			c.A436G												98.0	95.0	96.0					15																	34355354		2201	4298	6499	SO:0001583	missense	0	exon3			CCGAAAAGGGCTG		CCDS10031.1	15q26	2012-08-08			ENSG00000184984	ENSG00000184984		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1954	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 5"""	118496					Standard	NM_012125		Approved		uc001zhk.1	P08912	OTTHUMG00000129369	ENST00000383263.5:c.436A>G	15.37:g.34355354A>G	ENSP00000372750:p.Arg146Gly		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	111	0.03	3	NM_012125	0		0	Q96RG7	Missense_Mutation	SNP	ENST00000383263.5	37	CCDS10031.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.760817	0.49468	.	.	ENSG00000184984	ENST00000383263	T	0.41065	1.01	5.54	3.16	0.36331	GPCR, rhodopsin-like superfamily (1);	0.049404	0.85682	D	0.000000	T	0.69504	0.3118	M	0.91354	3.2	0.53005	D	0.999963	D	0.89917	1.0	D	0.78314	0.991	T	0.77763	-0.2466	10	0.87932	D	0	-23.3578	13.4832	0.61348	0.7438:0.2562:0.0:0.0	.	146	P08912	ACM5_HUMAN	G	146	ENSP00000372750:R146G	ENSP00000372750:R146G	R	+	1	2	CHRM5	32142646	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.311000	0.43717	1.090000	0.41315	0.528000	0.53228	AGG			0.537	CHRM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251521.2			
RORA	6095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	60849111	60849111	+	Intron	SNP	T	T	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr15:60849111T>A	ENST00000335670.6	-	3	297				RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000560004.1_Intron|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000449337.2_Intron|RORA_ENST00000309157.4_Intron|RORA_ENST00000261523.5_Missense_Mutation_p.N79I	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A						angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						TGGCTTGCCATTCTGCCTCCA	0.398																																					p.N79I													.	.			0			c.A236T												310.0	267.0	282.0					15																	60849111		2203	4300	6503	SO:0001627	intron_variant	6095	exon3			TTGCCATTCTGCC	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.197-25061A>T	15.37:g.60849111T>A			Somatic	150	0	0		WXS	Illumina HiSeq	.	176	0.10	17	NM_134260	0		0	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	37	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	T	10.74	1.436599	0.25813	.	.	ENSG00000069667	ENST00000261523	D	0.94232	-3.38	4.74	0.914	0.19360	.	0.995540	0.08138	N	0.991981	D	0.82944	0.5147	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71748	-0.4499	10	0.49607	T	0.09	.	3.0157	0.06059	0.1788:0.1964:0.0:0.6248	.	79	P35398	RORA_HUMAN	I	79	ENSP00000261523:N79I	ENSP00000261523:N79I	N	-	2	0	RORA	58636403	0.000000	0.05858	0.001000	0.08648	0.057000	0.15508	-0.260000	0.08708	0.401000	0.25424	0.533000	0.62120	AAT			0.398	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256142.2			
RORA	6095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	60849113	60849113	+	Intron	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr15:60849113C>T	ENST00000335670.6	-	3	297				RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000560004.1_Intron|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000449337.2_Intron|RORA_ENST00000309157.4_Intron|RORA_ENST00000261523.5_Silent_p.Q78Q	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A						angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						GCTTGCCATTCTGCCTCCAGG	0.408																																					p.Q78Q													.	.			0			c.G234A												308.0	266.0	280.0					15																	60849113		2203	4300	6503	SO:0001627	intron_variant	6095	exon3			GCCATTCTGCCTC	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.197-25063G>A	15.37:g.60849113C>T			Somatic	151	0	0		WXS	Illumina HiSeq	.	178	0.10	18	NM_134260	0		0	P35397|P35399|P45445|Q495X4|Q96H83	Silent	SNP	ENST00000335670.6	37	CCDS10177.1																																																																																					0.408	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256142.2			
PRKXP1	441733	hgsc.bcm.edu	37	15	101094337	101094337	+	RNA	SNP	G	G	A	rs191146252		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr15:101094337G>A	ENST00000516010.1	-	0	0									RNA, U6 small nuclear 322, pseudogene																		TCAAGTCCCTGTAGATGATCT	0.552													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18929	0.0		0.0	False		,,,				2504	0.0				.													.	.			0			.																																											441733	.			GTCCCTGTAGATG			15q26.3	2013-05-01			ENSG00000251819	ENSG00000251819			47285	pseudogene	RNA, pseudogene							Standard			Approved						15.37:g.101094337G>A			Somatic	102	0	0		WXS	Illumina HiSeq	.	122	0.12	15	.	11	0.18	2		RNA	SNP	ENST00000516010.1	37																																																																																				0		0.552	RNU6-322P-201	KNOWN	basic	snRNA	snRNA					
FAM86A	196483	ucsc.edu	37	16	5140488	5140488	+	Missense_Mutation	SNP	C	C	T	rs200021489	byFrequency	TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr16:5140488C>T	ENST00000427587.4	-	5	489	c.421G>A	c.(421-423)Gcc>Acc	p.A141T	FAM86A_ENST00000458008.4_Missense_Mutation_p.A107T|FAM86A_ENST00000587133.1_Missense_Mutation_p.A80T	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	141						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TAGAGGGCGGCGTCCCATGTG	0.642																																					p.A141T													.	FAM86A	32		0			c.G421A												90.0	88.0	89.0					16																	5140488		2197	4300	6497	SO:0001583	missense	196483	exon5			GGGCGGCGTCCCA	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.421G>A	16.37:g.5140488C>T	ENSP00000398502:p.Ala141Thr		Somatic	169	0.0059171598	1		RNA-Seq	Illumina HiSeq		144	0.03	4	NM_201400	50	0.24	12	D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	37	CCDS10529.1	.	.	.	.	.	.	.	.	.	.	c	20.2	3.953061	0.73902	.	.	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.14266	2.52;2.52	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.48554	0.1506	H	0.97077	3.935	0.80722	D	1	D;D	0.67145	0.996;0.987	P;P	0.60886	0.88;0.78	T	0.66101	-0.6007	10	0.72032	D	0.01	.	15.221	0.73310	0.0:1.0:0.0:0.0	.	107;141	Q96G04-2;Q96G04	.;FA86A_HUMAN	T	107;141	ENSP00000389710:A107T;ENSP00000398502:A141T	ENSP00000398502:A141T	A	-	1	0	FAM86A	5080489	1.000000	0.71417	0.506000	0.27664	0.137000	0.21094	6.686000	0.74548	2.620000	0.88729	0.450000	0.29827	GCC			0.642	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251713.1	rescued with RNA-seq	NM_201400	
APOBR	55911	broad.mit.edu	37	16	28511197	28511197	+	IGR	SNP	T	T	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr16:28511197T>C	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Silent_p.E169E			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						cctcctcctcttcctcctcct	0.672																																					p.E169E													.	IL27	27		0			c.A507G												8.0	9.0	9.0					16																	28511197		2149	4215	6364	SO:0001628	intergenic_variant	246778	exon5			CTCCTCTTCCTCC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			16.37:g.28511197T>C			Somatic	42	0.0238095238	1		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_145659	4	0.00	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	37																																																																																						0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_182804	
SETD6	79918	mdanderson.org	37	16	58549762	58549762	+	Missense_Mutation	SNP	T	T	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr16:58549762T>G	ENST00000219315.4	+	2	145	c.95T>G	c.(94-96)gTg>gGg	p.V32G	SETD6_ENST00000394266.4_Missense_Mutation_p.V32G|SETD6_ENST00000310682.2_Missense_Mutation_p.V32G|SETD6_ENST00000418480.1_3'UTR			Q8TBK2	SETD6_HUMAN	SET domain containing 6	32					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						TGCCGGCGGGTGGGGCTGGAG	0.741																																					p.V32G													.	.			0			c.T95G												6.0	7.0	7.0					16																	58549762		2098	4157	6255	SO:0001583	missense	79918	exon2			GGCGGGTGGGGCT	AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.95T>G	16.37:g.58549762T>G	ENSP00000219315:p.Val32Gly		Somatic	10	0.1	1		WXS	Illumina HiSeq	Phase_I	13	0.31	4	NM_024860	22	0.05	1	A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	ENST00000219315.4	37	CCDS54013.1	.	.	.	.	.	.	.	.	.	.	T	12.69	2.013612	0.35511	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315;ENST00000447443;ENST00000458571	T;T;T;T	0.60040	2.58;2.58;2.58;0.22	4.73	4.73	0.59995	.	0.065202	0.64402	D	0.000012	T	0.46795	0.1411	M	0.63843	1.955	0.80722	D	1	D;P;P	0.54207	0.965;0.728;0.943	B;B;B	0.37601	0.146;0.084;0.254	T	0.45906	-0.9229	10	0.23302	T	0.38	-2.4553	8.5488	0.33438	0.0:0.091:0.0:0.909	.	32;32;32	E9PC53;Q8TBK2;Q8TBK2-2	.;SETD6_HUMAN;.	G	32	ENSP00000310082:V32G;ENSP00000377809:V32G;ENSP00000219315:V32G;ENSP00000396437:V32G	ENSP00000219315:V32G	V	+	2	0	SETD6	57107263	0.997000	0.39634	0.987000	0.45799	0.441000	0.31987	2.406000	0.44557	1.974000	0.57490	0.454000	0.30748	GTG			0.741	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000317274.2		NM_024860	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7574027	7574027	+	Missense_Mutation	SNP	C	C	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:7574027C>A	ENST00000269305.4	-	10	1189	c.1000G>T	c.(1000-1002)Ggg>Tgg	p.G334W	TP53_ENST00000455263.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.G334W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	334	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		G -> V (in sporadic cancers; somatic mutation).|G -> W (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*5(1)|p.G334W(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCTCACGCCCACGGATCTGC	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G334W	Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000269305,NS,carcinoma,0,16	TP53_ENST00000269305	0	16	11	Whole gene deletion(8)|Substitution - Missense(1)|Unknown(1)|Deletion - Frameshift(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|lung(1)	c.G1000T												50.0	40.0	43.0					17																	7574027		2203	4300	6503	SO:0001583	missense	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CACGCCCACGGAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1000G>T	17.37:g.7574027C>A	ENSP00000269305:p.Gly334Trp		Somatic	106	0	0		WXS	Illumina HiSeq	.	76	0.13	10	NM_000546	124	0.28	35	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494483	0.64186	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.99910	-7.91;-7.91	5.43	5.43	0.79202	p53, tetramerisation domain (3);	0.000000	0.85682	D	0.000000	D	0.99915	0.9960	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95984	0.8980	10	0.87932	D	0	-30.4955	16.7337	0.85442	0.0:1.0:0.0:0.0	.	334	P04637	P53_HUMAN	W	334;334;323	ENSP00000269305:G334W;ENSP00000391478:G334W	ENSP00000269305:G334W	G	-	1	0	TP53	7514752	1.000000	0.71417	0.970000	0.41538	0.222000	0.24845	6.452000	0.73485	2.549000	0.85964	0.561000	0.74099	GGG			0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367397.1		NM_000546	
EFNB3	1949	mdanderson.org	37	17	7612495	7612495	+	Silent	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:7612495C>T	ENST00000226091.2	+	5	1021	c.624C>T	c.(622-624)acC>acT	p.T208T		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	208					adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				GTGACCCCACCAGCAATGCAA	0.697																																					p.T208T													.	.			0			c.C624T												39.0	41.0	40.0					17																	7612495		1942	4101	6043	SO:0001819	synonymous_variant	1949	exon5			CCCCACCAGCAAT	U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.624C>T	17.37:g.7612495C>T			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_001406	19	0.42	8	B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Silent	SNP	ENST00000226091.2	37	CCDS11120.1																																																																																					0.697	EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226965.1		NM_001406	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		Somatic	193	0.0414507772	8		RNA-Seq	Illumina HiSeq		188	0.06	12	NM_145301	37	0.70	26	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
PSMD11	5717	broad.mit.edu	37	17	30771555	30771555	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:30771555C>T	ENST00000261712.3	+	1	277	c.14C>T	c.(13-15)gCg>gTg	p.A5V	PSMD11_ENST00000457654.2_Missense_Mutation_p.A5V	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			gcggcggcggcggtggtggAG	0.701																																					p.A5V	Ovarian(130;1038 1716 9294 11987 19279)												.	PSMD11	41		0			c.C14T												18.0	18.0	18.0					17																	30771555		2186	4270	6456	SO:0001583	missense	5717	exon1			CGGCGGCGGTGGT	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.14C>T	17.37:g.30771555C>T	ENSP00000261712:p.Ala5Val		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	160	0.03	5	NM_002815	116	0.00	0	A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	ENST00000261712.3	37	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999150	0.74818	.	.	ENSG00000108671	ENST00000261712	.	.	.	5.25	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.24928	0.0605	N	0.08118	0	0.53688	D	0.999975	P;B	0.37038	0.579;0.212	B;B	0.33392	0.163;0.049	T	0.08086	-1.0739	9	0.27785	T	0.31	-19.5166	11.4424	0.50105	0.0:0.9133:0.0:0.0867	.	5;5	B4DTS5;O00231	.;PSD11_HUMAN	V	5	.	ENSP00000261712:A5V	A	+	2	0	PSMD11	27795668	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.945000	0.75947	1.455000	0.47813	0.558000	0.71614	GCG			0.701	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256252.2		NM_002815	
ERBB2	2064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37879626	37879626	+	Missense_Mutation	SNP	G	G	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:37879626G>C	ENST00000269571.5	+	17	2160	c.2001G>C	c.(1999-2001)ttG>ttC	p.L667F	ERBB2_ENST00000406381.2_Missense_Mutation_p.L637F|ERBB2_ENST00000445658.2_Missense_Mutation_p.L391F|ERBB2_ENST00000541774.1_Missense_Mutation_p.L652F|ERBB2_ENST00000584601.1_Missense_Mutation_p.L637F|ERBB2_ENST00000584450.1_Missense_Mutation_p.L667F|ERBB2_ENST00000540147.1_Missense_Mutation_p.L637F			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	667					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TCGTGGTCTTGGGGGTGGTCT	0.607		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.L667F				Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	.			0			c.G2001C												129.0	117.0	121.0					17																	37879626		2203	4300	6503	SO:0001583	missense	2064	exon17			GGTCTTGGGGGTG	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2001G>C	17.37:g.37879626G>C	ENSP00000269571:p.Leu667Phe		Somatic	109	0	0		WXS	Illumina HiSeq	.	84	0.20	17	NM_004448	49	0.37	18	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	7.985	0.752076	0.15778	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.80123	-1.33;-1.34;-1.31;-1.34;-1.33	4.97	0.106	0.14540	Cytochrome c1, transmembrane anchor, C-terminal (1);	.	.	.	.	T	0.70168	0.3193	L	0.60455	1.87	0.53688	D	0.999973	P;P;P	0.36465	0.554;0.501;0.554	B;B;B	0.38562	0.197;0.276;0.183	T	0.62469	-0.6848	9	0.30854	T	0.27	.	0.0894	0.00038	0.2682:0.2463:0.2121:0.2734	.	391;652;667	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	F	637;652;391;667;637	ENSP00000385185:L637F;ENSP00000446466:L652F;ENSP00000404047:L391F;ENSP00000269571:L667F;ENSP00000443562:L637F	ENSP00000269571:L667F	L	+	3	2	ERBB2	35133152	0.005000	0.15991	0.177000	0.23020	0.447000	0.32167	0.028000	0.13644	0.486000	0.27676	0.561000	0.74099	TTG			0.607	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445621.2			
KRT9	3857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39727976	39727976	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:39727976A>G	ENST00000246662.4	-	1	334	c.269T>C	c.(268-270)tTt>tCt	p.F90S	KRT9_ENST00000588431.1_Intron	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	90	Head.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				accacccccaaagccaccgcc	0.572																																					p.F90S													.	.			0			c.T269C												127.0	132.0	130.0					17																	39727976		2203	4300	6503	SO:0001583	missense	3857	exon1			CCCCCAAAGCCAC		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.269T>C	17.37:g.39727976A>G	ENSP00000246662:p.Phe90Ser		Somatic	145	0	0		WXS	Illumina HiSeq	.	136	0.15	21	NM_000226	0		0	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	37	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.115071	0.37339	.	.	ENSG00000171403	ENST00000246662	D	0.91124	-2.79	4.6	-1.7	0.08159	.	0.531595	0.14239	N	0.332225	T	0.80954	0.4723	L	0.45352	1.415	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63849	-0.6544	10	0.27082	T	0.32	.	0.9139	0.01300	0.2337:0.1153:0.1982:0.4529	.	90	P35527	K1C9_HUMAN	S	90	ENSP00000246662:F90S	ENSP00000246662:F90S	F	-	2	0	KRT9	36981502	0.000000	0.05858	0.001000	0.08648	0.077000	0.17291	-0.362000	0.07602	-0.062000	0.13088	0.477000	0.44152	TTT			0.572	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257707.1		NM_000226	
CDC27	996	mdanderson.org	37	17	45234397	45234397	+	Missense_Mutation	SNP	G	G	A	rs7350908		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:45234397G>A	ENST00000066544.3	-	7	817	c.724C>T	c.(724-726)Cct>Tct	p.P242S	CDC27_ENST00000527547.1_Missense_Mutation_p.P242S|CDC27_ENST00000531206.1_Missense_Mutation_p.P242S|CDC27_ENST00000446365.2_Missense_Mutation_p.P181S|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	242					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACAGTATCAGGTGAAATTACA	0.363																																					p.P242S													.	.			0			c.C724T												44.0	48.0	47.0					17																	45234397		2191	4293	6484	SO:0001583	missense	996	exon7			TATCAGGTGAAAT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.724C>T	17.37:g.45234397G>A	ENSP00000066544:p.Pro242Ser		Somatic	68	0.0294117647	2		WXS	Illumina HiSeq	Phase_I	76	0.09	7	NM_001114091	131	0.00	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407694	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.26;-0.27;0.01;-0.27;0.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26195	0.0;0.014;0.0;0.144	B;B;B;B	0.20955	0.001;0.008;0.001;0.032	T	0.50004	-0.8878	10	0.06099	T	0.92	-16.7932	16.7505	0.85484	0.0:0.0:1.0:0.0	rs7350908;rs52796638;rs7350908	181;242;242;242	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	242;242;181;242;242	ENSP00000066544:P242S;ENSP00000434614:P242S;ENSP00000392802:P181S;ENSP00000437339:P242S;ENSP00000432105:P242S	ENSP00000066544:P242S	P	-	1	0	CDC27	42589396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.436000	0.80404	2.555000	0.86185	0.460000	0.39030	CCT			0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			
OXLD1	339229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79632527	79632527	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr17:79632527C>T	ENST00000374741.3	-	2	158	c.148G>A	c.(148-150)Gcc>Acc	p.A50T	CCDC137_ENST00000329214.8_5'Flank|PDE6G_ENST00000574777.1_5'Flank|OXLD1_ENST00000571503.1_3'UTR|PDE6G_ENST00000571224.1_5'Flank|OXLD1_ENST00000573786.1_5'UTR	NM_001039842.1	NP_001034931.1	Q5BKU9	OXLD1_HUMAN	oxidoreductase-like domain containing 1	50						mitochondrion (GO:0005739)											CCATCAGGGGCTTGCGCTCCG	0.652																																					p.A50T													.	.			0			c.G148A												32.0	34.0	33.0					17																	79632527		2203	4298	6501	SO:0001583	missense	339229	exon2			CAGGGGCTTGCGC		CCDS32766.1	17q25.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000204237	ENSG00000204237			27901	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 90"""	C17orf90			Standard	NM_001039842		Approved	MGC104712	uc002kba.3	Q5BKU9	OTTHUMG00000178063	ENST00000374741.3:c.148G>A	17.37:g.79632527C>T	ENSP00000363873:p.Ala50Thr		Somatic	59	0	0		WXS	Illumina HiSeq	.	60	0.15	9	NM_001039842	86	0.10	9	A6ND24	Missense_Mutation	SNP	ENST00000374741.3	37	CCDS32766.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866621	0.32977	.	.	ENSG00000204237	ENST00000374741	.	.	.	3.48	2.51	0.30379	.	0.726127	0.11371	N	0.570890	T	0.20292	0.0488	N	0.19112	0.55	0.30363	N	0.783584	P	0.37781	0.608	B	0.32465	0.146	T	0.10405	-1.0631	9	0.25106	T	0.35	-0.4776	8.9408	0.35729	0.0:0.889:0.0:0.111	.	50	Q5BKU9	CQ090_HUMAN	T	50	.	ENSP00000363873:A50T	A	-	1	0	C17orf90	77242932	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.140000	0.10342	1.036000	0.39998	0.655000	0.94253	GCC			0.652	OXLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440380.1		NM_001039842	
BSG	682	mdanderson.org	37	19	577976	577976	+	Silent	SNP	C	C	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:577976C>A	ENST00000333511.3	+	2	340	c.270C>A	c.(268-270)gcC>gcA	p.A90A	BSG_ENST00000353555.4_Intron|BSG_ENST00000574970.1_3'UTR|BSG_ENST00000346916.4_Intron|BSG_ENST00000545507.2_Intron	NM_001728.3	NP_001719.2	P35613	BASI_HUMAN	basigin (Ok blood group)	90					blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular metabolic process (GO:0044237)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis of dentin-containing tooth (GO:0042475)|protein targeting to plasma membrane (GO:0072661)|pyruvate metabolic process (GO:0006090)|response to cAMP (GO:0051591)|response to mercury ion (GO:0046689)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|lung(1)	5		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACGCGGCCAGCACCATCT	0.687																																					p.A90A													.	.			0			c.C270A												36.0	33.0	34.0					19																	577976		2199	4298	6497	SO:0001819	synonymous_variant	682	exon2			CGCGGCCAGCACC	L10240	CCDS12032.1, CCDS12033.1, CCDS12034.1, CCDS58635.1	19p13.3	2014-07-19	2014-01-02		ENSG00000172270	ENSG00000172270		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1116	protein-coding gene	gene with protein product	"""Ok blood group"""	109480	"""basigin"""	OK		8404035, 7812975	Standard	NM_198591		Approved	EMMPRIN, CD147	uc002loz.4	P35613		ENST00000333511.3:c.270C>A	19.37:g.577976C>A			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001728	8	0.00	0	A6NJW1|D3YLG5|Q7Z796|Q8IZL7	Silent	SNP	ENST00000333511.3	37	CCDS12033.1																																																																																					0.687	BSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438630.2		NM_001728	
EMR1	2015	mdanderson.org	37	19	6937381	6937381	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:6937381G>T	ENST00000312053.4	+	19	2546	c.2509G>T	c.(2509-2511)Ggg>Tgg	p.G837W	EMR1_ENST00000450315.3_Missense_Mutation_p.G660W|EMR1_ENST00000381404.4_Missense_Mutation_p.G818W|EMR1_ENST00000250572.8_Missense_Mutation_p.G772W|EMR1_ENST00000381407.5_Missense_Mutation_p.G696W	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	837					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					CAGCCTGCAGGGGGCCTTCAT	0.602																																					p.G837W													.	.			0			c.G2509T												127.0	112.0	117.0					19																	6937381		2203	4300	6503	SO:0001583	missense	2015	exon19			CTGCAGGGGGCCT	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2509G>T	19.37:g.6937381G>T	ENSP00000311545:p.Gly837Trp		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_001974	19	0.00	0	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	g	21.2	4.113936	0.77210	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89	4.83	4.83	0.62350	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	.	.	.	.	D	0.95130	0.8422	H	0.97635	4.045	0.49483	D	0.99979	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0	D	0.96854	0.9627	9	0.87932	D	0	.	15.4845	0.75555	0.0:0.0:1.0:0.0	.	660;696;772;818;837	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	W	772;837;818;772;696;660	ENSP00000311545:G837W;ENSP00000370811:G818W;ENSP00000250572:G772W;ENSP00000370814:G696W;ENSP00000405974:G660W	ENSP00000250572:G772W	G	+	1	0	EMR1	6888381	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	7.476000	0.81055	2.249000	0.74217	0.632000	0.83419	GGG			0.602	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458485.1			
PEX11G	92960	mdanderson.org	37	19	7542209	7542209	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:7542209C>T	ENST00000221480.1	-	5	613	c.605G>A	c.(604-606)gGc>gAc	p.G202D	PEX11G_ENST00000593942.1_Missense_Mutation_p.G132D|PEX11G_ENST00000599519.1_5'UTR	NM_001270539.1|NM_080662.3	NP_001257468.1|NP_542393.1	Q96HA9	PX11C_HUMAN	peroxisomal biogenesis factor 11 gamma	202					peroxisome fission (GO:0016559)|regulation of peroxisome size (GO:0044375)	integral component of peroxisomal membrane (GO:0005779)|intrinsic component of peroxisomal membrane (GO:0031231)|peroxisome (GO:0005777)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(1)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	7						CCACAGCACGCCCCGGGGCAG	0.711																																					p.G202D													.	.			0			c.G605A												8.0	9.0	9.0					19																	7542209		2104	4150	6254	SO:0001583	missense	92960	exon5			AGCACGCCCCGGG	BC008780	CCDS12178.1	19p13.2	2008-02-05				ENSG00000104883			20208	protein-coding gene	gene with protein product		607583				12417726	Standard	NM_080662		Approved		uc002mgk.2	Q96HA9		ENST00000221480.1:c.605G>A	19.37:g.7542209C>T	ENSP00000221480:p.Gly202Asp		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_080662	6	0.00	0	Q8NDM0	Missense_Mutation	SNP	ENST00000221480.1	37	CCDS12178.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843426	0.91197	.	.	ENSG00000104883	ENST00000221480	T	0.51574	0.7	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.70850	0.3271	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70124	-0.4958	10	0.18276	T	0.48	-28.8537	16.2364	0.82377	0.0:1.0:0.0:0.0	.	202	Q96HA9	PX11C_HUMAN	D	202	ENSP00000221480:G202D	ENSP00000221480:G202D	G	-	2	0	PEX11G	7448209	1.000000	0.71417	0.092000	0.20876	0.979000	0.70002	7.052000	0.76634	2.405000	0.81733	0.563000	0.77884	GGC			0.711	PEX11G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458965.1		NM_080662	
CAMSAP3	57662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7675802	7675802	+	Missense_Mutation	SNP	A	A	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:7675802A>T	ENST00000160298.4	+	8	1135	c.1034A>T	c.(1033-1035)aAc>aTc	p.N345I	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.N372I	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	345					epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						CCACCTCAGAACAACAGCGGC	0.677																																					p.N372I													.	.			0			c.A1115T												56.0	63.0	60.0					19																	7675802		2029	4181	6210	SO:0001583	missense	57662	exon10			CTCAGAACAACAG	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1034A>T	19.37:g.7675802A>T	ENSP00000160298:p.Asn345Ile		Somatic	85	0	0		WXS	Illumina HiSeq	.	57	0.21	12	NM_001080429	23	0.65	15	Q8NDF1	Missense_Mutation	SNP	ENST00000160298.4	37	CCDS42489.1	.	.	.	.	.	.	.	.	.	.	a	7.633	0.679350	0.14907	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.14516	2.5;2.52	4.81	3.72	0.42706	.	0.942056	0.08947	N	0.870708	T	0.13243	0.0321	N	0.19112	0.55	0.34840	D	0.740556	P;D	0.59357	0.738;0.985	B;P	0.52217	0.149;0.693	T	0.24333	-1.0163	10	0.37606	T	0.19	-35.9202	4.2293	0.10596	0.8127:0.0:0.1873:0.0	.	345;372	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	I	372;345	ENSP00000416797:N372I;ENSP00000160298:N345I	ENSP00000160298:N345I	N	+	2	0	KIAA1543	7581802	0.651000	0.27340	0.956000	0.39512	0.056000	0.15407	0.853000	0.27777	1.806000	0.52798	0.523000	0.50628	AAC			0.677	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000459300.1		XM_048362	
FBN3	84467	mdanderson.org	37	19	8145898	8145898	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:8145898T>C	ENST00000600128.1	-	59	7856	c.7442A>G	c.(7441-7443)cAg>cGg	p.Q2481R	FBN3_ENST00000270509.2_Missense_Mutation_p.Q2481R|FBN3_ENST00000601739.1_Missense_Mutation_p.Q2481R			Q75N90	FBN3_HUMAN	fibrillin 3	2481	EGF-like 40; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GAAGCAGGCCTGGTGGTGCTG	0.587																																					p.Q2481R													.	.			0			c.A7442G												58.0	52.0	54.0					19																	8145898		2203	4300	6503	SO:0001583	missense	84467	exon58			CAGGCCTGGTGGT		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7442A>G	19.37:g.8145898T>C	ENSP00000470498:p.Gln2481Arg		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_032447	35	0.00	0	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	T	13.11	2.139616	0.37728	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.91996	-2.95	3.91	2.77	0.32553	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.508863	0.19221	U	0.119667	T	0.79862	0.4519	N	0.01091	-1.02	0.22754	N	0.99877	B;P	0.43826	0.197;0.818	B;P	0.47864	0.111;0.559	T	0.72962	-0.4132	10	0.20046	T	0.44	.	10.1969	0.43060	0.0:0.0:0.3385:0.6615	.	2481;587	Q75N90;Q6ZNB8	FBN3_HUMAN;.	R	2481;587	ENSP00000270509:Q2481R	ENSP00000270509:Q2481R	Q	-	2	0	FBN3	8051898	1.000000	0.71417	1.000000	0.80357	0.471000	0.32888	5.420000	0.66441	1.540000	0.49301	0.247000	0.18012	CAG			0.587	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461428.2		NM_032447	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000412601.1_Silent_p.E322E|PRKCSH_ENST00000252455.2_Silent_p.E322E|PRKCSH_ENST00000587327.1_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E													PRKCSH,caecum,carcinoma,0,1	PRKCSH	0	1	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A												27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	19.37:g.11558370G>A			Somatic	77	0.012987013	1		WXS	Illumina HiSeq	.	55	0.05	3	NM_001001329	127	0.00	0	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																					0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000458817.1			
MRI1	84245	broad.mit.edu;mdanderson.org	37	19	13879552	13879552	+	Splice_Site	SNP	G	G	A	rs147924371		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:13879552G>A	ENST00000040663.6	+	4	764		c.e4+1		MRI1_ENST00000319545.8_Splice_Site	NM_001031727.2	NP_001026897.1			methylthioribose-1-phosphate isomerase 1											breast(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6						GGCGTGTCAGGTAAGCAGACG	0.647																																					.													.	MRI1	35		0			c.724+1G>A							G	,	1,4405	2.1+/-5.4	0,1,2202	28.0	29.0	29.0		,	5.0	1.0	19	dbSNP_134	29	0,8600		0,0,4300	no	splice-5,splice-5	MRI1	NM_001031727.2,NM_032285.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	,	13879552	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	84245	exon4			TGTCAGGTAAGCA		CCDS12297.1, CCDS32923.1	19p13.13	2013-05-29	2013-05-29			ENSG00000037757	5.3.1.23		28469	protein-coding gene	gene with protein product	"""mediator of RhoA-dependent invasion"", ""S-methyl-5-thioribose-1-phosphate isomerase 1"""	615105	"""methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)"""			15215245, 19620624, 23124037	Standard	XR_244089		Approved	MGC3207, Ypr118w, mtnA, MRDI	uc002mxe.3	Q9BV20		ENST00000040663.6:c.724+1G>A	19.37:g.13879552G>A			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	38	0.13	5	NM_001031727	14	1.00	14		Splice_Site	SNP	ENST00000040663.6	37	CCDS32923.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081994	0.36758	2.27E-4	0.0	ENSG00000037757	ENST00000040663;ENST00000319545	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5256	0.84330	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRI1	13740552	1.000000	0.71417	0.998000	0.56505	0.069000	0.16628	8.826000	0.92034	2.688000	0.91661	0.491000	0.48974	.			0.647	MRI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453424.1		NM_032285	Intron
SLC25A42	284439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19218819	19218819	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:19218819T>C	ENST00000318596.7	+	7	765	c.614T>C	c.(613-615)tTc>tCc	p.F205S		NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	205					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			GGCCTGAGCTTCTTCACCTAT	0.562																																					p.F205S													.	.			0			c.T614C												86.0	74.0	78.0					19																	19218819		2203	4300	6503	SO:0001583	missense	284439	exon7			TGAGCTTCTTCAC		CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.614T>C	19.37:g.19218819T>C	ENSP00000326693:p.Phe205Ser		Somatic	76	0	0		WXS	Illumina HiSeq	.	71	0.18	13	NM_178526	27	0.22	6	D2T2J5|O14553|O43378	Missense_Mutation	SNP	ENST00000318596.7	37	CCDS32966.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.236064	0.58886	.	.	ENSG00000181035	ENST00000318596	D	0.85013	-1.93	5.39	5.39	0.77823	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.94935	0.8362	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96484	0.9358	10	0.87932	D	0	-13.6951	14.5846	0.68315	0.0:0.0:0.0:1.0	.	205	Q86VD7	S2542_HUMAN	S	205	ENSP00000326693:F205S	ENSP00000326693:F205S	F	+	2	0	SLC25A42	19079819	1.000000	0.71417	0.967000	0.41034	0.002000	0.02628	6.724000	0.74747	2.037000	0.60232	0.459000	0.35465	TTC			0.562	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465931.1		NM_178526	
ZNF850	342892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	37239994	37239994	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:37239994A>G	ENST00000591344.1	-	5	2106	c.1948T>C	c.(1948-1950)Tgt>Cgt	p.C650R	ZNF850_ENST00000589390.1_Intron	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	650					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GCTTTCCCACATTCCTGACAT	0.438																																					p.C650R													.	.			0			c.T1948C																																									SO:0001583	missense	342892	exon5			TCCCACATTCCTG	BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.1948T>C	19.37:g.37239994A>G	ENSP00000464976:p.Cys650Arg		Somatic	20	0	0		WXS	Illumina HiSeq	.	20	0.30	6	NM_001193552	8	0.25	2		Missense_Mutation	SNP	ENST00000591344.1	37	CCDS59379.1																																																																																					0.438	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453557.1		XM_001720258	
MEGF8	1954	mdanderson.org	37	19	42880076	42880076	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:42880076G>T	ENST00000251268.6	+	42	7687	c.7687G>T	c.(7687-7689)Gag>Tag	p.E2563*	MEGF8_ENST00000334370.4_Nonsense_Mutation_p.E2496*|MEGF8_ENST00000378073.4_Nonsense_Mutation_p.E157*	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2563	Pro-rich.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CGCCCCAGCAGAGCCACGGGT	0.741																																					p.E2563X													.	.			0			c.G7687T												14.0	16.0	16.0					19																	42880076		2168	4257	6425	SO:0001587	stop_gained	1954	exon42			CCAGCAGAGCCAC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7687G>T	19.37:g.42880076G>T	ENSP00000251268:p.Glu2563*		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001271938	11	0.00	0	A8KAY0|O75097	Nonsense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	g	23.2	4.393306	0.83011	.	.	ENSG00000105429	ENST00000334370;ENST00000251268;ENST00000378073	.	.	.	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-27.3462	13.3963	0.60856	0.0:0.0:1.0:0.0	.	.	.	.	X	2496;2563;157	.	ENSP00000251268:E2563X	E	+	1	0	MEGF8	47571916	1.000000	0.71417	0.954000	0.39281	0.035000	0.12851	5.910000	0.69931	2.634000	0.89283	0.651000	0.88453	GAG			0.741	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
ZC3H4	23211	mdanderson.org	37	19	47575844	47575844	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:47575844G>T	ENST00000253048.5	-	12	1604	c.1567C>A	c.(1567-1569)Ccc>Acc	p.P523T	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	523	Pro-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GGGCCAGGGGGCCGAGGAGGG	0.736																																					p.P523T													.	.			0			c.C1567A												6.0	7.0	6.0					19																	47575844		1722	3772	5494	SO:0001583	missense	23211	exon12			CAGGGGGCCGAGG	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1567C>A	19.37:g.47575844G>T	ENSP00000253048:p.Pro523Thr		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_015168	18	0.00	0	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	g	9.291	1.050693	0.19827	.	.	ENSG00000130749	ENST00000253048	T	0.31247	1.5	4.69	3.66	0.41972	.	0.000000	0.64402	D	0.000001	T	0.21550	0.0519	L	0.39898	1.24	0.35612	D	0.808729	P	0.35575	0.51	B	0.32211	0.142	T	0.22277	-1.0221	10	0.34782	T	0.22	.	8.4161	0.32672	0.1826:0.0:0.8174:0.0	.	523	Q9UPT8	ZC3H4_HUMAN	T	523	ENSP00000253048:P523T	ENSP00000253048:P523T	P	-	1	0	ZC3H4	52267684	1.000000	0.71417	0.155000	0.22561	0.083000	0.17756	4.370000	0.59517	0.983000	0.38602	-0.273000	0.10243	CCC			0.736	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466667.1			
ZNF808	388558	mdanderson.org	37	19	53050833	53050833	+	Silent	SNP	A	A	G	rs377723416		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:53050833A>G	ENST00000359798.4	+	4	312	c.132A>G	c.(130-132)gcA>gcG	p.A44A		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	44	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TGAACCCTGCACAGAGGGCTT	0.463																																					p.A44A													.	.			0			c.A132G												130.0	135.0	133.0					19																	53050833		2203	4300	6503	SO:0001819	synonymous_variant	388558	exon4			CCCTGCACAGAGG	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.132A>G	19.37:g.53050833A>G			Somatic	97	0.0103092784	1		WXS	Illumina HiSeq	Phase_I	65	0.11	7	NM_001039886	22	0.00	0	Q68CN7	Silent	SNP	ENST00000359798.4	37	CCDS46167.1																																																																																					0.463	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350447.3		NM_001039886	
CNOT3	4849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54646888	54646888	+	Missense_Mutation	SNP	A	A	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr19:54646888A>C	ENST00000406403.1	+	2	1662	c.59A>C	c.(58-60)gAg>gCg	p.E20A	CNOT3_ENST00000221232.5_Missense_Mutation_p.E20A|CNOT3_ENST00000358389.3_5'UTR			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	20					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AAGGTGTCCGAGGGCGTGGAG	0.552																																					p.E20A													CNOT3,NS,carcinoma,+1,6	CNOT3	1	6	0			c.A59C												171.0	171.0	171.0					19																	54646888		2203	4300	6503	SO:0001583	missense	4849	exon3			TGTCCGAGGGCGT	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.59A>C	19.37:g.54646888A>C	ENSP00000383954:p.Glu20Ala		Somatic	75	0	0		WXS	Illumina HiSeq	.	71	0.14	10	NM_014516	171	0.32	54	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.685245	0.88639	.	.	ENSG00000088038	ENST00000221232;ENST00000406403	T;T	0.72725	-0.68;-0.68	5.04	5.04	0.67666	Not CCR4-Not complex component, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83949	0.5365	M	0.81497	2.545	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.81914	0.995;0.992	D	0.86479	0.1790	10	0.87932	D	0	-31.302	14.0691	0.64849	1.0:0.0:0.0:0.0	.	20;20	B7Z6J7;O75175	.;CNOT3_HUMAN	A	20	ENSP00000221232:E20A;ENSP00000383954:E20A	ENSP00000221232:E20A	E	+	2	0	CNOT3	59338700	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.359000	0.90093	2.032000	0.59987	0.533000	0.62120	GAG			0.552	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000142130.3		NM_014516	
LOC401010	401010	bcgsc.ca	37	2	132200890	132200890	+	IGR	SNP	T	T	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr2:132200890T>C								AC073869.19 (34268 upstream) : RP11-109E12.1 (18503 downstream)																							GTCGTACAGCTGCTCCACCAG	0.632																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TACAGCTGCTCCA																													2.37:g.132200890T>C			Somatic	119	0	0		WXS	Illumina HiSeq	Phase_1	111	0.15	17	.	53	0.09	5		RNA	SNP		37																																																																																					0	0.632										
TTN	7273	hgsc.bcm.edu	37	2	179500487	179500487	+	Intron	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr2:179500487G>A	ENST00000591111.1	-	177	36910				TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTGAACAAGTAATATACAT	0.333																																					.													.	.			0			.												17.0	15.0	16.0					2																	179500487		1794	4067	5861	SO:0001627	intron_variant	100302152	.			GAACAAGTAATAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36686-45C>T	2.37:g.179500487G>A			Somatic	96	0	0		WXS	Illumina HiSeq	.	103	0.13	13	.	0		0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	ENST00000591111.1	37																																																																																						0.333	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
ITGA4	3676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	182400167	182400167	+	Silent	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr2:182400167C>T	ENST00000397033.2	+	28	3442	c.3012C>T	c.(3010-3012)ttC>ttT	p.F1004F		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	1004					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	AGGCTGGCTTCTTTAAAAGAC	0.313																																					p.F1004F													ITGA4,NS,carcinoma,0,1	ITGA4	0	1	0			c.C3012T												120.0	121.0	121.0					2																	182400167		1829	4074	5903	SO:0001819	synonymous_variant	3676	exon28			TGGCTTCTTTAAA		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.3012C>T	2.37:g.182400167C>T			Somatic	237	0	0		WXS	Illumina HiSeq	.	269	0.13	34	NM_000885	75	0.00	0	D3DPG4|Q7Z4L6	Silent	SNP	ENST00000397033.2	37	CCDS42788.1																																																																																					0.313	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334427.1			
KLHL30	377007	mdanderson.org	37	2	239050003	239050003	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr2:239050003G>T	ENST00000409223.1	+	2	715	c.608G>T	c.(607-609)tGg>tTg	p.W203L	KLHL30_ENST00000305959.4_Missense_Mutation_p.W185L			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	203	BACK.									lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CTGATGCGCTGGGTGCGCCAT	0.701																																					p.W203L													.	.			0			c.G608T												9.0	13.0	12.0					2																	239050003		2090	4175	6265	SO:0001583	missense	377007	exon2			TGCGCTGGGTGCG		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.608G>T	2.37:g.239050003G>T	ENSP00000386389:p.Trp203Leu		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_198582	0		0	Q6ZUS1	Missense_Mutation	SNP	ENST00000409223.1	37	CCDS46555.2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794869	0.90453	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	D;D	0.85411	-1.98;-1.98	5.82	5.82	0.92795	BTB/Kelch-associated (2);	0.066689	0.64402	D	0.000003	D	0.95072	0.8404	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95943	0.8948	10	0.87932	D	0	.	18.8769	0.92341	0.0:0.0:1.0:0.0	.	203	Q0D2K2	KLH30_HUMAN	L	203;185	ENSP00000386389:W203L;ENSP00000302386:W185L	ENSP00000302386:W185L	W	+	2	0	KLHL30	238714742	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	9.646000	0.98474	2.757000	0.94681	0.655000	0.94253	TGG			0.701	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328518.1		NM_198582	
CSRP2BP	57325	broad.mit.edu	37	20	18142572	18142572	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr20:18142572G>T	ENST00000435364.3	+	5	1132	c.791G>T	c.(790-792)cGa>cTa	p.R264L	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.R263L|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.R136L	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	264					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.R264Q(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						AAAAGGTCTCGAACTCAGGAA	0.453																																					p.R264L													CSRP2BP,NS,carcinoma,0,3	CSRP2BP	80	3	1	Substitution - Missense(1)	large_intestine(1)	c.G791T												124.0	144.0	137.0					20																	18142572		2203	4300	6503	SO:0001583	missense	57325	exon5			GGTCTCGAACTCA	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.791G>T	20.37:g.18142572G>T	ENSP00000392318:p.Arg264Leu		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	94	0.04	4	NM_020536	110	0.00	0	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.219086	0.58560	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.16196	2.36;2.36;2.36;2.39	5.84	5.84	0.93424	.	0.188137	0.47852	D	0.000211	T	0.17577	0.0422	L	0.29908	0.895	0.80722	D	1	P;P	0.52170	0.951;0.798	P;B	0.45794	0.493;0.195	T	0.02758	-1.1114	10	0.10377	T	0.69	-6.7325	20.563	0.99327	0.0:0.0:1.0:0.0	.	136;264	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	L	264;263;264;136	ENSP00000278816:R264L;ENSP00000366909:R263L;ENSP00000392318:R264L;ENSP00000425909:R136L	ENSP00000278816:R264L	R	+	2	0	CSRP2BP	18090572	1.000000	0.71417	0.956000	0.39512	0.982000	0.71751	9.071000	0.93980	2.937000	0.99478	0.650000	0.86243	CGA			0.453	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078152.5		NM_020536	
AIRE	326	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	21	45716314	45716316	+	Missense_Mutation	TNP	TCC	TCC	GTT			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr21:45716314_45716316TCC>GTT	ENST00000291582.5	+	13	1679_1681	c.1552_1554TCC>GTT	c.(1552-1554)TCC>GTT	p.S518V	AIRE_ENST00000355347.4_Missense_Mutation_p.S311V|AIRE_ENST00000329347.4_3'UTR	NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	518					humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		TGACCTGGAGTCCCTTCTGAGCG	0.655									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																												p.S518V													.	.			0			c.C1554T																																									SO:0001583	missense	326	exon13	Familial Cancer Database	APECED	CTGGAGTCCCTTC	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.1552_1554TCC>GTT	21.37:g.45716314TCC>GTT	ENSP00000291582:p.Ser518Val		Somatic	104	0	0		WXS	Illumina HiSeq	.	65	0.12	8	NM_000383	0		0	B2RP50|O43922|O43932|O75745	Missense_Mutation	TNP	ENST00000291582.5	37	CCDS13706.1																																																																																					0.655	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195842.2			
LSS	4047	mdanderson.org	37	21	47642587	47642587	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr21:47642587G>A	ENST00000397728.3	-	4	463	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W	LSS_ENST00000356396.4_Missense_Mutation_p.R129W|LSS_ENST00000464357.1_5'UTR|LSS_ENST00000457828.2_Missense_Mutation_p.R49W|LSS_ENST00000522411.1_Missense_Mutation_p.R129W|AP001469.5_ENST00000418029.1_RNA	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	129					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					CGCAGGTACCGCACAATCTCT	0.592																																					p.R129W	Pancreas(114;955 2313 34923 50507)												LSS,colon,carcinoma,+1,1	LSS	1	1	0			c.C385T												133.0	102.0	112.0					21																	47642587		2203	4300	6503	SO:0001583	missense	4047	exon4			GGTACCGCACAAT	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.385C>T	21.37:g.47642587G>A	ENSP00000380837:p.Arg129Trp		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001145436	97	0.00	0	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	37	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887511	0.91814	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411;ENST00000450351	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	5.07	5.07	0.68467	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.000000	0.85682	D	0.000000	T	0.77336	0.4115	H	0.97023	3.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85734	0.1333	10	0.87932	D	0	.	18.4016	0.90518	0.0:0.0:1.0:0.0	.	129;129	E9PEI9;P48449	.;ERG7_HUMAN	W	129;49;129;129;130	ENSP00000348762:R129W;ENSP00000409191:R49W;ENSP00000380837:R129W;ENSP00000429133:R129W;ENSP00000391368:R130W	ENSP00000348762:R129W	R	-	1	2	LSS	46467015	1.000000	0.71417	0.947000	0.38551	0.997000	0.91878	4.580000	0.60942	2.512000	0.84698	0.609000	0.83330	CGG			0.592	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207274.2			
THOC5	8563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29916094	29916094	+	Splice_Site	SNP	C	C	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr22:29916094C>G	ENST00000490103.1	-	14	1400		c.e14-1		CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Splice_Site|THOC5_ENST00000397872.1_Splice_Site|THOC5_ENST00000397873.2_Splice_Site	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5						blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AGTCAGGATGCTGCAGAAAAG	0.522																																					.													.	.			0			c.1278-1G>C												62.0	56.0	58.0					22																	29916094		2203	4300	6503	SO:0001630	splice_region_variant	8563	exon16			AGGATGCTGCAGA	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1278-1G>C	22.37:g.29916094C>G			Somatic	57	0	0		WXS	Illumina HiSeq	.	52	0.19	10	NM_001002877	7	1.00	7	O60839|Q9UPZ5	Splice_Site	SNP	ENST00000490103.1	37	CCDS13859.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016244	0.75161	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5308	0.95228	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	THOC5	28246094	1.000000	0.71417	0.999000	0.59377	0.792000	0.44763	7.028000	0.76470	2.715000	0.92844	0.655000	0.94253	.			0.522	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322097.1		NM_003678	Intron
APOBEC3B	9582	hgsc.bcm.edu	37	22	39382074	39382074	+	Silent	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr22:39382074C>T	ENST00000333467.3	+	3	477	c.432C>T	c.(430-432)cgC>cgT	p.R144R	APOBEC3B_ENST00000407298.3_Silent_p.R144R|APOBEC3B_ENST00000402182.3_Silent_p.R144R	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	144					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					CAGGAGCCCGCGTGACGATCA	0.587																																					p.R144R													APOBEC3B,NS,carcinoma,+1,1	APOBEC3B	1	1	0			c.C432T												51.0	56.0	54.0					22																	39382074		2197	4279	6476	SO:0001819	synonymous_variant	9582	exon3			AGCCCGCGTGACG	AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.432C>T	22.37:g.39382074C>T			Somatic	43	0	0		WXS	Illumina HiSeq	.	37	0.08	3	NM_004900	12	0.00	0	B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Silent	SNP	ENST00000333467.3	37	CCDS13982.1																																																																																					0.587	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321233.1		NM_004900	
P4HTM	54681	broad.mit.edu	37	3	49042374	49042374	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr3:49042374G>T	ENST00000383729.4	+	6	1339	c.968G>T	c.(967-969)gGc>gTc	p.G323V	WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000448293.1_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.G323V|WDR6_ENST00000415265.2_5'Flank|WDR6_ENST00000608424.1_5'Flank	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	323	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	GGTGAGGGGGGCCACTACCAT	0.617																																					p.G323V													.	P4HTM	71		0			c.G968T												105.0	87.0	93.0					3																	49042374		2203	4300	6503	SO:0001583	missense	54681	exon6			AGGGGGGCCACTA		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.968G>T	3.37:g.49042374G>T	ENSP00000373235:p.Gly323Val		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_177938	23	0.00	0	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	37	CCDS43089.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554830	0.65425	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	T	0.61510	0.1	5.29	5.29	0.74685	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.71013	0.3290	M	0.81614	2.55	0.80722	D	1	P;P	0.46327	0.876;0.51	P;B	0.50192	0.634;0.269	T	0.74191	-0.3745	10	0.49607	T	0.09	-16.5162	19.0165	0.92897	0.0:0.0:1.0:0.0	.	323;323	Q9NXG6-3;Q9NXG6	.;P4HTM_HUMAN	V	323	ENSP00000373235:G323V	ENSP00000341422:G323V	G	+	2	0	P4HTM	49017378	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.376000	0.59556	2.491000	0.84063	0.650000	0.86243	GGC			0.617	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157211.1		NM_177938	
RBM15B	29890	mdanderson.org	37	3	51429280	51429280	+	Silent	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr3:51429280G>T	ENST00000323686.4	+	1	550	c.450G>T	c.(448-450)ctG>ctT	p.L150L		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	150	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCCCCGCGCTGCCCGCCGAGC	0.711																																					p.L150L													.	.			0			c.G450T												32.0	39.0	36.0					3																	51429280		2036	3982	6018	SO:0001819	synonymous_variant	29890	exon1			CGCGCTGCCCGCC	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.450G>T	3.37:g.51429280G>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_013286	36	0.00	0	A4QPG7|Q6QE19|Q9BV96	Silent	SNP	ENST00000323686.4	37	CCDS33764.1																																																																																					0.711	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346489.1		NM_013286	
COPG1	22820	mdanderson.org	37	3	128979230	128979230	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr3:128979230G>A	ENST00000314797.6	+	11	1030	c.926G>A	c.(925-927)cGt>cAt	p.R309H		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	309					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										GCTGCTGTTCGTACCCTCAAT	0.552																																					p.R309H													.	.			0			c.G926A												120.0	110.0	114.0					3																	128979230		2203	4300	6503	SO:0001583	missense	22820	exon11			CTGTTCGTACCCT	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.926G>A	3.37:g.128979230G>A	ENSP00000325002:p.Arg309His		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_016128	213	0.00	0	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	37	CCDS33851.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761868	0.49468	.	.	ENSG00000181789	ENST00000314797	T	0.28895	1.59	6.0	6.0	0.97389	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.59018	0.2163	M	0.79614	2.46	0.53688	D	0.999979	D	0.76494	0.999	D	0.78314	0.991	T	0.59091	-0.7519	10	0.62326	D	0.03	-17.6909	18.0533	0.89356	0.0:0.0:1.0:0.0	.	309	Q9Y678	COPG_HUMAN	H	309	ENSP00000325002:R309H	ENSP00000325002:R309H	R	+	2	0	COPG	130461920	1.000000	0.71417	0.099000	0.21106	0.002000	0.02628	9.587000	0.98229	2.868000	0.98415	0.555000	0.69702	CGT			0.552	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355456.1		NM_016128	
TBCCD1	55171	mdanderson.org	37	3	186272317	186272317	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr3:186272317G>T	ENST00000424280.1	-	6	1749	c.1270C>A	c.(1270-1272)Cca>Aca	p.P424T	TBCCD1_ENST00000479590.1_5'Flank|TBCCD1_ENST00000338733.5_Missense_Mutation_p.P424T|TBCCD1_ENST00000446782.1_Missense_Mutation_p.P328T	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	424	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		TCTAGCATTGGGTAATGTGTA	0.468																																					p.P424T													.	.			0			c.C1270A												101.0	95.0	97.0					3																	186272317		2203	4300	6503	SO:0001583	missense	55171	exon6			GCATTGGGTAATG	BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.1270C>A	3.37:g.186272317G>T	ENSP00000411253:p.Pro424Thr		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_001134415	78	0.00	0	B3KW69|D3DNU6|G5E9J4	Missense_Mutation	SNP	ENST00000424280.1	37	CCDS3276.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082105	0.76528	.	.	ENSG00000113838	ENST00000424280;ENST00000338733;ENST00000446782	D;D;D	0.87491	-2.26;-2.26;-2.26	5.81	5.81	0.92471	Tubulin binding cofactor C (1);C-CAP/cofactor C-like domain (1);	0.108809	0.64402	D	0.000004	D	0.92077	0.7489	M	0.79693	2.465	0.53688	D	0.999977	D;D	0.64830	0.994;0.99	P;P	0.62649	0.905;0.898	D	0.91828	0.5473	10	0.52906	T	0.07	-12.264	10.9854	0.47518	0.084:0.0:0.916:0.0	.	328;424	G5E9J4;Q9NVR7	.;TBCC1_HUMAN	T	424;424;328	ENSP00000411253:P424T;ENSP00000341652:P424T;ENSP00000397091:P328T	ENSP00000341652:P424T	P	-	1	0	TBCCD1	187755011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.686000	0.84128	2.763000	0.94921	0.552000	0.68991	CCA			0.468	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344774.1		NM_018138	
MFSD10	10227	mdanderson.org	37	4	2932979	2932979	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr4:2932979G>T	ENST00000329687.4	-	10	1671	c.1137C>A	c.(1135-1137)tgC>tgA	p.C379*	MFSD10_ENST00000514800.1_Nonsense_Mutation_p.C379*|MFSD10_ENST00000508221.1_Intron|MFSD10_ENST00000355443.4_Nonsense_Mutation_p.C379*|MFSD10_ENST00000507555.1_Missense_Mutation_p.A343D	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	379					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CGGAGGACAGGCAGGGCACCA	0.687																																					p.C379X													.	.			0			c.C1137A												26.0	31.0	30.0					4																	2932979		2160	4271	6431	SO:0001587	stop_gained	10227	exon11			GGACAGGCAGGGC	L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.1137C>A	4.37:g.2932979G>T	ENSP00000332646:p.Cys379*		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001146069	109	0.00	0	Q07706	Nonsense_Mutation	SNP	ENST00000329687.4	37	CCDS3365.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.9|29.9	5.048024|5.048024	0.93740|0.93740	.|.	.|.	ENSG00000109736|ENSG00000109736	ENST00000507555|ENST00000514800;ENST00000355443;ENST00000329687	T|.	0.76839|.	-1.05|.	3.65|3.65	1.8|1.8	0.24995|0.24995	.|.	.|0.100469	.|0.64402	.|D	.|0.000001	T|.	0.09158|.	0.0226|.	.|.	.|.	.|.	0.22975|0.22975	N|N	0.998483|0.998483	B|.	0.21905|.	0.062|.	B|.	0.19391|.	0.025|.	T|.	0.33727|.	-0.9857|.	8|.	0.87932|0.02654	D|T	0|1	-0.3106|-0.3106	3.7371|3.7371	0.08515|0.08515	0.2749:0.0:0.5376:0.1874|0.2749:0.0:0.5376:0.1874	.|.	343|.	D6RA47|.	.|.	D|X	343|379	ENSP00000423402:A343D|.	ENSP00000423402:A343D|ENSP00000332646:C379X	A|C	-|-	2|3	0|2	MFSD10|MFSD10	2902777|2902777	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.926000|0.926000	0.56050|0.56050	0.957000|0.957000	0.29215|0.29215	0.288000|0.288000	0.22398|0.22398	0.561000|0.561000	0.74099|0.74099	GCC|TGC			0.687	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358072.2		NM_001120	
BTC	685	mdanderson.org	37	4	75719476	75719476	+	Silent	SNP	G	G	T	rs544207492		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr4:75719476G>T	ENST00000395743.3	-	1	420	c.60C>A	c.(58-60)gcC>gcA	p.A20A		NM_001729.2	NP_001720.1	P35070	BTC_HUMAN	betacellulin	20					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitosis (GO:0045840)|positive regulation of urine volume (GO:0035810)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(101;0.219)			ACTTACCCAGGGCAAGGGCCA	0.692																																					p.A20A													.	.			0			c.C60A												4.0	5.0	4.0					4																	75719476		1846	3536	5382	SO:0001819	synonymous_variant	685	exon1			ACCCAGGGCAAGG	S55606	CCDS3566.1	4q13.3	2012-09-20			ENSG00000174808	ENSG00000174808			1121	protein-coding gene	gene with protein product		600345				8439318, 11522793	Standard	NM_001729		Approved		uc003hig.2	P35070	OTTHUMG00000130107	ENST00000395743.3:c.60C>A	4.37:g.75719476G>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_001729	0		0	Q96F48	Silent	SNP	ENST00000395743.3	37	CCDS3566.1																																																																																					0.692	BTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252413.1			
FAM198B	51313	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	159092431	159092431	+	Missense_Mutation	SNP	T	T	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr4:159092431T>A	ENST00000296530.8	-	2	718	c.97A>T	c.(97-99)Agg>Tgg	p.R33W	FAM198B_ENST00000592057.1_Missense_Mutation_p.R33W|FAM198B_ENST00000393807.5_Missense_Mutation_p.R33W|RP11-597D13.9_ENST00000514381.1_RNA|RP11-597D13.9_ENST00000503611.1_RNA|FAM198B_ENST00000589306.1_Intron|RP11-597D13.9_ENST00000509463.1_RNA|RP11-597D13.9_ENST00000505532.1_RNA|FAM198B_ENST00000585682.1_Missense_Mutation_p.R33W	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	33						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						CTCCGGGTCCTTGGACGCCGG	0.627																																					p.R33W													.	.			0			c.A97T												40.0	42.0	41.0					4																	159092431		2200	4295	6495	SO:0001583	missense	51313	exon2			GGGTCCTTGGACG		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.97A>T	4.37:g.159092431T>A	ENSP00000296530:p.Arg33Trp		Somatic	109	0	0		WXS	Illumina HiSeq	.	83	0.08	7	NM_016613	21	0.00	0	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	ENST00000296530.8	37	CCDS3798.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.739680	0.69304	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807;ENST00000417442	T;T	0.34667	1.36;1.35	5.21	1.15	0.20763	.	0.201361	0.44688	D	0.000421	T	0.52901	0.1763	L	0.60455	1.87	0.36456	D	0.866377	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.977;0.977	T	0.60875	-0.7176	10	0.87932	D	0	-0.6057	12.7646	0.57385	0.0:0.0:0.394:0.606	.	33;33;33	Q6UWH4-3;Q6UWH4-2;Q6UWH4	.;.;F198B_HUMAN	W	33	ENSP00000296530:R33W;ENSP00000377396:R33W	ENSP00000296530:R33W	R	-	1	2	FAM198B	159311881	0.543000	0.26434	0.390000	0.26220	0.988000	0.76386	0.631000	0.24568	0.060000	0.16281	0.533000	0.62120	AGG			0.627	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365230.1		NM_001031700, NM_016613	
ADCY2	108	broad.mit.edu;mdanderson.org	37	5	7396571	7396571	+	Silent	SNP	C	C	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr5:7396571C>A	ENST00000338316.4	+	1	251	c.162C>A	c.(160-162)gtC>gtA	p.V54V		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	54					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TGCTCATCGTCATGGGCTCCT	0.706																																					p.V54V													.	ADCY2	337		0			c.C162A												52.0	44.0	47.0					5																	7396571		2203	4296	6499	SO:0001819	synonymous_variant	108	exon1			CATCGTCATGGGC	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.162C>A	5.37:g.7396571C>A			Somatic	75	0.0266666667	2		WXS	Illumina HiSeq	Phase_I	59	0.19	11	NM_020546	0		0	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																					0.706	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206930.2		NM_020546	
DMXL1	1657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	118469192	118469192	+	Missense_Mutation	SNP	T	T	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr5:118469192T>A	ENST00000311085.8	+	12	1653	c.1573T>A	c.(1573-1575)Tcc>Acc	p.S525T	DMXL1_ENST00000539542.1_Missense_Mutation_p.S525T	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	525										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATTCTAGGTGTCCTTTGTTTC	0.368																																					p.S525T													.	.			0			c.T1573A												100.0	105.0	103.0					5																	118469192		2201	4298	6499	SO:0001583	missense	1657	exon12			TAGGTGTCCTTTG	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1573T>A	5.37:g.118469192T>A	ENSP00000309690:p.Ser525Thr		Somatic	85	0	0		WXS	Illumina HiSeq	.	81	0.19	15	NM_005509	22	0.32	7		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.069919	0.76301	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.60299	0.2;0.2;0.2	5.57	5.57	0.84162	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75627	0.3875	M	0.78344	2.41	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.66979	0.936;0.948	T	0.79017	-0.1975	10	0.66056	D	0.02	-6.7971	15.7298	0.77792	0.0:0.0:0.0:1.0	.	525;525	F5H269;Q9Y485	.;DMXL1_HUMAN	T	525	ENSP00000427692:S525T;ENSP00000309690:S525T;ENSP00000439479:S525T	ENSP00000309690:S525T	S	+	1	0	DMXL1	118497091	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.698000	0.84413	2.135000	0.66039	0.482000	0.46254	TCC			0.368	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250862.1		NM_005509	
SYCP2L	221711	mdanderson.org	37	6	10928665	10928665	+	Silent	SNP	T	T	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr6:10928665T>C	ENST00000283141.6	+	18	1766	c.1470T>C	c.(1468-1470)ccT>ccC	p.P490P	SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	490						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			tcggggtccctgacttcccgc	0.478																																					p.P490P													.	.			0			c.T1470C												81.0	86.0	84.0					6																	10928665		1888	4100	5988	SO:0001819	synonymous_variant	221711	exon18			GGTCCCTGACTTC	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1470T>C	6.37:g.10928665T>C			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001040274	23	0.00	0	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Silent	SNP	ENST00000283141.6	37	CCDS43423.1																																																																																					0.478	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039845.3		NM_194299	
NFKBIL1	4795	mdanderson.org	37	6	31525456	31525456	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr6:31525456G>T	ENST00000376148.4	+	3	500	c.386G>T	c.(385-387)gGa>gTa	p.G129V	NFKBIL1_ENST00000376145.4_Missense_Mutation_p.G129V	NM_005007.3	NP_004998.3	Q9UBC1	IKBL1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1	129					cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of transcription factor (GO:0042994)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)	cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7						TCCGCCATGGGAATAAAGAAT	0.572																																					p.G129V													.	.			0			c.G386T												43.0	46.0	45.0					6																	31525456		2203	4300	6503	SO:0001583	missense	4795	exon3			CCATGGGAATAAA	X77909	CCDS4700.1, CCDS47399.1, CCDS47400.1	6p21.3	2010-02-17			ENSG00000204498	ENSG00000204498			7800	protein-coding gene	gene with protein product		601022		NFKBIL		8081366	Standard	NM_005007		Approved	IKBL	uc003nub.3	Q9UBC1	OTTHUMG00000031038	ENST00000376148.4:c.386G>T	6.37:g.31525456G>T	ENSP00000365318:p.Gly129Val		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	70	0.06	4	NM_001144961	79	0.00	0	A6NL91|B4DUW1|Q14625|Q5HYU4|Q5RJ72|Q5ST96|Q5STV4|Q5STV5|Q9UBX4	Missense_Mutation	SNP	ENST00000376148.4	37	CCDS4700.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.314166	0.60414	.	.	ENSG00000204498	ENST00000376146;ENST00000542852;ENST00000376148;ENST00000376145	T;T;T	0.68181	-0.31;-0.31;-0.31	6.08	5.04	0.67666	Ankyrin repeat-containing domain (3);	0.310616	0.35349	N	0.003267	T	0.61527	0.2354	N	0.22421	0.69	0.54753	D	0.999982	D;D;D	0.89917	1.0;0.994;0.994	D;P;P	0.87578	0.998;0.854;0.854	T	0.62369	-0.6869	10	0.41790	T	0.15	-16.7838	11.1321	0.48354	0.095:0.0:0.905:0.0	.	106;129;129	Q5STV6;Q5STV4;Q9UBC1	.;.;IKBL1_HUMAN	V	106;106;129;129	ENSP00000365316:G106V;ENSP00000365318:G129V;ENSP00000365315:G129V	ENSP00000365315:G129V	G	+	2	0	NFKBIL1	31633435	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.663000	0.46774	2.894000	0.99253	0.591000	0.81541	GGA			0.572	NFKBIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076036.3		NM_005007	
GRM4	2914	broad.mit.edu	37	6	34101114	34101114	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr6:34101114G>T	ENST00000538487.2	-	2	603	c.160C>A	c.(160-162)Ctg>Atg	p.L54M	GRM4_ENST00000374177.3_Intron|GRM4_ENST00000374181.4_Missense_Mutation_p.L54M	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	54					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						ACCGGGAACAGGCCTCCCAGT	0.607																																					p.L54M													.	GRM4	317		0			c.C160A												49.0	43.0	45.0					6																	34101114		2203	4300	6503	SO:0001583	missense	2914	exon2			GGAACAGGCCTCC	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.160C>A	6.37:g.34101114G>T	ENSP00000440556:p.Leu54Met		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	64	0.05	3	NM_001256811	0		0	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112380	0.77210	.	.	ENSG00000124493	ENST00000374181;ENST00000538487	T;T	0.81330	-1.48;-1.48	4.0	4.0	0.46444	.	0.096640	0.42964	D	0.000624	D	0.87981	0.6315	M	0.81942	2.565	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.80764	0.962;0.994	D	0.89608	0.3839	10	0.66056	D	0.02	.	16.2289	0.82318	0.0:0.0:1.0:0.0	.	54;54	B7ZLU9;Q14833	.;GRM4_HUMAN	M	54	ENSP00000363296:L54M;ENSP00000440556:L54M	ENSP00000363296:L54M	L	-	1	2	GRM4	34209092	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.504000	0.73704	2.231000	0.72958	0.467000	0.42956	CTG			0.607	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040213.2			
PHKG1	5260	mdanderson.org	37	7	56148891	56148891	+	Silent	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr7:56148891G>T	ENST00000297373.2	-	10	1214	c.1020C>A	c.(1018-1020)ctC>ctA	p.L340L	PHKG1_ENST00000489604.1_5'Flank|PHKG1_ENST00000452681.2_Silent_p.L372L|PHKG1_ENST00000537360.1_Silent_p.L286L	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	340					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCAGAGGCCGGAGGGCATAGG	0.617																																					p.L372L	Melanoma(184;580 2064 5329 24177 35303)												.	.			0			c.C1116A												60.0	57.0	58.0					7																	56148891		2203	4300	6503	SO:0001819	synonymous_variant	5260	exon11			AGGCCGGAGGGCA	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.1020C>A	7.37:g.56148891G>T			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001258459	1	0.00	0	B7Z1D0|F5H2S1|Q75LP5	Silent	SNP	ENST00000297373.2	37	CCDS5525.1																																																																																					0.617	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251587.1		NM_006213	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			Somatic	112	0.0089285714	1		WXS	Illumina HiSeq	Phase_I	100	0.03	3	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
HIP1	3092	mdanderson.org	37	7	75368221	75368221	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr7:75368221G>T	ENST00000336926.6	-	1	44	c.18C>A	c.(16-18)agC>agA	p.S6R	HIP1_ENST00000434438.2_Missense_Mutation_p.S6R|HIP1_ENST00000479835.1_5'UTR	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	6					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GCTTCATGGAGCTGGCCATCC	0.751			T	PDGFRB	CMML																																p.S6R				Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	.			0			c.C18A												5.0	5.0	5.0					7																	75368221		2025	4019	6044	SO:0001583	missense	3092	exon1			CATGGAGCTGGCC	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.18C>A	7.37:g.75368221G>T	ENSP00000336747:p.Ser6Arg		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	45	0.09	4	NM_001243198	2	0.00	0	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529854	0.85706	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.15139	2.69;2.45	4.96	4.96	0.65561	.	0.086938	0.41938	U	0.000799	T	0.28962	0.0719	L	0.29908	0.895	0.44055	D	0.996792	D	0.65815	0.995	D	0.70487	0.969	T	0.02424	-1.1161	10	0.66056	D	0.02	-10.2405	13.6835	0.62502	0.0:0.0:1.0:0.0	.	6	O00291	HIP1_HUMAN	R	6	ENSP00000336747:S6R;ENSP00000410300:S6R	ENSP00000336747:S6R	S	-	3	2	HIP1	75206157	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	1.971000	0.40530	2.277000	0.76020	0.460000	0.39030	AGC			0.751	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342863.2		NM_005338	
MTHFD2P5	442707	bcgsc.ca	37	7	82219828	82219828	+	IGR	SNP	T	T	C			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr7:82219828T>C								CACNA2D1 (146714 upstream) : PCLO (163500 downstream)																							TTGAAGCTGGTTTCATAATCG	0.408																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AGCTGGTTTCATA																													7.37:g.82219828T>C			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_1	59	0.10	6	.	0		0		RNA	SNP		37																																																																																					0	0.408										
ZAN	7455	broad.mit.edu	37	7	100336500	100336502	+	RNA	DEL	CCC	CCC	-	rs4729608|rs34669691|rs370133868	byFrequency	TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	CCC	CCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr7:100336500_100336502delCCC	ENST00000348028.3	+	0	931				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ttcttcttctccctctccctctc	0.586																																					.													.	ZAN	658		0			.																																											7455	.			TCTTCTCCCTCTC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100336500_100336502delCCC			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	8	0.63	5	.	0		0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	DEL	ENST00000348028.3	37																																																																																						0.586	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347214.1		NM_003386	
AP1S1	1174	bcgsc.ca;mdanderson.org	37	7	100799986	100799986	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr7:100799986G>A	ENST00000337619.5	+	2	233	c.115G>A	c.(115-117)Gtc>Atc	p.V39I	MIR4653_ENST00000585107.1_RNA	NM_001283.3	NP_001274.1	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1 subunit	39					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor-mediated endocytosis (GO:0006898)|regulation of defense response to virus by virus (GO:0050690)|response to virus (GO:0009615)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)	8	Lung NSC(181;0.168)|all_lung(186;0.215)					CATGCAGGTTGTCCTGGCTCG	0.537																																					p.V39I													.	AP1S1	22		0			c.G115A												46.0	50.0	49.0					7																	100799986		2045	4187	6232	SO:0001583	missense	1174	exon2			CAGGTTGTCCTGG	AB015319	CCDS47669.1	7q22.1	2014-02-04			ENSG00000106367	ENSG00000106367			559	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, small 1 (19kD)"", ""clathrin coat assembly protein AP19"", ""sigma1A subunit of AP-1 clathrin adaptor complex"", ""AP-1 complex subunit sigma-1A"", ""sigma1A-adaptin"", ""golgi adaptor HA1/AP1 adaptin sigma-1A subunit"", ""clathrin assembly protein complex 1 sigma-1A small chain"", ""HA1 19 kDa subunit"""	603531	"""erythrokeratodermia variabilis 3 (Kamouraska type)"""	CLAPS1, EKV3		9653655, 9733768, 19057675	Standard	NM_001283		Approved	AP19, SIGMA1A, WUGSC:H_DJ0747G18.2	uc003uxv.4	P61966	OTTHUMG00000157103	ENST00000337619.5:c.115G>A	7.37:g.100799986G>A	ENSP00000336666:p.Val39Ile		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_1	64	0.19	12	NM_001283	124	0.15	18	B2R5D8|P82267|Q00382|Q53YA7|Q9BTN4|Q9UDW9	Missense_Mutation	SNP	ENST00000337619.5	37	CCDS47669.1	.	.	.	.	.	.	.	.	.	.	G	9.812	1.183518	0.21870	.	.	ENSG00000106367	ENST00000337619	.	.	.	5.84	4.95	0.65309	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.64402	D	0.000001	T	0.39036	0.1063	N	0.11651	0.15	0.43678	D	0.996117	B	0.02656	0.0	B	0.17979	0.02	T	0.15549	-1.0433	9	0.23302	T	0.38	-6.3215	14.7995	0.69903	0.0:0.145:0.855:0.0	.	39	P61966	AP1S1_HUMAN	I	39	.	ENSP00000336666:V39I	V	+	1	0	AP1S1	100586706	0.998000	0.40836	0.111000	0.21465	0.964000	0.63967	2.508000	0.45450	1.454000	0.47793	0.561000	0.74099	GTC			0.537	AP1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347439.1		NM_001283	
ARFGEF1	10565	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68128855	68128855	+	Silent	SNP	T	T	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr8:68128855T>A	ENST00000262215.3	-	33	5045	c.4656A>T	c.(4654-4656)ccA>ccT	p.P1552P	ARFGEF1_ENST00000518230.1_Silent_p.P390P|ARFGEF1_ENST00000520381.1_Silent_p.P1006P	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1552					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GAGATGGAGGTGGGGGGGCAG	0.418																																					p.P1552P													.	ARFGEF1	196		0			c.A4656T												57.0	60.0	59.0					8																	68128855		2203	4300	6503	SO:0001819	synonymous_variant	10565	exon33			TGGAGGTGGGGGG	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.4656A>T	8.37:g.68128855T>A			Somatic	211	0.0142180095	3		WXS	Illumina HiSeq	Phase_I	243	0.12	28	NM_006421	333	0.23	76	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	37	CCDS6199.1																																																																																					0.418	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379441.4		NM_006421	
KIAA0368	23392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	114132781	114132781	+	Silent	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr9:114132781G>A	ENST00000338205.5	-	44	5127	c.4908C>T	c.(4906-4908)atC>atT	p.I1636I	KIAA0368_ENST00000465499.1_5'UTR|KIAA0368_ENST00000374378.3_Silent_p.I100I|KIAA0368_ENST00000259335.4_Silent_p.I1814I			Q5VYK3	ECM29_HUMAN	KIAA0368	1642					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TGGCCTTCAAGATATCAGCTG	0.403																																					p.I1814I													.	.			0			c.C5442T												69.0	66.0	67.0					9																	114132781		1906	4118	6024	SO:0001819	synonymous_variant	23392	exon46			CTTCAAGATATCA	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.4908C>T	9.37:g.114132781G>A			Somatic	88	0	0		WXS	Illumina HiSeq	.	112	0.11	12	NM_001080398	688	0.26	181	O15074|Q8WU82	Silent	SNP	ENST00000338205.5	37																																																																																						0.403	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000053637.2		NM_014686	
ENG	2022	mdanderson.org	37	9	130588924	130588924	+	Missense_Mutation	SNP	G	G	A	rs199840979	byFrequency	TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chr9:130588924G>A	ENST00000373203.4	-	4	788	c.388C>T	c.(388-390)Ccc>Tcc	p.P130S	ENG_ENST00000480266.1_5'Flank|ENG_ENST00000344849.3_Missense_Mutation_p.P130S	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	130	Required for interaction with EGL.			SSLVTFQEP -> FQPGHLPRA (in Ref. 5). {ECO:0000305}.	artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						ACCCCCGGGGGCTCTTGGAAG	0.612									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																												p.P130S													.	.			0			c.C388T							G	SER/PRO,SER/PRO	0,4406		0,0,2203	53.0	53.0	53.0		388,388	-6.9	0.0	9		53	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ENG	NM_000118.2,NM_001114753.1	74,74	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	130/626,130/659	130588924	1,13005	2203	4300	6503	SO:0001583	missense	2022	exon4	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	CCGGGGGCTCTTG	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.388C>T	9.37:g.130588924G>A	ENSP00000362299:p.Pro130Ser		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	39	0.10	4	NM_000118	167	0.00	0	Q14248|Q14926|Q5T9C0	Missense_Mutation	SNP	ENST00000373203.4	37	CCDS48029.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.258229	0.23051	0.0	1.16E-4	ENSG00000106991	ENST00000373203;ENST00000344849;ENST00000545345	T;T	0.40225	1.04;1.63	5.22	-6.95	0.01628	.	2.380880	0.01435	N	0.014878	T	0.21022	0.0506	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.26318	0.146;0.146	B;B	0.22152	0.038;0.038	T	0.09907	-1.0653	10	0.13108	T	0.6	-9.6829	2.7488	0.05274	0.4664:0.1996:0.2333:0.1006	.	130;130	Q5T9B9;P17813	.;EGLN_HUMAN	S	130	ENSP00000362299:P130S;ENSP00000341917:P130S	ENSP00000341917:P130S	P	-	1	0	ENG	129628745	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.682000	0.01935	-0.998000	0.03446	-0.258000	0.10820	CCC	0.002		0.612	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054313.1			
MT-ND1	4535	hgsc.bcm.edu	37	M	1282	1282	+	5'Flank	SNP	G	G	A			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chrM:1282G>A	ENST00000361390.2	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCAGCAAACCCTGATGAAGGC	0.488																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			AACCCTGATGAAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1282G>A	Exception_encountered		Somatic	14	0	0		WXS	Illumina HiSeq	.	20	0.65	13	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.488	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
CYBB	1536	mdanderson.org	37	X	37665737	37665737	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chrX:37665737C>T	ENST00000378588.4	+	11	1479	c.1412C>T	c.(1411-1413)gCc>gTc	p.A471V	TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000536160.1_Missense_Mutation_p.A204V|CYBB_ENST00000545017.1_Missense_Mutation_p.A439V	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	471					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	AGGAACAATGCCGGCTTCCTC	0.527																																					p.A471V													.	.			0			c.C1412T												116.0	89.0	98.0					X																	37665737		2202	4300	6502	SO:0001583	missense	1536	exon11			ACAATGCCGGCTT	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.1412C>T	X.37:g.37665737C>T	ENSP00000367851:p.Ala471Val		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_000397	690	0.00	0	A8K138|Q2PP16	Missense_Mutation	SNP	ENST00000378588.4	37	CCDS14242.1	.	.	.	.	.	.	.	.	.	.	C	5.680	0.309999	0.10733	.	.	ENSG00000165168	ENST00000378588;ENST00000545017;ENST00000536160	D;D;D	0.95690	-3.75;-3.78;-3.28	5.61	5.61	0.85477	Ferric reductase, NAD binding (1);	0.350128	0.33515	N	0.004840	D	0.89022	0.6597	N	0.11560	0.145	0.33562	D	0.597505	B;B	0.14438	0.002;0.01	B;B	0.14023	0.002;0.01	D	0.87628	0.2514	10	0.26408	T	0.33	.	13.5387	0.61662	0.1557:0.8443:0.0:0.0	.	439;471	F5GWD2;P04839	.;CY24B_HUMAN	V	471;439;204	ENSP00000367851:A471V;ENSP00000441896:A439V;ENSP00000441958:A204V	ENSP00000367851:A471V	A	+	2	0	CYBB	37550681	0.980000	0.34600	0.627000	0.29227	0.077000	0.17291	2.401000	0.44513	2.332000	0.79248	0.544000	0.68410	GCC			0.527	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080881.1			
PORCN	64840	broad.mit.edu	37	X	48370301	48370301	+	Silent	SNP	C	C	T	rs142038251		TCGA-XY-A89B-01A-11D-A435-10	TCGA-XY-A89B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33cb241d-2efe-4922-af5a-389ea190a083	f478c02b-426c-4d7c-824f-ef1b8d222670	g.chrX:48370301C>T	ENST00000326194.6	+	3	394	c.351C>T	c.(349-351)acC>acT	p.T117T	PORCN_ENST00000359882.4_Silent_p.T117T|PORCN_ENST00000537758.1_Silent_p.T117T|PORCN_ENST00000355961.4_Silent_p.T117T|PORCN_ENST00000367574.4_Silent_p.T46T|PORCN_ENST00000361988.3_Silent_p.T117T|PORCN_ENST00000355092.3_Silent_p.T117T	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	117					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGGTAGACACCGTGACATGGC	0.607											OREG0019764	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T117T													.	PORCN	61		0			c.C351T							C	,,,	0,3835		0,0,1632,571	163.0	110.0	128.0		351,351,351,351	-3.4	1.0	X	dbSNP_134	128	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PORCN	NM_022825.2,NM_203473.1,NM_203474.1,NM_203475.1	,,,	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	,,,	117/451,117/457,117/456,117/462	48370301	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	64840	exon3			AGACACCGTGACA	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.351C>T	X.37:g.48370301C>T			Somatic	301	0	0	954	WXS	Illumina HiSeq	Phase_I	295	0.02	5	NM_203475	30	0.00	0	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Silent	SNP	ENST00000326194.6	37	CCDS14299.1																																																																																					0.607	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000356990.1		NM_022825	
