#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PERM1	84808	broad.mit.edu	37	1	915369	915369	+	Silent	SNP	T	T	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:915369T>G	ENST00000341290.2	-	3	734	c.699A>C	c.(697-699)acA>acC	p.T233T	C1orf170_ENST00000433179.2_Silent_p.T253T			Q5SV97	PERM1_HUMAN		347					regulation of transcription, DNA-templated (GO:0006355)|response to muscle activity (GO:0014850)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CAGAGGCAGGTGTAGACACAG	0.587																																					.													.	C1orf170	5		0			.																																									SO:0001819	synonymous_variant	0	.			GGCAGGTGTAGAC																												ENST00000341290.2:c.699A>C	1.37:g.915369T>G			Somatic	99	0.2626262626	26		WXS	Illumina HiSeq	Phase_I	83	0.18	15	.	0		0	Q6ZVZ7|Q9BRF2|S5G239	Silent	SNP	ENST00000341290.2	37																																																																																						0.587	C1orf170-001	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000097943.2			
RERE	473	ucsc.edu;bcgsc.ca	37	1	8424850	8424850	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:8424850T>C	ENST00000337907.3	-	15	2130	c.1496A>G	c.(1495-1497)gAg>gGg	p.E499G	RERE_ENST00000476556.1_5'UTR|RERE_ENST00000377464.1_Missense_Mutation_p.E231G|RERE_ENST00000400907.2_Missense_Mutation_p.E499G|RERE_ENST00000460659.1_5'Flank|RERE_ENST00000400908.2_Missense_Mutation_p.E499G	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	499					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CAGCTCCTGCTCACTGTCCTC	0.617																																					p.E499G													.	RERE	129		0			c.A1496G												104.0	74.0	84.0					1																	8424850		2203	4300	6503	SO:0001583	missense	473	exon15			TCCTGCTCACTGT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1496A>G	1.37:g.8424850T>C	ENSP00000338629:p.Glu499Gly		Somatic	34	0	0		WXS	Illumina HiSeq		32	0.13	4	NM_012102	99	0.00	0	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	T	31	5.070425	0.93950	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000400907;ENST00000400908	T;T;T	0.47528	0.85;0.84;0.85	5.78	5.78	0.91487	.	.	.	.	.	T	0.56934	0.2019	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	T	0.56025	-0.8047	9	0.39692	T	0.17	-26.3576	15.2892	0.73854	0.0:0.0:0.0:1.0	.	231;499	B1AKN3;Q9P2R6	.;RERE_HUMAN	G	499;231;499;499	ENSP00000338629:E499G;ENSP00000366684:E231G;ENSP00000383700:E499G	ENSP00000338629:E499G	E	-	2	0	RERE	8347437	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.698000	0.84413	2.194000	0.70268	0.533000	0.62120	GAG			0.617	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004916.1			
PHACTR4	65979	broad.mit.edu	37	1	28793239	28793239	+	Silent	SNP	T	T	C	rs34628351		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:28793239T>C	ENST00000373839.3	+	6	1044	c.783T>C	c.(781-783)ccT>ccC	p.P261P	PHACTR4_ENST00000373836.3_Silent_p.P271P|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	261	Pro-rich.				actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCTATCCCTCCCCCTAAAC	0.517																																					p.P271P													.	PHACTR4	64		0			c.T813C												82.0	84.0	84.0					1																	28793239		1929	4139	6068	SO:0001819	synonymous_variant	65979	exon5			TATCCCTCCCCCT	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.783T>C	1.37:g.28793239T>C			Somatic	128	0.0078125	1		WXS	Illumina HiSeq	Phase_I	122	0.04	5	NM_023923	57	0.00	0	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Silent	SNP	ENST00000373839.3	37	CCDS41293.1																																																																																					0.517	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000009868.4		NM_023923	
FOXD2	2306	hgsc.bcm.edu;broad.mit.edu	37	1	47905268	47905268	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:47905268delC	ENST00000334793.5	+	1	3580	c.1461delC	c.(1459-1461)gtcfs	p.V487fs		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	487					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		CCAGCAAAGTCGCCGGCCTTA	0.682																																					p.V487fs													.	.			0			c.1460delT												4.0	5.0	5.0					1																	47905268		2113	4180	6293	SO:0001589	frameshift_variant	2306	exon1			CAAAGTCGCCGGC	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.1461delC	1.37:g.47905268delC	ENSP00000335493:p.Val487fs		Somatic	90	0	0		WXS	Illumina HiSeq	.	144	0.09	13	NM_004474	1	0.00	0	Q5SVZ3	Frame_Shift_Del	DEL	ENST00000334793.5	37	CCDS30708.1																																																																																					0.682	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021831.1		NM_004474	
FOXD2	2306	hgsc.bcm.edu;broad.mit.edu	37	1	47905271	47905272	+	Frame_Shift_Ins	INS	-	-	A	rs561751813		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:47905271_47905272insA	ENST00000334793.5	+	1	3583_3584	c.1464_1465insA	c.(1465-1467)ggcfs	p.G489fs		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	489					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		GCAAAGTCGCCGGCCTTAGTGG	0.678																																					p.A488fs													.	.			0			c.1464_1465insA																																									SO:0001589	frameshift_variant	2306	exon1			AGTCGCCGGCCTT	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	Exception_encountered	1.37:g.47905271_47905272insA	ENSP00000335493:p.Gly489fs		Somatic	98	0	0		WXS	Illumina HiSeq	.	155	0.06	10	NM_004474	0		0	Q5SVZ3	Frame_Shift_Ins	INS	ENST00000334793.5	37	CCDS30708.1																																																																																					0.678	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021831.1		NM_004474	
FOXD2	2306	hgsc.bcm.edu;broad.mit.edu	37	1	47905272	47905273	+	In_Frame_Ins	INS	-	-	CAAAGA	rs561751813		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:47905272_47905273insCAAAGA	ENST00000334793.5	+	1	3584_3585	c.1465_1466insCAAAGA	c.(1465-1467)ggc>gCAAAGAgc	p.489_489G>AKS		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	489					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		CAAAGTCGCCGGCCTTAGTGGC	0.683																																					p.G489delinsAKS													.	.			0			c.1465_1466insCAAAGA																																									SO:0001652	inframe_insertion	2306	exon1			GTCGCCGGCCTTA	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	Exception_encountered	1.37:g.47905272_47905273insCAAAGA	ENSP00000335493:p.Gly489delinsAlaLysSer		Somatic	99	0	0		WXS	Illumina HiSeq	.	158	0.06	10	NM_004474	0		0	Q5SVZ3	In_Frame_Ins	INS	ENST00000334793.5	37	CCDS30708.1																																																																																					0.683	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021831.1		NM_004474	
ZCCHC11	23318	broad.mit.edu	37	1	52991402	52991403	+	Frame_Shift_Ins	INS	-	-	T	rs180741095		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:52991402_52991403insT	ENST00000371544.3	-	2	812_813	c.550_551insA	c.(550-552)attfs	p.I184fs	ZCCHC11_ENST00000257177.4_Frame_Shift_Ins_p.I184fs|ZCCHC11_ENST00000371541.1_5'UTR|ZCCHC11_ENST00000355809.4_Frame_Shift_Ins_p.I184fs	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	184					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GGAGCTTGGAATTTTTTTTCCA	0.406																																					p.I184fs													.	ZCCHC11	151		0			c.551_552insA																																									SO:0001589	frameshift_variant	23318	exon2			CTTGGAATTTTTT	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.551dupA	1.37:g.52991410_52991410dupT	ENSP00000360599:p.Ile184fs		Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	526	0.00	0	NM_001009881	188	0.00	0	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Frame_Shift_Ins	INS	ENST00000371544.3	37	CCDS30716.1																																																																																					0.406	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000022462.1		XM_038288	
ATP1A1	476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	116940526	116940526	+	Missense_Mutation	SNP	G	G	A	rs200285355		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:116940526G>A	ENST00000295598.5	+	15	2242	c.1990G>A	c.(1990-1992)Gta>Ata	p.V664I	ATP1A1_ENST00000369496.4_Missense_Mutation_p.V633I|ATP1A1_ENST00000537345.1_Missense_Mutation_p.V664I	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	664					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	CAAGGCCTGCGTAGTACACGG	0.468																																					p.V664I													ATP1A1,NS,carcinoma,-2,1	ATP1A1	-2	1	0			c.G1990A												132.0	116.0	121.0					1																	116940526		2203	4300	6503	SO:0001583	missense	476	exon15			GCCTGCGTAGTAC	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1990G>A	1.37:g.116940526G>A	ENSP00000295598:p.Val664Ile		Somatic	48	0	0		WXS	Illumina HiSeq	.	51	0.18	9	NM_000701	1540	0.09	144	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	G	31	5.103243	0.94245	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.95980	-3.87;-3.87;-3.85	5.15	5.15	0.70609	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96457	0.8844	L	0.47016	1.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.986;0.992	D	0.96740	0.9546	10	0.66056	D	0.02	.	18.8196	0.92090	0.0:0.0:1.0:0.0	.	664;664	F5H3A1;P05023	.;AT1A1_HUMAN	I	664;664;633	ENSP00000295598:V664I;ENSP00000445306:V664I;ENSP00000358508:V633I	ENSP00000295598:V664I	V	+	1	0	ATP1A1	116742049	1.000000	0.71417	0.639000	0.29394	0.896000	0.52359	9.657000	0.98554	2.673000	0.90976	0.655000	0.94253	GTA	0.001		0.468	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000033481.5		NM_001160233	
CD1C	911	broad.mit.edu	37	1	158261009	158261009	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:158261009G>T	ENST00000368170.3	+	2	426	c.147G>T	c.(145-147)tgG>tgT	p.W49C		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	49					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					GCTCAGGATGGCTGGACGAGT	0.498																																					p.W49C													.	CD1C	100		0			c.G147T												103.0	90.0	94.0					1																	158261009		2203	4300	6503	SO:0001583	missense	911	exon2			AGGATGGCTGGAC	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.147G>T	1.37:g.158261009G>T	ENSP00000357152:p.Trp49Cys		Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	174	0.02	4	NM_001765	1	0.00	0	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	ENST00000368170.3	37	CCDS1175.1	.	.	.	.	.	.	.	.	.	.	-	12.95	2.092555	0.36952	.	.	ENSG00000158481	ENST00000368169;ENST00000368170	T	0.07800	3.16	3.32	2.4	0.29515	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.000000	0.33075	N	0.005309	T	0.14356	0.0347	M	0.89534	3.04	0.09310	N	1	D	0.61697	0.99	P	0.59825	0.864	T	0.03086	-1.1074	10	0.87932	D	0	.	6.5825	0.22602	0.1315:0.0:0.8685:0.0	.	49	P29017	CD1C_HUMAN	C	49	ENSP00000357152:W49C	ENSP00000357151:W49C	W	+	3	0	CD1C	156527633	0.992000	0.36948	0.019000	0.16419	0.346000	0.29079	3.642000	0.54367	0.988000	0.38734	-0.142000	0.14014	TGG			0.498	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046351.2		NM_001765	
ZBTB37	84614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	173839876	173839876	+	Silent	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:173839876G>A	ENST00000367701.5	+	2	704	c.513G>A	c.(511-513)aaG>aaA	p.K171K	ZBTB37_ENST00000367702.1_Silent_p.K171K|ZBTB37_ENST00000432989.1_Silent_p.K171K|GAS5_ENST00000364084.1_RNA|ZBTB37_ENST00000367704.1_Silent_p.K171K|ZBTB37_ENST00000427304.1_Silent_p.K171K			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						ATACCCCAAAGGGAAACCGGC	0.502																																					p.K171K													.	.			0			c.G513A												55.0	58.0	57.0					1																	173839876		2203	4300	6503	SO:0001819	synonymous_variant	84614	exon3			CCCAAAGGGAAAC	AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.513G>A	1.37:g.173839876G>A			Somatic	95	0	0		WXS	Illumina HiSeq	.	86	0.38	33	NM_032522	6	0.83	5	Q5TC80|Q96M87|Q9BQ88	Silent	SNP	ENST00000367701.5	37	CCDS44278.1																																																																																					0.502	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090729.2		NM_032522	
HMCN1	83872	hgsc.bcm.edu	37	1	186134395	186134395	+	Intron	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:186134395G>T	ENST00000271588.4	+	98	15548				HMCN1_ENST00000367492.2_Intron	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1						response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ctttcactaggtatttaatct	0.333																																					.													.	.			0			.																																									SO:0001627	intron_variant	100302192	.			CACTAGGTATTTA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15319+90G>T	1.37:g.186134395G>T			Somatic	46	0	0		WXS	Illumina HiSeq	.	38	0.34	13	.	0		0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	RNA	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																					0.333	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131848.1		NM_031935	
OBSCN	84033	broad.mit.edu	37	1	228553857	228553857	+	Silent	SNP	C	C	T	rs187833194	byFrequency	TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:228553857C>T	ENST00000422127.1	+	83	19190	c.19146C>T	c.(19144-19146)ggC>ggT	p.G6382G	OBSCN_ENST00000366707.4_Silent_p.G4016G|OBSCN_ENST00000570156.2_Silent_p.G7339G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6382	Ig-like 54.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCATTGAGGGCGACCCACAGC	0.657													C|||	3	0.000599042	0.0008	0.0029	5008	,	,		19577	0.0		0.0	False		,,,				2504	0.0				p.G7339G													.	OBSCN	2142		0			c.C22017T							C		4,4158		0,4,2077	71.0	77.0	75.0		19146	1.1	0.9	1		75	2,8404		0,2,4201	no	coding-synonymous	OBSCN	NM_001098623.1		0,6,6278	TT,TC,CC		0.0238,0.0961,0.0477		6382/7969	228553857	6,12562	2081	4203	6284	SO:0001819	synonymous_variant	84033	exon94			TGAGGGCGACCCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.19146C>T	1.37:g.228553857C>T			Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	214	0.02	5	NM_001271223	1	0.00	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	10.31	1.315935	0.23908	9.61E-4	2.38E-4	ENSG00000154358	ENST00000441106	.	.	.	5.41	1.14	0.20703	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5707	0.12208	0.168:0.2832:0.4605:0.0883	.	.	.	.	X	999	.	.	R	+	1	2	OBSCN	226620480	0.003000	0.15002	0.910000	0.35882	0.219000	0.24729	-0.225000	0.09151	0.249000	0.21456	-0.671000	0.03813	CGA			0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
GNPAT	8443	mdanderson.org	37	1	231401776	231401776	+	Silent	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:231401776G>T	ENST00000366647.4	+	7	958	c.789G>T	c.(787-789)gtG>gtT	p.V263V	GNPAT_ENST00000366646.3_Silent_p.V202V	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	263					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TGAATATTGTGATGGAGCCAT	0.353																																					p.V263V													.	.			0			c.G789T												85.0	83.0	83.0					1																	231401776		2203	4299	6502	SO:0001819	synonymous_variant	8443	exon7			TATTGTGATGGAG	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.789G>T	1.37:g.231401776G>T			Somatic	43	0.023255814	1		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_014236	51	0.00	0	B4DNM9|Q5TBH7|Q9BWC2	Silent	SNP	ENST00000366647.4	37	CCDS1592.1																																																																																					0.353	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000092871.1			
COX20	116228	hgsc.bcm.edu	37	1	245009836	245009836	+	IGR	SNP	A	A	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr1:245009836A>G	ENST00000411948.2	+	0	2631				HNRNPU-AS1_ENST00000475997.1_RNA|HNRNPU-AS1_ENST00000489705.1_RNA	NM_198076.4	NP_932342.1	Q5RI15	COX20_HUMAN	COX20 cytochrome C oxidase assembly factor							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											aaataaaaaTAGTCCAGGTTC	0.473																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	284702	.			AAAAATAGTCCAG	BC062419	CCDS31080.1	1q44	2013-05-24	2013-05-23	2012-02-24	ENSG00000203667	ENSG00000203667		"""Mitochondrial respiratory chain complex assembly factors"""	26970	protein-coding gene	gene with protein product		614698	"""family with sequence similarity 36, member A"", ""COX20 Cox2 chaperone homolog (S. cerevisiae)"""	FAM36A		22356826, 23125284	Standard	NM_198076		Approved	FLJ43269	uc001iar.3	Q5RI15	OTTHUMG00000040401		1.37:g.245009836A>G			Somatic	80	0	0		WXS	Illumina HiSeq	.	104	0.38	39	.	3	1.00	3	Q8WV86	RNA	SNP	ENST00000411948.2	37	CCDS31080.1																																																																																					0.473	COX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097174.1		NM_198076	
DCLRE1C	64421	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	14976452	14976454	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	ACA	ACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr10:14976452_14976454delACA	ENST00000378278.2	-	8	640_642	c.603_605delTGT	c.(601-606)gttgtg>gtg	p.201_202VV>V	DCLRE1C_ENST00000378289.4_In_Frame_Del_p.201_202VV>V|DCLRE1C_ENST00000378249.1_In_Frame_Del_p.86_87VV>V|DCLRE1C_ENST00000357717.2_In_Frame_Del_p.86_87VV>V|DCLRE1C_ENST00000396817.2_In_Frame_Del_p.81_82VV>V|DCLRE1C_ENST00000378258.1_In_Frame_Del_p.81_82VV>V|DCLRE1C_ENST00000378255.1_In_Frame_Del_p.81_82VV>V|DCLRE1C_ENST00000378254.1_In_Frame_Del_p.81_82VV>V|DCLRE1C_ENST00000453695.2_In_Frame_Del_p.81_82VV>V|DCLRE1C_ENST00000378246.2_In_Frame_Del_p.86_87VV>V			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	201					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						GTTCAGCCACACAACATGGTACG	0.448								Non-homologous end-joining																													p.202_202del													.	.			0			c.604_606del																																									SO:0001651	inframe_deletion	64421	exon8			AGCCACACAACAT	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.603_605delTGT	10.37:g.14976455_14976457delACA	ENSP00000367527:p.Val202del		Somatic	215	0	0		WXS	Illumina HiSeq	.	178	0.29	51	NM_001033855	7	0.00	0	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	In_Frame_Del	DEL	ENST00000378278.2	37	CCDS31149.1																																																																																					0.448	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046934.1		NM_022487	
FZD8	8325	mdanderson.org	37	10	35928341	35928341	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr10:35928341G>T	ENST00000374694.1	-	1	2021	c.2017C>A	c.(2017-2019)Ctg>Atg	p.L673M	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	673					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						CGCCACGTCAGGCCAGTGCTG	0.781																																					p.L673M													.	.			0			c.C2017A												4.0	5.0	4.0					10																	35928341		1502	3282	4784	SO:0001583	missense	8325	exon1			ACGTCAGGCCAGT	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.2017C>A	10.37:g.35928341G>T	ENSP00000363826:p.Leu673Met		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_031866	0		0		Missense_Mutation	SNP	ENST00000374694.1	37	CCDS7192.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587626	0.66105	.	.	ENSG00000177283	ENST00000374694	D	0.89196	-2.48	3.5	1.6	0.23607	.	0.000000	0.53938	U	0.000052	D	0.88636	0.6490	L	0.29908	0.895	0.37004	D	0.895414	D	0.76494	0.999	D	0.83275	0.996	D	0.87220	0.2253	10	0.41790	T	0.15	.	8.7242	0.34458	0.2685:0.0:0.7315:0.0	.	673	Q9H461	FZD8_HUMAN	M	673	ENSP00000363826:L673M	ENSP00000363826:L673M	L	-	1	2	FZD8	35968347	.	.	1.000000	0.80357	0.978000	0.69477	.	.	0.814000	0.34374	0.449000	0.29647	CTG			0.781	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047575.2		NM_031866	
SLIT1	6585	mdanderson.org	37	10	98791382	98791382	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr10:98791382G>T	ENST00000266058.4	-	24	2736	c.2491C>A	c.(2491-2493)Ctc>Atc	p.L831I	SLIT1_ENST00000371070.4_Missense_Mutation_p.L831I|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	831					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		AGGGAGCGGAGTCCCTGGAAG	0.607																																					p.L831I													.	.			0			c.C2491A												123.0	94.0	104.0					10																	98791382		2140	4195	6335	SO:0001583	missense	6585	exon24			AGCGGAGTCCCTG	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2491C>A	10.37:g.98791382G>T	ENSP00000266058:p.Leu831Ile		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_003061	4	0.00	0	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.363068	0.61403	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	T;T	0.71934	-0.61;-0.61	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	D	0.87458	0.6182	M	0.91561	3.22	0.80722	D	1	D	0.62365	0.991	D	0.87578	0.998	D	0.90685	0.4608	10	0.87932	D	0	.	17.4125	0.87489	0.0:0.0:1.0:0.0	.	831	O75093	SLIT1_HUMAN	I	831	ENSP00000266058:L831I;ENSP00000360109:L831I	ENSP00000266058:L831I	L	-	1	0	SLIT1	98781372	1.000000	0.71417	0.999000	0.59377	0.252000	0.25951	7.391000	0.79828	2.344000	0.79699	0.313000	0.20887	CTC			0.607	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049636.1		NM_003061	
BLOC1S2	282991	mdanderson.org	37	10	102045950	102045950	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr10:102045950C>T	ENST00000370372.2	-	2	128	c.76G>A	c.(76-78)Gct>Act	p.A26T	BLOC1S2_ENST00000361832.2_5'UTR|BLOC1S2_ENST00000441611.1_5'UTR	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	26					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)			large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		GCTTCCTCAGCTGTCTCCACG	0.577																																					p.A26T													.	.			0			c.G76A												80.0	68.0	72.0					10																	102045950		2203	4300	6503	SO:0001583	missense	282991	exon2			CCTCAGCTGTCTC	AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.76G>A	10.37:g.102045950C>T	ENSP00000359398:p.Ala26Thr		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_173809	106	0.00	0	B4DQV2|Q5W040|Q8WUI8	Missense_Mutation	SNP	ENST00000370372.2	37	CCDS7490.1	.	.	.	.	.	.	.	.	.	.	-	36	5.728316	0.96856	.	.	ENSG00000196072	ENST00000358848	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.49253	0.1546	L	0.27053	0.805	0.58432	D	0.999999	D	0.58268	0.982	P	0.48627	0.584	T	0.39800	-0.9596	9	0.30078	T	0.28	-5.5634	18.568	0.91124	0.0:1.0:0.0:0.0	.	26	Q6QNY1	BL1S2_HUMAN	T	26	.	ENSP00000351716:A26T	A	-	1	0	BLOC1S2	102035940	1.000000	0.71417	0.950000	0.38849	0.998000	0.95712	7.419000	0.80179	2.632000	0.89209	0.550000	0.68814	GCT			0.577	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049861.2		NM_173809	
SMC3	9126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112352948	112352948	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr10:112352948C>T	ENST00000361804.4	+	18	2056	c.1930C>T	c.(1930-1932)Cgt>Tgt	p.R644C		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	644	Flexible hinge.				DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CCAGCTGGCCCGTGCTTTCAC	0.353																																					p.R644C													.	.			0			c.C1930T												90.0	83.0	85.0					10																	112352948		2203	4300	6503	SO:0001583	missense	9126	exon18			CTGGCCCGTGCTT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.1930C>T	10.37:g.112352948C>T	ENSP00000354720:p.Arg644Cys		Somatic	96	0	0		WXS	Illumina HiSeq	.	107	0.43	46	NM_005445	211	0.43	91	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568676	0.65651	.	.	ENSG00000108055	ENST00000361804	D	0.86562	-2.14	5.17	5.17	0.71159	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.93413	0.7899	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.94011	0.7284	10	0.87932	D	0	.	12.2607	0.54649	0.2851:0.7149:0.0:0.0	.	644	Q9UQE7	SMC3_HUMAN	C	644	ENSP00000354720:R644C	ENSP00000354720:R644C	R	+	1	0	SMC3	112342938	0.993000	0.37304	1.000000	0.80357	0.999000	0.98932	2.800000	0.47900	2.569000	0.86673	0.585000	0.79938	CGT			0.353	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050337.1		NM_005445	
HABP2	3026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	115349537	115349537	+	IGR	SNP	A	A	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr10:115349537A>G	ENST00000351270.3	+	0	3009				NRAP_ENST00000360478.3_Missense_Mutation_p.L1624S|NRAP_ENST00000369360.3_Missense_Mutation_p.L1632S|NRAP_ENST00000369358.4_Missense_Mutation_p.L1667S|NRAP_ENST00000359988.3_Missense_Mutation_p.L1659S	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2						cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	GGTCAGGTTCAAGTCTGATTT	0.517																																					p.L1659S													.	.			0			c.T4976C												70.0	68.0	69.0					10																	115349537		2203	4300	6503	SO:0001628	intergenic_variant	4892	exon41			AGGTTCAAGTCTG		CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073		10.37:g.115349537A>G			Somatic	44	0	0		WXS	Illumina HiSeq	.	31	0.39	12	NM_001261463	0		0	A8K467|B7Z8U5|F5H5M6|O00663	Missense_Mutation	SNP	ENST00000351270.3	37	CCDS7577.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.613040	0.87258	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.74351	0.3705	M	0.88775	2.98	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.991;1.0;1.0;1.0	T	0.79612	-0.1731	10	0.72032	D	0.01	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	781;1659;1624;1659	B1ANW7;A0AVL2;Q86VF7-4;Q86VF7	.;.;.;NRAP_HUMAN	S	1667;1632;1659;1624;781	ENSP00000358365:L1667S;ENSP00000358367:L1632S;ENSP00000353078:L1659S;ENSP00000353666:L1624S	ENSP00000353078:L1659S	L	-	2	0	NRAP	115339527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.499000	0.81566	2.281000	0.76405	0.533000	0.62120	TTG			0.517	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050428.1		NM_004132	
TACC2	10579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123844801	123844801	+	Missense_Mutation	SNP	A	A	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr10:123844801A>T	ENST00000369005.1	+	4	3126	c.2786A>T	c.(2785-2787)gAa>gTa	p.E929V	TACC2_ENST00000515273.1_Missense_Mutation_p.E929V|TACC2_ENST00000515603.1_Missense_Mutation_p.E929V|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Missense_Mutation_p.E929V|TACC2_ENST00000334433.3_Missense_Mutation_p.E929V|TACC2_ENST00000358010.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	929					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TCTCTGACAGAAGAGTCAGAA	0.537																																					p.E929V													.	.			0			c.A2786T												99.0	100.0	99.0					10																	123844801		2203	4300	6503	SO:0001583	missense	10579	exon4			TGACAGAAGAGTC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.2786A>T	10.37:g.123844801A>T	ENSP00000358001:p.Glu929Val		Somatic	62	0	0		WXS	Illumina HiSeq	.	51	0.31	16	NM_206862	0		0	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	A	9.592	1.126522	0.20959	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.03831	3.8;3.79;3.8;3.8;3.79	4.36	0.603	0.17541	.	0.425847	0.17437	N	0.174263	T	0.03520	0.0101	L	0.32530	0.975	0.09310	N	1	B;B;B	0.26935	0.164;0.164;0.164	B;B;B	0.23852	0.049;0.049;0.049	T	0.39231	-0.9624	10	0.72032	D	0.01	-1.3762	2.9817	0.05955	0.6245:0.0:0.1934:0.1821	.	929;929;929	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	V	929;929;929;929;929;919	ENSP00000358001:E929V;ENSP00000424467:E929V;ENSP00000427618:E929V;ENSP00000334280:E929V;ENSP00000395048:E929V	ENSP00000334280:E929V	E	+	2	0	TACC2	123834791	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.171000	0.16685	-0.050000	0.13356	0.448000	0.29417	GAA			0.537	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000090004.1			
MUC2	4583	mdanderson.org	37	11	1093324	1093324	+	Missense_Mutation	SNP	G	G	A	rs201143282		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:1093324G>A	ENST00000441003.2	+	30	5170	c.5143G>A	c.(5143-5145)Ggc>Agc	p.G1715S	MUC2_ENST00000333592.6_Missense_Mutation_p.G3S|MUC2_ENST00000359061.5_Missense_Mutation_p.G1682S|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																					p.G1715S													MUC2_ENST00000441003,uveal_tract,malignant_melanoma,0,2	MUC2_ENST00000441003	0	2	0			c.G5143A												178.0	224.0	208.0					11																	1093324		1930	3651	5581	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5143G>A	11.37:g.1093324G>A	ENSP00000415183:p.Gly1715Ser		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	17	0.24	4	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	7.149	0.583420	0.13749	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.11;3.17;2.32	1.64	0.221	0.15283	.	155.122000	0.02480	U	0.088379	T	0.09686	0.0238	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22556	-1.0213	9	0.19147	T	0.46	.	3.4701	0.07563	0.7575:0.0:0.2425:0.0	.	1715	E7EUV1	.	S	1715;1682;3	ENSP00000415183:G1715S;ENSP00000351956:G1682S;ENSP00000331373:G3S	ENSP00000331373:G3S	G	+	1	0	MUC2	1083324	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.131000	0.10482	-0.042000	0.13535	-1.076000	0.02234	GGC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
BRSK2	9024	mdanderson.org	37	11	1475738	1475738	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:1475738G>T	ENST00000528841.1	+	16	1952	c.1568G>T	c.(1567-1569)gGg>gTg	p.G523V	BRSK2_ENST00000308230.5_Missense_Mutation_p.G545V|BRSK2_ENST00000528710.1_Missense_Mutation_p.G463V|BRSK2_ENST00000526678.1_Missense_Mutation_p.G545V|BRSK2_ENST00000544817.1_Missense_Mutation_p.G218V|BRSK2_ENST00000308219.9_Missense_Mutation_p.G523V|BRSK2_ENST00000382179.1_Missense_Mutation_p.G569V|BRSK2_ENST00000531197.1_Missense_Mutation_p.G523V			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	523					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		TCCTGGTTTGGGAACTTCATC	0.577																																					p.G569V													.	.			0			c.G1706T												58.0	65.0	63.0					11																	1475738		2024	4189	6213	SO:0001583	missense	9024	exon16			GGTTTGGGAACTT	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1568G>T	11.37:g.1475738G>T	ENSP00000432000:p.Gly523Val		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001256630	24	0.00	0	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	CCDS58107.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.297200|4.297200	0.81025|0.81025	.|.	.|.	ENSG00000174672|ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179;ENST00000544817|ENST00000533606	T;T;T;T;T;T;T;T|.	0.78126|.	-1.07;-1.11;-1.11;-1.15;-1.11;-0.92;-1.06;0.49|.	3.57|3.57	3.57|3.57	0.40892|0.40892	.|.	0.062472|.	0.64402|.	U|.	0.000005|.	T|T	0.75882|0.75882	0.3910|0.3910	M|M	0.81341|0.81341	2.54|2.54	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.998;1.0;0.998;0.999;1.0|.	D;D;D;D;D|.	0.79108|.	0.978;0.992;0.978;0.986;0.992|.	T|T	0.79200|0.79200	-0.1901|-0.1901	10|5	0.87932|.	D|.	0|.	.|.	15.3534|15.3534	0.74409|0.74409	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	545;569;523;523;523|.	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2|.	.;.;.;BRSK2_HUMAN;.|.	V|C	523;523;545;523;545;463;569;218|61	ENSP00000310697:G523V;ENSP00000431152:G523V;ENSP00000310805:G545V;ENSP00000432000:G523V;ENSP00000433370:G545V;ENSP00000433235:G463V;ENSP00000371614:G569V;ENSP00000445168:G218V|.	ENSP00000310697:G523V|.	G|W	+|+	2|3	0|0	BRSK2|BRSK2	1432314|1432314	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.953000|0.953000	0.61014|0.61014	9.128000|9.128000	0.94424|0.94424	1.849000|1.849000	0.53698|0.53698	0.313000|0.313000	0.20887|0.20887	GGG|TGG			0.577	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000393033.1		NM_003957	
STIM1	6786	mdanderson.org	37	11	3877621	3877621	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:3877621G>T	ENST00000300737.4	+	1	690	c.121G>T	c.(121-123)Gag>Tag	p.E41*	AC090587.4_ENST00000430222.1_RNA|STIM1_ENST00000527651.1_Nonsense_Mutation_p.E41*|MIR4687_ENST00000583618.1_RNA|AC090587.5_ENST00000415809.1_RNA	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	41					activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		GGCCAACTCTGAGGAGTCCAC	0.622																																					p.E41X													.	.			0			c.G121T												68.0	70.0	70.0					11																	3877621		2201	4298	6499	SO:0001587	stop_gained	6786	exon1			AACTCTGAGGAGT	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.121G>T	11.37:g.3877621G>T	ENSP00000300737:p.Glu41*		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_003156	14	0.00	0	E9PQJ4|Q8N382	Nonsense_Mutation	SNP	ENST00000300737.4	37	CCDS7749.1	.	.	.	.	.	.	.	.	.	.	G	36	5.630068	0.96671	.	.	ENSG00000167323	ENST00000300737;ENST00000527651	.	.	.	4.49	4.49	0.54785	.	0.232813	0.36167	N	0.002749	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-10.7869	12.5521	0.56231	0.0:0.0:1.0:0.0	.	.	.	.	X	41	.	ENSP00000300737:E41X	E	+	1	0	STIM1	3834197	0.998000	0.40836	0.926000	0.36857	0.951000	0.60555	4.202000	0.58446	2.327000	0.79052	0.591000	0.81541	GAG			0.622	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257196.1		NM_003156	
ST5	6764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	8734259	8734259	+	Missense_Mutation	SNP	T	T	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:8734259T>G	ENST00000534127.1	-	12	2396	c.2011A>C	c.(2011-2013)Atc>Ctc	p.I671L	ST5_ENST00000526757.1_Missense_Mutation_p.I251L|ST5_ENST00000530438.1_Missense_Mutation_p.I251L|ST5_ENST00000357665.1_Missense_Mutation_p.I671L|ST5_ENST00000313726.6_Missense_Mutation_p.I671L|ST5_ENST00000526099.1_Missense_Mutation_p.I184L|ST5_ENST00000530991.1_Missense_Mutation_p.I143L|RPL27A_ENST00000531102.1_Intron	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	671					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		ATCGACTGGATGTGGACCAGG	0.612																																					p.I671L													.	.			0			c.A2011C												40.0	38.0	38.0					11																	8734259		2201	4296	6497	SO:0001583	missense	6764	exon12			ACTGGATGTGGAC	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.2011A>C	11.37:g.8734259T>G	ENSP00000433528:p.Ile671Leu		Somatic	37	0	0		WXS	Illumina HiSeq	.	34	0.26	9	NM_005418	8	0.38	3	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	37	CCDS7791.1	.	.	.	.	.	.	.	.	.	.	T	12.21	1.869663	0.33069	.	.	ENSG00000166444	ENST00000526757;ENST00000534127;ENST00000313726;ENST00000530991;ENST00000357665;ENST00000526099;ENST00000530438;ENST00000533020;ENST00000447053;ENST00000530593;ENST00000528527	T;T;T;T;T;T;T;T;T;T	0.31510	2.97;2.97;2.97;2.97;2.97;2.97;2.97;2.97;1.49;2.97	5.28	5.28	0.74379	.	0.059384	0.64402	D	0.000001	T	0.08088	0.0202	N	0.00321	-1.65	0.41135	D	0.985918	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.10450	0.002;0.005;0.004	T	0.22871	-1.0204	10	0.16896	T	0.51	-15.5475	9.7095	0.40236	0.0:0.0773:0.0:0.9227	.	184;251;671	B4DDL8;P78524-2;P78524	.;.;ST5_HUMAN	L	251;671;671;143;671;184;251;143;281;128;143	ENSP00000435097:I251L;ENSP00000433528:I671L;ENSP00000319678:I671L;ENSP00000432887:I143L;ENSP00000350294:I671L;ENSP00000436808:I184L;ENSP00000436802:I251L;ENSP00000433588:I143L;ENSP00000437096:I128L;ENSP00000431580:I143L	ENSP00000319678:I671L	I	-	1	0	ST5	8690835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.338000	0.52128	1.998000	0.58463	0.533000	0.62120	ATC			0.612	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000386518.1		NM_005418	
BDNF	627	mdanderson.org	37	11	27681195	27681195	+	5'UTR	SNP	T	T	C	rs376982344|rs200712840|rs5790661|rs202011320	byFrequency	TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:27681195T>C	ENST00000525528.1	-	0	10				BDNF_ENST00000533131.1_Intron|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000438929.1_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000418212.1_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000395986.2_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000584049.1_Intron|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000395980.2_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000314915.6_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						tgtgtgtgtgtgcgcgcgcgc	0.438													T|||	31	0.0061901	0.0159	0.0029	5008	,	,		15764	0.0		0.006	False		,,,				2504	0.002				.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	627	.			TGTGTGTGCGCGC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1084A>G	11.37:g.27681195T>C			Somatic	94	0.0106382979	1		WXS	Illumina HiSeq	Phase_I	100	0.06	6	.	0		0	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																					0.438	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388135.1		NM_170735	
MED19	219541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57472453	57472453	+	Missense_Mutation	SNP	T	T	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:57472453T>G	ENST00000431606.2	-	2	495	c.466A>C	c.(466-468)Act>Cct	p.T156P	MED19_ENST00000337672.2_Missense_Mutation_p.T156P			A0JLT2	MED19_HUMAN	mediator complex subunit 19	156						mediator complex (GO:0016592)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			cervix(1)|large_intestine(1)|lung(1)|ovary(2)	5						ACCGGGCCAGTGTGGAGGCGG	0.522																																					p.T156P													.	.			0			c.A466C												40.0	43.0	42.0					11																	57472453		2201	4296	6497	SO:0001583	missense	219541	exon2			GGCCAGTGTGGAG	AY148462	CCDS7966.1	11q12.1	2008-02-05	2007-07-30		ENSG00000156603	ENSG00000156603			29600	protein-coding gene	gene with protein product		612385	"""mediator of RNA polymerase II transcription, subunit 19 homolog (S. cerevisiae)"""			9417904	Standard	NM_153450		Approved	LCMR1	uc001nlb.3	A0JLT2	OTTHUMG00000167199	ENST00000431606.2:c.466A>C	11.37:g.57472453T>G	ENSP00000416227:p.Thr156Pro		Somatic	48	0	0		WXS	Illumina HiSeq	.	34	0.35	12	NM_153450	93	0.57	53	Q8IV02|Q8IZD1	Missense_Mutation	SNP	ENST00000431606.2	37		.	.	.	.	.	.	.	.	.	.	T	5.197	0.221953	0.09863	.	.	ENSG00000156603	ENST00000337672;ENST00000431606	.	.	.	5.6	4.47	0.54385	.	0.102460	0.64402	D	0.000002	T	0.29190	0.0726	N	0.21373	0.66	0.49687	D	0.999816	B;B	0.06786	0.0;0.001	B;B	0.11329	0.002;0.006	T	0.17837	-1.0356	9	0.02654	T	1	-22.2694	5.4827	0.16733	0.0:0.1964:0.0:0.8036	.	156;156	A0JLT2-2;A0JLT2	.;MED19_HUMAN	P	156	.	ENSP00000337340:T156P	T	-	1	0	MED19	57229029	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.870000	0.48451	2.132000	0.65825	0.459000	0.35465	ACT			0.522	MED19-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000393702.1		NM_153450	
SCGB1D2	10647	mdanderson.org	37	11	62012170	62012170	+	Nonstop_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:62012170G>T	ENST00000244926.3	+	3	370	c.272G>T	c.(271-273)tGa>tTa	p.*91L	RP11-703H8.9_ENST00000529875.1_RNA	NM_006551.3	NP_006542.1	O95969	SG1D2_HUMAN	secretoglobin, family 1D, member 2	0						extracellular space (GO:0005615)				breast(1)|endometrium(1)|lung(1)	3						TGTAGTGTGTGACATGTAAAA	0.398																																					p.X91L													.	.			0			c.G272T												167.0	151.0	157.0					11																	62012170		2201	4299	6500	SO:0001578	stop_lost	10647	exon3			GTGTGTGACATGT	AJ224172	CCDS8017.1	11q13	2011-12-14			ENSG00000124935	ENSG00000124935		"""Secretoglobins"""	18396	protein-coding gene	gene with protein product	"""prostatein-like lipophilin B"", ""lipophilin B (uteroglobin family member), prostatein-like"""	615061				10066439, 9720917, 22155607	Standard	XM_006718422		Approved	LPHB, LIPB	uc001ntb.3	O95969	OTTHUMG00000167508	ENST00000244926.3:c.272G>T	11.37:g.62012170G>T	ENSP00000244926:p.*91Leuext*14		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_006551	6	0.00	0	Q2M3N9	Missense_Mutation	SNP	ENST00000244926.3	37	CCDS8017.1	.	.	.	.	.	.	.	.	.	.	G	0.048	-1.257987	0.01457	.	.	ENSG00000124935	ENST00000244926	.	.	.	2.66	-5.31	0.02730	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.0825	0.00033	0.316:0.1631:0.1962:0.3247	.	.	.	.	L	91	.	.	X	+	2	2	SCGB1D2	61768746	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.266000	0.08631	-1.480000	0.01865	0.313000	0.20887	TGA			0.398	SCGB1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394859.1		NM_006551	
ARAP1	116985	broad.mit.edu;mdanderson.org	37	11	72438118	72438118	+	Missense_Mutation	SNP	T	T	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:72438118T>A	ENST00000393609.3	-	3	258	c.56A>T	c.(55-57)cAc>cTc	p.H19L	ARAP1_ENST00000359373.5_Missense_Mutation_p.H19L|ARAP1_ENST00000455638.2_Missense_Mutation_p.H19L	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	19	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						CTGCTCCAGGTGCAATGCCCG	0.647																																					p.H19L	Ovarian(102;1198 1520 13195 17913 37529)												.	ARAP1	168		0			c.A56T												16.0	20.0	19.0					11																	72438118		2082	4204	6286	SO:0001583	missense	116985	exon3			TCCAGGTGCAATG	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.56A>T	11.37:g.72438118T>A	ENSP00000377233:p.His19Leu		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_001040118	37	0.14	5	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.112662	0.77210	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393609	T;T;T	0.49432	0.78;0.78;0.78	4.59	4.59	0.56863	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.071731	0.56097	D	0.000037	T	0.59783	0.2219	M	0.64997	1.995	0.36122	D	0.84555	P;P	0.51791	0.936;0.948	P;P	0.56823	0.708;0.807	T	0.71490	-0.4577	10	0.87932	D	0	.	12.9481	0.58384	0.0:0.0:0.0:1.0	.	19;19	Q96P48-3;Q96P48	.;ARAP1_HUMAN	L	19	ENSP00000352332:H19L;ENSP00000390461:H19L;ENSP00000377233:H19L	ENSP00000352332:H19L	H	-	2	0	ARAP1	72115766	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	3.419000	0.52728	1.931000	0.55961	0.454000	0.30748	CAC			0.647	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000347428.1		NM_001040118	
INTS4	92105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	77612564	77612564	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:77612564A>G	ENST00000534064.1	-	18	2165	c.2131T>C	c.(2131-2133)Tac>Cac	p.Y711H	AAMDC_ENST00000532481.1_Intron|INTS4_ENST00000535943.1_Missense_Mutation_p.Y86H	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	711					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ACACCACTGTACATGAATTCC	0.368																																					p.Y711H													.	.			0			c.T2131C												132.0	115.0	121.0					11																	77612564		2200	4292	6492	SO:0001583	missense	92105	exon18			CACTGTACATGAA	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.2131T>C	11.37:g.77612564A>G	ENSP00000434466:p.Tyr711His		Somatic	136	0	0		WXS	Illumina HiSeq	.	132	0.33	43	NM_033547	53	0.49	26	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243736	0.79912	.	.	ENSG00000149262	ENST00000534064;ENST00000535943	.	.	.	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.70219	0.3199	L	0.60455	1.87	0.58432	D	0.99999	D	0.65815	0.995	D	0.70487	0.969	T	0.73668	-0.3910	9	0.87932	D	0	-3.4512	12.5095	0.55999	1.0:0.0:0.0:0.0	.	711	Q96HW7	INT4_HUMAN	H	711;86	.	ENSP00000434466:Y711H	Y	-	1	0	INTS4	77290212	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.139000	0.89615	1.936000	0.56123	0.377000	0.23210	TAC			0.368	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390927.1		NM_033547	
FAT3	120114	mdanderson.org	37	11	92088566	92088566	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:92088566G>T	ENST00000298047.6	+	1	3305	c.3288G>T	c.(3286-3288)gaG>gaT	p.E1096D	FAT3_ENST00000525166.1_Missense_Mutation_p.E946D|FAT3_ENST00000541502.1_Missense_Mutation_p.E1096D|FAT3_ENST00000409404.2_Missense_Mutation_p.E1096D			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1096	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TAGACGACGAGAGTGGTAAGT	0.443										TCGA Ovarian(4;0.039)																											p.E1096D													.	.			0			c.G3288T												107.0	103.0	104.0					11																	92088566		2014	4180	6194	SO:0001583	missense	120114	exon1			CGACGAGAGTGGT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3288G>T	11.37:g.92088566G>T	ENSP00000298047:p.Glu1096Asp		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	52	0.08	4	NM_001008781	4	0.00	0	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	4.188	0.033500	0.08101	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.51817	4.66;4.66;0.69;4.66	5.56	2.21	0.28008	.	.	.	.	.	T	0.21186	0.0510	N	0.03209	-0.39	0.31392	N	0.677746	B	0.25486	0.127	B	0.26614	0.071	T	0.29181	-1.0020	9	0.14656	T	0.56	.	7.6768	0.28490	0.4241:0.0:0.5759:0.0	.	1096	Q8TDW7-3	.	D	1096;1096;1096;946	ENSP00000298047:E1096D;ENSP00000387040:E1096D;ENSP00000443786:E1096D;ENSP00000432586:E946D	ENSP00000298047:E1096D	E	+	3	2	FAT3	91728214	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	1.496000	0.35638	0.836000	0.34901	0.655000	0.94253	GAG			0.443	FAT3-201	KNOWN	basic	protein_coding	protein_coding				NM_001008781	
EXPH5	23086	hgsc.bcm.edu	37	11	108384984	108384984	+	Nonsense_Mutation	SNP	G	G	T	rs115714924	byFrequency	TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:108384984G>T	ENST00000265843.4	-	6	1360	c.1250C>A	c.(1249-1251)tCg>tAg	p.S417*	EXPH5_ENST00000428840.1_Nonsense_Mutation_p.S341*|EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000525344.1_Nonsense_Mutation_p.S410*|EXPH5_ENST00000443411.1_Nonsense_Mutation_p.S229*	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	417					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TGAATGGTACGATTCATATCT	0.438																																					p.S417X													.	.			0			c.C1250A												149.0	154.0	152.0					11																	108384984		2201	4298	6499	SO:0001587	stop_gained	23086	exon6			TGGTACGATTCAT		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.1250C>A	11.37:g.108384984G>T	ENSP00000265843:p.Ser417*		Somatic	97	0	0		WXS	Illumina HiSeq	.	96	0.04	4	NM_015065	0		0	Q2KHM1|Q9Y4D6	Nonsense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656229	0.67586	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	.	.	.	5.66	0.391	0.16282	.	0.583594	0.16472	N	0.212916	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-0.3749	1.5988	0.02669	0.4642:0.2599:0.1501:0.1258	.	.	.	.	X	417;341;229;410;261;341;229	.	ENSP00000265843:S417X	S	-	2	0	EXPH5	107890194	0.364000	0.24997	0.174000	0.22961	0.187000	0.23431	0.827000	0.27421	0.087000	0.17167	-0.339000	0.08088	TCG			0.438	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390279.1		NM_015065	
TMPRSS13	84000	mdanderson.org	37	11	117772964	117772964	+	Missense_Mutation	SNP	C	C	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr11:117772964C>A	ENST00000524993.1	-	13	1751	c.1694G>T	c.(1693-1695)aGa>aTa	p.R565I	TMPRSS13_ENST00000528626.1_Missense_Mutation_p.R530I	NM_001077263.2	NP_001070731.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	0						blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TTAGGATTTTCTGAATCGCAC	0.582																																					p.R565I													.	.			0			c.G1694T												45.0	51.0	49.0					11																	117772964		2006	4184	6190	SO:0001583	missense	84000	exon13			GATTTTCTGAATC	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000524993.1:c.1694G>T	11.37:g.117772964C>A	ENSP00000434279:p.Arg565Ile		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_001077263	1	0.00	0	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000524993.1	37	CCDS41721.1	.	.	.	.	.	.	.	.	.	.	C	9.120	1.008812	0.19199	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993	D;D	0.88741	-2.4;-2.42	3.57	0.636	0.17729	.	1.707770	0.03320	N	0.191843	T	0.80491	0.4633	N	0.08118	0	0.80722	D	1	B;B	0.32693	0.38;0.226	B;B	0.37304	0.193;0.246	T	0.66752	-0.5844	10	0.72032	D	0.01	.	5.8215	0.18530	0.0:0.6465:0.0:0.3535	.	560;565	E9PHM4;E9PRA0	.;.	I	530;560;565	ENSP00000435813:R530I;ENSP00000434279:R565I	ENSP00000337113:R560I	R	-	2	0	TMPRSS13	117278174	0.976000	0.34144	0.987000	0.45799	0.050000	0.14768	-0.040000	0.12104	0.144000	0.18951	0.467000	0.42956	AGA			0.582	TMPRSS13-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000392317.1		NM_032046	
DYRK4	8798	broad.mit.edu	37	12	4721824	4721824	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:4721824T>C	ENST00000540757.2	+	12	1421	c.1261T>C	c.(1261-1263)Ttt>Ctt	p.F421L	DYRK4_ENST00000010132.5_Missense_Mutation_p.F421L|DYRK4_ENST00000545342.1_Missense_Mutation_p.F58L|DYRK4_ENST00000543431.1_Missense_Mutation_p.F421L|RP11-500M8.7_ENST00000536588.1_Intron	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	421						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			ATCCAATTCCTTTTTCCCCTC	0.542																																					p.F421L													.	DYRK4	75		0			c.T1261C												114.0	104.0	107.0					12																	4721824		2203	4300	6503	SO:0001583	missense	8798	exon12			AATTCCTTTTTCC	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.1261T>C	12.37:g.4721824T>C	ENSP00000441755:p.Phe421Leu		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	208	0.02	4	NM_003845	171	0.00	0	A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	ENST00000540757.2	37	CCDS8530.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.806|0.806	-0.753704|-0.753704	0.03041|0.03041	.|.	.|.	ENSG00000010219|ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431;ENST00000545342|ENST00000544671	T;T;T;T;T|.	0.62498|.	0.03;0.02;0.02;0.03;1.03|.	5.06|5.06	-1.09|-1.09	0.09904|0.09904	Protein kinase-like domain (1);|.	1.075440|.	0.07061|.	N|.	0.833662|.	T|T	0.22437|0.22437	0.0541|0.0541	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.12013|.	0.005;0.0;0.0;0.0|.	B;B;B;B|.	0.13407|.	0.009;0.0;0.0;0.0|.	T|T	0.29852|0.29852	-0.9998|-0.9998	10|5	0.11182|.	T|.	0.66|.	.|.	6.6901|6.6901	0.23165|0.23165	0.5157:0.0:0.1235:0.3608|0.5157:0.0:0.1235:0.3608	.|.	536;135;421;421|.	F5H6L9;B4E1A4;Q9NR20-2;Q9NR20|.	.;.;.;DYRK4_HUMAN|.	L|P	536;421;421;421;58|82	ENSP00000437534:F536L;ENSP00000441755:F421L;ENSP00000010132:F421L;ENSP00000439697:F421L;ENSP00000446005:F58L|.	ENSP00000010132:F421L|.	F|L	+|+	1|2	0|0	DYRK4|DYRK4	4592085|4592085	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.952000|-0.952000	0.03881|0.03881	-0.352000|-0.352000	0.08237|0.08237	-0.291000|-0.291000	0.09656|0.09656	TTT|CTT			0.542	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000398780.2			
GDF3	9573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	7848063	7848063	+	Missense_Mutation	SNP	C	C	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:7848063C>A	ENST00000329913.3	-	1	309	c.262G>T	c.(262-264)Gac>Tac	p.D88Y		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	88					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)	p.D88N(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TTACCTTGGTCTGGGAGAAAG	0.498																																					p.D88Y													GDF3,NS,malignant_melanoma,0,1	GDF3	0	1	1	Substitution - Missense(1)	skin(1)	c.G262T												76.0	79.0	78.0					12																	7848063		2203	4300	6503	SO:0001583	missense	9573	exon1			CTTGGTCTGGGAG	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.262G>T	12.37:g.7848063C>A	ENSP00000331745:p.Asp88Tyr		Somatic	67	0.0149253731	1		WXS	Illumina HiSeq	.	232	0.15	34	NM_020634	5025	0.10	512	Q8NEJ4	Missense_Mutation	SNP	ENST00000329913.3	37	CCDS8581.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455851	0.63401	.	.	ENSG00000184344	ENST00000329913	T	0.67345	-0.26	3.98	3.98	0.46160	Transforming growth factor-beta, N-terminal (1);	0.108662	0.64402	D	0.000011	T	0.80834	0.4699	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83377	0.0010	10	0.72032	D	0.01	.	11.9498	0.52948	0.0:1.0:0.0:0.0	.	88	Q9NR23	GDF3_HUMAN	Y	88	ENSP00000331745:D88Y	ENSP00000331745:D88Y	D	-	1	0	GDF3	7739330	1.000000	0.71417	0.121000	0.21740	0.912000	0.54170	4.348000	0.59379	1.937000	0.56155	0.313000	0.20887	GAC			0.498	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399717.1			
AC079630.4	0	broad.mit.edu	37	12	40590333	40590340	+	RNA	DEL	ACACACAG	ACACACAG	-	rs201173014|rs2172242|rs17465568|rs17465582|rs4604959|rs202005517|rs17465575	byFrequency	TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	ACACACAG	ACACACAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:40590333_40590340delACACACAG	ENST00000412812.1	-	0	145																											acacacacacacacacagagagagagag	0.457																																					.													.	.			0			.																																											0	.			ACACACACACACA																													12.37:g.40590333_40590340delACACACAG			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	25	0.44	11	.	0		0		RNA	DEL	ENST00000412812.1	37																																																																																						0.457	AC079630.4-001	KNOWN	basic	antisense	antisense		OTTHUMT00000257956.1			
HOXC4	3221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	54448769	54448769	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:54448769C>A	ENST00000430889.2	+	2	621	c.575C>A	c.(574-576)tCg>tAg	p.S192*	HOXC4_ENST00000303406.4_Nonsense_Mutation_p.S192*|HOXC4_ENST00000609810.1_Nonsense_Mutation_p.S192*	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	192					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						ATCGCCCACTCGCTGTGCCTC	0.522																																					p.S192X													.	.			0			c.C575A												48.0	44.0	45.0					12																	54448769		2203	4300	6503	SO:0001587	stop_gained	3221	exon4			CCCACTCGCTGTG		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.575C>A	12.37:g.54448769C>A	ENSP00000399808:p.Ser192*		Somatic	119	0	0		WXS	Illumina HiSeq	.	145	0.26	38	NM_014620	0		0		Nonsense_Mutation	SNP	ENST00000430889.2	37	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081945	0.76528	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	.	.	.	3.85	3.85	0.44370	.	0.149515	0.44902	D	0.000418	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	15.0798	0.72106	0.0:1.0:0.0:0.0	.	.	.	.	X	192	.	ENSP00000305973:S192X	S	+	2	0	HOXC4	52735036	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.568000	0.82369	2.139000	0.66308	0.448000	0.29417	TCG			0.522	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358963.1			
PA2G4	5036	broad.mit.edu;mdanderson.org	37	12	56501389	56501389	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:56501389G>A	ENST00000303305.6	+	5	897	c.478G>A	c.(478-480)Gga>Aga	p.G160R	RP11-603J24.9_ENST00000548861.1_Missense_Mutation_p.G141R|PA2G4_ENST00000552766.1_Missense_Mutation_p.G160R|RP11-603J24.17_ENST00000548595.1_RNA	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	160					cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			GGTCAAACCTGGAAATCAGGT	0.448																																					p.G160R													.	PA2G4	24		0			c.G478A												73.0	70.0	71.0					12																	56501389		2203	4300	6503	SO:0001583	missense	5036	exon5			AAACCTGGAAATC	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.478G>A	12.37:g.56501389G>A	ENSP00000302886:p.Gly160Arg		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	57	0.07	4	NM_006191	1437	0.00	7	O43846|Q9UM59	Missense_Mutation	SNP	ENST00000303305.6	37	CCDS8902.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467414	0.84533	.	.	ENSG00000257411;ENSG00000170515;ENSG00000170515;ENSG00000170515;ENSG00000170515;ENSG00000170515;ENSG00000170515	ENST00000548861;ENST00000303305;ENST00000552766;ENST00000417031;ENST00000546435;ENST00000548711;ENST00000553057	D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05	5.71	4.82	0.62117	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.93475	0.7918	H	0.94306	3.52	0.80722	D	1	P;D;D	0.56968	0.769;0.973;0.978	B;P;P	0.61592	0.142;0.891;0.854	D	0.94831	0.7996	10	0.87932	D	0	.	13.4893	0.61386	0.0762:0.0:0.9238:0.0	.	160;160;160	F8VRZ3;F8VTY8;Q9UQ80	.;.;PA2G4_HUMAN	R	141;160;160;189;160;160;149	ENSP00000449770:G141R;ENSP00000302886:G160R;ENSP00000448557:G160R;ENSP00000447615:G149R	ENSP00000302886:G160R	G	+	1	0	PA2G4;RP11-603J24.9	54787656	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.672000	0.98629	1.429000	0.47314	0.655000	0.94253	GGA			0.448	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407767.1		NM_006191	
KNTC1	9735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123041970	123041970	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:123041970C>G	ENST00000333479.7	+	17	1489	c.1312C>G	c.(1312-1314)Ctg>Gtg	p.L438V	KNTC1_ENST00000450485.2_Missense_Mutation_p.L401V	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	438					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ATTGGAGAAACTGGCATTGAG	0.388																																					p.L438V													.	.			0			c.C1312G												116.0	111.0	113.0					12																	123041970		1882	4120	6002	SO:0001583	missense	9735	exon17			GAGAAACTGGCAT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1312C>G	12.37:g.123041970C>G	ENSP00000328236:p.Leu438Val		Somatic	76	0	0		WXS	Illumina HiSeq	.	87	0.24	21	NM_014708	52	0.38	20	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591413	0.28357	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.29397	1.57;2.07	5.38	1.35	0.21983	.	0.270122	0.30649	N	0.009169	T	0.25531	0.0621	L	0.60455	1.87	0.80722	D	1	P;P	0.48294	0.908;0.908	B;B	0.44224	0.444;0.265	T	0.04255	-1.0965	10	0.28530	T	0.3	-9.8253	3.9063	0.09183	0.2488:0.4019:0.0:0.3493	.	401;438	E7ES84;P50748	.;KNTC1_HUMAN	V	401;438	ENSP00000397992:L401V;ENSP00000328236:L438V	ENSP00000328236:L438V	L	+	1	2	KNTC1	121607923	0.997000	0.39634	0.999000	0.59377	0.757000	0.42996	0.593000	0.23999	0.758000	0.33059	0.563000	0.77884	CTG			0.388	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396110.2			
RIMBP2	23504	mdanderson.org	37	12	130921452	130921452	+	Missense_Mutation	SNP	C	C	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:130921452C>A	ENST00000261655.4	-	10	2153	c.1990G>T	c.(1990-1992)Gtg>Ttg	p.V664L	RIMBP2_ENST00000536002.1_Missense_Mutation_p.V572L|RIMBP2_ENST00000535703.1_Missense_Mutation_p.V572L	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	664					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GTGGTGGACACCGGGGTGCCC	0.736																																					p.V664L													.	.			0			c.G1990T												12.0	17.0	15.0					12																	130921452		2185	4280	6465	SO:0001583	missense	23504	exon10			TGGACACCGGGGT	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1990G>T	12.37:g.130921452C>A	ENSP00000261655:p.Val664Leu		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_015347	6	0.00	0	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677907	0.68042	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.19669	2.13;2.7;2.7	4.63	4.63	0.57726	.	0.257927	0.31531	N	0.007499	T	0.39545	0.1082	L	0.58101	1.795	0.37505	D	0.916934	D;P;P	0.64830	0.994;0.953;0.702	D;P;B	0.72625	0.978;0.548;0.116	T	0.30119	-0.9989	10	0.09084	T	0.74	-23.3766	17.4987	0.87725	0.0:1.0:0.0:0.0	.	572;572;664	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	L	664;572;572;572	ENSP00000261655:V664L;ENSP00000440347:V572L;ENSP00000439159:V572L	ENSP00000261655:V664L	V	-	1	0	RIMBP2	129487405	0.998000	0.40836	0.524000	0.27887	0.413000	0.31143	3.657000	0.54474	2.121000	0.65114	0.561000	0.74099	GTG			0.736	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399520.1		NM_015347	
POLE	5426	mdanderson.org	37	12	133218311	133218311	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr12:133218311T>C	ENST00000320574.5	-	39	5343	c.5300A>G	c.(5299-5301)gAg>gGg	p.E1767G	POLE_ENST00000535270.1_Missense_Mutation_p.E1740G|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1767					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GATCATGTCCTCCAGGGAGGC	0.612								DNA polymerases (catalytic subunits)																													p.E1767G													.	.			0			c.A5300G												95.0	79.0	84.0					12																	133218311		2203	4300	6503	SO:0001583	missense	5426	exon39			ATGTCCTCCAGGG		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.5300A>G	12.37:g.133218311T>C	ENSP00000322570:p.Glu1767Gly		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_006231	111	0.01	1	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	17.42	3.385338	0.61956	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.03035	4.07;4.07;4.07	5.43	5.43	0.79202	DNA polymerase epsilon, catalytic subunit A, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.08846	0.0219	M	0.79258	2.445	0.80722	D	1	B	0.21381	0.055	B	0.24006	0.05	T	0.02081	-1.1217	10	0.62326	D	0.03	.	15.4991	0.75680	0.0:0.0:0.0:1.0	.	1767	Q07864	DPOE1_HUMAN	G	1767;1778;1740	ENSP00000322570:E1767G;ENSP00000406383:E1778G;ENSP00000445753:E1740G	ENSP00000322570:E1767G	E	-	2	0	POLE	131728384	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.106000	0.71511	2.069000	0.61940	0.533000	0.62120	GAG			0.612	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397689.2		NM_006231	
TPTE2P2	644623	broad.mit.edu	37	13	52855276	52855277	+	RNA	DEL	TG	TG	-	rs373565102|rs377643612		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr13:52855276_52855277delTG	ENST00000451298.1	-	0	333																											ctggtgtgcttgtgtgtgtgtg	0.47																																					.													.	.			0			.																																											0	.			TGTGCTTGTGTGT																													13.37:g.52855286_52855287delTG			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000451298.1	37																																																																																						0.470	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000471093.1			
CUL4A	8451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	113897455	113897455	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr13:113897455C>G	ENST00000375440.4	+	11	1293	c.1209C>G	c.(1207-1209)aaC>aaG	p.N403K	CUL4A_ENST00000451881.1_Missense_Mutation_p.N303K|CUL4A_ENST00000326335.4_Missense_Mutation_p.N303K|CUL4A_ENST00000375441.3_Missense_Mutation_p.N303K	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	403					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			AGAGACCCAACAAGCCTGCAG	0.408																																					p.N403K													.	.			0			c.C1209G												116.0	104.0	108.0					13																	113897455		2203	4300	6503	SO:0001583	missense	8451	exon11			ACCCAACAAGCCT	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1209C>G	13.37:g.113897455C>G	ENSP00000364589:p.Asn403Lys		Somatic	68	0	0		WXS	Illumina HiSeq	.	64	0.28	18	NM_001008895	108	0.51	55	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932372	0.52866	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	4.97	1.5	0.22942	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);Cullin homology (1);	0.000000	0.85682	D	0.000000	T	0.78266	0.4256	M	0.87900	2.915	0.80722	D	1	P;P	0.37781	0.608;0.608	B;B	0.44315	0.446;0.446	T	0.75545	-0.3280	10	0.72032	D	0.01	-50.9379	7.4746	0.27368	0.0:0.3838:0.0:0.6162	.	403;403	Q13619;A8MSH7	CUL4A_HUMAN;.	K	303;303;303;403	ENSP00000364590:N303K;ENSP00000389118:N303K;ENSP00000322132:N303K;ENSP00000364589:N403K	ENSP00000322132:N303K	N	+	3	2	CUL4A	112945456	1.000000	0.71417	0.998000	0.56505	0.759000	0.43091	1.299000	0.33424	0.081000	0.16988	0.655000	0.94253	AAC			0.408	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045888.3		NM_003589	
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45665475	45665475	+	Missense_Mutation	SNP	A	A	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr14:45665475A>T	ENST00000267430.5	+	21	5526	c.5441A>T	c.(5440-5442)gAa>gTa	p.E1814V	FANCM_ENST00000542564.2_Missense_Mutation_p.E1788V	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1814	Interaction with FAAP24 and EME1.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CTTCCGCAGGAAGGAAAAGGA	0.433								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.E1814V													.	.			0			c.A5441T												128.0	125.0	126.0					14																	45665475		2203	4300	6503	SO:0001583	missense	57697	exon21	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CGCAGGAAGGAAA	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5441A>T	14.37:g.45665475A>T	ENSP00000267430:p.Glu1814Val		Somatic	131	0	0		WXS	Illumina HiSeq	.	128	0.20	25	NM_020937	18	0.00	0	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.121764	0.37436	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.20463	2.66;2.66;2.07	5.27	5.27	0.74061	.	0.318671	0.30890	N	0.008674	T	0.37046	0.0989	L	0.56769	1.78	0.09310	N	0.999999	D;D	0.69078	0.994;0.997	P;P	0.60789	0.795;0.879	T	0.21861	-1.0233	10	0.72032	D	0.01	.	10.9594	0.47376	0.8434:0.1566:0.0:0.0	.	1788;1814	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	V	1814;1788;1330	ENSP00000267430:E1814V;ENSP00000442493:E1788V;ENSP00000452033:E1330V	ENSP00000267430:E1814V	E	+	2	0	FANCM	44735225	0.024000	0.19004	0.470000	0.27216	0.314000	0.28054	1.316000	0.33620	1.998000	0.58463	0.460000	0.39030	GAA			0.433	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000410474.1		XM_048128	
CCDC88C	440193	mdanderson.org	37	14	91780051	91780051	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr14:91780051G>T	ENST00000389857.6	-	15	2195	c.2109C>A	c.(2107-2109)gaC>gaA	p.D703E		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	703					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GGTTCTCTGCGTCCAGCTGCT	0.612																																					p.D703E													.	.			0			c.C2109A												44.0	45.0	45.0					14																	91780051		2150	4256	6406	SO:0001583	missense	440193	exon15			CTCTGCGTCCAGC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2109C>A	14.37:g.91780051G>T	ENSP00000374507:p.Asp703Glu		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001080414	39	0.00	0	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	G	9.576	1.122413	0.20877	.	.	ENSG00000015133	ENST00000389857	T	0.12569	2.67	5.15	-2.44	0.06502	.	0.269375	0.25509	U	0.030181	T	0.12390	0.0301	L	0.58101	1.795	0.25192	N	0.99013	B	0.17465	0.022	B	0.16722	0.016	T	0.31641	-0.9936	10	0.25751	T	0.34	-11.8022	11.9908	0.53173	0.7437:0.0:0.2563:0.0	.	703	Q9P219	DAPLE_HUMAN	E	703	ENSP00000374507:D703E	ENSP00000374507:D703E	D	-	3	2	CCDC88C	90849804	0.005000	0.15991	0.060000	0.19600	0.915000	0.54546	-0.158000	0.10070	-0.292000	0.08999	0.561000	0.74099	GAC			0.612	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411650.1		XM_029353	
SERPINA9	327657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94933616	94933616	+	Silent	SNP	C	C	T	rs539102578		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr14:94933616C>T	ENST00000380365.3	-	3	810	c.732G>A	c.(730-732)gaG>gaA	p.E244E	SERPINA9_ENST00000337425.5_Silent_p.E262E|SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000546329.1_Silent_p.E226E|SERPINA9_ENST00000424550.2_Silent_p.E113E|SERPINA9_ENST00000448305.2_Silent_p.E164E|RP11-349I1.2_ENST00000536735.1_RNA|SERPINA9_ENST00000298845.7_Silent_p.E162E			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	244					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		AAGCGAACTGCTCTTTCTGGT	0.522																																					p.E262E													.	.			0			c.G786A												74.0	72.0	73.0					14																	94933616		2011	4180	6191	SO:0001819	synonymous_variant	327657	exon3			GAACTGCTCTTTC	AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.732G>A	14.37:g.94933616C>T			Somatic	73	0	0		WXS	Illumina HiSeq	.	68	0.21	14	NM_175739	0		0	B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Silent	SNP	ENST00000380365.3	37																																																																																						0.522	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000395803.2		NM_175739	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105415680	105415680	+	Silent	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr14:105415680G>T	ENST00000333244.5	-	7	6227	c.6108C>A	c.(6106-6108)ctC>ctA	p.L2036L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2036						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGAATGCTGAGGTCAGTGG	0.657																																					p.L2036L													.	.			0			c.C6108A																																									SO:0001819	synonymous_variant	113146	exon7			AATGCTGAGGTCA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6108C>A	14.37:g.105415680G>T			Somatic	85	0	0		WXS	Illumina HiSeq	.	68	0.53	36	NM_138420	1	0.00	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																					0.657	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000410300.1		NM_138420	
IGHV1-8	28472	broad.mit.edu	37	14	106539317	106539317	+	RNA	SNP	T	T	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr14:106539317T>C	ENST00000390599.2	-	0	174									immunoglobulin heavy variable 1-8																		GCAGGAGACCTTCACTGAGGC	0.552																																					.													.	.			0			.												101.0	76.0	85.0					14																	106539317		1814	3492	5306			0	.			GAGACCTTCACTG	M99637		14q32.33	2012-02-08			ENSG00000211939			"""Immunoglobulins / IGH locus"""	5559	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152284		14.37:g.106539317T>C			Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	160	0.02	3	.	229	0.00	0		RNA	SNP	ENST00000390599.2	37																																																																																						0.552	IGHV1-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000325672.1		NG_001019	
Unknown	0	bcgsc.ca	37	15	20482111	20482111	+	IGR	SNP	G	G	A	rs11629632		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr15:20482111G>A								RP11-173D3.1 (128905 upstream) : CHEK2P2 (5885 downstream)																							TTGGGTTCGCGGCCACTCTGT	0.582																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GTTCGCGGCCACT																													15.37:g.20482111G>A			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_1	20	0.25	5	.	0		0		RNA	SNP		37																																																																																					0	0.582										
RYR3	6263	broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	33895565	33895565	+	Splice_Site	SNP	G	G	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr15:33895565G>C	ENST00000389232.4	+	18	2234	c.2164G>C	c.(2164-2166)Ggc>Cgc	p.G722R	RYR3_ENST00000415757.3_Splice_Site_p.G722R	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	722	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTTTGGTCAGGTGAGTACCT	0.468																																					p.G722R													.	RYR3	760		0			c.G2164C												220.0	227.0	224.0					15																	33895565		2087	4224	6311	SO:0001630	splice_region_variant	6263	exon18			TGGTCAGGTGAGT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2164+1G>C	15.37:g.33895565G>C			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	93	0.17	16	NM_001243996	0		0	O15175|Q15412	Splice_Site	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012028	0.93346	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.60171	0.21;0.21	5.42	5.42	0.78866	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.80607	0.4655	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.83194	-0.0082	10	0.87932	D	0	.	19.4732	0.94971	0.0:0.0:1.0:0.0	.	722;722	Q15413-2;Q15413	.;RYR3_HUMAN	R	722	ENSP00000373884:G722R;ENSP00000399610:G722R	ENSP00000354735:G722R	G	+	1	0	RYR3	31682857	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.539000	0.98076	2.831000	0.97527	0.644000	0.83932	GGC			0.468	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000417514.1			Missense_Mutation
FAM98B	283742	bcgsc.ca	37	15	38776809	38776809	+	IGR	SNP	T	T	A	rs201831942|rs374461368		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr15:38776809T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G417G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		ATGGAGGAggtggtggtggtg	0.473																																					p.G417G													.	FAM98B	53		0			c.T1251A							T		2,3092		0,2,1545	25.0	24.0	25.0		1251	-6.5	0.3	15		25	0,6894		0,0,3447	no	coding-synonymous	FAM98B	NM_173611.2		0,2,4992	AA,AT,TT		0.0,0.0646,0.02		417/434	38776809	2,9986	1547	3447	4994	SO:0001628	intergenic_variant	283742	exon8			AGGAGGTGGTGGT		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		15.37:g.38776809T>A			Somatic	80	0.0125	1		WXS	Illumina HiSeq	Phase_1	109	0.06	6	NM_173611	0		0	A8MUW5|Q8N935	Missense_Mutation	SNP	ENST00000491535.1	37	CCDS42015.1																																																																																					0.473	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252071.2		NM_173611	
RASGRP1	10125	broad.mit.edu	37	15	38800149	38800149	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr15:38800149G>T	ENST00000310803.5	-	9	1197	c.1020C>A	c.(1018-1020)taC>taA	p.Y340*	RASGRP1_ENST00000539159.1_Nonsense_Mutation_p.Y292*|RASGRP1_ENST00000561180.1_Nonsense_Mutation_p.Y391*|RASGRP1_ENST00000559830.1_Nonsense_Mutation_p.Y340*|RP11-102L12.2_ENST00000560231.1_RNA|RASGRP1_ENST00000450598.2_Nonsense_Mutation_p.Y340*|RASGRP1_ENST00000558164.1_Nonsense_Mutation_p.Y340*	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	340	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		AGGCTCGCCGGTAATTGTCGT	0.532																																					p.Y340X													.	RASGRP1	50		0			c.C1020A												52.0	51.0	51.0					15																	38800149		2039	4182	6221	SO:0001587	stop_gained	10125	exon9			TCGCCGGTAATTG	AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1020C>A	15.37:g.38800149G>T	ENSP00000310244:p.Tyr340*		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	108	0.03	3	NM_001128602	10	0.00	0	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Nonsense_Mutation	SNP	ENST00000310803.5	37	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	G	33	5.207365	0.95033	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	.	.	.	5.13	3.25	0.37280	.	0.061292	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.7115	12.5572	0.56261	0.2526:0.0:0.7474:0.0	.	.	.	.	X	340;340;340;340;292;340;340	.	ENSP00000310244:Y340X	Y	-	3	2	RASGRP1	36587441	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	0.885000	0.28227	0.337000	0.23665	-1.134000	0.01955	TAC			0.532	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418223.1		NM_005739	
PLA2G4F	255189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42446574	42446574	+	Silent	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr15:42446574G>A	ENST00000382396.4	-	3	353	c.267C>T	c.(265-267)tgC>tgT	p.C89C	PLA2G4F_ENST00000397272.3_Silent_p.C89C			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	89	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CGGGGTCACTGCAGTTGGCCA	0.622																																					p.C89C													.	.			0			c.C267T												83.0	69.0	74.0					15																	42446574		2203	4299	6502	SO:0001819	synonymous_variant	255189	exon3			GTCACTGCAGTTG		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.267C>T	15.37:g.42446574G>A			Somatic	51	0	0		WXS	Illumina HiSeq	.	72	0.14	10	NM_213600	4	0.25	1	Q6ZMC8	Silent	SNP	ENST00000382396.4	37	CCDS32204.1																																																																																					0.622	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000420463.1		NM_213600	
SHC4	399694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49170473	49170473	+	Intron	SNP	G	G	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr15:49170473G>C	ENST00000332408.4	-	4	1269				EID1_ENST00000530028.2_Missense_Mutation_p.G34R|EID1_ENST00000560490.1_Intron|SHC4_ENST00000396535.3_5'Flank|EID1_ENST00000558295.1_Intron|SHC4_ENST00000537958.1_5'Flank	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		GATGGAGGTAGGCAGCGGGAG	0.627																																					p.G34R													.	.			0			c.G100C												71.0	75.0	74.0					15																	49170473		2067	4209	6276	SO:0001627	intron_variant	23741	exon1			GAGGTAGGCAGCG	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.840+5971C>G	15.37:g.49170473G>C			Somatic	33	0	0		WXS	Illumina HiSeq	.	45	0.24	11	NM_014335	217	0.10	22	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.988589	0.53934	.	.	ENSG00000255302	ENST00000530028	T	0.56444	0.46	4.18	3.26	0.37387	.	.	.	.	.	T	0.61961	0.2389	L	0.53249	1.67	0.80722	D	1	D	0.67145	0.996	P	0.62813	0.907	T	0.64266	-0.6448	9	0.87932	D	0	.	9.5917	0.39550	0.0:0.0:0.7921:0.2079	.	34	Q9Y6B2	EID1_HUMAN	R	34	ENSP00000431162:G34R	ENSP00000431162:G34R	G	+	1	0	EID1	46957765	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	2.182000	0.42556	1.342000	0.45619	0.650000	0.86243	GGC			0.627	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254371.1		NM_203349	
EEF2K	29904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	22268122	22268122	+	Silent	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr16:22268122C>T	ENST00000263026.5	+	7	1146	c.672C>T	c.(670-672)ccC>ccT	p.P224P		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	224	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		CGGGCAAGCCCCTCTTCCACC	0.602																																					p.P224P	NSCLC(195;1411 2157 20319 27471 51856)												.	.			0			c.C672T												132.0	92.0	106.0					16																	22268122		2197	4300	6497	SO:0001819	synonymous_variant	29904	exon7			CAAGCCCCTCTTC	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.672C>T	16.37:g.22268122C>T			Somatic	75	0	0		WXS	Illumina HiSeq	.	57	0.37	21	NM_013302	23	0.65	15	Q8N588	Silent	SNP	ENST00000263026.5	37	CCDS10604.1																																																																																					0.602	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211580.2		NM_013302	
ARHGAP17	55114	mdanderson.org	37	16	24942406	24942406	+	Silent	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr16:24942406G>T	ENST00000289968.6	-	19	2283	c.2214C>A	c.(2212-2214)ccC>ccA	p.P738P	ARHGAP17_ENST00000303665.5_Silent_p.P660P|ARHGAP17_ENST00000441763.2_3'UTR	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	738	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		GCAATGCCATGGGGTTGGGAG	0.622																																					p.P738P													.	.			0			c.C2214A												129.0	149.0	142.0					16																	24942406		2197	4300	6497	SO:0001819	synonymous_variant	55114	exon19			TGCCATGGGGTTG	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.2214C>A	16.37:g.24942406G>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001006634	95	0.00	0	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Silent	SNP	ENST00000289968.6	37	CCDS32409.1																																																																																					0.622	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436548.3		NM_018054	
PRSS36	146547	mdanderson.org	37	16	31159768	31159768	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr16:31159768G>T	ENST00000268281.4	-	5	559	c.501C>A	c.(499-501)ttC>ttA	p.F167L	PRSS36_ENST00000569305.1_Missense_Mutation_p.F167L|PRSS36_ENST00000418068.2_Missense_Mutation_p.F167L	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	167	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						TGCCGTGCACGAAGCGGTGTG	0.751																																					p.F167L													.	.			0			c.C501A												6.0	6.0	6.0					16																	31159768		2051	4058	6109	SO:0001583	missense	146547	exon5			GTGCACGAAGCGG	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.501C>A	16.37:g.31159768G>T	ENSP00000268281:p.Phe167Leu		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	9	0.67	6	NM_001258290	0		0	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944045	0.73672	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.86769	-2.17;-2.17	4.94	0.639	0.17747	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.74884	0.3775	N	0.10972	0.075	0.34350	D	0.689742	B;P;P	0.47302	0.014;0.825;0.893	B;B;P	0.45681	0.035;0.339;0.49	T	0.74284	-0.3715	9	0.46703	T	0.11	.	5.891	0.18913	0.2618:0.1549:0.5834:0.0	.	167;167;167	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	L	167	ENSP00000268281:F167L;ENSP00000407160:F167L	ENSP00000268281:F167L	F	-	3	2	PRSS36	31067269	0.363000	0.24989	0.751000	0.31187	0.895000	0.52256	0.742000	0.26216	0.131000	0.18576	0.555000	0.69702	TTC			0.751	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000433542.1		NM_173502	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72992565	72992565	+	Missense_Mutation	SNP	G	G	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr16:72992565G>C	ENST00000268489.5	-	2	2152	c.1480C>G	c.(1480-1482)Ctc>Gtc	p.L494V	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	494					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CTTGGAAAGAGTCCTTTGCAA	0.577																																					p.L494V													.	.			0			c.C1480G												74.0	79.0	77.0					16																	72992565		2198	4300	6498	SO:0001583	missense	463	exon2			GAAAGAGTCCTTT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1480C>G	16.37:g.72992565G>C	ENSP00000268489:p.Leu494Val		Somatic	85	0	0		WXS	Illumina HiSeq	.	79	0.42	33	NM_006885	1	0.00	0	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	6.475	0.455818	0.12283	.	.	ENSG00000140836	ENST00000268489	T	0.73363	-0.74	5.01	4.04	0.47022	.	0.000000	0.44688	D	0.000439	T	0.49609	0.1567	N	0.08118	0	0.80722	D	1	P	0.38148	0.62	B	0.25759	0.063	T	0.51513	-0.8696	10	0.27082	T	0.32	.	14.6558	0.68833	0.0:0.0:0.853:0.147	.	494	Q15911	ZFHX3_HUMAN	V	494	ENSP00000268489:L494V	ENSP00000268489:L494V	L	-	1	0	ZFHX3	71550066	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	5.706000	0.68362	1.222000	0.43521	-0.188000	0.12872	CTC			0.577	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269008.1		NM_006885	
ELAC2	60528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	12921085	12921085	+	Silent	SNP	C	C	T	rs370459638		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:12921085C>T	ENST00000338034.4	-	1	419	c.180G>A	c.(178-180)ctG>ctA	p.L60L	ELAC2_ENST00000609345.1_5'Flank|ELAC2_ENST00000578071.1_Silent_p.L60L|ELAC2_ENST00000395962.2_Silent_p.L60L|ELAC2_ENST00000426905.3_Silent_p.L60L	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	60					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						CCACCACCTGCAGGTACACGG	0.736																																					p.L60L													.	.			0			c.G180A							C	,,	0,4320		0,0,2160	10.0	15.0	14.0		180,180,180	3.2	1.0	17		14	1,8499		0,1,4249	no	coding-synonymous,coding-synonymous,coding-synonymous	ELAC2	NM_001165962.1,NM_018127.6,NM_173717.1	,,	0,1,6409	TT,TC,CC		0.0118,0.0,0.0078	,,	60/787,60/827,60/826	12921085	1,12819	2160	4250	6410	SO:0001819	synonymous_variant	60528	exon1			CACCTGCAGGTAC	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.180G>A	17.37:g.12921085C>T			Somatic	46	0	0		WXS	Illumina HiSeq	.	53	0.19	10	NM_001165962	89	0.36	32	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Silent	SNP	ENST00000338034.4	37	CCDS11164.1																																																																																					0.736	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000129934.5			
TUBG2	27175	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	40817522	40817522	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:40817522G>A	ENST00000251412.7	+	7	834	c.635G>A	c.(634-636)cGg>cAg	p.R212Q	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	212					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		GCCCTGAACCGGATTGCCACA	0.567																																					p.R212Q													.	.			0			c.G635A												180.0	172.0	175.0					17																	40817522		2203	4300	6503	SO:0001583	missense	27175	exon7			TGAACCGGATTGC	AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.635G>A	17.37:g.40817522G>A	ENSP00000251412:p.Arg212Gln		Somatic	100	0	0		WXS	Illumina HiSeq	.	141	0.06	8	NM_016437	69	0.06	4	A6NDI4|Q32NB2	Missense_Mutation	SNP	ENST00000251412.7	37	CCDS32658.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914990	0.52546	.	.	ENSG00000037042	ENST00000251412	T	0.68479	-0.33	4.8	1.64	0.23874	Tubulin/FtsZ, GTPase domain (4);	0.064970	0.64402	D	0.000005	T	0.60209	0.2251	M	0.81112	2.525	0.58432	D	0.999995	P	0.49783	0.928	B	0.36608	0.229	T	0.61048	-0.7141	10	0.87932	D	0	-37.5257	7.3675	0.26781	0.1457:0.0:0.7182:0.1361	.	212	Q9NRH3	TBG2_HUMAN	Q	212	ENSP00000251412:R212Q	ENSP00000251412:R212Q	R	+	2	0	TUBG2	38071048	1.000000	0.71417	0.997000	0.53966	0.252000	0.25951	7.863000	0.87023	0.175000	0.19841	-0.136000	0.14681	CGG			0.567	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452326.1		NM_016437	
NMT1	4836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	43173564	43173564	+	Silent	SNP	A	A	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:43173564A>T	ENST00000592782.1	+	6	638	c.507A>T	c.(505-507)ctA>ctT	p.L169L	NMT1_ENST00000258960.2_Silent_p.L169L|NMT1_ENST00000590114.1_3'UTR			P30419	NMT1_HUMAN	N-myristoyltransferase 1	169					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)	p.L169L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				CTTTACAGCTAAAAGAACTGT	0.433																																					p.L169L													NMT1,NS,carcinoma,0,1	NMT1	0	1	1	Substitution - coding silent(1)	kidney(1)	c.A507T												145.0	136.0	139.0					17																	43173564		2203	4300	6503	SO:0001819	synonymous_variant	4836	exon5			ACAGCTAAAAGAA		CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.507A>T	17.37:g.43173564A>T			Somatic	76	0	0		WXS	Illumina HiSeq	.	101	0.16	16	NM_021079	182	0.26	47	A8K7C1|Q9UE09	Silent	SNP	ENST00000592782.1	37	CCDS11494.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.034505	0.35893	.	.	ENSG00000136448	ENST00000543908	.	.	.	5.65	0.127	0.14727	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.6584	7.7356	0.28812	0.1842:0.3212:0.4946:0.0	.	.	.	.	X	130	.	ENSP00000439263:K130X	K	+	1	0	NMT1	40529090	0.999000	0.42202	0.997000	0.53966	0.331000	0.28603	0.436000	0.21526	-0.041000	0.13558	-0.798000	0.03219	AAA			0.433	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449239.1		NM_021079	
HEXIM1	10614	broad.mit.edu	37	17	43229647	43229648	+	IGR	INS	-	-	A	rs61347123|rs66651362|rs12450963|rs141039553|rs71373537		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:43229647_43229648insA	ENST00000332499.2	+	0	4785				AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						tttctttatttttttttttttt	0.455																																					.													.	HEXIM1	25		0			.																																									SO:0001628	intergenic_variant	0	.			TTTATTTTTTTTT	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992			17.37:g.43229647_43229648insA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	7	0.71	5	.	0		0	B2R8Y5	RNA	INS	ENST00000332499.2	37	CCDS11495.1																																																																																					0.455	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449821.2		NM_006460	
LRRC37A2	474170	broad.mit.edu	37	17	44627781	44627781	+	Splice_Site	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:44627781C>T	ENST00000576629.1	+	11	5200	c.4705C>T	c.(4705-4707)Ctc>Ttc	p.L1569F	ARL17A_ENST00000329240.4_Intron|ARL17A_ENST00000445552.2_Intron|ARL17A_ENST00000337845.7_Intron|LRRC37A2_ENST00000333412.3_Splice_Site_p.L1569F|ARL17A_ENST00000573185.1_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1569						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TTTTTTTTAGCTCAAAAAAGA	0.323																																					p.L1569F													.	LRRC37A2	37		0			c.C4705T												46.0	44.0	44.0					17																	44627781		2026	3985	6011	SO:0001630	splice_region_variant	474170	exon10			TTTTAGCTCAAAA	AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.4705-1C>T	17.37:g.44627781C>T			Somatic	151	0.0198675497	3		WXS	Illumina HiSeq	Phase_I	203	0.04	9	NM_001006607	6	0.00	0	B7ZMC3	Splice_Site	SNP	ENST00000576629.1	37	CCDS42353.1	.	.	.	.	.	.	.	.	.	.	c	7.240	0.601118	0.13939	.	.	ENSG00000238083	ENST00000333412	T	0.51817	0.69	3.19	0.16	0.14972	.	.	.	.	.	T	0.55737	0.1939	L	0.55743	1.74	0.09310	N	0.999991	B;D;B	0.69078	0.01;0.997;0.44	B;D;B	0.70227	0.002;0.968;0.08	T	0.41016	-0.9532	8	.	.	.	.	5.2125	0.15325	0.0:0.5916:0.0:0.4084	.	1569;530;1569	C9JSP5;B3KRJ4;A6NM11	.;.;L37A2_HUMAN	F	1569	ENSP00000333071:L1569F	.	L	+	1	0	LRRC37A2	41983097	0.005000	0.15991	0.071000	0.20095	0.116000	0.19942	-0.715000	0.04997	0.185000	0.20105	0.175000	0.17021	CTC			0.323	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440299.2		NM_001006607	Missense_Mutation
EPN3	55040	mdanderson.org	37	17	48614207	48614207	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:48614207G>T	ENST00000268933.3	+	2	869	c.290G>T	c.(289-291)cGc>cTc	p.R97L	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000537145.1_Missense_Mutation_p.R152L|EPN3_ENST00000541226.1_Missense_Mutation_p.R41L	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	97	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)	p.R97H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CACCAGTGCCGCGAGAACCTC	0.602																																					p.R97L													EPN3,mouth,carcinoma,0,1	EPN3	0	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G290T												111.0	101.0	104.0					17																	48614207		2203	4300	6503	SO:0001583	missense	55040	exon2			AGTGCCGCGAGAA	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.290G>T	17.37:g.48614207G>T	ENSP00000268933:p.Arg97Leu		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_017957	1	0.00	0	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235833	0.58886	.	.	ENSG00000049283	ENST00000268933;ENST00000503246;ENST00000442715;ENST00000537145;ENST00000541226;ENST00000515126;ENST00000507467;ENST00000411703	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.28	4.32	0.51571	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.130598	0.52532	D	0.000063	T	0.66268	0.2772	M	0.84433	2.695	0.42793	D	0.9939	D;D;D	0.58970	0.984;0.98;0.968	P;P;P	0.61658	0.892;0.827;0.672	T	0.70389	-0.4885	10	0.59425	D	0.04	-14.6161	9.9144	0.41425	0.1575:0.0:0.8425:0.0	.	152;152;97	B4DK18;F6QWW5;Q9H201	.;.;EPN3_HUMAN	L	97;97;152;152;41;97;97;97	ENSP00000268933:R97L;ENSP00000426762:R97L;ENSP00000439512:R152L;ENSP00000440540:R41L;ENSP00000422601:R97L;ENSP00000421515:R97L	ENSP00000268933:R97L	R	+	2	0	EPN3	45969206	0.991000	0.36638	0.912000	0.35992	0.995000	0.86356	2.304000	0.43655	1.235000	0.43724	0.561000	0.74099	CGC			0.602	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367573.1		NM_017957	
SPAG9	9043	ucsc.edu	37	17	49124780	49124780	+	Silent	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:49124780G>A	ENST00000262013.7	-	4	754	c.546C>T	c.(544-546)ctC>ctT	p.L182L	SPAG9_ENST00000510283.1_5'Flank|RP11-481C4.1_ENST00000509833.1_RNA|SPAG9_ENST00000505279.1_Silent_p.L182L|SPAG9_ENST00000357122.4_Silent_p.L182L	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	182					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CACTCCCTGAGAGCTGATGAA	0.284																																					p.L182L													.	SPAG9	151		0			c.C546T												119.0	118.0	118.0					17																	49124780		2203	4298	6501	SO:0001819	synonymous_variant	9043	exon4			CCCTGAGAGCTGA	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.546C>T	17.37:g.49124780G>A			Somatic	37	0	0		WXS	Illumina HiSeq		36	0.11	4	NM_001130528	43	0.00	0	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Silent	SNP	ENST00000262013.7	37	CCDS45740.1																																																																																					0.284	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000368543.2		NM_003971	
MKS1	54903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56293605	56293605	+	Splice_Site	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:56293605C>G	ENST00000393119.2	-	4	336		c.e4-1		MKS1_ENST00000546108.1_Splice_Site|MKS1_ENST00000337050.7_Splice_Site|MKS1_ENST00000313863.6_Splice_Site|LPO_ENST00000582328.1_5'Flank|MKS1_ENST00000537529.2_Splice_Site	NM_017777.3	NP_060247.2	Q9NXB0	MKS1_HUMAN	Meckel syndrome, type 1						branching morphogenesis of an epithelial tube (GO:0048754)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				endometrium(5)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						CTACTTCAAACTGAGGTTACC	0.393																																					.													.	.			0			c.232-1G>C												106.0	96.0	100.0					17																	56293605		1850	4100	5950	SO:0001630	splice_region_variant	54903	exon5			TTCAAACTGAGGT	DQ185029	CCDS11603.2, CCDS54148.1	17q21-q24	2014-09-17			ENSG00000011143	ENSG00000011143			7121	protein-coding gene	gene with protein product	"""POC12 centriolar protein homolog (Chlamydomonas)"""	609883		MKS		7550354, 16415886, 18327255	Standard	NM_017777		Approved	FLJ20345, POC12, BBS13	uc002ivr.2	Q9NXB0	OTTHUMG00000133714	ENST00000393119.2:c.262-1G>C	17.37:g.56293605C>G			Somatic	35	0	0		WXS	Illumina HiSeq	.	40	0.28	11	NM_001165927	0		0	B7WNX4|F5H885|Q284T0|Q96G13	Splice_Site	SNP	ENST00000393119.2	37	CCDS11603.2	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574633	0.86542	.	.	ENSG00000011143	ENST00000537529;ENST00000393120;ENST00000393119;ENST00000313863;ENST00000337050	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.661	0.91471	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MKS1	53648604	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.298000	0.78815	2.770000	0.95276	0.643000	0.83706	.			0.393	MKS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258015.2		NM_017777	Intron
MARCH10	162333	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	60814457	60814457	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:60814457G>T	ENST00000311269.5	-	6	1046	c.772C>A	c.(772-774)Ccc>Acc	p.P258T	MARCH10_ENST00000456609.2_Missense_Mutation_p.P258T|RP11-156L14.1_ENST00000582564.1_RNA|RP11-156L14.1_ENST00000579201.1_RNA|RP11-156L14.1_ENST00000584597.1_RNA|RP11-156L14.1_ENST00000577270.1_RNA|MARCH10_ENST00000544856.2_Missense_Mutation_p.P257T|MARCH10_ENST00000583600.1_Missense_Mutation_p.P296T	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	258					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						ACAGTGGTGGGTGTGAGTGGT	0.493																																					p.P258T													.	MARCH10	102		0			c.C772A												119.0	120.0	120.0					17																	60814457		2203	4300	6503	SO:0001583	missense	162333	exon6			TGGTGGGTGTGAG	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.772C>A	17.37:g.60814457G>T	ENSP00000311496:p.Pro258Thr		Somatic	180	0.0055555556	1		WXS	Illumina HiSeq	Phase_I	168	0.27	46	NM_001100875	0		0	D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	ENST00000311269.5	37	CCDS11635.1	.	.	.	.	.	.	.	.	.	.	G	8.197	0.797283	0.16327	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	T;T;T	0.32515	1.45;1.45;1.45	4.98	-3.63	0.04529	.	1.110450	0.06812	N	0.790540	T	0.08358	0.0208	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.16603	0.01;0.018;0.01	B;B;B	0.14578	0.005;0.011;0.005	T	0.28522	-1.0041	10	0.02654	T	1	0.9716	0.4768	0.00541	0.3957:0.1343:0.1665:0.3035	.	257;257;258	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	T	258;258;257	ENSP00000416177:P258T;ENSP00000311496:P258T;ENSP00000443746:P257T	ENSP00000311496:P258T	P	-	1	0	MARCH10	58168189	0.001000	0.12720	0.000000	0.03702	0.065000	0.16274	-0.240000	0.08952	-0.452000	0.07087	-0.291000	0.09656	CCC			0.493	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000445252.1		NM_152598	
GPS1	2873	mdanderson.org	37	17	80012851	80012851	+	Splice_Site	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr17:80012851G>T	ENST00000306823.6	+	5	722	c.699G>T	c.(697-699)gaG>gaT	p.E233D	GPS1_ENST00000355130.2_Splice_Site_p.E269D|GPS1_ENST00000578552.1_Splice_Site_p.E229D|GPS1_ENST00000320548.4_Splice_Site_p.E213D|GPS1_ENST00000392358.2_Splice_Site_p.E269D			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	233					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			AGATTGCCGAGGTACGGGCCA	0.617																																					p.E269D													.	.			0			c.G807T												70.0	69.0	69.0					17																	80012851		2203	4300	6503	SO:0001630	splice_region_variant	2873	exon5			TGCCGAGGTACGG		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.699+1G>T	17.37:g.80012851G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_212492	542	0.00	0	Q8NA10|Q9BWL1	Missense_Mutation	SNP	ENST00000306823.6	37	CCDS32774.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911098	0.33721	.	.	ENSG00000169727	ENST00000392358;ENST00000320548;ENST00000306823;ENST00000355130;ENST00000392357	.	.	.	4.63	4.63	0.57726	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.55321	0.1913	L	0.39147	1.195	0.80722	D	1	B;B;B;B;B;B	0.20988	0.009;0.001;0.05;0.007;0.005;0.002	B;B;B;B;B;B	0.33254	0.036;0.015;0.16;0.021;0.02;0.013	T	0.52540	-0.8562	9	0.31617	T	0.26	-42.3675	11.5222	0.50558	0.0964:0.0:0.9036:0.0	.	225;269;218;229;233;269	B4DND6;A8K070;Q13098-6;Q13098-5;Q13098;Q13098-7	.;.;.;.;CSN1_HUMAN;.	D	269;219;233;269;154	.	ENSP00000302873:E233D	E	+	3	2	GPS1	77606140	1.000000	0.71417	1.000000	0.80357	0.410000	0.31052	7.289000	0.78701	2.141000	0.66446	0.591000	0.81541	GAG			0.617	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000442176.1		NM_212492	Missense_Mutation
NAPG	8774	mdanderson.org	37	18	10526105	10526105	+	Silent	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr18:10526105G>T	ENST00000322897.6	+	1	75	c.6G>T	c.(4-6)gcG>gcT	p.A2A	NAPG_ENST00000542979.1_5'UTR	NM_003826.2	NP_003817.1	Q99747	SNAG_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, gamma	2					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)				large_intestine(2)|lung(2)	4						TGGAGATGGCGGCTCAGAAGA	0.602																																					p.A2A													NAPG,NS,carcinoma,+2,1	NAPG	2	1	0			c.G6T												48.0	57.0	54.0					18																	10526105		1964	4142	6106	SO:0001819	synonymous_variant	8774	exon1			GATGGCGGCTCAG	U78107	CCDS45827.1	18p11.21	2013-02-28			ENSG00000134265	ENSG00000134265			7642	protein-coding gene	gene with protein product	"""gamma SNAP"""	603216				9269766	Standard	NM_003826		Approved		uc002kon.3	Q99747	OTTHUMG00000179119	ENST00000322897.6:c.6G>T	18.37:g.10526105G>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_003826	35	0.00	0	B4DFC9|Q9BUV1	Silent	SNP	ENST00000322897.6	37	CCDS45827.1																																																																																					0.602	NAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444873.1		NM_003826	
NEDD4L	23327	bcgsc.ca	37	18	56057876	56057876	+	Splice_Site	SNP	A	A	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr18:56057876A>G	ENST00000400345.3	+	29	2938		c.e29-1		NEDD4L_ENST00000357895.5_Splice_Site|NEDD4L_ENST00000589054.1_Splice_Site|NEDD4L_ENST00000256832.7_Splice_Site|NEDD4L_ENST00000256830.9_Splice_Site|NEDD4L_ENST00000435432.2_Splice_Site|NEDD4L_ENST00000586263.1_Splice_Site|NEDD4L_ENST00000456986.1_Splice_Site|NEDD4L_ENST00000456173.2_Splice_Site|NEDD4L_ENST00000382850.4_Splice_Site|NEDD4L_ENST00000356462.6_Splice_Site|NEDD4L_ENST00000431212.2_Splice_Site	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase						cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						CTCTGTTCATAGGCTGTGCTA	0.478																																					.													.	NEDD4L	126		0			c.2596-2A>G												65.0	63.0	64.0					18																	56057876		2032	4193	6225	SO:0001630	splice_region_variant	23327	exon28			GTTCATAGGCTGT	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.2656-1A>G	18.37:g.56057876A>G			Somatic	82	0	0		WXS	Illumina HiSeq	Phase_1	60	0.07	4	NM_015277	1	0.00	0	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Splice_Site	SNP	ENST00000400345.3	37	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.760589	0.89932	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9027	0.79392	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NEDD4L	54208856	1.000000	0.71417	0.922000	0.36590	0.882000	0.50991	9.283000	0.95860	2.146000	0.66826	0.533000	0.62120	.			0.478	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000448749.1			Intron
ZNF516	9658	broad.mit.edu	37	18	74154244	74154244	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr18:74154244G>T	ENST00000443185.2	-	3	1084	c.767C>A	c.(766-768)gCc>gAc	p.A256D	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A256D(2)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGGCTGAAGGCCTGGCCACA	0.687																																					p.A256D													ZNF516,NS,carcinoma,0,2	ZNF516	102	2	2	Substitution - Missense(2)	kidney(2)	c.C767A												17.0	20.0	19.0					18																	74154244		2007	4189	6196	SO:0001583	missense	9658	exon3			CTGAAGGCCTGGC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.767C>A	18.37:g.74154244G>T	ENSP00000394757:p.Ala256Asp		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	50	0.12	6	NM_014643	15	0.07	1		Missense_Mutation	SNP	ENST00000443185.2	37		.	.	.	.	.	.	.	.	.	.	G	18.16	3.562224	0.65538	.	.	ENSG00000101493	ENST00000443185	T	0.52295	0.67	4.52	4.52	0.55395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.074994	0.53938	D	0.000047	T	0.65637	0.2710	.	.	.	0.37315	D	0.909299	D	0.76494	0.999	D	0.73708	0.981	T	0.72924	-0.4144	9	0.87932	D	0	-8.9982	11.3066	0.49338	0.084:0.0:0.916:0.0	.	256	Q92618	ZN516_HUMAN	D	256	ENSP00000394757:A256D	ENSP00000394757:A256D	A	-	2	0	ZNF516	72283232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.515000	0.67049	2.508000	0.84585	0.650000	0.86243	GCC			0.687	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding				NM_014643	
POLRMT	5442	mdanderson.org	37	19	619021	619021	+	Silent	SNP	G	G	T	rs14155	byFrequency	TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:619021G>T	ENST00000588649.2	-	15	3327	c.3243C>A	c.(3241-3243)ccC>ccA	p.P1081P	AC005559.2_ENST00000591847.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	1081	Mediates interaction with TEFM.				gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)	p.P1081P(1)		cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGGCGATAGGGCTGGATGA	0.637																																					p.P1081P													POLRMT,colon,carcinoma,0,2	POLRMT	0	2	1	Substitution - coding silent(1)	stomach(1)	c.C3243A												59.0	50.0	53.0					19																	619021		2197	4299	6496	SO:0001819	synonymous_variant	5442	exon15			GCGATAGGGCTGG		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.3243C>A	19.37:g.619021G>T			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	73	0.04	3	NM_005035	86	0.00	0	O60370	Silent	SNP	ENST00000588649.2	37	CCDS12036.1																																																																																					0.637	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452172.3		NM_005035	
C19orf25	148223	mdanderson.org	37	19	1482101	1482101	+	5'Flank	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:1482101G>A	ENST00000436106.2	-	0	0				C19orf25_ENST00000586564.1_5'Flank|PCSK4_ENST00000300954.5_Missense_Mutation_p.A642V|C19orf25_ENST00000588871.1_5'Flank|C19orf25_ENST00000592872.1_5'Flank|C19orf25_ENST00000588427.1_5'Flank|C19orf25_ENST00000591027.1_5'Flank|CTB-25B13.6_ENST00000585643.1_RNA|C19orf25_ENST00000427685.2_5'Flank|C19orf25_ENST00000585675.1_5'Flank			Q9UFG5	CS025_HUMAN	chromosome 19 open reading frame 25														Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGGGCGCCGCCGTGTGCCC	0.711																																					p.A642V													.	.			0			c.C1925T												7.0	5.0	5.0					19																	1482101		2014	3984	5998	SO:0001631	upstream_gene_variant	54760	exon15			GGCGCCGCCGTGT	AK075267	CCDS45898.1	19p13.3	2012-10-24			ENSG00000119559	ENSG00000119559			26711	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_152482		Approved	FLJ36666	uc010dsk.3	Q9UFG5	OTTHUMG00000180092		19.37:g.1482101G>A	Exception_encountered		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_017573	22	0.00	0	B3KQN6|Q8N9R7|Q8WV94	Missense_Mutation	SNP	ENST00000436106.2	37	CCDS45898.1	.	.	.	.	.	.	.	.	.	.	G	6.268	0.417639	0.11870	.	.	ENSG00000115257	ENST00000300954	T	0.62788	0.0	4.22	2.06	0.26882	Growth factor, receptor (1);	3.291290	0.02080	U	0.052281	T	0.53417	0.1795	L	0.43152	1.355	0.09310	N	1	B	0.15473	0.013	B	0.08055	0.003	T	0.17531	-1.0366	10	0.16896	T	0.51	.	6.5428	0.22390	0.2317:0.0:0.7683:0.0	.	642	Q6UW60	PCSK4_HUMAN	V	642	ENSP00000300954:A642V	ENSP00000300954:A642V	A	-	2	0	PCSK4	1433101	0.000000	0.05858	0.002000	0.10522	0.021000	0.10359	-1.894000	0.01607	0.264000	0.21851	0.462000	0.41574	GCG			0.711	C19orf25-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449694.1		NM_152482	
LONP1	9361	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	5696679	5696690	+	Splice_Site	DEL	ACCTCGTCGATG	ACCTCGTCGATG	-	rs368178461|rs11551018|rs374023976	byFrequency	TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	ACCTCGTCGATG	ACCTCGTCGATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:5696679_5696690delACCTCGTCGATG	ENST00000360614.3	-	11	1921_1931	c.1764_1774delCATCGACGAGGT	c.(1762-1776)ctcatcgacgaggtt>cttt	p.IDEV589del	LONP1_ENST00000540670.2_Splice_Site_p.IDEV393del|LONP1_ENST00000590729.1_Splice_Site_p.IDEV459del|LONP1_ENST00000593119.1_Splice_Site_p.IDEV525del|LONP1_ENST00000585374.1_Splice_Site_p.IDEV475del	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTCCGCACGCACCTCGTCGATGAGGATCAGGG	0.642																																					p.589_591del													.	.			0			c.1765_1773del																																									SO:0001630	splice_region_variant	9361	exon11			GCACGCACCTCGT	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1773+1CATCGACGAGGT>-	19.37:g.5696679_5696690delACCTCGTCGATG			Somatic	57	0	0		WXS	Illumina HiSeq	.	37	0.27	10	NM_004793	5	0.00	0		In_Frame_Del	DEL	ENST00000360614.3	37	CCDS12148.1																																																																																					0.642	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451662.1		NM_004793	In_Frame_Del
ZNF358	140467	mdanderson.org	37	19	7585369	7585369	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:7585369C>T	ENST00000597229.1	+	2	1411	c.1241C>T	c.(1240-1242)gCg>gTg	p.A414V	ZNF358_ENST00000394341.2_Missense_Mutation_p.A414V|MCOLN1_ENST00000264079.6_5'Flank|CTD-2207O23.11_ENST00000602083.1_RNA	NM_018083.4	NP_060553.4	Q9NW07	ZN358_HUMAN	zinc finger protein 358	414	Poly-Ala.				embryonic forelimb morphogenesis (GO:0035115)|neural tube development (GO:0021915)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|lung(1)|skin(2)	8						gctgcagcagcggccgccgGC	0.701																																					p.A414V													.	.			0			c.C1241T												4.0	5.0	4.0					19																	7585369		1605	3355	4960	SO:0001583	missense	140467	exon2			CAGCAGCGGCCGC	AK001252	CCDS32890.2	19p13.2	2013-01-08			ENSG00000198816	ENSG00000198816		"""Zinc fingers, C2H2-type"""	16838	protein-coding gene	gene with protein product							Standard	NM_018083		Approved	FLJ10390, ZFEND	uc002mgn.2	Q9NW07		ENST00000597229.1:c.1241C>T	19.37:g.7585369C>T	ENSP00000472305:p.Ala414Val		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	29	0.07	2	NM_018083	15	0.00	0	Q9BTM7	Missense_Mutation	SNP	ENST00000597229.1	37	CCDS32890.2	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728565	0.30593	.	.	ENSG00000198816	ENST00000361576;ENST00000394341	T	0.09163	3.01	2.76	2.76	0.32466	.	.	.	.	.	T	0.10380	0.0254	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	P	0.61132	0.884	T	0.28776	-1.0033	9	0.14252	T	0.57	-1.0289	9.175	0.37107	0.0:1.0:0.0:0.0	.	414	Q9NW07	ZN358_HUMAN	V	414	ENSP00000377873:A414V	ENSP00000354703:A414V	A	+	2	0	ZNF358	7491369	0.001000	0.12720	0.017000	0.16124	0.026000	0.11368	-0.405000	0.07196	1.875000	0.54330	0.443000	0.29094	GCG			0.701	ZNF358-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316747.1			
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15284960	15284960	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:15284960T>C	ENST00000263388.2	-	25	4730	c.4655A>G	c.(4654-4656)cAg>cGg	p.Q1552R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1552					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GACCATGGCCTGGCCGTGCGC	0.701																																					p.Q1552R													.	.			0			c.A4655G												21.0	29.0	27.0					19																	15284960		2196	4294	6490	SO:0001583	missense	4854	exon25			ATGGCCTGGCCGT	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4655A>G	19.37:g.15284960T>C	ENSP00000263388:p.Gln1552Arg		Somatic	31	0	0		WXS	Illumina HiSeq	.	25	0.36	9	NM_000435	63	0.40	25	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.138376	0.56936	.	.	ENSG00000074181	ENST00000263388	D	0.86956	-2.19	4.83	4.83	0.62350	Notch, NOD domain (1);	.	.	.	.	T	0.77110	0.4082	N	0.13098	0.295	0.35301	D	0.783016	B	0.13594	0.008	B	0.22386	0.039	T	0.75345	-0.3350	9	0.20519	T	0.43	.	13.3666	0.60687	0.0:0.0:0.0:1.0	.	1552	Q9UM47	NOTC3_HUMAN	R	1552	ENSP00000263388:Q1552R	ENSP00000263388:Q1552R	Q	-	2	0	NOTCH3	15145960	0.990000	0.36364	0.999000	0.59377	0.991000	0.79684	7.744000	0.85034	1.812000	0.52913	0.402000	0.26972	CAG			0.701	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465714.1		NM_000435	
ZNF849P	100130108	bcgsc.ca	37	19	22868586	22868586	+	RNA	SNP	T	T	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:22868586T>G	ENST00000601860.1	-	0	340																											TTACTACACATAAGAGAATTC	0.383																																					.													.	.			0			.																																											0	.			TACACATAAGAGA																													19.37:g.22868586T>G			Somatic	183	0	0		WXS	Illumina HiSeq	Phase_1	169	0.36	61	.	10	0.40	4		Missense_Mutation	SNP	ENST00000601860.1	37		.	.	.	.	.	.	.	.	.	.	.	10.69	1.420348	0.25552	.	.	ENSG00000198153	ENST00000340708	.	.	.	0.828	0.828	0.18841	.	.	.	.	.	T	0.46737	0.1408	.	.	.	.	.	.	.	.	.	.	.	.	T	0.55730	-0.8095	4	0.87932	D	0	.	5.5763	0.17225	0.0:0.0:0.0:1.0	.	.	.	.	Q	206	.	ENSP00000342595:H206Q	H	+	3	2	AC011467.1	22660426	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	-0.706000	0.05047	0.249000	0.21456	0.246000	0.17985	CAT			0.383	CTC-457E21.9-001	KNOWN	basic	antisense	antisense		OTTHUMT00000464586.1			
SLC7A9	11136	mdanderson.org	37	19	33353095	33353095	+	Missense_Mutation	SNP	G	G	T	rs372980958		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:33353095G>T	ENST00000023064.4	-	6	824	c.633C>A	c.(631-633)ttC>ttA	p.F211L	SLC7A9_ENST00000590341.1_Missense_Mutation_p.F211L|SLC7A9_ENST00000587772.1_Missense_Mutation_p.F211L|RN7SKP22_ENST00000365097.1_RNA	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	211					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.F211F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GGGCGCCCTCGAAAGAATTAT	0.517																																					p.F211L	GBM(181;1335 2108 9644 44178 46689)												SLC7A9,NS,carcinoma,0,2	SLC7A9	0	2	1	Substitution - coding silent(1)	large_intestine(1)	c.C633A	GRCh37	CD010661	SLC7A9	D								68.0	67.0	68.0					19																	33353095		2203	4300	6503	SO:0001583	missense	11136	exon6			GCCCTCGAAAGAA	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.633C>A	19.37:g.33353095G>T	ENSP00000023064:p.Phe211Leu		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001243036	1	0.00	0	B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	CCDS12425.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337950	0.60963	.	.	ENSG00000021488	ENST00000023064	D	0.90324	-2.65	5.12	-0.885	0.10593	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.94604	0.8261	M	0.86651	2.83	0.53688	D	0.999975	D	0.89917	1.0	D	0.81914	0.995	D	0.93022	0.6441	10	0.72032	D	0.01	.	11.6208	0.51117	0.5366:0.0:0.4634:0.0	.	211	P82251	BAT1_HUMAN	L	211	ENSP00000023064:F211L	ENSP00000023064:F211L	F	-	3	2	SLC7A9	38044935	1.000000	0.71417	0.949000	0.38748	0.481000	0.33189	1.717000	0.37991	-0.468000	0.06922	-0.258000	0.10820	TTC			0.517	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450585.1			
SIPA1L3	23094	broad.mit.edu	37	19	38684282	38684282	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:38684282delC	ENST00000222345.6	+	18	5211	c.4702delC	c.(4702-4704)cccfs	p.P1568fs		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1568					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GCCAGGGCTGCCCAGCGACGT	0.746																																					p.P1568fs													.	SIPA1L3	150		0			c.4702delC												8.0	9.0	8.0					19																	38684282		2149	4219	6368	SO:0001589	frameshift_variant	23094	exon18			GGGCTGCCCAGCG	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.4702delC	19.37:g.38684282delC	ENSP00000222345:p.Pro1568fs		Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_015073	5	0.00	0	Q2TV87	Frame_Shift_Del	DEL	ENST00000222345.6	37	CCDS33007.1																																																																																					0.746	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000156294.2		XM_032278	
BCKDHA	593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41932344	41932344	+	IGR	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:41932344C>T	ENST00000269980.2	+	0	2103				CTC-435M10.6_ENST00000598887.1_RNA|B3GNT8_ENST00000601379.1_5'UTR|B3GNT8_ENST00000321702.2_Missense_Mutation_p.D114N	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						CGGCGGAGGTCCTTGGGGTAG	0.672																																					p.D114N													.	.			0			c.G340A												27.0	29.0	28.0					19																	41932344		2202	4299	6501	SO:0001628	intergenic_variant	374907	exon3			GGAGGTCCTTGGG	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41932344C>T			Somatic	54	0	0		WXS	Illumina HiSeq	.	49	0.47	23	NM_198540	3	0.67	2	B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	ENST00000269980.2	37	CCDS12581.1	.	.	.	.	.	.	.	.	.	.	C	2.694	-0.272444	0.05716	.	.	ENSG00000177191	ENST00000321702	T	0.34072	1.38	4.21	2.06	0.26882	.	0.929501	0.08989	N	0.864614	T	0.20618	0.0496	N	0.24115	0.695	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.30765	-0.9967	10	0.15952	T	0.53	.	4.3184	0.11003	0.0:0.5994:0.1902:0.2104	.	114	Q7Z7M8	B3GN8_HUMAN	N	114	ENSP00000312700:D114N	ENSP00000312700:D114N	D	-	1	0	B3GNT8	46624184	0.000000	0.05858	0.126000	0.21872	0.215000	0.24574	0.638000	0.24674	0.536000	0.28733	0.462000	0.41574	GAC			0.672	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398313.3		NM_000709	
ARHGAP35	2909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47422321	47422321	+	Missense_Mutation	SNP	A	A	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:47422321A>T	ENST00000404338.3	+	1	389	c.389A>T	c.(388-390)aAa>aTa	p.K130I		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	130					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										TCAGCTGAAAAACTCATGTAC	0.478																																					p.K130I													.	.			0			c.A389T												64.0	62.0	62.0					19																	47422321		1925	4130	6055	SO:0001583	missense	2909	exon1			CTGAAAAACTCAT	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.389A>T	19.37:g.47422321A>T	ENSP00000385720:p.Lys130Ile		Somatic	91	0	0		WXS	Illumina HiSeq	.	77	0.32	25	NM_004491	18	0.39	7	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.208886	0.58343	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.80480	-1.38	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.90844	0.7124	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92293	0.5843	10	0.87932	D	0	-27.2395	15.3143	0.74062	1.0:0.0:0.0:0.0	.	130	Q9NRY4-2	.	I	130	ENSP00000385720:K130I	ENSP00000324820:K130I	K	+	2	0	ARHGAP35	52114161	1.000000	0.71417	1.000000	0.80357	0.639000	0.38242	9.339000	0.96797	2.264000	0.75181	0.533000	0.62120	AAA			0.478	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466652.1		NM_004491	
TRPM4	54795	mdanderson.org	37	19	49699839	49699839	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:49699839G>T	ENST00000252826.5	+	17	2479	c.2353G>T	c.(2353-2355)Ggc>Tgc	p.G785C	TRPM4_ENST00000355712.5_Missense_Mutation_p.G431C|TRPM4_ENST00000427978.2_Intron	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	785					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CATCTTCATGGGCAACGTGGT	0.701																																					p.G785C													.	.			0			c.G2353T												24.0	21.0	22.0					19																	49699839		2168	4239	6407	SO:0001583	missense	54795	exon17			TTCATGGGCAACG	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.2353G>T	19.37:g.49699839G>T	ENSP00000252826:p.Gly785Cys		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_017636	2	0.00	0	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	37	CCDS33073.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.825029	0.71143	.	.	ENSG00000130529	ENST00000252826;ENST00000355712	D;D	0.96651	-4.08;-4.08	3.28	3.28	0.37604	.	0.126740	0.52532	U	0.000065	D	0.96864	0.8976	M	0.64997	1.995	0.44061	D	0.996802	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.982;0.992;0.998	D	0.95617	0.8677	10	0.46703	T	0.11	-25.5903	8.8777	0.35356	0.1141:0.0:0.8859:0.0	.	431;611;785	B4DIX5;Q8TD43-2;Q8TD43	.;.;TRPM4_HUMAN	C	785;431	ENSP00000252826:G785C;ENSP00000347944:G431C	ENSP00000252826:G785C	G	+	1	0	TRPM4	54391651	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.225000	0.72271	2.142000	0.66516	0.543000	0.68304	GGC			0.701	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000465543.2		NM_017636	
RPL13A	23521	mdanderson.org	37	19	49994344	49994344	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:49994344G>T	ENST00000391857.4	+	6	466	c.390G>T	c.(388-390)aaG>aaT	p.K130N	SNORD33_ENST00000362761.1_RNA|SNORD35A_ENST00000363389.1_RNA|RPL13A_ENST00000477613.2_3'UTR|SNORD32A_ENST00000364805.1_RNA|SNORD34_ENST00000365633.1_RNA	NM_001270491.1|NM_012423.3	NP_001257420.1|NP_036555.1	P40429	RL13A_HUMAN	ribosomal protein L13a	130					cellular protein metabolic process (GO:0044267)|cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of formation of translation preinitiation complex (GO:1901194)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|GAIT complex (GO:0097452)|large ribosomal subunit (GO:0015934)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)	2		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		TGCGTCTGAAGCCTACAAGAA	0.567																																					p.K130N													.	.			0			c.G390T												63.0	57.0	59.0					19																	49994344		2203	4300	6503	SO:0001583	missense	23521	exon6			TCTGAAGCCTACA	X56932	CCDS12768.1, CCDS74421.1	19q13.3	2011-04-06			ENSG00000142541	ENSG00000142541		"""L ribosomal proteins"""	10304	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 1"""	TSTA1			Standard	NM_012423		Approved	L13A	uc031rlt.1	P40429	OTTHUMG00000134289	ENST00000391857.4:c.390G>T	19.37:g.49994344G>T	ENSP00000375730:p.Lys130Asn		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_012423	2619	0.00	0	A8K505	Missense_Mutation	SNP	ENST00000391857.4	37	CCDS12768.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.411132	0.42817	.	.	ENSG00000142541	ENST00000391857	.	.	.	5.61	5.61	0.85477	Ribosomal protein L13 domain (2);	0.000000	0.64402	U	0.000001	T	0.66197	0.2765	M	0.62154	1.92	0.58432	D	0.999998	B;B	0.18013	0.011;0.025	B;B	0.19148	0.016;0.024	T	0.61554	-0.7039	9	0.42905	T	0.14	.	17.4888	0.87696	0.0:0.0:1.0:0.0	.	130;130	Q5QTS3;P40429	.;RL13A_HUMAN	N	130	.	ENSP00000375730:K130N	K	+	3	2	RPL13A	54686156	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	4.536000	0.60636	2.813000	0.96785	0.655000	0.94253	AAG			0.567	RPL13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258989.1			
KCNC3	3748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50826601	50826601	+	Missense_Mutation	SNP	C	C	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr19:50826601C>A	ENST00000477616.1	-	2	1903	c.1609G>T	c.(1609-1611)Gtc>Ttc	p.V537F	KCNC3_ENST00000376959.2_Missense_Mutation_p.V537F|KCNC3_ENST00000391818.2_Intron|KCNC3_ENST00000474951.1_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	537					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	TTGACAATGACGGGCACAGGC	0.617																																					p.V537F	Melanoma(91;1496 2324 50908)												.	.			0			c.G1609T												71.0	68.0	69.0					19																	50826601		2203	4300	6503	SO:0001583	missense	3748	exon2			CAATGACGGGCAC	AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.1609G>T	19.37:g.50826601C>A	ENSP00000434241:p.Val537Phe		Somatic	43	0	0		WXS	Illumina HiSeq	.	41	0.29	12	NM_004977	3	0.33	1		Missense_Mutation	SNP	ENST00000477616.1	37	CCDS12793.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974692	0.74360	.	.	ENSG00000131398	ENST00000376959;ENST00000477616;ENST00000443843	D;D	0.99080	-5.4;-5.4	3.26	3.26	0.37387	Ion transport (1);	0.000000	0.64402	U	0.000014	D	0.99099	0.9690	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98971	1.0801	10	0.87932	D	0	.	13.7855	0.63108	0.0:1.0:0.0:0.0	.	537;537	Q14003;E7ETH1	KCNC3_HUMAN;.	F	537;537;351	ENSP00000366158:V537F;ENSP00000434241:V537F	ENSP00000366158:V537F	V	-	1	0	KCNC3	55518413	1.000000	0.71417	0.991000	0.47740	0.982000	0.71751	7.477000	0.81069	1.841000	0.53522	0.491000	0.48974	GTC			0.617	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314288.2		NM_004977	
ACOXL	55289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	111556598	111556598	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr2:111556598C>G	ENST00000389811.4	+	7	692	c.468C>G	c.(466-468)caC>caG	p.H156Q	ACOXL_ENST00000439055.1_Missense_Mutation_p.H156Q|ACOXL_ENST00000340561.4_Missense_Mutation_p.H156Q			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	156					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						TAGGGCCCCACTGTTTCATCG	0.463																																					p.H156Q													.	.			0			c.C468G												139.0	121.0	127.0					2																	111556598		2203	4300	6503	SO:0001583	missense	55289	exon7			GCCCCACTGTTTC		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.468C>G	2.37:g.111556598C>G	ENSP00000374461:p.His156Gln		Somatic	94	0	0		WXS	Illumina HiSeq	.	121	0.20	24	NM_001142807	64	0.31	20	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Missense_Mutation	SNP	ENST00000389811.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.94|16.94	3.262079|3.262079	0.59431|0.59431	.|.	.|.	ENSG00000153093|ENSG00000153093	ENST00000389811;ENST00000439055;ENST00000340561|ENST00000422487	D;D;D|.	0.98937|.	-5.25;-5.25;-5.25|.	5.35|5.35	2.51|2.51	0.30379|0.30379	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);|.	0.065659|.	0.64402|.	D|.	0.000019|.	T|T	0.60907|0.60907	0.2305|0.2305	L|L	0.56396|0.56396	1.775|1.775	0.36658|0.36658	D|D	0.877786|0.877786	D;D;D|.	0.76494|.	0.999;0.999;0.996|.	D;D;D|.	0.73380|.	0.96;0.974;0.98|.	T|T	0.66771|0.66771	-0.5839|-0.5839	10|6	0.87932|0.87932	D|D	0|0	-31.4712|-31.4712	8.061|8.061	0.30633|0.30633	0.0:0.6645:0.0:0.3355|0.0:0.6645:0.0:0.3355	.|.	156;156;156|.	E9PB20;Q9NUZ1-2;Q9NUZ1|.	.;.;ACOXL_HUMAN|.	Q|S	156|8	ENSP00000374461:H156Q;ENSP00000407761:H156Q;ENSP00000343717:H156Q|.	ENSP00000343717:H156Q|ENSP00000404255:T8S	H|T	+|+	3|2	2|0	ACOXL|ACOXL	111273069|111273069	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	0.417000|0.417000	0.21214|0.21214	0.734000|0.734000	0.32515|0.32515	0.650000|0.650000	0.86243|0.86243	CAC|ACT			0.463	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000254024.2		NM_018308	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152486121	152486121	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr2:152486121C>G	ENST00000172853.10	-	64	9181	c.9034G>C	c.(9034-9036)Ggc>Cgc	p.G3012R	NEB_ENST00000409198.1_Missense_Mutation_p.G3012R|NEB_ENST00000427231.2_Missense_Mutation_p.G3255R|NEB_ENST00000604864.1_Missense_Mutation_p.G3255R|NEB_ENST00000603639.1_Missense_Mutation_p.G3255R|NEB_ENST00000397345.3_Missense_Mutation_p.G3255R			P20929	NEBU_HUMAN	nebulin	3012					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AAGTCGTAGCCTTTCTTTTTT	0.423																																					p.G3255R													.	.			0			c.G9763C												154.0	154.0	154.0					2																	152486121		1912	4122	6034	SO:0001583	missense	4703	exon68			CGTAGCCTTTCTT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9034G>C	2.37:g.152486121C>G	ENSP00000172853:p.Gly3012Arg		Somatic	77	0	0		WXS	Illumina HiSeq	.	94	0.20	19	NM_001271208	9	0.44	4	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	34	5.371430	0.95923	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.27104	1.72;1.86;1.75;1.69	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.65048	0.2654	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72798	-0.4184	10	0.87932	D	0	.	20.1899	0.98228	0.0:1.0:0.0:0.0	.	3012	P20929	NEBU_HUMAN	R	3012;3255;3255;3012	ENSP00000386259:G3012R;ENSP00000380505:G3255R;ENSP00000416578:G3255R;ENSP00000172853:G3012R	ENSP00000172853:G3012R	G	-	1	0	NEB	152194367	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.495000	0.81514	2.873000	0.98535	0.563000	0.77884	GGC			0.423	NEB-201	KNOWN	basic	protein_coding	protein_coding				NM_004543	
SLC4A10	57282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	162751205	162751205	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr2:162751205C>T	ENST00000446997.1	+	11	1304	c.1211C>T	c.(1210-1212)gCc>gTc	p.A404V	SLC4A10_ENST00000415876.2_Missense_Mutation_p.A374V|SLC4A10_ENST00000272716.5_Missense_Mutation_p.A374V|SLC4A10_ENST00000375514.5_Missense_Mutation_p.A385V|SLC4A10_ENST00000421911.1_Missense_Mutation_p.A404V|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000535165.1_Missense_Mutation_p.P375S	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	404					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	CATGATGTTGCCTATAAAGCT	0.318																																					p.A404V													.	.			0			c.C1211T												96.0	86.0	89.0					2																	162751205		1807	4069	5876	SO:0001583	missense	57282	exon11			ATGTTGCCTATAA		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1211C>T	2.37:g.162751205C>T	ENSP00000393066:p.Ala404Val		Somatic	86	0	0		WXS	Illumina HiSeq	.	105	0.26	27	NM_001178015	0		0	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	CCDS54411.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.166251|5.166251	0.94768|0.94768	.|.	.|.	ENSG00000144290|ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711|ENST00000535165	T;T;T;T;T|T	0.80824|0.51071	-1.42;-1.42;-1.42;-1.42;-1.42|0.72	5.43|5.43	5.43|5.43	0.79202|0.79202	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68091|0.68091	0.2963|0.2963	M|M	0.85859|0.85859	2.78|2.78	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;1.0;0.999|.	D;D;D;D|.	0.91635|.	0.999;0.996;0.999;0.989|.	T|T	0.64076|0.64076	-0.6492|-0.6492	10|7	0.59425|0.17369	D|T	0.04|0.5	.|.	19.6166|19.6166	0.95636|0.95636	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	385;404;374;404|.	F8W675;E7EW28;Q6U841-2;Q6U841|.	.;.;.;S4A10_HUMAN|.	V|S	385;374;374;373;404;404;403|375	ENSP00000364664:A385V;ENSP00000395797:A374V;ENSP00000272716:A374V;ENSP00000393066:A404V;ENSP00000404486:A404V|ENSP00000437527:P375S	ENSP00000272716:A374V|ENSP00000437527:P375S	A|P	+|+	2|1	0|0	SLC4A10|SLC4A10	162459451|162459451	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	7.776000|7.776000	0.85560|0.85560	2.721000|2.721000	0.93114|0.93114	0.655000|0.655000	0.94253|0.94253	GCC|CCT			0.318	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000333090.1		NM_022058	
ABCB11	8647	mdanderson.org	37	2	169787208	169787208	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr2:169787208C>G	ENST00000263817.6	-	25	3502	c.3378G>C	c.(3376-3378)ttG>ttC	p.L1126F		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	1126	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	AGAAACGTTCCAACAGCTGAA	0.483																																					p.L1126F													.	.			0			c.G3378C												79.0	76.0	77.0					2																	169787208		2029	4177	6206	SO:0001583	missense	8647	exon25			ACGTTCCAACAGC	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.3378G>C	2.37:g.169787208C>G	ENSP00000263817:p.Leu1126Phe		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	70	0.07	5	NM_003742	0		0	Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256553	0.80246	.	.	ENSG00000073734	ENST00000263817	D	0.95656	-3.77	6.08	6.08	0.98989	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.97807	0.9280	M	0.87097	2.86	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.995;1.0	D	0.97994	1.0356	10	0.87932	D	0	.	13.8141	0.63281	0.0:0.9304:0.0:0.0696	.	568;1126	B4DZQ8;O95342	.;ABCBB_HUMAN	F	1126	ENSP00000263817:L1126F	ENSP00000263817:L1126F	L	-	3	2	ABCB11	169495454	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.263000	0.51546	2.890000	0.99128	0.655000	0.94253	TTG			0.483	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333616.2		NM_003742	
DLX2	1746	broad.mit.edu	37	2	172965287	172965287	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr2:172965287G>T	ENST00000234198.4	-	3	1332	c.971C>A	c.(970-972)gCg>gAg	p.A324E	AC104801.1_ENST00000448117.1_lincRNA|DLX2_ENST00000466293.2_3'UTR	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	324					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			AATCGTCCCCGCGCTCACCGG	0.677																																					p.A324E	GBM(188;775 2993 11256 23072)												.	DLX2	29		0			c.C971A												22.0	26.0	25.0					2																	172965287		2200	4287	6487	SO:0001583	missense	1746	exon3			GTCCCCGCGCTCA	U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.971C>A	2.37:g.172965287G>T	ENSP00000234198:p.Ala324Glu		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	70	0.04	3	NM_004405	1	0.00	0	B4DMK4|B7ZA14	Missense_Mutation	SNP	ENST00000234198.4	37	CCDS2248.1	.	.	.	.	.	.	.	.	.	.	G	32	5.122899	0.94429	.	.	ENSG00000115844	ENST00000234198	D	0.91464	-2.85	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	D	0.89701	0.6791	N	0.08118	0	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.92434	0.5956	10	0.72032	D	0.01	-13.9839	15.8472	0.78901	0.0:0.0:1.0:0.0	.	324	Q07687	DLX2_HUMAN	E	324	ENSP00000234198:A324E	ENSP00000234198:A324E	A	-	2	0	DLX2	172673533	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	6.251000	0.72441	2.004000	0.58718	0.462000	0.41574	GCG			0.677	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255368.3			
HECW2	57520	mdanderson.org	37	2	197084819	197084819	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr2:197084819G>T	ENST00000260983.3	-	26	4534	c.4352C>A	c.(4351-4353)gCa>gAa	p.A1451E	HECW2_ENST00000409111.1_Missense_Mutation_p.A1095E	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1451	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						AGCTGTGCCTGCGATGACCAA	0.403																																					p.A1451E													.	.			0			c.C4352A												128.0	123.0	125.0					2																	197084819		2203	4300	6503	SO:0001583	missense	57520	exon26			GTGCCTGCGATGA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4352C>A	2.37:g.197084819G>T	ENSP00000260983:p.Ala1451Glu		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_020760	9	0.00	0	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095055	0.94197	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.56776	0.44;0.44	5.11	5.11	0.69529	HECT (4);	0.000000	0.85682	D	0.000000	T	0.67392	0.2888	L	0.43701	1.375	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69793	-0.5049	10	0.87932	D	0	.	18.7211	0.91694	0.0:0.0:1.0:0.0	.	1451	Q9P2P5	HECW2_HUMAN	E	1095;1451	ENSP00000386775:A1095E;ENSP00000260983:A1451E	ENSP00000260983:A1451E	A	-	2	0	HECW2	196793064	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.263000	0.95617	2.637000	0.89404	0.655000	0.94253	GCA			0.403	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335199.3		NM_020760	
SP140	11262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	231174675	231174675	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr2:231174675G>T	ENST00000392045.3	+	23	2209	c.2095G>T	c.(2095-2097)Gga>Tga	p.G699*	SP140_ENST00000417495.3_Nonsense_Mutation_p.G585*|SP140_ENST00000350136.5_Nonsense_Mutation_p.G568*|SP140_ENST00000420434.3_Nonsense_Mutation_p.G672*|SP140_ENST00000486687.2_Nonsense_Mutation_p.G623*|SP140_ENST00000343805.6_Nonsense_Mutation_p.G639*	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	699					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GTGCCGGGACGGAGGGGAGCT	0.537																																					p.G699X													.	.			0			c.G2095T												179.0	192.0	188.0					2																	231174675		2170	4291	6461	SO:0001587	stop_gained	11262	exon23			CGGGACGGAGGGG	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.2095G>T	2.37:g.231174675G>T	ENSP00000375899:p.Gly699*		Somatic	186	0	0		WXS	Illumina HiSeq	.	204	0.25	50	NM_007237	16	0.00	0	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Nonsense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901526	0.92035	.	.	ENSG00000079263	ENST00000486687;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	.	.	.	2.91	1.07	0.20283	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.9758	5.1126	0.14817	0.2848:0.0:0.7152:0.0	.	.	.	.	X	623;568;699;585;639;672	.	ENSP00000342096:G639X	G	+	1	0	SP140	230882919	0.001000	0.12720	0.007000	0.13788	0.036000	0.12997	0.524000	0.22940	0.296000	0.22592	0.456000	0.33151	GGA			0.537	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000332015.1		NM_007237	
FAM182A	284800	hgsc.bcm.edu	37	20	26062141	26062141	+	RNA	SNP	G	G	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr20:26062141G>C	ENST00000376398.2	+	0	1046					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GCGCGGCGCAGCCCTGGCGGA	0.687																																					.													.	.			0			.																																											284800	.			GGCGCAGCCCTGG	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26062141G>C			Somatic	85	0	0		WXS	Illumina HiSeq	.	76	0.07	5	.	1	0.00	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37																																																																																						0.687	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript		OTTHUMT00000078473.2			
NECAB3	63941	mdanderson.org	37	20	32247754	32247754	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr20:32247754C>T	ENST00000246190.6	-	7	635	c.580G>A	c.(580-582)Gga>Aga	p.G194R	NECAB3_ENST00000375238.4_Missense_Mutation_p.G194R|C20orf144_ENST00000375222.3_5'Flank|NECAB3_ENST00000606525.1_5'UTR|RP1-63M2.6_ENST00000607224.1_RNA	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	194					protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						GCTCGGCGTCCTGCCCGCCGG	0.701																																					p.G194R													.	.			0			c.G580A												5.0	8.0	7.0					20																	32247754		1921	4019	5940	SO:0001583	missense	63941	exon7			GGCGTCCTGCCCG	AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.580G>A	20.37:g.32247754C>T	ENSP00000246190:p.Gly194Arg		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_031231	26	0.00	0	A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	Missense_Mutation	SNP	ENST00000246190.6	37	CCDS42866.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531529	0.45073	.	.	ENSG00000125967	ENST00000375238;ENST00000246190;ENST00000439478	T;T;T	0.25250	2.12;2.25;1.81	4.11	4.11	0.48088	.	0.059836	0.64402	D	0.000003	T	0.40067	0.1102	L	0.52759	1.655	0.49213	D	0.999767	P;D;D	0.56746	0.783;0.977;0.977	P;P;P	0.60609	0.655;0.824;0.877	T	0.27673	-1.0067	10	0.87932	D	0	0.1113	12.5666	0.56314	0.0:1.0:0.0:0.0	.	71;194;194	E1P5N3;Q96P71;Q96P71-2	.;NECA3_HUMAN;.	R	194	ENSP00000364386:G194R;ENSP00000246190:G194R;ENSP00000392064:G194R	ENSP00000246190:G194R	G	-	1	0	NECAB3	31711415	0.008000	0.16893	1.000000	0.80357	0.013000	0.08279	1.324000	0.33712	2.219000	0.72066	0.462000	0.41574	GGA			0.701	NECAB3-010	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000078724.2			
ZMYND8	23613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45905062	45905062	+	Missense_Mutation	SNP	G	G	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr20:45905062G>C	ENST00000311275.7	-	11	1669	c.1416C>G	c.(1414-1416)agC>agG	p.S472R	ZMYND8_ENST00000540497.1_Missense_Mutation_p.S467R|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000471951.2_Missense_Mutation_p.S492R|ZMYND8_ENST00000352431.2_Missense_Mutation_p.S492R|ZMYND8_ENST00000461685.1_Missense_Mutation_p.S492R|ZMYND8_ENST00000372023.3_Missense_Mutation_p.S467R|ZMYND8_ENST00000360911.3_Missense_Mutation_p.S467R|ZMYND8_ENST00000396281.4_Missense_Mutation_p.S472R|ZMYND8_ENST00000262975.4_Missense_Mutation_p.S472R|ZMYND8_ENST00000458360.2_Missense_Mutation_p.S467R|ZMYND8_ENST00000355972.4_Missense_Mutation_p.S472R|ZMYND8_ENST00000536340.1_Missense_Mutation_p.S499R|ZMYND8_ENST00000446994.2_Missense_Mutation_p.S409R	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	472					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GCTGACCTGTGCTCTTATCCA	0.637																																					p.S492R													ZMYND8_ENST00000536340,NS,carcinoma,-2,2	ZMYND8_ENST00000536340	-2	2	0			c.C1476G												39.0	33.0	35.0					20																	45905062		2203	4300	6503	SO:0001583	missense	23613	exon11			ACCTGTGCTCTTA	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.1416C>G	20.37:g.45905062G>C	ENSP00000312237:p.Ser472Arg		Somatic	28	0	0		WXS	Illumina HiSeq	.	37	0.27	10	NM_183047	171	0.38	65	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.87|16.87	3.242343|3.242343	0.58995|0.58995	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000467200|ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.89617	.|-1.68;-1.58;-1.69;-1.58;-1.58;-1.57;-1.69;-1.58;-1.58;-2.54;-1.58;-1.68;-1.65	5.51|5.51	3.58|3.58	0.41010|0.41010	.|.	.|0.276491	.|0.38663	.|N	.|0.001620	D|D	0.88381|0.88381	0.6421|0.6421	L|L	0.34521|0.34521	1.04|1.04	0.37705|0.37705	D|D	0.924377|0.924377	.|D;P;P;P;P;P;P;P;P;P;P;P;P;P;P;B;P;P	.|0.62365	.|0.991;0.811;0.743;0.908;0.841;0.924;0.811;0.811;0.944;0.698;0.811;0.743;0.843;0.843;0.922;0.144;0.904;0.743	.|P;P;P;P;P;P;P;P;P;P;P;P;P;P;P;B;P;P	.|0.59546	.|0.859;0.66;0.632;0.717;0.532;0.694;0.568;0.568;0.499;0.465;0.465;0.694;0.689;0.694;0.632;0.075;0.632;0.694	D|D	0.87312|0.87312	0.2312|0.2312	5|10	.|0.38643	.|T	.|0.18	-13.3397|-13.3397	10.3549|10.3549	0.43958|0.43958	0.2277:0.0:0.7723:0.0|0.2277:0.0:0.7723:0.0	.|.	.|467;499;467;467;447;466;492;472;467;492;492;472;409;467;467;492;467;472	.|B7ZM62;F5H0X3;Q2HXV7;Q2HXV3;Q5TH11;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8	.|.;.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.	D|R	399|467;472;467;472;492;492;472;499;472;409;492;467;467	.|ENSP00000354166:S467R;ENSP00000312237:S472R;ENSP00000392964:S467R;ENSP00000262975:S472R;ENSP00000420095:S492R;ENSP00000335537:S492R;ENSP00000379577:S472R;ENSP00000439800:S499R;ENSP00000348246:S472R;ENSP00000396725:S409R;ENSP00000418210:S492R;ENSP00000361093:S467R;ENSP00000443086:S467R	.|ENSP00000262975:S472R	H|S	-|-	1|3	0|2	ZMYND8|ZMYND8	45338469|45338469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.074000|2.074000	0.41529|0.41529	0.707000|0.707000	0.31934|0.31934	0.655000|0.655000	0.94253|0.94253	CAC|AGC			0.637	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000079596.2		NM_183047	
CYP24A1	1591	ucsc.edu;bcgsc.ca;mdanderson.org	37	20	52789455	52789455	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr20:52789455G>T	ENST00000216862.3	-	2	835	c.442C>A	c.(442-444)Ctg>Atg	p.L148M	CYP24A1_ENST00000395955.3_Missense_Mutation_p.L148M|CYP24A1_ENST00000395954.3_5'Flank	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	148					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CACAGGATCAGCAGCCCGTAG	0.617																																					p.L148M													.	CYP24A1	75		0			c.C442A												92.0	83.0	86.0					20																	52789455		2203	4300	6503	SO:0001583	missense	1591	exon2			GGATCAGCAGCCC	U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.442C>A	20.37:g.52789455G>T	ENSP00000216862:p.Leu148Met		Somatic	53	0	0		WXS	Illumina HiSeq		43	0.09	4	NM_000782	0		0	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	37	CCDS33491.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864388	0.51482	.	.	ENSG00000019186	ENST00000216862;ENST00000395955	T;T	0.71103	-0.54;-0.54	5.21	1.82	0.25136	.	0.129851	0.53938	N	0.000057	T	0.78175	0.4242	M	0.82323	2.585	0.80722	D	1	P;B	0.35872	0.525;0.383	P;P	0.46629	0.522;0.522	T	0.76945	-0.2771	10	0.49607	T	0.09	-10.8908	13.1117	0.59277	0.0:0.0:0.4995:0.5005	.	148;148	Q32ML3;Q07973	.;CP24A_HUMAN	M	148	ENSP00000216862:L148M;ENSP00000379285:L148M	ENSP00000216862:L148M	L	-	1	2	CYP24A1	52222862	1.000000	0.71417	0.994000	0.49952	0.877000	0.50540	2.443000	0.44881	0.067000	0.16545	-0.314000	0.08810	CTG			0.617	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079769.2			
BAGE2	85319	broad.mit.edu	37	21	11050075	11050077	+	RNA	DEL	GTT	GTT	-	rs55661652|rs4462874		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	GTT	GTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr21:11050075_11050077delGTT	ENST00000470054.1	-	0	487							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATTAAGAAACGTTAATATCAATT	0.281																																					.													.	.			0			.																																											85319	.			AGAAACGTTAATA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11050075_11050077delGTT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.281	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
ANKRD30BP2	149992	broad.mit.edu	37	21	14415103	14415103	+	RNA	SNP	C	C	G	rs369320513		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr21:14415103C>G	ENST00000507941.1	+	0	95									ankyrin repeat domain 30B pseudogene 2																		CTGACAGGCTCTGCAATGCCA	0.338																																					.													.	.			0			.																																											0	.			CAGGCTCTGCAAT	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14415103C>G			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	28	0.18	5	.	0		0		RNA	SNP	ENST00000507941.1	37																																																																																						0.338	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000372094.1		NR_026916	
ANKRD30BP2	149992	broad.mit.edu	37	21	14415122	14415122	+	RNA	SNP	C	C	T	rs373171837		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr21:14415122C>T	ENST00000507941.1	+	0	95									ankyrin repeat domain 30B pseudogene 2																		CAGAGGGAGGCTTGTGCAAAT	0.353																																					.													.	.			0			.																																											0	.			GGGAGGCTTGTGC	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14415122C>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	21	0.19	4	.	0		0		RNA	SNP	ENST00000507941.1	37																																																																																						0.353	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000372094.1		NR_026916	
ITGB2	3689	mdanderson.org	37	21	46311735	46311735	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr21:46311735G>T	ENST00000397850.2	-	12	1853	c.1401C>A	c.(1399-1401)tgC>tgA	p.C467*	ITGB2_ENST00000302347.5_Nonsense_Mutation_p.C467*|ITGB2_ENST00000397852.1_Nonsense_Mutation_p.C467*|ITGB2_ENST00000397857.1_Nonsense_Mutation_p.C467*|ITGB2_ENST00000397854.3_Nonsense_Mutation_p.C410*|ITGB2_ENST00000355153.4_Nonsense_Mutation_p.C467*			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	467	Cysteine-rich tandem repeats.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	TGCAGATGCCGCACTCCAAGA	0.667																																					p.C467X													.	.			0			c.C1401A												54.0	52.0	52.0					21																	46311735		2203	4300	6503	SO:0001587	stop_gained	3689	exon11			GATGCCGCACTCC	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1401C>A	21.37:g.46311735G>T	ENSP00000380948:p.Cys467*		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_000211	151	0.00	0	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Nonsense_Mutation	SNP	ENST00000397850.2	37	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	G	40	8.179136	0.98691	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	.	.	.	5.54	-11.1	0.00147	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6088	0.88046	0.3766:0.0:0.6234:0.0	.	.	.	.	X	467;467;410;467;467;467	.	ENSP00000303242:C467X	C	-	3	2	ITGB2	45136163	0.020000	0.18652	0.199000	0.23439	0.833000	0.47200	-0.745000	0.04834	-2.005000	0.00959	-1.021000	0.02439	TGC			0.667	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206566.2		NM_000211	
ZNF280B	140883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	22842853	22842853	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr22:22842853C>G	ENST00000406426.1	-	4	1613	c.871G>C	c.(871-873)Gga>Cga	p.G291R	ZNF280B_ENST00000360412.2_Missense_Mutation_p.G291R			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TTATGCTGTCCATAGTAAAAG	0.378																																					p.G291R													.	.			0			c.G871C												124.0	115.0	118.0					22																	22842853		2203	4300	6503	SO:0001583	missense	140883	exon4			GCTGTCCATAGTA	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.871G>C	22.37:g.22842853C>G	ENSP00000385998:p.Gly291Arg		Somatic	80	0	0		WXS	Illumina HiSeq	.	64	0.34	22	NM_080764	14	0.50	7		Missense_Mutation	SNP	ENST00000406426.1	37	CCDS13799.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091501	0.76756	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.04049	3.72;3.72	4.43	4.43	0.53597	.	.	.	.	.	T	0.22513	0.0543	M	0.79805	2.47	0.44402	D	0.997311	D	0.89917	1.0	D	0.91635	0.999	T	0.00717	-1.1596	9	0.87932	D	0	-11.5729	14.9439	0.71014	0.0:1.0:0.0:0.0	.	291	Q86YH2	Z280B_HUMAN	R	291	ENSP00000385998:G291R;ENSP00000353586:G291R	ENSP00000353586:G291R	G	-	1	0	ZNF280B	21172853	1.000000	0.71417	0.985000	0.45067	0.960000	0.62799	6.226000	0.72277	2.471000	0.83476	0.655000	0.94253	GGA			0.378	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321170.2		NM_080764	
SLC2A11	66035	mdanderson.org	37	22	24224967	24224967	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr22:24224967G>T	ENST00000345044.6	+	8	1163	c.895G>T	c.(895-897)Gtg>Ttg	p.V299L	SLC2A11_ENST00000316185.8_Missense_Mutation_p.V302L|RN7SL268P_ENST00000491172.2_RNA|SLC2A11_ENST00000398356.2_Missense_Mutation_p.V306L|AP000350.10_ENST00000433835.3_Intron|SLC2A11_ENST00000467660.1_3'UTR			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	299					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						CGCCTCCTCCGTGTTCCGGAA	0.647																																					p.V306L													.	.			0			c.G916T												78.0	53.0	62.0					22																	24224967		2203	4300	6503	SO:0001583	missense	66035	exon9			TCCTCCGTGTTCC	AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.895G>T	22.37:g.24224967G>T	ENSP00000342542:p.Val299Leu		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_030807	6	0.00	0	E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Missense_Mutation	SNP	ENST00000345044.6	37	CCDS46673.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.92|14.92	2.680050|2.680050	0.47886|0.47886	.|.	.|.	ENSG00000251357|ENSG00000133460	ENST00000421180|ENST00000345044;ENST00000398356;ENST00000398363;ENST00000398359;ENST00000407566;ENST00000316185	.|T;T;T	.|0.72615	.|-0.67;-0.67;-0.67	4.12|4.12	1.97|1.97	0.26223|0.26223	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.216139	.|0.37955	.|N	.|0.001871	T|T	0.58666|0.58666	0.2138|0.2138	L|L	0.36672|0.36672	1.1|1.1	0.22226|0.22226	N|N	0.999276|0.999276	.|P;P;B;P;P	.|0.40302	.|0.712;0.563;0.013;0.617;0.455	.|B;B;B;B;B	.|0.42798	.|0.142;0.277;0.029;0.398;0.395	T|T	0.48163|0.48163	-0.9059|-0.9059	5|9	.|.	.|.	.|.	.|.	6.7624|6.7624	0.23548|0.23548	0.3158:0.0:0.6841:0.0|0.3158:0.0:0.6841:0.0	.|.	.|306;302;299;306;306	.|E7ENI4;Q9BYW1-3;Q9BYW1;E9PH55;Q6P4C1	.|.;.;GTR11_HUMAN;.;.	L|L	162|299;306;248;306;306;302	.|ENSP00000342542:V299L;ENSP00000381399:V306L;ENSP00000326748:V302L	.|.	R|V	+|+	2|1	0|0	AP000350.10|SLC2A11	22554967|22554967	0.161000|0.161000	0.22892|0.22892	0.368000|0.368000	0.25939|0.25939	0.002000|0.002000	0.02628|0.02628	0.416000|0.416000	0.21198|0.21198	0.469000|0.469000	0.27268|0.27268	-0.223000|-0.223000	0.12442|0.12442	CGT|GTG			0.647	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319889.3		NM_030807	
MN1	4330	mdanderson.org	37	22	28196364	28196364	+	Silent	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr22:28196364G>T	ENST00000302326.4	-	1	1122	c.168C>A	c.(166-168)ggC>ggA	p.G56G		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	56					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						TCGGGGGTTCGCCCAGCGCGC	0.657			T	ETV6	"""AML, meningioma"""																																p.G56G				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	.			0			c.C168A												51.0	56.0	54.0					22																	28196364		1915	4113	6028	SO:0001819	synonymous_variant	4330	exon1			GGGTTCGCCCAGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.168C>A	22.37:g.28196364G>T			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_002430	16	0.00	0	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																					0.657	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
CAPN7	23473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	15274030	15274030	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr3:15274030T>C	ENST00000253693.2	+	10	1290	c.1037T>C	c.(1036-1038)aTa>aCa	p.I346T		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	346	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						CTCCAGGTGATAATTGATGAC	0.323																																					p.I346T													.	.			0			c.T1037C												95.0	94.0	94.0					3																	15274030		2203	4300	6503	SO:0001583	missense	23473	exon10			AGGTGATAATTGA	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.1037T>C	3.37:g.15274030T>C	ENSP00000253693:p.Ile346Thr		Somatic	90	0	0		WXS	Illumina HiSeq	.	61	0.26	16	NM_014296	12	0.58	7		Missense_Mutation	SNP	ENST00000253693.2	37	CCDS2624.1	.	.	.	.	.	.	.	.	.	.	T	16.24	3.066915	0.55539	.	.	ENSG00000131375	ENST00000253693	D	0.89123	-2.47	5.22	5.22	0.72569	Peptidase C2, calpain, catalytic domain (3);	0.046228	0.85682	D	0.000000	D	0.86485	0.5944	L	0.43757	1.38	0.80722	D	1	B	0.25105	0.118	B	0.32149	0.141	D	0.84221	0.0461	10	0.48119	T	0.1	-17.9486	14.7645	0.69629	0.0:0.0:0.0:1.0	.	346	Q9Y6W3	CAN7_HUMAN	T	346	ENSP00000253693:I346T	ENSP00000253693:I346T	I	+	2	0	CAPN7	15249034	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	7.734000	0.84928	1.966000	0.57179	0.528000	0.53228	ATA			0.323	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252105.2		NM_014296	
MLH1	4292	mdanderson.org	37	3	37050329	37050329	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr3:37050329G>T	ENST00000231790.2	+	6	694	c.478G>T	c.(478-480)Gcc>Tcc	p.A160S	MLH1_ENST00000455445.2_5'UTR|MLH1_ENST00000539477.1_Intron|MLH1_ENST00000435176.1_Missense_Mutation_p.A62S|MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000492474.1_3'UTR|MLH1_ENST00000458205.2_5'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	160					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						TTACAACATAGCCACGAGGAG	0.383		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.A160S			yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	.			1	Whole gene deletion(1)	ovary(1)	c.G478T												99.0	101.0	100.0					3																	37050329		2203	4300	6503	SO:0001583	missense	4292	exon6	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	AACATAGCCACGA	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.478G>T	3.37:g.37050329G>T	ENSP00000231790:p.Ala160Ser		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_000249	40	0.00	0	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	37	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.76|11.76	1.735764|1.735764	0.30774|0.30774	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937;ENST00000383761;ENST00000435176;ENST00000429117|ENST00000456676	D;D;T|.	0.89939|.	-2.59;-2.59;-0.74|.	6.17|6.17	-4.22|-4.22	0.03800|0.03800	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (2);|.	0.754909|.	0.13232|.	N|.	0.403616|.	T|.	0.17746|.	0.0426|.	N|N	0.02697|0.02697	-0.525|-0.525	0.58432|0.58432	D|D	0.999995|0.999995	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.0;0.001|.	T|.	0.13442|.	-1.0509|.	10|.	0.19147|.	T|.	0.46|.	-0.8016|-0.8016	6.6045|6.6045	0.22718|0.22718	0.2744:0.0:0.3979:0.3278|0.2744:0.0:0.3979:0.3278	.|.	62;160;160|.	E9PCU2;Q53GX1;P40692|.	.;.;MLH1_HUMAN|.	S|Y	160;126;126;24;62;62|151	ENSP00000231790:A160S;ENSP00000402564:A62S;ENSP00000407019:A62S|.	ENSP00000231790:A160S|.	A|X	+|+	1|3	0|2	MLH1|MLH1	37025333|37025333	0.832000|0.832000	0.29368|0.29368	0.851000|0.851000	0.33527|0.33527	0.957000|0.957000	0.61999|0.61999	-0.100000|-0.100000	0.10990|0.10990	-1.099000|-1.099000	0.03034|0.03034	-1.599000|-1.599000	0.00816|0.00816	GCC|TAG			0.383	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253337.2		NM_000249	
LAMB2	3913	mdanderson.org	37	3	49167754	49167754	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr3:49167754G>T	ENST00000418109.1	-	10	1299	c.1135C>A	c.(1135-1137)Cat>Aat	p.H379N	LAMB2_ENST00000305544.4_Missense_Mutation_p.H379N	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	379	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.H379Y(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCTGTGTTATGCTGACATCCA	0.597																																					p.H379N													LAMB2,NS,carcinoma,0,1	LAMB2	0	1	1	Substitution - Missense(1)	lung(1)	c.C1135A												114.0	95.0	101.0					3																	49167754		2203	4300	6503	SO:0001583	missense	3913	exon9			TGTTATGCTGACA		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1135C>A	3.37:g.49167754G>T	ENSP00000388325:p.His379Asn		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	124	0.04	5	NM_002292	30	0.00	0	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799599	0.90538	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.64085	-0.08;-0.08	5.17	5.17	0.71159	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	T	0.80259	0.4590	M	0.76938	2.355	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.81143	-0.1067	10	0.51188	T	0.08	.	18.6406	0.91394	0.0:0.0:1.0:0.0	.	379	P55268	LAMB2_HUMAN	N	379	ENSP00000388325:H379N;ENSP00000307156:H379N	ENSP00000307156:H379N	H	-	1	0	LAMB2	49142758	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.805000	0.99149	2.553000	0.86117	0.591000	0.81541	CAT			0.597	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345939.1		NM_002292	
NISCH	11188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52492745	52492745	+	Missense_Mutation	SNP	G	G	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr3:52492745G>C	ENST00000479054.1	+	4	317	c.245G>C	c.(244-246)aGa>aCa	p.R82T	NISCH_ENST00000345716.4_Missense_Mutation_p.R82T|NISCH_ENST00000488380.1_Missense_Mutation_p.R82T|NISCH_ENST00000420808.2_Missense_Mutation_p.R82T			Q9Y2I1	NISCH_HUMAN	nischarin	82	Necessary for binding to phosphoinositide-3-P; not sufficient for targeting to endosomes.|PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	AAAAACTCAAGAAGCTTGGTG	0.483																																					p.R82T													.	.			0			c.G245C												71.0	75.0	73.0					3																	52492745		2203	4300	6503	SO:0001583	missense	11188	exon3			ACTCAAGAAGCTT	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.245G>C	3.37:g.52492745G>C	ENSP00000418232:p.Arg82Thr		Somatic	87	0	0		WXS	Illumina HiSeq	.	152	0.24	37	NM_001276293	70	0.27	19	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.578509	0.28180	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000488380;ENST00000420808	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.7	2.54	0.30619	Phox homologous domain (5);	0.164087	0.52532	D	0.000072	T	0.31606	0.0802	N	0.16790	0.44	0.38388	D	0.945318	D;D	0.76494	0.999;0.994	D;P	0.72982	0.979;0.873	T	0.11891	-1.0569	10	0.34782	T	0.22	-6.2075	6.7606	0.23538	0.4227:0.0:0.5772:0.0	.	82;82	Q9Y2I1;C9J715	NISCH_HUMAN;.	T	82	ENSP00000418232:R82T;ENSP00000339958:R82T;ENSP00000417812:R82T;ENSP00000392484:R82T	ENSP00000339958:R82T	R	+	2	0	NISCH	52467785	1.000000	0.71417	0.547000	0.28179	0.993000	0.82548	2.550000	0.45811	0.769000	0.33313	0.655000	0.94253	AGA			0.483	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351357.1		NM_007184	
WFS1	7466	broad.mit.edu	37	4	6296878	6296878	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr4:6296878G>T	ENST00000226760.1	+	7	993	c.823G>T	c.(823-825)Gcg>Tcg	p.A275S	WFS1_ENST00000503569.1_Missense_Mutation_p.A275S	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	275					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		TGACGAGCTGGCGGGGAAGAG	0.622																																					p.A275S													.	WFS1	71		0			c.G823T												68.0	62.0	64.0					4																	6296878		2203	4300	6503	SO:0001583	missense	7466	exon7			GAGCTGGCGGGGA	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.823G>T	4.37:g.6296878G>T	ENSP00000226760:p.Ala275Ser		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001145853	22	0.00	0	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	ENST00000226760.1	37	CCDS3386.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.04|15.04	2.714405|2.714405	0.48622|0.48622	.|.	.|.	ENSG00000109501|ENSG00000109501	ENST00000503569;ENST00000226760|ENST00000506362	D;D|.	0.94092|.	-3.35;-3.35|.	4.35|4.35	3.49|3.49	0.39957|0.39957	.|.	0.289177|.	0.32386|.	N|.	0.006164|.	T|T	0.57257|0.57257	0.2041|0.2041	L|L	0.44542|0.44542	1.39|1.39	0.39274|0.39274	D|D	0.964432|0.964432	B|.	0.13145|.	0.007|.	B|.	0.17098|.	0.017|.	T|T	0.55503|0.55503	-0.8131|-0.8131	10|5	0.17369|.	T|.	0.5|.	-7.077|-7.077	12.7382|12.7382	0.57236|0.57236	0.0:0.0:0.835:0.165|0.0:0.0:0.835:0.165	.|.	275|.	O76024|.	WFS1_HUMAN|.	S|C	275|152	ENSP00000423337:A275S;ENSP00000226760:A275S|.	ENSP00000226760:A275S|.	A|W	+|+	1|3	0|0	WFS1|WFS1	6347779|6347779	1.000000|1.000000	0.71417|0.71417	0.844000|0.844000	0.33320|0.33320	0.905000|0.905000	0.53344|0.53344	6.614000|6.614000	0.74197|0.74197	0.783000|0.783000	0.33636|0.33636	0.462000|0.462000	0.41574|0.41574	GCG|TGG			0.622	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206863.1			
FRYL	285527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	48597656	48597656	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr4:48597656C>T	ENST00000503238.1	-	12	1198	c.1199G>A	c.(1198-1200)cGt>cAt	p.R400H	FRYL_ENST00000358350.4_Missense_Mutation_p.R400H|FRYL_ENST00000264319.7_De_novo_Start_OutOfFrame|FRYL_ENST00000507711.1_Missense_Mutation_p.R400H|FRYL_ENST00000537810.1_Missense_Mutation_p.R400H|FRYL_ENST00000506685.1_Missense_Mutation_p.R106H			O94915	FRYL_HUMAN	FRY-like	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AGGTGTGTCACGAGGAACCAC	0.373																																					p.R400H													.	.			0			c.G1199A												91.0	82.0	85.0					4																	48597656		1862	4099	5961	SO:0001583	missense	285527	exon15			GTGTCACGAGGAA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1199G>A	4.37:g.48597656C>T	ENSP00000426064:p.Arg400His		Somatic	253	0	0		WXS	Illumina HiSeq	.	203	0.37	75	NM_015030	11	0.36	4	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	36	5.754230	0.96890	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T	0.65732	1.83;1.83;1.83;-0.17	5.97	5.97	0.96955	Armadillo-type fold (1);	0.000000	0.64402	U	0.000003	T	0.80507	0.4636	M	0.76574	2.34	0.80722	D	1	D;P	0.76494	0.999;0.944	D;P	0.78314	0.991;0.674	T	0.79629	-0.1724	10	0.54805	T	0.06	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	400;400	F2Z2S2;O94915	.;FRYL_HUMAN	H	400;400;400;400;106	ENSP00000426064:R400H;ENSP00000351113:R400H;ENSP00000441114:R400H;ENSP00000421584:R400H	ENSP00000351113:R400H	R	-	2	0	FRYL	48292413	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.818000	0.86416	2.834000	0.97654	0.650000	0.86243	CGT			0.373	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000369265.2			
NIPBL	25836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	37044488	37044488	+	Missense_Mutation	SNP	A	A	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr5:37044488A>T	ENST00000282516.8	+	35	6647	c.6148A>T	c.(6148-6150)Atc>Ttc	p.I2050F	NIPBL_ENST00000448238.2_Missense_Mutation_p.I2050F	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2050					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGTTGCAAAAATCCTAGAGCT	0.343																																					p.I2050F													NIPBL_ENST00000448238,neck,malignant_melanoma,-2,2	NIPBL_ENST00000448238	-2	2	0			c.A6148T												84.0	82.0	82.0					5																	37044488		2203	4300	6503	SO:0001583	missense	25836	exon35			GCAAAAATCCTAG	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6148A>T	5.37:g.37044488A>T	ENSP00000282516:p.Ile2050Phe		Somatic	159	0	0		WXS	Illumina HiSeq	.	133	0.41	54	NM_015384	115	0.50	58	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.870102	0.91587	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.65916	-0.18;-0.18	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78136	0.4236	M	0.72894	2.215	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.72982	0.952;0.979	T	0.80885	-0.1182	10	0.87932	D	0	-5.3744	15.7982	0.78428	1.0:0.0:0.0:0.0	.	2050;2050	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	F	2050	ENSP00000282516:I2050F;ENSP00000406266:I2050F	ENSP00000282516:I2050F	I	+	1	0	NIPBL	37080245	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.958000	0.93099	2.124000	0.65301	0.477000	0.44152	ATC			0.343	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207582.1		NM_015384	
EGFLAM	133584	mdanderson.org	37	5	38427181	38427181	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr5:38427181G>T	ENST00000354891.3	+	14	2227	c.1881G>T	c.(1879-1881)gaG>gaT	p.E627D	EGFLAM_ENST00000322350.5_Missense_Mutation_p.E627D|EGFLAM_ENST00000336740.6_Missense_Mutation_p.E393D|EGFLAM-AS1_ENST00000508986.1_RNA|EGFLAM_ENST00000397202.2_5'UTR	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	627	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GGCCACTGGAGCCCCAGCATT	0.483																																					p.E627D	Colon(62;485 1295 3347 17454)												.	.			0			c.G1881T												158.0	155.0	156.0					5																	38427181		2203	4300	6503	SO:0001583	missense	133584	exon14			ACTGGAGCCCCAG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1881G>T	5.37:g.38427181G>T	ENSP00000346964:p.Glu627Asp		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001205301	10	0.00	0	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	8.789	0.930184	0.18131	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.69175	-0.38;-0.38;-0.38	5.63	1.84	0.25277	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.521229	0.21675	N	0.070805	T	0.51517	0.1679	L	0.38531	1.155	0.80722	D	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.10450	0.005;0.004;0.005	T	0.34279	-0.9835	10	0.27082	T	0.32	-9.7112	8.7196	0.34432	0.5114:0.0:0.4886:0.0	.	393;627;627	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	D	627;627;393;393	ENSP00000346964:E627D;ENSP00000313084:E627D;ENSP00000337607:E393D	ENSP00000313084:E627D	E	+	3	2	EGFLAM	38462938	0.939000	0.31865	1.000000	0.80357	0.792000	0.44763	0.252000	0.18278	0.330000	0.23485	0.563000	0.77884	GAG			0.483	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000367323.1		NM_152403	
SEMA6A	57556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	115837930	115837930	+	Missense_Mutation	SNP	T	T	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr5:115837930T>A	ENST00000343348.6	-	3	981	c.194A>T	c.(193-195)aAc>aTc	p.N65I	CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.N65I|SEMA6A_ENST00000503962.1_5'UTR|SEMA6A_ENST00000510263.1_Missense_Mutation_p.N65I	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	65	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GAGGGTTCCGTTCATGATCAT	0.488																																					p.N65I													.	.			0			c.A194T												235.0	234.0	234.0					5																	115837930		2036	4187	6223	SO:0001583	missense	57556	exon3			GTTCCGTTCATGA	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.194A>T	5.37:g.115837930T>A	ENSP00000345512:p.Asn65Ile		Somatic	186	0	0		WXS	Illumina HiSeq	.	147	0.15	22	NM_020796	246	0.32	79	Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	37	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.230176	0.79688	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263;ENST00000515009;ENST00000509665	T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.284333	0.41001	D	0.000969	T	0.35248	0.0925	M	0.79805	2.47	0.80722	D	1	P;P	0.52842	0.956;0.864	D;P	0.68192	0.956;0.905	T	0.11842	-1.0571	10	0.62326	D	0.03	.	15.2197	0.73303	0.0:0.0:0.0:1.0	.	65;65	Q9H2E6;Q9H2E6-2	SEM6A_HUMAN;.	I	65	ENSP00000345512:N65I;ENSP00000257414:N65I;ENSP00000424388:N65I;ENSP00000421935:N65I;ENSP00000425553:N65I	ENSP00000257414:N65I	N	-	2	0	SEMA6A	115865829	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.876000	0.63079	2.082000	0.62665	0.528000	0.53228	AAC			0.488	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371270.1		NM_020796	
AFF4	27125	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	132232477	132232479	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr5:132232477_132232479delCTT	ENST00000265343.5	-	11	2222_2224	c.1843_1845delAAG	c.(1843-1845)aagdel	p.K615del	AFF4_ENST00000378595.3_In_Frame_Del_p.K615del	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	615					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTTAGACTCCTTCTTTATATTG	0.433																																					p.615_616del	Ovarian(126;889 1733 2942 10745 11605)												.	.			0			c.1844_1846del																																									SO:0001651	inframe_deletion	27125	exon11			AGACTCCTTCTTT	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.1843_1845delAAG	5.37:g.132232480_132232482delCTT	ENSP00000265343:p.Lys615del		Somatic	136	0	0		WXS	Illumina HiSeq	.	105	0.36	38	NM_014423	64	0.00	0	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	In_Frame_Del	DEL	ENST00000265343.5	37	CCDS4164.1																																																																																					0.433	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000133049.1		NM_014423	
KDM3B	51780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	137762705	137762705	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr5:137762705C>T	ENST00000314358.5	+	18	4653	c.4453C>T	c.(4453-4455)Ctc>Ttc	p.L1485F	KDM3B_ENST00000542866.1_Missense_Mutation_p.L517F|KDM3B_ENST00000394866.1_Missense_Mutation_p.L1141F	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1485					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GGTGCTCAAACTCAAGGACTG	0.493																																					p.L1485F													.	.			0			c.C4453T												82.0	80.0	80.0					5																	137762705		2203	4300	6503	SO:0001583	missense	51780	exon18			CTCAAACTCAAGG	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4453C>T	5.37:g.137762705C>T	ENSP00000326563:p.Leu1485Phe		Somatic	77	0	0		WXS	Illumina HiSeq	.	61	0.28	17	NM_016604	245	0.44	108	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126470	0.77549	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.72615	-0.67;-0.67;-0.67	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000001	D	0.85336	0.5673	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	D	0.87441	0.2395	10	0.87932	D	0	-8.6727	10.2244	0.43216	0.0:0.8774:0.0:0.1226	.	1141;1485	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	F	1485;1275;1141;517	ENSP00000326563:L1485F;ENSP00000378335:L1141F;ENSP00000439462:L517F	ENSP00000326563:L1485F	L	+	1	0	KDM3B	137790604	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.225000	0.32551	2.485000	0.83878	0.655000	0.94253	CTC			0.493	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000373597.1		NM_016604	
TNIP1	10318	mdanderson.org	37	5	150444639	150444639	+	Silent	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr5:150444639C>T	ENST00000389378.2	-	2	606	c.18G>A	c.(16-18)ccG>ccA	p.P6P	TNIP1_ENST00000522226.1_Silent_p.P6P|TNIP1_ENST00000523200.1_Silent_p.P6P|TNIP1_ENST00000521591.1_Silent_p.P6P|TNIP1_ENST00000518977.1_Silent_p.P6P|TNIP1_ENST00000520931.1_Intron|TNIP1_ENST00000315050.7_Silent_p.P6P|TNIP1_ENST00000524280.1_Silent_p.P6P|TNIP1_ENST00000523338.1_Silent_p.P6P	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	6					defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGATCCGGTACGGTCCTCTCC	0.617																																					p.P6P													.	.			0			c.G18A												72.0	63.0	66.0					5																	150444639		2203	4300	6503	SO:0001819	synonymous_variant	10318	exon2			CCGGTACGGTCCT	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.18G>A	5.37:g.150444639C>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001252385	48	0.00	0	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Silent	SNP	ENST00000389378.2	37	CCDS34280.1																																																																																					0.617	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374914.1		NM_006058	
DOK3	79930	hgsc.bcm.edu;bcgsc.ca	37	5	176936846	176936848	+	In_Frame_Del	DEL	CGA	CGA	-	rs558150906		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	CGA	CGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr5:176936846_176936848delCGA	ENST00000357198.4	-	1	10_12	c.6_8delTCG	c.(4-9)actcgg>acg	p.R3del	DOK3_ENST00000377112.4_Intron|DOK3_ENST00000312943.6_Intron|DOK3_ENST00000501403.2_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	3					Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TCTGGCTCCCCGAGTCATGAGTT	0.704																																					p.3_3del													.	.			0			c.7_9del																																									SO:0001651	inframe_deletion	79930	exon1			GCTCCCCGAGTCA	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.6_8delTCG	5.37:g.176936846_176936848delCGA	ENSP00000349727:p.Arg3del		Somatic	66	0	0		WXS	Illumina HiSeq	.	42	0.33	14	NM_024872	0		0	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	In_Frame_Del	DEL	ENST00000357198.4	37	CCDS4426.1																																																																																					0.704	DOK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000253420.4		NM_024872	
WRNIP1	56897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	2770515	2770515	+	Silent	SNP	G	G	A	rs148604433		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:2770515G>A	ENST00000380773.4	+	3	1385	c.1176G>A	c.(1174-1176)gcG>gcA	p.A392A	WRNIP1_ENST00000380771.4_Silent_p.A367A|WRNIP1_ENST00000380769.4_Silent_p.A172A|WRNIP1_ENST00000380764.1_Silent_p.A8A	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1											breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				TAATGCGAGCGATCAACTCCC	0.532																																					p.A392A													.	.			0			c.G1176A							G	,	1,4405	2.1+/-5.4	0,1,2202	126.0	116.0	119.0		1176,1101	-8.1	0.8	6	dbSNP_134	119	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	WRNIP1	NM_020135.2,NM_130395.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	392/666,367/641	2770515	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56897	exon3			GCGAGCGATCAAC	AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.1176G>A	6.37:g.2770515G>A			Somatic	89	0	0		WXS	Illumina HiSeq	.	100	0.06	6	NM_020135	214	0.07	14		Silent	SNP	ENST00000380773.4	37	CCDS4475.1																																																																																			0		0.532	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039641.1		NM_130395	
HIST1H2AD	3013	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	26199104	26199105	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:26199104_26199105delCT	ENST00000341023.1	-	1	366_367	c.367_368delAG	c.(367-369)agtfs	p.S123fs	HIST1H3D_ENST00000356476.2_5'Flank|HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	123						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				CTTGTGGTGACTCTCAGTCTTC	0.48																																					p.123_123del													.	.			0			c.368_369del								,	16,4248		8,0,2124					,	0.6	1.0			107	16,8238		7,2,4118	no	frameshift,utr-5	HIST1H2AD,HIST1H3D	NM_021065.2,NM_003530.3	,	15,2,6242	A1A1,A1R,RR		0.1938,0.3752,0.2556	,	,		32,12486				SO:0001589	frameshift_variant	3013	exon1			TGGTGACTCTCAG	Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.367_368delAG	6.37:g.26199106_26199107delCT	ENSP00000341094:p.Ser123fs		Somatic	249	0	0		WXS	Illumina HiSeq	.	260	0.28	73	NM_021065	1	0.00	0	A0PK91|P57754|Q6FGY6	Frame_Shift_Del	DEL	ENST00000341023.1	37	CCDS4591.1																																																																																					0.480	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040100.1		NM_021065	
BTN2A3P	54718	broad.mit.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	.		9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											0	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	66	0.0303030303	2		WXS	Illumina HiSeq	Phase_I	90	0.06	5	.	4	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
HIST1H3H	8357	broad.mit.edu	37	6	27777859	27777859	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:27777859G>A	ENST00000369163.2	+	1	18	c.8G>A	c.(7-9)cGt>cAt	p.R3H	HIST1H2BL_ENST00000377401.2_5'Flank	NM_003536.2	NP_003527.1	P68431	H31_HUMAN	histone cluster 1, H3h	3					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)|upper_aerodigestive_tract(3)	10						GGCATGGCGCGTACGAAGCAG	0.572																																					p.R3H													.	HIST1H3H	25		0			c.G8A												41.0	45.0	43.0					6																	27777859		2200	4298	6498	SO:0001583	missense	8357	exon1			TGGCGCGTACGAA	Z83735	CCDS4627.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000203813	ENSG00000278828		"""Histones / Replication-dependent"""	4775	protein-coding gene	gene with protein product		602818	"""H3 histone family, member K"", ""histone 1, H3h"""	H3FK		9439656, 12408966	Standard	NM_003536		Approved	H3/k, H3F1K	uc003njm.3	P68431	OTTHUMG00000014483	ENST00000369163.2:c.8G>A	6.37:g.27777859G>A	ENSP00000358160:p.Arg3His		Somatic	78	0.0128205128	1		WXS	Illumina HiSeq	Phase_I	93	0.04	4	NM_003536	2	0.00	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000369163.2	37	CCDS4627.1	.	.	.	.	.	.	.	.	.	.	.	12.11	1.838888	0.32513	.	.	ENSG00000203813	ENST00000369163	T	0.46819	0.86	4.18	3.29	0.37713	.	.	.	.	.	T	0.42086	0.1187	.	.	.	0.32017	N	0.601257	.	.	.	.	.	.	T	0.41645	-0.9497	6	0.62326	D	0.03	.	12.9846	0.58583	0.0:0.0:0.8366:0.1634	.	.	.	.	H	3	ENSP00000358160:R3H	ENSP00000358160:R3H	R	+	2	0	HIST1H3H	27885838	0.998000	0.40836	0.473000	0.27253	0.006000	0.05464	7.435000	0.80391	1.030000	0.39839	-0.182000	0.12963	CGT			0.572	HIST1H3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040151.1		NM_003536	
HIST1H1B	3009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27834706	27834706	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:27834706G>A	ENST00000331442.3	-	1	653	c.602C>T	c.(601-603)gCa>gTa	p.A201V		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	201					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TTTGGGCTTTGCCGCCTTCGG	0.547																																					p.A201V													.	.			0			c.C602T												70.0	66.0	68.0					6																	27834706		2203	4300	6503	SO:0001583	missense	3009	exon1			GGCTTTGCCGCCT	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.602C>T	6.37:g.27834706G>A	ENSP00000330074:p.Ala201Val		Somatic	113	0	0		WXS	Illumina HiSeq	.	148	0.21	31	NM_005322	1	0.00	0	Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	37	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209929	0.39003	.	.	ENSG00000184357	ENST00000331442	T	0.20332	2.08	4.94	4.07	0.47477	.	0.368622	0.27109	N	0.020886	T	0.04679	0.0127	N	0.08118	0	0.33644	D	0.607651	B	0.20052	0.041	B	0.12156	0.007	T	0.15065	-1.0450	10	0.62326	D	0.03	-8.882	11.7966	0.52104	0.0876:0.0:0.9124:0.0	.	201	P16401	H15_HUMAN	V	201	ENSP00000330074:A201V	ENSP00000330074:A201V	A	-	2	0	HIST1H1B	27942685	0.938000	0.31826	0.023000	0.16930	0.060000	0.15804	3.475000	0.53136	1.402000	0.46780	0.655000	0.94253	GCA			0.547	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043371.1		NM_005322	
PPP1R18	170954	broad.mit.edu	37	6	30652190	30652190	+	Nonsense_Mutation	SNP	T	T	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:30652190T>A	ENST00000274853.3	-	1	3482	c.1606A>T	c.(1606-1608)Aaa>Taa	p.K536*	PPP1R18_ENST00000488324.1_5'UTR|PPP1R18_ENST00000399199.3_Nonsense_Mutation_p.K536*	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	536						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CCTACCTGTTTGTGGTGTCTT	0.527																																					p.K536X													.	.			0			c.A1606T												55.0	59.0	58.0					6																	30652190		1205	2523	3728	SO:0001587	stop_gained	170954	exon2			CCTGTTTGTGGTG	AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.1606A>T	6.37:g.30652190T>A	ENSP00000274853:p.Lys536*		Somatic	101	0.0099009901	1		WXS	Illumina HiSeq	Phase_I	130	0.20	26	NM_001134870	89	0.04	4	A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Nonsense_Mutation	SNP	ENST00000274853.3	37	CCDS43444.1	.	.	.	.	.	.	.	.	.	.	T	39	7.806801	0.98501	.	.	ENSG00000146112	ENST00000274853;ENST00000399199	.	.	.	4.52	4.52	0.55395	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.2393	11.4972	0.50415	0.0:0.0:0.0:1.0	.	.	.	.	X	536	.	ENSP00000274853:K536X	K	-	1	0	KIAA1949	30760169	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.757000	0.62213	1.909000	0.55274	0.533000	0.62120	AAA			0.527	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076498.2		NM_133471	
TJAP1	93643	mdanderson.org	37	6	43473096	43473096	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:43473096G>A	ENST00000372445.5	+	11	1553	c.1177G>A	c.(1177-1179)Gca>Aca	p.A393T	TJAP1_ENST00000372449.1_Missense_Mutation_p.A393T|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000436109.2_Missense_Mutation_p.A383T|TJAP1_ENST00000259751.1_Missense_Mutation_p.A383T|TJAP1_ENST00000438588.2_Missense_Mutation_p.A393T|TJAP1_ENST00000372444.2_Missense_Mutation_p.A383T|TJAP1_ENST00000372452.1_Missense_Mutation_p.A383T	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	393					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			gcccagcccagcacccctaac	0.682																																					p.A393T													.	.			0			c.G1177A												34.0	36.0	35.0					6																	43473096		2202	4298	6500	SO:0001583	missense	93643	exon10			AGCCCAGCACCCC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.1177G>A	6.37:g.43473096G>A	ENSP00000361522:p.Ala393Thr		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_001146017	121	0.00	0	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	37	CCDS55004.1	.	.	.	.	.	.	.	.	.	.	G	3.229	-0.157905	0.06544	.	.	ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588	.	.	.	4.84	0.957	0.19613	.	1.058480	0.07206	N	0.858372	T	0.10937	0.0267	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.30268	-0.9984	9	0.20046	T	0.44	-9.1731	4.2656	0.10761	0.1446:0.2767:0.473:0.1056	.	393;383	Q5JTD0;Q5JTD0-2	TJAP1_HUMAN;.	T	383;393;383;383;383;383;393;393	.	ENSP00000259751:A383T	A	+	1	0	TJAP1	43581074	0.428000	0.25522	0.000000	0.03702	0.153000	0.21895	0.644000	0.24766	0.034000	0.15491	0.655000	0.94253	GCA			0.682	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000040629.1		NM_080604	
VEGFA	7422	mdanderson.org	37	6	43738965	43738965	+	5'UTR	SNP	C	C	T	rs370465512		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:43738965C>T	ENST00000523873.1	+	0	20				RP1-261G23.7_ENST00000607600.1_RNA|VEGFA_ENST00000520948.1_5'UTR|VEGFA_ENST00000518689.1_5'Flank|VEGFA_ENST00000482630.2_Silent_p.P174P|VEGFA_ENST00000413642.3_Silent_p.P174P|VEGFA_ENST00000457104.2_5'Flank|VEGFA_ENST00000417285.2_Silent_p.P174P|VEGFA_ENST00000372077.4_5'UTR|VEGFA_ENST00000518824.1_5'Flank|VEGFA_ENST00000425836.2_Silent_p.P174P|VEGFA_ENST00000324450.6_Silent_p.P174P|VEGFA_ENST00000372055.4_Silent_p.P174P|VEGFA_ENST00000372064.4_Silent_p.P174P|VEGFA_ENST00000230480.6_5'Flank|VEGFA_ENST00000372067.3_Silent_p.P174P|VEGFA_ENST00000523125.1_5'Flank|VEGFA_ENST00000523950.1_5'UTR			P15692	VEGFA_HUMAN	vascular endothelial growth factor A						activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|basophil chemotaxis (GO:0002575)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|camera-type eye morphogenesis (GO:0048593)|cardiac muscle fiber development (GO:0048739)|cardiac vascular smooth muscle cell development (GO:0060948)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to hypoxia (GO:0071456)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|dopaminergic neuron differentiation (GO:0071542)|endothelial cell chemotaxis (GO:0035767)|epithelial cell differentiation (GO:0030855)|eye photoreceptor cell development (GO:0042462)|growth (GO:0040007)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|induction of positive chemotaxis (GO:0050930)|kidney development (GO:0001822)|lactation (GO:0007595)|lung development (GO:0030324)|lymph vessel morphogenesis (GO:0036303)|macrophage differentiation (GO:0030225)|mammary gland alveolus development (GO:0060749)|mesoderm development (GO:0007498)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|outflow tract morphogenesis (GO:0003151)|ovarian follicle development (GO:0001541)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cellular component movement (GO:0051272)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein localization to early endosome (GO:1902966)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor internalization (GO:0002092)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular permeability (GO:0043117)|post-embryonic camera-type eye development (GO:0031077)|primitive erythrocyte differentiation (GO:0060319)|regulation of cell shape (GO:0008360)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)|surfactant homeostasis (GO:0043129)|tube formation (GO:0035148)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|VEGF-activated neuropilin signaling pathway (GO:0038190)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|neuropilin binding (GO:0038191)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor agonist activity (GO:0048018)|vascular endothelial growth factor receptor 1 binding (GO:0043183)|vascular endothelial growth factor receptor 2 binding (GO:0043184)|vascular endothelial growth factor receptor binding (GO:0005172)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Aflibercept(DB08885)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Dalteparin(DB06779)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Vandetanib(DB05294)	GCGCCGGCCCCGGTCGGGCCT	0.701																																					p.P174P													.	.			0			c.C522T												15.0	17.0	16.0					6																	43738965		1340	3038	4378	SO:0001623	5_prime_UTR_variant	7422	exon1			CGGCCCCGGTCGG	AB021221	CCDS34457.1, CCDS4907.2, CCDS34458.1, CCDS47432.1, CCDS47433.1, CCDS47434.1, CCDS47435.1, CCDS55007.1, CCDS55008.1, CCDS55009.1, CCDS55010.1, CCDS55011.1, CCDS55012.1, CCDS55013.1, CCDS55014.1, CCDS55015.1, CCDS69125.1	6p12	2008-02-05	2006-10-31	2006-10-31	ENSG00000112715	ENSG00000112715			12680	protein-coding gene	gene with protein product		192240	"""vascular endothelial growth factor"""	VEGF		8786112	Standard	NM_001025366		Approved	VEGF-A, VPF	uc003owh.3	P15692	OTTHUMG00000014745	ENST00000523873.1:c.-19C>T	6.37:g.43738965C>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_001204385	39	0.00	0	B5BU86|H0Y2S8|H0Y407|H0Y414|H0Y462|H0Y8N2|H3BLW7|O60720|O75875|Q074Z4|Q16889|Q5UB46|Q6P0P5|Q96KJ0|Q96L82|Q96NW5|Q9H1W8|Q9H1W9|Q9UH58|Q9UL23	Silent	SNP	ENST00000523873.1	37	CCDS55010.1	.	.	.	.	.	.	.	.	.	.	c	9.414	1.081354	0.20309	.	.	ENSG00000112715	ENST00000519767	.	.	.	3.52	1.68	0.24146	.	.	.	.	.	T	0.43942	0.1270	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33624	-0.9861	4	.	.	.	-20.4283	9.5319	0.39198	0.0:0.6011:0.3989:0.0	.	.	.	.	W	146	.	.	R	+	1	2	VEGFA	43846943	0.993000	0.37304	1.000000	0.80357	0.945000	0.59286	0.197000	0.17197	0.204000	0.20548	-0.560000	0.04181	CGG			0.701	VEGFA-021	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000374460.1		NM_001025366	
CEP162	22832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	84862439	84862439	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr6:84862439C>T	ENST00000403245.3	-	23	3568	c.3454G>A	c.(3454-3456)Gga>Aga	p.G1152R	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.G1076R	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TCCAGGGTTCCAGGGAAGGAG	0.408																																					p.G1152R													.	.			0			c.G3454A												86.0	83.0	84.0					6																	84862439		2203	4300	6503	SO:0001583	missense	22832	exon23			GGGTTCCAGGGAA																												ENST00000403245.3:c.3454G>A	6.37:g.84862439C>T	ENSP00000385215:p.Gly1152Arg		Somatic	149	0	0		WXS	Illumina HiSeq	.	141	0.06	8	NM_014895	11	0.00	0		Missense_Mutation	SNP	ENST00000403245.3	37	CCDS34494.2	.	.	.	.	.	.	.	.	.	.	C	11.31	1.601246	0.28534	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.17854	2.25;2.25	5.6	5.6	0.85130	.	0.466636	0.21682	N	0.070706	T	0.18676	0.0448	M	0.69823	2.125	0.09310	N	1	D	0.56746	0.977	P	0.53760	0.734	T	0.18650	-1.0330	10	0.19147	T	0.46	-11.9247	15.1502	0.72692	0.0:0.9303:0.0:0.0697	.	1152	Q5TB80	QN1_HUMAN	R	1076;1152	ENSP00000257766:G1076R;ENSP00000385215:G1152R	ENSP00000257766:G1076R	G	-	1	0	KIAA1009	84919158	0.936000	0.31750	0.110000	0.21437	0.050000	0.14768	2.081000	0.41596	2.806000	0.96561	0.552000	0.68991	GGA			0.408	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317315.1			
ABCB5	340273	broad.mit.edu	37	7	20687234	20687234	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:20687234G>A	ENST00000404938.2	+	10	1710	c.1058G>A	c.(1057-1059)cGa>cAa	p.R353Q	ABCB5_ENST00000477094.1_3'UTR|ABCB5_ENST00000258738.6_5'UTR|ABCB5_ENST00000443026.2_5'UTR|ABCB5_ENST00000406935.1_5'UTR	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	353					antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GCAATAGCCCGAGGAGCTGCC	0.378																																					p.R353Q													.	ABCB5	357		0			c.G1058A												77.0	67.0	70.0					7																	20687234		1564	3581	5145	SO:0001583	missense	340273	exon10			TAGCCCGAGGAGC	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1058G>A	7.37:g.20687234G>A	ENSP00000384881:p.Arg353Gln		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	155	0.03	4	NM_001163941	0		0	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829190	0.71258	.	.	ENSG00000004846	ENST00000404938	T	0.80566	-1.39	4.09	3.21	0.36854	.	.	.	.	.	D	0.82852	0.5127	L	0.49571	1.57	0.80722	D	1	D	0.65815	0.995	P	0.60886	0.88	T	0.79923	-0.1598	9	0.28530	T	0.3	.	11.4473	0.50131	0.091:0.0:0.909:0.0	.	353	A7BKA4	.	Q	353	ENSP00000384881:R353Q	ENSP00000384881:R353Q	R	+	2	0	ABCB5	20653759	0.999000	0.42202	1.000000	0.80357	0.602000	0.36980	8.881000	0.92415	1.328000	0.45358	-0.136000	0.14681	CGA			0.378	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000326736.2		NM_178559	
SP4	6671	broad.mit.edu	37	7	21468306	21468306	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:21468306G>A	ENST00000222584.3	+	2	237	c.19G>A	c.(19-21)Gag>Aag	p.E7K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	7	Poly-Glu.				regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TCAGAAGAAGGAGGAGGAGGA	0.512																																					p.E7K													SP4,colon,carcinoma,0,1	SP4	91	1	0			c.G19A												20.0	20.0	20.0					7																	21468306		2171	4251	6422	SO:0001583	missense	6671	exon2			AAGAAGGAGGAGG		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.19G>A	7.37:g.21468306G>A	ENSP00000222584:p.Glu7Lys		Somatic	39	0.0256410256	1		WXS	Illumina HiSeq	Phase_I	63	0.06	4	NM_003112	8	0.00	0	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318989	0.41096	.	.	ENSG00000105866	ENST00000222584;ENST00000446800	T	0.09911	2.93	4.5	4.5	0.54988	.	0.061123	0.64402	N	0.000005	T	0.10937	0.0267	L	0.36672	1.1	0.44142	D	0.996934	P	0.34587	0.458	B	0.39152	0.292	T	0.20907	-1.0261	10	0.23891	T	0.37	.	12.5742	0.56355	0.0:0.0:1.0:0.0	.	7	Q02446	SP4_HUMAN	K	7	ENSP00000222584:E7K	ENSP00000222584:E7K	E	+	1	0	SP4	21434831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.555000	0.73928	2.345000	0.79718	0.563000	0.77884	GAG			0.512	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211617.2		NM_003112	
STK31	56164	bcgsc.ca;mdanderson.org	37	7	23776556	23776556	+	Silent	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:23776556G>T	ENST00000355870.3	+	8	995	c.876G>T	c.(874-876)ggG>ggT	p.G292G	STK31_ENST00000433467.2_Silent_p.G292G|STK31_ENST00000428484.1_Silent_p.G269G|STK31_ENST00000354639.3_Silent_p.G269G|STK31_ENST00000405627.3_3'UTR	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	292						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTAATTTAGGGTCTAACGTCA	0.333																																					p.G292G													.	STK31	175		0			c.G876T												83.0	84.0	84.0					7																	23776556		2203	4300	6503	SO:0001819	synonymous_variant	56164	exon8			TTTAGGGTCTAAC	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.876G>T	7.37:g.23776556G>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_1	87	0.06	5	NM_031414	2	0.00	0	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Silent	SNP	ENST00000355870.3	37	CCDS5386.1																																																																																					0.333	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214036.2		NM_031414	
FAM188B	84182	mdanderson.org	37	7	30868345	30868345	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:30868345T>C	ENST00000265299.6	+	6	1201	c.1124T>C	c.(1123-1125)cTg>cCg	p.L375P	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	375										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTGGGTGCCCTGCGGCTCGGT	0.572																																					p.L375P													.	.			0			c.T1124C												125.0	130.0	128.0					7																	30868345		2032	4189	6221	SO:0001583	missense	84182	exon6			GTGCCCTGCGGCT	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.1124T>C	7.37:g.30868345T>C	ENSP00000265299:p.Leu375Pro		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_032222	11	0.00	0	Q71AZ7|Q9H6D2	Missense_Mutation	SNP	ENST00000265299.6	37	CCDS43565.1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.292695	0.40594	.	.	ENSG00000106125	ENST00000265299	T	0.12569	2.67	3.3	3.3	0.37823	.	0.343431	0.23740	N	0.045031	T	0.11665	0.0284	L	0.52573	1.65	0.38989	D	0.959101	P	0.36599	0.56	B	0.31547	0.132	T	0.08554	-1.0716	10	0.87932	D	0	-29.8809	8.3607	0.32357	0.0:0.0:0.0:1.0	.	375	Q4G0A6	F188B_HUMAN	P	375	ENSP00000265299:L375P	ENSP00000265299:L375P	L	+	2	0	FAM188B	30834870	0.760000	0.28428	0.130000	0.21974	0.008000	0.06430	3.093000	0.50217	1.741000	0.51731	0.455000	0.32223	CTG			0.572	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327962.1		NM_032222	
CCT6P1	643253	broad.mit.edu	37	7	65222986	65222986	+	RNA	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:65222986G>T	ENST00000442266.1	+	0	578				SNORA22_ENST00000383907.1_RNA|SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		GAATTCTGGCGTTTTTTACAA	0.289																																					.													.	.			0			.																																											0	.			TCTGGCGTTTTTT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65222986G>T			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	.	48	0.00	0		RNA	SNP	ENST00000442266.1	37																																																																																						0.289	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345507.1		NR_003110	
OR2AE1	81392	mdanderson.org	37	7	99474221	99474221	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:99474221C>T	ENST00000316368.2	-	1	459	c.436G>A	c.(436-438)Gtc>Atc	p.V146I		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CATGACATGACAGCCATCATC	0.498																																					p.V146I													.	.			0			c.G436A												147.0	136.0	140.0					7																	99474221		2203	4300	6503	SO:0001583	missense	81392	exon1			ACATGACAGCCAT	AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.436G>A	7.37:g.99474221C>T	ENSP00000313936:p.Val146Ile		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001005276	1	0.00	0	B2RPD2	Missense_Mutation	SNP	ENST00000316368.2	37	CCDS34696.1	.	.	.	.	.	.	.	.	.	.	C	2.987	-0.209003	0.06140	.	.	ENSG00000244623	ENST00000316368	T	0.37915	1.17	3.49	-0.562	0.11781	GPCR, rhodopsin-like superfamily (1);	1.566430	0.04304	N	0.347859	T	0.25419	0.0618	N	0.25957	0.775	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.22103	-1.0226	10	0.38643	T	0.18	.	5.5604	0.17140	0.0:0.5011:0.3062:0.1927	.	146	Q8NHA4	O2AE1_HUMAN	I	146	ENSP00000313936:V146I	ENSP00000313936:V146I	V	-	1	0	OR2AE1	99312157	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-0.775000	0.04679	-0.118000	0.11851	0.390000	0.25778	GTC			0.498	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345053.1			
ZC3HC1	51530	broad.mit.edu	37	7	129664141	129664141	+	Silent	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:129664141G>T	ENST00000358303.4	-	7	1066	c.982C>A	c.(982-984)Cgg>Agg	p.R328R	ZC3HC1_ENST00000311873.5_Silent_p.R307R|RP11-306G20.1_ENST00000587038.1_RNA|ZC3HC1_ENST00000360708.5_Silent_p.R328R|RNA5SP245_ENST00000364239.1_RNA|RP11-306G20.1_ENST00000480018.1_RNA|ZC3HC1_ENST00000481503.1_Silent_p.R285R	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	328					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					TCCTGGCTCCGGGTCATCATC	0.537																																					p.R328R	Melanoma(115;540 1606 16325 28853 48167)												.	ZC3HC1	45		0			c.C982A												68.0	70.0	69.0					7																	129664141		2203	4300	6503	SO:0001819	synonymous_variant	51530	exon7			GGCTCCGGGTCAT	AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.982C>A	7.37:g.129664141G>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	67	0.04	3	NM_016478	182	0.00	0	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Silent	SNP	ENST00000358303.4	37	CCDS34753.1																																																																																					0.537	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349316.1		NM_016478	
ZNF862	643641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149545019	149545019	+	Missense_Mutation	SNP	A	A	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:149545019A>C	ENST00000223210.4	+	4	682	c.437A>C	c.(436-438)cAg>cCg	p.Q146P		NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						TGGTTTGTGCAGTTTCCGTGG	0.537																																					p.Q146P													.	.			0			c.A437C												41.0	42.0	42.0					7																	149545019		1972	4155	6127	SO:0001583	missense	643641	exon4			TTGTGCAGTTTCC	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.437A>C	7.37:g.149545019A>C	ENSP00000223210:p.Gln146Pro		Somatic	72	0	0		WXS	Illumina HiSeq	.	109	0.13	14	NM_001099220	5	0.00	0	A0AUL8	Missense_Mutation	SNP	ENST00000223210.4	37	CCDS47741.1	.	.	.	.	.	.	.	.	.	.	A	16.20	3.055663	0.55325	.	.	ENSG00000106479	ENST00000223210;ENST00000460379	T	0.01215	5.16	5.28	5.28	0.74379	Zinc finger, TTF-type (1);	0.135912	0.33916	N	0.004436	T	0.02688	0.0081	M	0.65975	2.015	0.30415	N	0.778665	P	0.48911	0.917	P	0.46049	0.502	T	0.06661	-1.0814	10	0.87932	D	0	-10.1768	11.6405	0.51230	1.0:0.0:0.0:0.0	.	146	O60290	ZN862_HUMAN	P	146;62	ENSP00000223210:Q146P	ENSP00000223210:Q146P	Q	+	2	0	ZNF862	149175952	0.998000	0.40836	0.982000	0.44146	0.365000	0.29674	3.598000	0.54038	2.008000	0.58898	0.533000	0.62120	CAG			0.537	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350165.1		NM_001099220	
ABCF2	10061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150912779	150912779	+	Missense_Mutation	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:150912779C>G	ENST00000287844.2	-	13	1550	c.1441G>C	c.(1441-1443)Gag>Cag	p.E481Q	ABCF2_ENST00000222388.2_Missense_Mutation_p.E481Q|ABCF2_ENST00000473874.1_5'Flank	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	481	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATCATGTACTCCAAAGGTGAG	0.473																																					p.E481Q													.	.			0			c.G1441C												169.0	147.0	154.0					7																	150912779		2203	4300	6503	SO:0001583	missense	10061	exon13			TGTACTCCAAAGG	AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1441G>C	7.37:g.150912779C>G	ENSP00000287844:p.Glu481Gln		Somatic	115	0	0		WXS	Illumina HiSeq	.	187	0.13	24	NM_005692	266	0.19	50	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	ENST00000287844.2	37	CCDS5923.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974550	0.92919	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.95137	-3.62;-3.62	5.76	5.76	0.90799	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.043866	0.85682	D	0.000000	D	0.91372	0.7278	N	0.20881	0.62	0.80722	D	1	B;B	0.29232	0.149;0.238	B;B	0.35353	0.201;0.201	D	0.88349	0.2980	10	0.33940	T	0.23	-8.9641	18.9739	0.92728	0.0:1.0:0.0:0.0	.	481;481	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	Q	481	ENSP00000222388:E481Q;ENSP00000287844:E481Q	ENSP00000222388:E481Q	E	-	1	0	ABCF2	150543712	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.237000	0.78164	2.706000	0.92434	0.655000	0.94253	GAG			0.473	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336086.1		NM_005692	
CHPF2	54480	broad.mit.edu	37	7	150931207	150931207	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr7:150931207A>G	ENST00000035307.2	+	1	1623	c.110A>G	c.(109-111)gAg>gGg	p.E37G	CHPF2_ENST00000495645.1_Missense_Mutation_p.E29G	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	37					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						ATCCAGGGGGAGGGAGAAGAT	0.607																																					p.E37G													CHPF2,bladder,carcinoma,0,1	CHPF2	52	1	0			c.A110G												69.0	73.0	71.0					7																	150931207		2203	4300	6503	SO:0001583	missense	54480	exon1			AGGGGGAGGGAGA	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.110A>G	7.37:g.150931207A>G	ENSP00000035307:p.Glu37Gly		Somatic	99	0.0101010101	1		WXS	Illumina HiSeq	Phase_I	139	0.04	5	NM_019015	84	0.00	0	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	A	15.82	2.945917	0.53079	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.27890	1.64;1.66	5.07	5.07	0.68467	.	0.164731	0.53938	D	0.000059	T	0.16342	0.0393	N	0.14661	0.345	0.46725	D	0.999178	B;B	0.12013	0.0;0.005	B;B	0.08055	0.0;0.003	T	0.09975	-1.0650	10	0.25751	T	0.34	-23.2909	7.6487	0.28336	0.9048:0.0:0.0952:0.0	.	37;29	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	G	29;37;37	ENSP00000418914:E29G;ENSP00000035307:E37G	ENSP00000035307:E37G	E	+	2	0	CHPF2	150562140	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.563000	0.60823	1.907000	0.55213	0.379000	0.24179	GAG			0.607	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348648.2		NM_019015	
CDCA2	157313	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	25344851	25344851	+	Splice_Site	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr8:25344851G>A	ENST00000330560.3	+	12	2010		c.e12+1		CDCA2_ENST00000521098.2_Splice_Site|CDCA2_ENST00000380665.3_Splice_Site	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2						mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		CAGAAGAAATGTAAGTGTTTG	0.323																																					.													.	.			0			c.1533+1G>A												137.0	136.0	137.0					8																	25344851		2203	4300	6503	SO:0001630	splice_region_variant	157313	exon12			AGAAATGTAAGTG	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.1533+1G>A	8.37:g.25344851G>A			Somatic	78	0	0		WXS	Illumina HiSeq	.	70	0.13	9	NM_152562	0		0	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Splice_Site	SNP	ENST00000330560.3	37	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916411	0.73098	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5945	0.76569	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDCA2	25400768	0.973000	0.33851	0.756000	0.31282	0.885000	0.51271	4.489000	0.60309	2.826000	0.97356	0.655000	0.94253	.			0.323	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216891.3		NM_152562	Intron
VPS13B	157680	broad.mit.edu;mdanderson.org	37	8	100523425	100523425	+	Missense_Mutation	SNP	T	T	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr8:100523425T>G	ENST00000358544.2	+	29	4504	c.4393T>G	c.(4393-4395)Tta>Gta	p.L1465V	VPS13B_ENST00000357162.2_Missense_Mutation_p.L1440V|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1465					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCGCCACAAGTTAACATCAAG	0.393																																					p.L1465V	Colon(161;2205 2542 7338 31318)												.	VPS13B	811		0			c.T4393G												124.0	126.0	125.0					8																	100523425		2203	4300	6503	SO:0001583	missense	157680	exon29			CACAAGTTAACAT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4393T>G	8.37:g.100523425T>G	ENSP00000351346:p.Leu1465Val		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	72	0.06	4	NM_017890	4	0.00	0	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.426981	0.62733	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.56776	0.44;0.44	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000009	T	0.62060	0.2397	L	0.44542	1.39	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.997	D;D;D	0.78314	0.92;0.99;0.991	T	0.61292	-0.7092	10	0.41790	T	0.15	.	10.4043	0.44248	0.0:0.0835:0.0:0.9165	.	1464;1440;1465	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8	.;.;VP13B_HUMAN	V	1440;1465	ENSP00000349685:L1440V;ENSP00000351346:L1465V	ENSP00000349685:L1440V	L	+	1	2	VPS13B	100592601	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.032000	0.49736	2.155000	0.67459	0.477000	0.44152	TTA			0.393	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000277138.1		NM_184042	
COL14A1	7373	broad.mit.edu	37	8	121322273	121322273	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr8:121322273A>G	ENST00000297848.3	+	37	4697	c.4427A>G	c.(4426-4428)aAg>aGg	p.K1476R	COL14A1_ENST00000309791.4_Missense_Mutation_p.K1476R|COL14A1_ENST00000247781.3_Missense_Mutation_p.K1381R	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CGAGGACCAAAGGGCCAGCAA	0.433																																					p.K1476R													.	COL14A1	292		0			c.A4427G												150.0	134.0	139.0					8																	121322273		2203	4300	6503	SO:0001583	missense	7373	exon37			GACCAAAGGGCCA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4427A>G	8.37:g.121322273A>G	ENSP00000297848:p.Lys1476Arg		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	104	0.03	3	NM_021110	105	0.00	0		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	A	6.313	0.425918	0.11987	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.94232	-3.38;-3.38;-3.38	4.8	4.8	0.61643	.	0.048102	0.85682	D	0.000000	D	0.90310	0.6969	N	0.12920	0.275	0.80722	D	1	P	0.50272	0.933	P	0.56960	0.81	D	0.87121	0.2191	10	0.10377	T	0.69	.	13.4694	0.61273	1.0:0.0:0.0:0.0	.	1476	Q05707	COEA1_HUMAN	R	1476;1476;1381	ENSP00000311809:K1476R;ENSP00000297848:K1476R;ENSP00000247781:K1381R	ENSP00000247781:K1381R	K	+	2	0	COL14A1	121391454	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.475000	0.60210	2.023000	0.59567	0.454000	0.30748	AAG			0.433	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313657.2		NM_021110	
DENND4C	55667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	19346326	19346326	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr9:19346326C>T	ENST00000380432.2	+	18	2737	c.2704C>T	c.(2704-2706)Ctc>Ttc	p.L902F	DENND4C_ENST00000602925.1_Missense_Mutation_p.L1138F|DENND4C_ENST00000434457.2_Missense_Mutation_p.L1187F			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	902					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						AAGCCAAGAACTCCTTGAGCC	0.443																																					p.L1138F													.	.			0			c.C3412T												114.0	110.0	111.0					9																	19346326		2203	4300	6503	SO:0001583	missense	55667	exon22			CAAGAACTCCTTG	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.2704C>T	9.37:g.19346326C>T	ENSP00000369797:p.Leu902Phe		Somatic	65	0	0		WXS	Illumina HiSeq	.	90	0.31	28	NM_017925	45	0.29	13	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	37		.	.	.	.	.	.	.	.	.	.	C	2.353	-0.348340	0.05208	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427	T;T	0.23348	1.91;1.91	5.81	2.83	0.33086	.	1.257830	0.05163	N	0.498262	T	0.26846	0.0657	L	0.44542	1.39	0.26630	N	0.972482	P;P;P;B	0.44380	0.828;0.547;0.834;0.412	B;B;B;B	0.43783	0.431;0.347;0.221;0.084	T	0.16247	-1.0409	10	0.52906	T	0.07	6.6013	5.2684	0.15611	0.1172:0.6354:0.1134:0.134	.	232;902;84;902	B7Z660;Q5VZ89-5;Q5VZ89-3;Q5VZ89	.;.;.;DEN4C_HUMAN	F	902;375;84;232;375;84	ENSP00000305795:L375F;ENSP00000443804:L232F	ENSP00000305795:L375F	L	+	1	0	DENND4C	19336326	0.187000	0.23238	0.259000	0.24435	0.168000	0.22595	0.762000	0.26503	0.302000	0.22762	0.650000	0.86243	CTC			0.443	DENND4C-201	KNOWN	basic	protein_coding	protein_coding				NM_017925	
MELK	9833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	36657333	36657333	+	Silent	SNP	A	A	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr9:36657333A>C	ENST00000298048.2	+	13	1333	c.1149A>C	c.(1147-1149)acA>acC	p.T383T	MELK_ENST00000543751.1_Silent_p.T351T|MELK_ENST00000538311.1_Silent_p.T189T|MELK_ENST00000545008.1_Silent_p.T312T|MELK_ENST00000541717.1_Intron|MELK_ENST00000536987.1_Silent_p.T252T|MELK_ENST00000536329.1_Silent_p.T312T|MELK_ENST00000536860.1_Silent_p.T335T	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	383	Autoinhibitory region.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			ATTTATCAACAGGTGCTGCTA	0.358																																					p.T383T	Ovarian(82;980 1317 7225 14391 18624)												MELK,right_lower_lobe,carcinoma,+2,1	MELK	2	1	0			c.A1149C												127.0	126.0	126.0					9																	36657333		2203	4300	6503	SO:0001819	synonymous_variant	9833	exon13			ATCAACAGGTGCT	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1149A>C	9.37:g.36657333A>C			Somatic	71	0	0		WXS	Illumina HiSeq	.	106	0.30	32	NM_014791	110	0.39	43	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Silent	SNP	ENST00000298048.2	37	CCDS6606.1																																																																																					0.358	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052428.3		NM_014791	
Unknown	0	bcgsc.ca	37	9	68427863	68427863	+	IGR	SNP	T	T	C	rs144877320		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr9:68427863T>C								MIR4477B (12475 upstream) : CR786580.2 (84482 downstream)																							TCCCAGTCATTTGCAGTATCT	0.289																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AGTCATTTGCAGT																													9.37:g.68427863T>C			Somatic	214	0.0186915888	4		WXS	Illumina HiSeq	Phase_1	267	0.06	16	.	38	0.32	12		RNA	SNP		37																																																																																					0	0.289										
TRAF2	7186	mdanderson.org	37	9	139811054	139811054	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chr9:139811054G>A	ENST00000247668.2	+	7	717	c.665G>A	c.(664-666)gGc>gAc	p.G222D	TRAF2_ENST00000359662.3_Missense_Mutation_p.G274D|TRAF2_ENST00000536468.1_Missense_Mutation_p.G222D|TRAF2_ENST00000482854.1_3'UTR	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	222				Missing (in Ref. 2; BAB70792). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		CACGCCATCGGCTGCCTCGAG	0.582																																					p.G222D													.	.			0			c.G665A												129.0	104.0	112.0					9																	139811054		2203	4300	6503	SO:0001583	missense	7186	exon7			CCATCGGCTGCCT	U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.665G>A	9.37:g.139811054G>A	ENSP00000247668:p.Gly222Asp		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_021138	66	0.00	0	A8K107|B4DPJ7|Q7Z337|Q96NT2	Missense_Mutation	SNP	ENST00000247668.2	37	CCDS7013.1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898753	0.72639	.	.	ENSG00000127191	ENST00000536468;ENST00000432785;ENST00000247668;ENST00000359662	T;T;T	0.69175	-0.38;-0.38;-0.38	4.74	4.74	0.60224	Zinc finger, TRAF-type (1);	0.000000	0.85682	D	0.000000	D	0.84857	0.5565	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	D	0.88177	0.2868	10	0.72032	D	0.01	-44.3374	18.0766	0.89428	0.0:0.0:1.0:0.0	.	211;197;222	Q12933-3;Q12933-4;Q12933	.;.;TRAF2_HUMAN	D	222;221;222;274	ENSP00000446414:G222D;ENSP00000247668:G222D;ENSP00000352685:G274D	ENSP00000247668:G222D	G	+	2	0	TRAF2	138930875	1.000000	0.71417	0.989000	0.46669	0.294000	0.27393	8.515000	0.90548	2.337000	0.79520	0.462000	0.41574	GGC			0.582	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055166.1		NM_021138	
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	31950249	31950249	+	Missense_Mutation	SNP	G	G	C			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chrX:31950249G>C	ENST00000357033.4	-	46	6916	c.6710C>G	c.(6709-6711)cCa>cGa	p.P2237R	DMD_ENST00000541735.1_5'UTR|DMD_ENST00000343523.2_5'UTR|DMD_ENST00000378677.2_Missense_Mutation_p.P2233R|DMD_ENST00000474231.1_5'UTR|DMD_ENST00000378707.3_5'UTR|DMD_ENST00000359836.1_5'UTR	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2237					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGGTTCAAGTGGGATACTAGC	0.368																																					p.P2237R													.	.			0			c.C6710G												115.0	107.0	110.0					X																	31950249		2202	4300	6502	SO:0001583	missense	1756	exon46			TCAAGTGGGATAC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6710C>G	X.37:g.31950249G>C	ENSP00000354923:p.Pro2237Arg		Somatic	68	0	0		WXS	Illumina HiSeq	.	76	0.18	14	NM_004006	0		0	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	g	16.23	3.064978	0.55432	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.48201	0.82;0.82	5.81	5.81	0.92471	.	0.000000	0.36815	U	0.002390	T	0.65657	0.2712	L	0.58101	1.795	0.80722	D	1	B;D;D;D;D;D	0.76494	0.247;0.998;0.999;0.999;0.999;0.996	B;D;D;D;D;D	0.83275	0.109;0.962;0.977;0.977;0.996;0.967	T	0.58945	-0.7546	10	0.22109	T	0.4	.	19.0034	0.92842	0.0:0.0:1.0:0.0	.	896;2229;2237;2233;896;893	P11532-2;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;.;DMD_HUMAN;.;.;.	R	2229;896;893;2233;2237;2237;2114	ENSP00000367948:P2233R;ENSP00000354923:P2237R	ENSP00000354923:P2237R	P	-	2	0	DMD	31860170	1.000000	0.71417	0.193000	0.23327	0.566000	0.35808	5.206000	0.65192	2.437000	0.82529	0.591000	0.81541	CCA			0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056182.2		NM_004006	
ZXDA	7789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	57936054	57936054	+	Silent	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chrX:57936054G>A	ENST00000358697.4	-	1	1013	c.801C>T	c.(799-801)taC>taT	p.Y267Y		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	267	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						CGGGGCACAGGTACAGCACCA	0.716																																					p.Y267Y													.	.			0			c.C801T												11.0	12.0	12.0					X																	57936054		2189	4287	6476	SO:0001819	synonymous_variant	7789	exon1			GCACAGGTACAGC	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.801C>T	X.37:g.57936054G>A			Somatic	68	0	0		WXS	Illumina HiSeq	.	68	0.35	24	NM_007156	2	1.00	2	Q9UJP7	Silent	SNP	ENST00000358697.4	37	CCDS14376.1																																																																																					0.716	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056925.1		NM_007156	
Unknown	0	hgsc.bcm.edu	37	X	70890401	70890401	+	IGR	SNP	G	G	T			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chrX:70890401G>T								RP11-402P6.9 (4798 upstream) : CXorf49 (43822 downstream)																							CAGGGAGAACGGGGAGAAAGG	0.532											OREG0019861	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	.			0			.																																									SO:0001628	intergenic_variant	618	.			GAGAACGGGGAGA																													X.37:g.70890401G>T			Somatic	35	0	0	1125	WXS	Illumina HiSeq	.	55	0.44	24	.	0		0		RNA	SNP		37																																																																																					0	0.532										
SASH3	54440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	128925040	128925040	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chrX:128925040G>A	ENST00000356892.3	+	4	539	c.425G>A	c.(424-426)aGc>aAc	p.S142N		NM_018990.3	NP_061863.1	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	142					homeostasis of number of cells within a tissue (GO:0048873)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tumor necrosis factor production (GO:0032760)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	12						CCGGTGCTCAGCCGCCAGGCA	0.617																																					p.S142N													.	.			0			c.G425A												44.0	40.0	41.0					X																	128925040		2203	4300	6503	SO:0001583	missense	54440	exon4			TGCTCAGCCGCCA	BC051881	CCDS14614.1	Xq26	2013-01-10	2008-02-18	2008-02-18	ENSG00000122122	ENSG00000122122		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	15975	protein-coding gene	gene with protein product		300441	"""chromosome X open reading frame 9"""	CXorf9		11470164	Standard	NM_018990		Approved	SLY, 753P9, SH3D6C, HACS2	uc004euu.3	O75995	OTTHUMG00000022372	ENST00000356892.3:c.425G>A	X.37:g.128925040G>A	ENSP00000349359:p.Ser142Asn		Somatic	189	0	0		WXS	Illumina HiSeq	.	233	0.43	100	NM_018990	18	0.00	0	A6NCH1|A8K7K8|Q5JZ38	Missense_Mutation	SNP	ENST00000356892.3	37	CCDS14614.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717024	0.48622	.	.	ENSG00000122122	ENST00000443760;ENST00000356892	T	0.64991	-0.13	5.72	2.96	0.34315	.	0.221618	0.53938	D	0.000048	T	0.66577	0.2803	L	0.43152	1.355	0.45930	D	0.998763	D;B	0.69078	0.997;0.001	D;B	0.79108	0.992;0.002	T	0.63305	-0.6667	10	0.56958	D	0.05	-9.1285	4.901	0.13775	0.1823:0.0:0.6497:0.168	.	110;142	B4DKQ0;O75995	.;SASH3_HUMAN	N	110;142	ENSP00000349359:S142N	ENSP00000349359:S142N	S	+	2	0	SASH3	128752721	1.000000	0.71417	0.697000	0.30258	0.374000	0.29953	3.033000	0.49743	0.185000	0.20105	0.544000	0.68410	AGC			0.617	SASH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058208.1		NM_018990	
GPC3	2719	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	133119396	133119396	+	Silent	SNP	C	C	G			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chrX:133119396C>G	ENST00000370818.3	-	1	526	c.81G>C	c.(79-81)ccG>ccC	p.P27P	GPC3_ENST00000543339.1_Silent_p.P27P|GPC3_ENST00000394299.2_Silent_p.P27P	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	27					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					GCGGCGGCGGCGGGGGCTGCG	0.687			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.P27P			yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	GPC3	88		0			c.G81C												14.0	14.0	14.0					X																	133119396		2189	4277	6466	SO:0001819	synonymous_variant	2719	exon1	Familial Cancer Database	SGBS	CGGCGGCGGGGGC	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.81G>C	X.37:g.133119396C>G			Somatic	110	0.0181818182	2		WXS	Illumina HiSeq	Phase_I	151	0.05	7	NM_001164617	32	0.00	0	C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	CCDS14638.1																																																																																					0.687	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058356.1		NM_004484	
MAGEC1	9947	broad.mit.edu	37	X	140994639	140994641	+	In_Frame_Del	DEL	CTC	CTC	-	rs372076984|rs144357389		TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chrX:140994639_140994641delCTC	ENST00000285879.4	+	4	1735_1737	c.1449_1451delCTC	c.(1447-1452)agctcc>agc	p.483_484SS>S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	483										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTGTGAGCTCCTCCTCCTCC	0.473										HNSCC(15;0.026)																											p.483_484del													.	MAGEC1	317		0			c.1449_1451del																																									SO:0001651	inframe_deletion	9947	exon4			TGTGAGCTCCTCC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1449_1451delCTC	X.37:g.140994648_140994650delCTC	ENSP00000285879:p.Ser489del		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	197	0.04	8	NM_005462	0		0	A0PK03|O75451|Q8TCV4	In_Frame_Del	DEL	ENST00000285879.4	37	CCDS35417.1																																																																																					0.473	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058604.1		NM_005462	
HMGB3	3149	mdanderson.org	37	X	150156360	150156360	+	Silent	SNP	G	G	A			TCGA-XY-A8S2-01A-11D-A435-10	TCGA-XY-A8S2-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63bb0810-bd3e-4f54-bd20-4b016522d054	a7a967d7-1710-4c00-93cf-9d80cebc0e56	g.chrX:150156360G>A	ENST00000325307.7	+	5	672	c.576G>A	c.(574-576)gaG>gaA	p.E192E	HMGB3_ENST00000448905.2_Silent_p.E192E	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	192	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaagaagaggaggaggagg	0.443																																					p.E192E													.	.			1	Substitution - coding silent(1)	large_intestine(1)	c.G576A												50.0	48.0	49.0					X																	150156360		2202	4299	6501	SO:0001819	synonymous_variant	3149	exon5			AGAAGAGGAGGAG	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.576G>A	X.37:g.150156360G>A			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_005342	196	0.01	2	O95556|Q6NS40	Silent	SNP	ENST00000325307.7	37	CCDS35428.1																																																																																					0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060867.1		NM_005342	
