#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MAN1C1	57134	mdanderson.org	37	1	25944310	25944310	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr1:25944310G>T	ENST00000374332.4	+	1	352	c.22G>T	c.(22-24)Ggc>Tgc	p.G8C	MAN1C1_ENST00000263979.3_5'Flank	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	8					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		GAAAGTGCCCGGCTTCGTCCC	0.706																																					p.G8C													.	.			0			c.G22T												11.0	14.0	13.0					1																	25944310		2183	4285	6468	SO:0001583	missense	57134	exon1			GTGCCCGGCTTCG	AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.22G>T	1.37:g.25944310G>T	ENSP00000363452:p.Gly8Cys		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_020379	111	0.00	0	A6NNE2|B2RNP2|Q9Y545	Missense_Mutation	SNP	ENST00000374332.4	37	CCDS265.1	.	.	.	.	.	.	.	.	.	.	g	21.5	4.154669	0.78114	.	.	ENSG00000117643	ENST00000374332	D	0.98684	-5.07	3.53	3.53	0.40419	.	0.308584	0.20358	U	0.093913	D	0.97120	0.9059	L	0.29908	0.895	0.80722	D	1	D	0.52996	0.957	P	0.52481	0.7	D	0.96144	0.9102	10	0.48119	T	0.1	.	10.9465	0.47304	0.0:0.0:1.0:0.0	.	8	Q9NR34	MA1C1_HUMAN	C	8	ENSP00000363452:G8C	ENSP00000363452:G8C	G	+	1	0	MAN1C1	25816897	1.000000	0.71417	0.993000	0.49108	0.894000	0.52154	4.681000	0.61663	1.986000	0.57962	0.546000	0.68486	GGC			0.706	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012828.3		NM_020379	
MAP3K6	9064	broad.mit.edu;ucsc.edu	37	1	27686379	27686379	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr1:27686379G>T	ENST00000493901.1	-	18	2528	c.2289C>A	c.(2287-2289)caC>caA	p.H763Q	MAP3K6_ENST00000357582.2_Missense_Mutation_p.H763Q|MAP3K6_ENST00000374040.3_Missense_Mutation_p.H755Q	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	763	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TGTGGTTGTCGTGCAAGTAGC	0.602																																					p.H763Q													.	MAP3K6	134		0			c.C2289A												115.0	105.0	108.0					1																	27686379		2203	4300	6503	SO:0001583	missense	9064	exon17			GTTGTCGTGCAAG	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2289C>A	1.37:g.27686379G>T	ENSP00000419591:p.His763Gln		Somatic	86	0.011627907	1		WXS	Illumina HiSeq	Phase_I	80	0.14	11	NM_004672	16	0.00	0	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	ENST00000493901.1	37	CCDS299.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.65|14.65	2.599442|2.599442	0.46318|0.46318	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582|ENST00000472410	D;D;D|.	0.84516|.	-1.86;-1.86;-1.86|.	5.03|5.03	-5.62|-5.62	0.02481|0.02481	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	.|.	.|.	.|.	.|.	D|D	0.82793|0.82793	0.5114|0.5114	H|H	0.94183|0.94183	3.505|3.505	0.48185|0.48185	D|D	0.999603|0.999603	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.86254|0.86254	0.1651|0.1651	9|5	0.87932|.	D|.	0|.	.|.	15.152|15.152	0.72706|0.72706	0.3845:0.0:0.6155:0.0|0.3845:0.0:0.6155:0.0	.|.	755;763|.	O95382-3;O95382|.	.;M3K6_HUMAN|.	Q|K	755;763;486;763|487	ENSP00000363152:H755Q;ENSP00000419591:H763Q;ENSP00000350195:H763Q|.	ENSP00000350195:H763Q|.	H|T	-|-	3|2	2|0	MAP3K6|MAP3K6	27558966|27558966	0.001000|0.001000	0.12720|0.12720	0.900000|0.900000	0.35374|0.35374	0.322000|0.322000	0.28314|0.28314	-1.313000|-1.313000	0.02718|0.02718	-1.223000|-1.223000	0.02584|0.02584	-1.036000|-1.036000	0.02392|0.02392	CAC|ACG			0.602	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000013469.2		NM_004672	
PRPF38B	55119	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	109242141	109242142	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr1:109242141_109242142delAG	ENST00000370025.4	+	6	1409_1410	c.1140_1141delAG	c.(1138-1143)aaagagfs	p.E381fs	PRPF38B_ENST00000370021.1_Frame_Shift_Del_p.E270fs	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	381	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		aacgagaaaaagagagagagcg	0.436																																					p.380_380del													PRPF38B,colon,carcinoma,0,1	PRPF38B	55		0			c.1139_1140del																																									SO:0001589	frameshift_variant	55119	exon6			AGAAAAAGAGAGA	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.1140_1141delAG	1.37:g.109242149_109242150delAG	ENSP00000359042:p.Glu381fs		Somatic	94	0	0		WXS	Illumina HiSeq	.	81	0.28	23	NM_018061	193	0.00	0	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Frame_Shift_Del	DEL	ENST00000370025.4	37	CCDS788.1																																																																																					0.436	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030231.1		NM_018061	
NBPF15	284565	hgsc.bcm.edu	37	1	148579688	148579688	+	Silent	SNP	C	C	G	rs202153254		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr1:148579688C>G	ENST00000369187.3	+	6	747	c.258C>G	c.(256-258)ctC>ctG	p.L86L	NBPF15_ENST00000464336.2_3'UTR|NBPF15_ENST00000442702.2_Silent_p.L86L	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	86						cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					CAGAGCAGCTCAAGCAAGCTG	0.512																																					p.L86L													NBPF15,face,carcinoma,+2,1	NBPF15	2	1	0			c.C258G												5.0	8.0	7.0					1																	148579688		840	1968	2808	SO:0001819	synonymous_variant	728936	exon3			GCAGCTCAAGCAA	BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.258C>G	1.37:g.148579688C>G			Somatic	33	0	0		WXS	Illumina HiSeq	.	32	0.13	4	NM_001102663	8	0.00	0	Q3BBV9|Q8IX77	Silent	SNP	ENST00000369187.3	37	CCDS932.1																																																																																			0.001		0.512	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000038609.3		NM_173638	
TSACC	128229	broad.mit.edu	37	1	156314421	156314421	+	Missense_Mutation	SNP	T	T	C	rs149637850	byFrequency	TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr1:156314421T>C	ENST00000368255.3	+	3	445	c.85T>C	c.(85-87)Tcc>Ccc	p.S29P	TSACC_ENST00000368253.2_Missense_Mutation_p.S29P|TSACC_ENST00000368254.1_Missense_Mutation_p.S29P|TSACC_ENST00000481479.1_Missense_Mutation_p.S29P|TSACC_ENST00000466306.1_Missense_Mutation_p.S29P|TSACC_ENST00000368252.1_Missense_Mutation_p.S29P|TSACC_ENST00000368251.1_Missense_Mutation_p.S29P|TSACC_ENST00000470342.1_Missense_Mutation_p.S29P	NM_144627.3	NP_653228.1	Q96A04	TSACC_HUMAN	TSSK6 activating co-chaperone	29						cytoplasm (GO:0005737)	chaperone binding (GO:0051087)										AGCAAAACCCTCCCCCAGCTA	0.468																																					p.S29P													.	.			0			c.T85C												92.0	92.0	92.0					1																	156314421		2203	4300	6503	SO:0001583	missense	128229	exon3			AAACCCTCCCCCA	AY048672	CCDS1141.1	1q22	2012-08-16	2012-08-16	2012-08-16	ENSG00000163467	ENSG00000163467			30636	protein-coding gene	gene with protein product	"""SSTK-interacting protein"""		"""chromosome 1 open reading frame 182"""	C1orf182		20829357	Standard	NM_144627		Approved	SSTK-IP, SIP	uc001foo.3	Q96A04	OTTHUMG00000024060	ENST00000368255.3:c.85T>C	1.37:g.156314421T>C	ENSP00000357238:p.Ser29Pro		Somatic	91	0.032967033	3		WXS	Illumina HiSeq	Phase_I	75	0.11	8	NM_144627	23	0.00	0	D3DVB9	Missense_Mutation	SNP	ENST00000368255.3	37	CCDS1141.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.582359	0.65992	.	.	ENSG00000163467	ENST00000368255;ENST00000368254;ENST00000368253;ENST00000368252;ENST00000368251	T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32	4.86	3.72	0.42706	.	0.000000	0.44483	D	0.000448	T	0.45955	0.1368	L	0.32530	0.975	0.31276	N	0.691214	D	0.57899	0.981	P	0.61275	0.886	T	0.50021	-0.8876	10	0.87932	D	0	-6.5054	7.8292	0.29332	0.1841:0.0:0.0:0.8159	.	29	Q96A04	CA182_HUMAN	P	29	ENSP00000357238:S29P;ENSP00000357237:S29P;ENSP00000357236:S29P;ENSP00000357235:S29P;ENSP00000357234:S29P	ENSP00000357234:S29P	S	+	1	0	C1orf182	154581045	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	1.656000	0.37355	0.866000	0.35629	0.402000	0.26972	TCC			0.468	TSACC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060594.1		NM_144627	
OR6K6	128371	broad.mit.edu	37	1	158725536	158725536	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr1:158725536T>C	ENST00000368144.2	+	1	1027	c.931T>C	c.(931-933)Ttt>Ctt	p.F311L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					CCTTGCTCCCTTTTTCAACCC	0.438																																					p.F311L													.	OR6K6	81		0			c.T931C												149.0	140.0	143.0					1																	158725536		2203	4300	6503	SO:0001583	missense	128371	exon1			GCTCCCTTTTTCA	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.931T>C	1.37:g.158725536T>C	ENSP00000357126:p.Phe311Leu		Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	168	0.02	4	NM_001005184	0		0	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	T	7.953	0.745283	0.15710	.	.	ENSG00000180433	ENST00000368144	T	0.35789	1.29	5.33	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000869	T	0.05914	0.0154	N	0.03281	-0.365	0.29167	N	0.877357	B	0.28667	0.219	B	0.27380	0.079	T	0.16070	-1.0415	10	0.40728	T	0.16	-17.7057	7.5224	0.27635	0.1408:0.0:0.147:0.7122	.	311	Q8NGW6	OR6K6_HUMAN	L	311	ENSP00000357126:F311L	ENSP00000357126:F311L	F	+	1	0	OR6K6	156992160	0.000000	0.05858	0.973000	0.42090	0.816000	0.46133	-1.108000	0.03313	1.043000	0.40175	-0.257000	0.10917	TTT			0.438	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059065.2		NM_001005184	
FMN2	56776	broad.mit.edu	37	1	240371139	240371139	+	Silent	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr1:240371139C>T	ENST00000319653.9	+	5	3257	c.3027C>T	c.(3025-3027)ccC>ccT	p.P1009P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1009	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGGGCATACCCCCTCCTCCCC	0.731																																					p.P1009P													.	FMN2	451		0			c.C3027T																																									SO:0001819	synonymous_variant	56776	exon5			CATACCCCCTCCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3027C>T	1.37:g.240371139C>T			Somatic	101	0.0099009901	1		WXS	Illumina HiSeq	Phase_I	103	0.05	5	NM_020066	0		0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																					0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
ZNF485	220992	mdanderson.org	37	10	44112810	44112810	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr10:44112810G>T	ENST00000361807.3	+	5	1513	c.1319G>T	c.(1318-1320)tGt>tTt	p.C440F	ZNF485_ENST00000374437.2_Missense_Mutation_p.C349F|ZNF485_ENST00000374435.3_Missense_Mutation_p.C440F	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	440					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						GCCATGAAATGTAGTTAGTGT	0.333																																					p.C440F													.	.			0			c.G1319T												42.0	47.0	45.0					10																	44112810		2187	4293	6480	SO:0001583	missense	220992	exon5			TGAAATGTAGTTA	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.1319G>T	10.37:g.44112810G>T	ENSP00000354694:p.Cys440Phe		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_145312	7	0.00	0	B4DSE6|Q96CL0	Missense_Mutation	SNP	ENST00000361807.3	37	CCDS7205.2	.	.	.	.	.	.	.	.	.	.	G	8.159	0.789147	0.16258	.	.	ENSG00000198298	ENST00000361807;ENST00000374437;ENST00000374435	T;T;T	0.08720	3.38;3.06;3.38	2.3	2.3	0.28687	.	.	.	.	.	T	0.41073	0.1143	H	0.98068	4.14	0.41698	D	0.989387	D	0.89917	1.0	D	0.97110	1.0	T	0.59440	-0.7454	9	0.87932	D	0	.	10.6907	0.45869	0.0:0.0:1.0:0.0	.	440	Q8NCK3	ZN485_HUMAN	F	440;349;440	ENSP00000354694:C440F;ENSP00000363560:C349F;ENSP00000363558:C440F	ENSP00000354694:C440F	C	+	2	0	ZNF485	43432816	1.000000	0.71417	0.959000	0.39883	0.138000	0.21146	3.818000	0.55678	1.586000	0.49944	0.313000	0.20887	TGT			0.333	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047719.2		NM_145312	
ANK3	288	mdanderson.org	37	10	61815794	61815794	+	Splice_Site	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr10:61815794G>T	ENST00000280772.2	-	42	12878	c.12687C>A	c.(12685-12687)agC>agA	p.S4229R	ANK3_ENST00000503366.1_Splice_Site_p.S1720R|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000355288.2_Splice_Site_p.S853R|ANK3_ENST00000373827.2_Splice_Site_p.S1713R	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4229					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ACTGGTCAGGGCTGCAACAGA	0.388																																					p.S4229R													ANK3_ENST00000355288,NS,carcinoma,0,2	ANK3_ENST00000355288	0	2	0			c.C12687A												48.0	47.0	47.0					10																	61815794		2201	4300	6501	SO:0001630	splice_region_variant	288	exon42			GTCAGGGCTGCAA	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12687-1C>A	10.37:g.61815794G>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	22	0.14	3	NM_020987	17	0.00	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513917	0.64522	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000502769;ENST00000355288;ENST00000503366;ENST00000395299;ENST00000373817	T;T;T;T;T;T	0.74421	-0.58;-0.84;0.39;0.44;-0.03;-0.83	5.89	3.04	0.35103	.	0.000000	0.43747	U	0.000523	T	0.74869	0.3773	L	0.29908	0.895	0.80722	D	1	B;D;D;B;D;D;D	0.64830	0.0;0.99;0.99;0.289;0.994;0.99;0.987	B;D;D;B;D;D;P	0.71870	0.0;0.944;0.944;0.189;0.975;0.944;0.67	T	0.70706	-0.4798	10	0.32370	T	0.25	.	9.6883	0.40111	0.2774:0.0:0.7226:0.0	.	1720;853;1713;4229;954;853;252	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	R	4229;1713;311;1;853;1720;1699;954	ENSP00000280772:S4229R;ENSP00000362933:S1713R;ENSP00000362926:S311R;ENSP00000423057:S1R;ENSP00000347436:S853R;ENSP00000425236:S1720R	ENSP00000280772:S4229R	S	-	3	2	ANK3	61485800	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	2.393000	0.44442	0.841000	0.35020	0.561000	0.74099	AGC			0.388	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000048201.4		NM_020987	Missense_Mutation
JAKMIP3	282973	mdanderson.org	37	10	133955460	133955460	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr10:133955460C>T	ENST00000298622.4	+	10	1648	c.1510C>T	c.(1510-1512)Cag>Tag	p.Q504*		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	504						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		GAGGTTCCGGCAGCTGACCAT	0.607																																					p.Q504X													.	.			0			c.C1510T												99.0	65.0	77.0					10																	133955460		2199	4294	6493	SO:0001587	stop_gained	282973	exon10			TTCCGGCAGCTGA	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1510C>T	10.37:g.133955460C>T	ENSP00000298622:p.Gln504*		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001105521	0		0	A6PW00|Q69YM6|Q6ZT29	Nonsense_Mutation	SNP	ENST00000298622.4	37	CCDS44494.1	.	.	.	.	.	.	.	.	.	.	C	40	8.518117	0.98845	.	.	ENSG00000188385	ENST00000298622	.	.	.	3.87	3.87	0.44632	.	0.154517	0.43416	D	0.000567	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-31.323	16.3872	0.83514	0.0:1.0:0.0:0.0	.	.	.	.	X	504	.	ENSP00000298622:Q504X	Q	+	1	0	JAKMIP3	133805450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.225000	0.78051	2.182000	0.69389	0.561000	0.74099	CAG			0.607	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051049.3		NM_194303	
ZNF511	118472	mdanderson.org	37	10	135123706	135123706	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr10:135123706G>T	ENST00000359035.3	+	4	471	c.468G>T	c.(466-468)aaG>aaT	p.K156N	ZNF511_ENST00000361518.5_Missense_Mutation_p.K156N|TUBGCP2_ENST00000417178.2_5'Flank|ZNF511_ENST00000463816.2_3'UTR|ZNF511_ENST00000368554.4_Missense_Mutation_p.K91N|TUBGCP2_ENST00000368563.2_5'Flank|TUBGCP2_ENST00000470829.1_5'Flank			Q8NB15	ZN511_HUMAN	zinc finger protein 511	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		AGAAGTTCAAGACCAGCAGAG	0.582																																					p.K156N													.	.			0			c.G468T												109.0	111.0	110.0					10																	135123706		2203	4300	6503	SO:0001583	missense	118472	exon4			GTTCAAGACCAGC	AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.468G>T	10.37:g.135123706G>T	ENSP00000351929:p.Lys156Asn		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_145806	130	0.00	0	A8K8L5|Q8WUP1|Q96BV2	Missense_Mutation	SNP	ENST00000359035.3	37		.	.	.	.	.	.	.	.	.	.	G	20.1	3.937071	0.73557	.	.	ENSG00000198546	ENST00000361518;ENST00000359035;ENST00000368554	D;D;D	0.88741	-2.42;-2.42;-2.42	5.38	4.47	0.54385	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.409630	0.29059	N	0.013267	D	0.91157	0.7215	L	0.57536	1.79	0.46356	D	0.999003	D;P;D	0.69078	0.997;0.859;0.969	P;P;P	0.62298	0.9;0.491;0.754	D	0.90325	0.4347	10	0.48119	T	0.1	-3.8727	9.7739	0.40607	0.1601:0.0:0.8399:0.0	.	156;91;156	Q8NB15;E1U340;Q8NB15-2	ZN511_HUMAN;.;.	N	156;156;91	ENSP00000355251:K156N;ENSP00000351929:K156N;ENSP00000357542:K91N	ENSP00000351929:K156N	K	+	3	2	ZNF511	134973696	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.757000	0.38400	1.425000	0.47237	0.655000	0.94253	AAG			0.582	ZNF511-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000051143.1		NM_145806	
CALY	50632	mdanderson.org	37	10	135141480	135141480	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr10:135141480G>T	ENST00000252939.4	-	3	268	c.175C>A	c.(175-177)Cca>Aca	p.P59T	CALY_ENST00000368558.1_Missense_Mutation_p.P59T|ZNF511_ENST00000368554.4_Intron|CALY_ENST00000368555.3_Missense_Mutation_p.P59T|CALY_ENST00000368556.2_Missense_Mutation_p.P59T|CALY_ENST00000467611.1_5'Flank	NM_015722.3	NP_056537.1	Q9NYX4	CALY_HUMAN	calcyon neuron-specific vesicular protein	59					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)|endocytosis (GO:0006897)|positive regulation of endocytosis (GO:0045807)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)	clathrin light chain binding (GO:0032051)			kidney(1)|lung(2)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)	Apomorphine(DB00714)|Clozapine(DB00363)|Trifluoperazine(DB00831)	TGCTGGTCTGGGGAGGACAGC	0.602																																					p.P59T													.	.			0			c.C175A												138.0	107.0	118.0					10																	135141480		2201	4300	6501	SO:0001583	missense	50632	exon3			GGTCTGGGGAGGA	AF225903	CCDS7678.1	10q26.3	2008-07-02	2008-01-16	2008-01-16	ENSG00000130643	ENSG00000130643			17938	protein-coding gene	gene with protein product		604647	"""dopamine receptor D1 interacting protein"""	DRD1IP		10698743, 17623072	Standard	NM_015722		Approved	CALCYON, NSG3	uc001lmo.2	Q9NYX4	OTTHUMG00000019310	ENST00000252939.4:c.175C>A	10.37:g.135141480G>T	ENSP00000252939:p.Pro59Thr		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_015722	0		0	Q5VWX3|Q5VWY5|Q5VWY6	Missense_Mutation	SNP	ENST00000252939.4	37	CCDS7678.1	.	.	.	.	.	.	.	.	.	.	G	3.490	-0.104039	0.06967	.	.	ENSG00000130643	ENST00000252939;ENST00000368558;ENST00000368556;ENST00000368555	.	.	.	4.11	-3.15	0.05233	.	0.640711	0.14000	N	0.348180	T	0.24005	0.0581	L	0.36672	1.1	0.09310	N	1	B	0.18968	0.032	B	0.17098	0.017	T	0.13308	-1.0514	9	0.44086	T	0.13	-7.1606	1.6909	0.02852	0.2734:0.2681:0.3381:0.1204	.	59	Q9NYX4	CALY_HUMAN	T	59	.	ENSP00000252939:P59T	P	-	1	0	CALY	134991470	0.000000	0.05858	0.001000	0.08648	0.286000	0.27126	-0.676000	0.05221	-0.833000	0.04245	-1.369000	0.01192	CCA			0.602	CALY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051122.1		NM_015722	
ARNTL	406	mdanderson.org	37	11	13407273	13407273	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr11:13407273G>T	ENST00000403290.1	+	19	2010	c.1655G>T	c.(1654-1656)gGc>gTc	p.G552V	ARNTL_ENST00000403482.3_Missense_Mutation_p.G550V|ARNTL_ENST00000361003.4_Missense_Mutation_p.G434V|ARNTL_ENST00000389707.4_Missense_Mutation_p.G551V|ARNTL_ENST00000403510.3_Missense_Mutation_p.G508V|ARNTL_ENST00000396441.3_Missense_Mutation_p.G551V|ARNTL_ENST00000389708.3_3'UTR|ARNTL_ENST00000401424.1_Missense_Mutation_p.G509V			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	552	Interaction with CIART. {ECO:0000250|UniProtKB:Q9WTL8}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		CCTTCCAGTGGCCTACTATCA	0.408																																					p.G551V													.	.			0			c.G1652T												141.0	126.0	131.0					11																	13407273		2200	4294	6494	SO:0001583	missense	406	exon19			CCAGTGGCCTACT	D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.1655G>T	11.37:g.13407273G>T	ENSP00000384517:p.Gly552Val		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001178	30	0.00	0	A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Missense_Mutation	SNP	ENST00000403290.1	37		.	.	.	.	.	.	.	.	.	.	G	15.10	2.734486	0.48939	.	.	ENSG00000133794	ENST00000396441;ENST00000389707;ENST00000401424;ENST00000403290;ENST00000361003;ENST00000403510;ENST00000339640;ENST00000403482	T;T;T;T;T;T;T	0.12569	3.07;3.07;3.1;3.07;2.67;3.1;3.07	5.22	5.22	0.72569	.	0.106561	0.64402	D	0.000004	T	0.16599	0.0399	L	0.43152	1.355	0.80722	D	1	B;B;B;B;B	0.30021	0.016;0.001;0.137;0.215;0.265	B;B;B;B;B	0.37047	0.015;0.003;0.121;0.24;0.107	T	0.02244	-1.1189	10	0.49607	T	0.09	.	13.5203	0.61563	0.0:0.0:0.844:0.156	.	550;509;552;551;508	O00327-7;O00327-1;O00327;O00327-8;A2I2N6	.;.;BMAL1_HUMAN;.;.	V	551;551;509;552;434;508;508;550	ENSP00000379718:G551V;ENSP00000374357:G551V;ENSP00000385915:G509V;ENSP00000384517:G552V;ENSP00000354278:G434V;ENSP00000385581:G508V;ENSP00000385897:G550V	ENSP00000340289:G508V	G	+	2	0	ARNTL	13363849	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.252000	0.78309	2.710000	0.92621	0.561000	0.74099	GGC			0.408	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000319173.1		NM_001178	
NRXN2	9379	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	64375421	64375421	+	Silent	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr11:64375421C>T	ENST00000377551.1	-	22	4597	c.4386G>A	c.(4384-4386)acG>acA	p.T1462T	NRXN2_ENST00000301894.2_Silent_p.T416T|NRXN2_ENST00000377559.3_Silent_p.T1392T|NRXN2_ENST00000409571.1_Silent_p.T1455T|NRXN2_ENST00000265459.6_Silent_p.T1462T			Q9P2S2	NRX2A_HUMAN	neurexin 2	1462					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						gcgggggcAGCGTGTCTTGGG	0.751																																					p.T1462T													.	.			0			c.G4386A												2.0	3.0	2.0					11																	64375421		1314	2901	4215	SO:0001819	synonymous_variant	9379	exon23			GGGCAGCGTGTCT		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.4386G>A	11.37:g.64375421C>T			Somatic	8	0	0		WXS	Illumina HiSeq	.	14	0.93	13	NM_015080	1	1.00	1	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																					0.751	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000104967.3		NM_015080	
ATG2A	23130	mdanderson.org	37	11	64680578	64680578	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr11:64680578C>T	ENST00000377264.3	-	6	869	c.757G>A	c.(757-759)Ggc>Agc	p.G253S	ATG2A_ENST00000421419.2_Missense_Mutation_p.G253S	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	253					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GAGCAGCTGCCGATCTGCAAG	0.587																																					p.G253S													.	.			0			c.G757A												18.0	19.0	19.0					11																	64680578		2199	4295	6494	SO:0001583	missense	23130	exon6			AGCTGCCGATCTG		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.757G>A	11.37:g.64680578C>T	ENSP00000366475:p.Gly253Ser		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_015104	14	0.00	0	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.8|21.8	4.202103|4.202103	0.79127|0.79127	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459|ENST00000418259	T;T|.	0.10573|.	2.86;2.86|.	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60025|0.60025	0.2237|0.2237	L|L	0.45581|0.45581	1.43|1.43	0.44579|0.44579	D|D	0.99754|0.99754	D|.	0.57899|.	0.981|.	B|.	0.38378|.	0.272|.	T|T	0.57447|0.57447	-0.7810|-0.7810	10|5	0.56958|.	D|.	0.05|.	.|.	13.1711|13.1711	0.59599|0.59599	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	253|.	Q2TAZ0|.	ATG2A_HUMAN|.	S|Q	253|54	ENSP00000410522:G253S;ENSP00000366475:G253S|.	ENSP00000227459:G253S|.	G|R	-|-	1|2	0|0	ATG2A|ATG2A	64437154|64437154	0.997000|0.997000	0.39634|0.39634	0.996000|0.996000	0.52242|0.52242	0.978000|0.978000	0.69477|0.69477	3.782000|3.782000	0.55401|0.55401	2.255000|2.255000	0.74692|0.74692	0.555000|0.555000	0.69702|0.69702	GGC|CGG			0.587	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000143224.1		NM_015104	
KLHL35	283212	mdanderson.org	37	11	75139524	75139524	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr11:75139524G>T	ENST00000539798.1	-	2	1028	c.1029C>A	c.(1027-1029)ttC>ttA	p.F343L	KLHL35_ENST00000376292.4_Missense_Mutation_p.F123L	NM_001039548.2	NP_001034637.2	Q6PF15	KLH35_HUMAN	kelch-like family member 35	343										lung(2)|stomach(1)	3						CACAGGCGGCGAATTCTGAGC	0.647																																					p.F343L	Colon(77;683 1691 18820 23811)												.	.			0			c.C1029A												40.0	49.0	46.0					11																	75139524		2002	4163	6165	SO:0001583	missense	283212	exon2			GGCGGCGAATTCT		CCDS44685.1, CCDS44685.2	11q13.4	2013-02-22	2013-02-22		ENSG00000149243	ENSG00000149243		"""Kelch-like"", ""BTB/POZ domain containing"""	26597	protein-coding gene	gene with protein product			"""kelch-like 35 (Drosophila)"""				Standard	NM_001039548		Approved	FLJ33790	uc001owm.2	Q6PF15	OTTHUMG00000133573	ENST00000539798.1:c.1029C>A	11.37:g.75139524G>T	ENSP00000438526:p.Phe343Leu		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_001039548	25	0.00	0	A2RU06|F5H412|Q86XM7|Q8NBB1	Missense_Mutation	SNP	ENST00000539798.1	37	CCDS44685.2	.	.	.	.	.	.	.	.	.	.	G	16.16	3.045262	0.55110	.	.	ENSG00000149243	ENST00000376292;ENST00000539798	T;T	0.66995	-0.24;-0.24	5.11	-2.37	0.06643	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.59945	0.2231	M	0.62088	1.915	0.46167	D	0.998903	P	0.36465	0.554	B	0.38296	0.27	T	0.59526	-0.7438	10	0.66056	D	0.02	.	10.8785	0.46925	0.5553:0.0:0.4447:0.0	.	123	Q6PF15	KLH35_HUMAN	L	123;343	ENSP00000365469:F123L;ENSP00000438526:F343L	ENSP00000365469:F123L	F	-	3	2	KLHL35	74817172	0.933000	0.31639	0.938000	0.37757	0.559000	0.35586	0.151000	0.16283	-0.301000	0.08882	-1.036000	0.02392	TTC			0.647	KLHL35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_173583	
NAALAD2	10003	broad.mit.edu;mdanderson.org	37	11	89891357	89891357	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr11:89891357C>T	ENST00000534061.1	+	7	1071	c.841C>T	c.(841-843)Cga>Tga	p.R281*	NAALAD2_ENST00000525171.1_Intron|NAALAD2_ENST00000321955.4_Nonsense_Mutation_p.R281*|NAALAD2_ENST00000375944.3_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	281	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)	p.R281*(2)|p.R281R(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GGGAATCCCCCGAATACCTGT	0.313																																					p.R281X													NAALAD2,NS,carcinoma,0,2	NAALAD2	113	2	3	Substitution - Nonsense(2)|Substitution - coding silent(1)	lung(2)|prostate(1)	c.C841T												115.0	121.0	119.0					11																	89891357		2201	4299	6500	SO:0001587	stop_gained	10003	exon7			ATCCCCCGAATAC	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.841C>T	11.37:g.89891357C>T	ENSP00000432481:p.Arg281*		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	88	0.05	4	NM_005467	28	0.00	0	B3KQR4|Q4KKV4|Q4VAM9	Nonsense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	C	33	5.250829	0.95305	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	.	.	.	5.13	-10.3	0.00346	.	0.797499	0.11731	N	0.534986	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	0.2934	23.9434	0.99987	0.2095:0.7905:0.0:0.0	.	.	.	.	X	281	.	.	R	+	1	2	NAALAD2	89531005	0.248000	0.23930	0.084000	0.20598	0.982000	0.71751	0.998000	0.29744	-1.706000	0.01404	-0.358000	0.07595	CGA			0.313	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389424.2		NM_005467	
FAT3	120114	mdanderson.org	37	11	92616362	92616362	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr11:92616362G>T	ENST00000298047.6	+	23	12757	c.12740G>T	c.(12739-12741)aGc>aTc	p.S4247I	FAT3_ENST00000533797.1_Missense_Mutation_p.S582I|FAT3_ENST00000525166.1_Missense_Mutation_p.S4097I|FAT3_ENST00000409404.2_Missense_Mutation_p.S4247I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4247					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GACTCCAGGAGCAACCTGGAT	0.677										TCGA Ovarian(4;0.039)																											p.S4247I													.	.			0			c.G12740T												73.0	88.0	83.0					11																	92616362		2093	4205	6298	SO:0001583	missense	120114	exon23			CCAGGAGCAACCT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12740G>T	11.37:g.92616362G>T	ENSP00000298047:p.Ser4247Ile		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001008781	0		0	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	15.53	2.860348	0.51482	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;D	0.86097	-0.86;-0.87;-0.87;-2.07	5.85	4.85	0.62838	.	.	.	.	.	T	0.75369	0.3840	N	0.22421	0.69	0.80722	D	1	B;B	0.32101	0.078;0.356	B;B	0.37780	0.054;0.258	T	0.74441	-0.3664	9	0.87932	D	0	.	3.8799	0.09074	0.3237:0.0:0.6763:0.0	.	4247;4247	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	I	4247;4247;4097;582	ENSP00000298047:S4247I;ENSP00000387040:S4247I;ENSP00000432586:S4097I;ENSP00000436399:S582I	ENSP00000298047:S4247I	S	+	2	0	FAT3	92256010	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.424000	0.52764	2.770000	0.95276	0.655000	0.94253	AGC			0.677	FAT3-201	KNOWN	basic	protein_coding	protein_coding				NM_001008781	
KMT2A	4297	broad.mit.edu	37	11	118391583	118391583	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr11:118391583G>T	ENST00000389506.5	+	34	11487	c.11487G>T	c.(11485-11487)gaG>gaT	p.E3829D	RP11-770J1.3_ENST00000532597.1_RNA|KMT2A_ENST00000534358.1_Missense_Mutation_p.E3832D|KMT2A_ENST00000354520.4_Missense_Mutation_p.E3791D|RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000528578.1_RNA|RP11-770J1.3_ENST00000554407.1_RNA|RP11-770J1.3_ENST00000556583.1_RNA			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3829	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CTTCTAAGGAGGCAGTTGGTG	0.393																																					p.E3832D													.	MLL	548		0			c.G11496T												52.0	52.0	52.0					11																	118391583		2200	4295	6495	SO:0001583	missense	4297	exon34			TAAGGAGGCAGTT	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.11487G>T	11.37:g.118391583G>T	ENSP00000374157:p.Glu3829Asp		Somatic	373	0	0		WXS	Illumina HiSeq	Phase_I	262	0.02	5	NM_001197104	13	0.00	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.821825	0.32237	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	T;T;T	0.80214	-1.35;-1.35;-1.35	5.68	2.67	0.31697	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.60560	0.2278	N	0.05414	-0.055	0.43499	D	0.995749	B;B	0.20780	0.048;0.048	B;B	0.13407	0.009;0.009	T	0.52193	-0.8608	10	0.32370	T	0.25	.	10.5036	0.44821	0.2172:0.0:0.7828:0.0	.	3832;3829	E9PQG7;Q03164	.;MLL1_HUMAN	D	3832;3829;3791;2739	ENSP00000436786:E3832D;ENSP00000374157:E3829D;ENSP00000346516:E3791D	ENSP00000346516:E3791D	E	+	3	2	MLL	117896793	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.108000	0.41854	0.690000	0.31570	0.561000	0.74099	GAG			0.393	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000399085.2		NM_005933	
CEP290	80184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	88524340	88524340	+	Missense_Mutation	SNP	G	G	C			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr12:88524340G>C	ENST00000552810.1	-	8	841	c.498C>G	c.(496-498)aaC>aaG	p.N166K	CEP290_ENST00000397838.3_5'Flank|CEP290_ENST00000309041.7_Missense_Mutation_p.N166K	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	166					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTAGACGTTTGTTCTACAGAA	0.289																																					p.N166K													.	.			0			c.C498G												75.0	64.0	67.0					12																	88524340		1795	4064	5859	SO:0001583	missense	80184	exon8			ACGTTTGTTCTAC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.498C>G	12.37:g.88524340G>C	ENSP00000448012:p.Asn166Lys		Somatic	51	0	0		WXS	Illumina HiSeq	.	65	0.22	14	NM_025114	1	0.00	0	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698950	0.30142	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139;ENST00000550962	T;T;D	0.86627	-0.09;-0.09;-2.15	5.77	4.88	0.63580	.	0.123933	0.52532	D	0.000066	T	0.70859	0.3272	N	0.08118	0	0.80722	D	1	B	0.11235	0.004	B	0.14578	0.011	T	0.64533	-0.6385	10	0.21540	T	0.41	.	7.1789	0.25761	0.0827:0.0:0.627:0.2903	.	166	O15078	CE290_HUMAN	K	166;166;166;68;148	ENSP00000448012:N166K;ENSP00000308021:N166K;ENSP00000447623:N148K	ENSP00000308021:N166K	N	-	3	2	CEP290	87048471	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.893000	0.48633	2.728000	0.93425	0.650000	0.86243	AAC			0.289	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000406344.1		NM_025114	
NBEA	26960	mdanderson.org	37	13	36050879	36050879	+	Intron	SNP	G	G	T	rs529737825		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr13:36050879G>T	ENST00000400445.3	+	41	7119				NBEA_ENST00000310336.4_Intron|MAB21L1_ENST00000379919.4_5'Flank|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000537702.1_5'Flank	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin						protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CAGGCAGGCGGGCGGCCAATC	0.532													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14463	0.0		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001627	intron_variant	100302239	.			CAGGCGGGCGGCC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6585+4206G>T	13.37:g.36050879G>T			Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	.	0		0	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	RNA	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																					0.532	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_015678	
NDFIP2	54602	mdanderson.org	37	13	80055401	80055401	+	Silent	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr13:80055401C>T	ENST00000218652.7	+	1	115	c.63C>T	c.(61-63)cgC>cgT	p.R21R	NDFIP2-AS1_ENST00000457171.1_RNA	NM_001161407.1|NM_019080.2	NP_001154879.1|NP_061953.2	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2	21					negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of transporter activity (GO:0032410)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			NS(1)|breast(1)|endometrium(2)|kidney(3)|lung(3)|ovary(2)|prostate(1)|skin(1)	14		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		ATAGCGCGCGCGGCGCCCCGG	0.726																																					p.R21R													.	.			0			c.C63T												2.0	3.0	3.0					13																	80055401		1702	3429	5131	SO:0001819	synonymous_variant	54602	exon1			CGCGCGCGGCGCC	AB032991	CCDS31998.1	13q22.1	2011-05-18			ENSG00000102471	ENSG00000102471			18537	protein-coding gene	gene with protein product		610041				10574461, 12050153	Standard	NM_019080		Approved	KIAA1165, N4wbp5a	uc001vlf.3	Q9NV92	OTTHUMG00000017136	ENST00000218652.7:c.63C>T	13.37:g.80055401C>T			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_019080	1	0.00	0	Q7Z2H3|Q7Z428|Q8TAR3|Q9ULQ5	Silent	SNP	ENST00000218652.7	37	CCDS31998.1																																																																																					0.726	NDFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045380.2			
IGHM	3507	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	106320477	106320477	+	RNA	SNP	T	T	C			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr14:106320477T>C	ENST00000390559.2	-	0	1332							P01871	IGHM_HUMAN	immunoglobulin heavy constant mu						adaptive immune response (GO:0002250)|antibacterial humoral response (GO:0019731)|defense response to Gram-negative bacterium (GO:0050829)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|hexameric IgM immunoglobulin complex (GO:0071757)|integral component of membrane (GO:0016021)|pentameric IgM immunoglobulin complex (GO:0071756)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GTGTCGGACATGACCAGGGAC	0.637																																					.													.	.			0			.												114.0	123.0	120.0					14																	106320477		2126	4208	6334			0	.			CGGACATGACCAG	X14940		14q32.33	2012-10-02			ENSG00000211899	ENSG00000211899		"""Immunoglobulins / IGH locus"""	5541	other	immunoglobulin gene		147020				2115996	Standard	NG_001019		Approved			P01871	OTTHUMG00000152452		14.37:g.106320477T>C			Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	141	0.12	17	.	21	0.00	0	P20769	RNA	SNP	ENST00000390559.2	37																																																																																						0.637	IGHM-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IG_C_gene		OTTHUMT00000326272.1		NG_001019	
CHEK2P2	646096	broad.mit.edu	37	15	20488769	20488770	+	RNA	DNP	CA	CA	TG			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr15:20488769_20488770CA>TG	ENST00000555186.1	+	0	252_253					NR_038836.1				checkpoint kinase 2 pseudogene 2																		TTGGGCACTCCAAGATTTTGGG	0.406																																					.													.	.			0			.																																											0	.			GCACTCCAAGATT			15q11.1	2011-11-11			ENSG00000259156	ENSG00000259156			43578	pseudogene	pseudogene							Standard	NR_038836		Approved		uc001ytf.1		OTTHUMG00000171660	Exception_encountered	15.37:g.20488769_20488770delinsTG			Somatic	531	0	0		WXS	Illumina HiSeq	Phase_I	453	0.03	13	.	25	0.00	0		RNA	DNP	ENST00000555186.1	37																																																																																						0.406	CHEK2P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000414654.1		NR_038836	
WHAMMP3	339005	broad.mit.edu	37	15	23200539	23200540	+	RNA	INS	-	-	C	rs368734160		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr15:23200539_23200540insC	ENST00000400153.2	-	0	1123					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		TGTTTTATTAAttttttattat	0.248																																					.													.	.			0			.																																											0	.			TTATTAATTTTTT	BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23200539_23200540insC			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	23	0.35	8	.	0		0	Q1A5X8|Q52M16|Q52M18	RNA	INS	ENST00000400153.2	37																																																																																						0.248	WHAMMP3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000415907.1		NR_003521	
CILP	8483	mdanderson.org	37	15	65496896	65496896	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr15:65496896C>T	ENST00000261883.4	-	6	795	c.629G>A	c.(628-630)gGc>gAc	p.G210D		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	210					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						ATTCACCTGGCCCATTGGGCA	0.572																																					p.G210D													.	.			0			c.G629A												45.0	44.0	44.0					15																	65496896		2201	4299	6500	SO:0001583	missense	8483	exon6			ACCTGGCCCATTG	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.629G>A	15.37:g.65496896C>T	ENSP00000261883:p.Gly210Asp		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_003613	0		0	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	C	31	5.091445	0.94149	.	.	ENSG00000138615	ENST00000261883	T	0.54479	0.57	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.73102	0.3544	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75572	-0.3271	10	0.87932	D	0	-27.735	18.423	0.90598	0.0:1.0:0.0:0.0	.	210	O75339	CILP1_HUMAN	D	210	ENSP00000261883:G210D	ENSP00000261883:G210D	G	-	2	0	CILP	63283949	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	7.716000	0.84723	2.588000	0.87417	0.563000	0.77884	GGC			0.572	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256829.1		NM_003613	
TCEB2	6923	ucsc.edu	37	16	2825543	2825543	+	Silent	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr16:2825543C>T	ENST00000409906.4	-	3	210	c.153G>A	c.(151-153)ttG>ttA	p.L51L	TCEB2_ENST00000572954.1_Intron|TCEB2_ENST00000409477.1_Silent_p.L46L|TCEB2_ENST00000262306.7_Silent_p.L51L	NM_007108.3	NP_009039.1	Q15370	ELOB_HUMAN	transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)	51	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|elongin complex (GO:0070449)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|prostate(1)	3						TGCCATCATCCAAGAGTTGGT	0.592																																					p.L51L	GBM(141;5215 5962)												.	TCEB2	6		0			c.G153A												72.0	65.0	67.0					16																	2825543		2198	4300	6498	SO:0001819	synonymous_variant	6923	exon3			ATCATCCAAGAGT	L42856	CCDS32374.1, CCDS45387.1	16p12.3	2008-02-05	2002-08-29		ENSG00000103363	ENSG00000103363			11619	protein-coding gene	gene with protein product		600787	"""transcription elongation factor B (SIII), polypeptide 2 (18kD, elongin B)"""			7638163	Standard	NM_007108		Approved	SIII	uc002crm.3	Q15370	OTTHUMG00000154125	ENST00000409906.4:c.153G>A	16.37:g.2825543C>T			Somatic	21	0	0		WXS	Illumina HiSeq		35	0.11	4	NM_007108	3290	0.00	0	B7WPD3	Missense_Mutation	SNP	ENST00000409906.4	37	CCDS45387.1																																																																																					0.592	TCEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333975.2		NM_007108	
NUDT16L1	84309	mdanderson.org	37	16	4743826	4743826	+	Silent	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr16:4743826C>T	ENST00000304301.6	+	1	132	c.99C>T	c.(97-99)taC>taT	p.Y33Y	NUDT16L1_ENST00000405142.1_Silent_p.Y33Y|NUDT16L1_ENST00000586252.1_Silent_p.Y33Y|NUDT16L1_ENST00000586536.1_Silent_p.Y33Y	NM_032349.3	NP_115725.1	Q9BRJ7	SDOS_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1	33						cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4						CCATGCTGTACGCCGCCAACC	0.731																																					p.Y33Y													.	.			0			c.C99T												18.0	17.0	17.0					16																	4743826		2173	4288	6461	SO:0001819	synonymous_variant	84309	exon1			GCTGTACGCCGCC	BC006223	CCDS10519.1, CCDS59257.1	16p13.3	2008-02-05			ENSG00000168101	ENSG00000168101		"""Nudix motif containing"""	28154	protein-coding gene	gene with protein product						11805099	Standard	NM_032349		Approved	SDOS	uc002cxe.3	Q9BRJ7	OTTHUMG00000129471	ENST00000304301.6:c.99C>T	16.37:g.4743826C>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_001193452	80	0.00	0	Q8NAI2	Silent	SNP	ENST00000304301.6	37	CCDS10519.1																																																																																					0.731	NUDT16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251634.1		NM_032349	
PHKG2	5261	mdanderson.org	37	16	30764793	30764793	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr16:30764793G>T	ENST00000563588.1	+	6	710	c.471G>T	c.(469-471)gaG>gaT	p.E157D	PHKG2_ENST00000328273.7_Missense_Mutation_p.E157D|RP11-2C24.4_ENST00000483578.1_lincRNA|PHKG2_ENST00000424889.3_Missense_Mutation_p.E157D	NM_000294.2	NP_000285.1	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		E -> K (in GSD9C). {ECO:0000269|PubMed:12930917}.		carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|positive regulation of glycogen catabolic process (GO:0045819)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			ovary(1)|skin(1)	2			Colorectal(24;0.198)			TGAAGCCCGAGAATATTCTCC	0.532																																					p.E157D													PHKG2_ENST00000328273,colon,carcinoma,+2,1	PHKG2_ENST00000328273	2	1	0			c.G471T												73.0	73.0	73.0					16																	30764793		2197	4300	6497	SO:0001583	missense	5261	exon6			GCCCGAGAATATT	S73483, M31606	CCDS10690.1, CCDS54002.1	16p11.2	2008-02-05			ENSG00000156873	ENSG00000156873			8931	protein-coding gene	gene with protein product		172471				2915644, 8020963	Standard	NM_000294		Approved		uc021tgo.1	P15735	OTTHUMG00000132400	ENST00000563588.1:c.471G>T	16.37:g.30764793G>T	ENSP00000455607:p.Glu157Asp		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	74	0.05	4	NM_001172432	210	0.00	0	A8K0C7|B4DEB7|E9PEU3|P11800	Missense_Mutation	SNP	ENST00000563588.1	37	CCDS10690.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779500	0.90195	.	.	ENSG00000156873	ENST00000328273;ENST00000424889	T;T	0.44482	0.92;0.92	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48286	D	0.000192	T	0.62913	0.2467	M	0.72118	2.19	0.80722	D	1	P;P	0.44241	0.774;0.829	P;P	0.58077	0.832;0.741	T	0.64761	-0.6331	10	0.87932	D	0	-18.2067	18.2169	0.89889	0.0:0.0:1.0:0.0	.	157;157	P15735;P15735-2	PHKG2_HUMAN;.	D	157	ENSP00000329968:E157D;ENSP00000388571:E157D	ENSP00000329968:E157D	E	+	3	2	PHKG2	30672294	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.601000	0.61090	2.586000	0.87340	0.655000	0.94253	GAG			0.532	PHKG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255531.2		NM_000294	
ZNF646	9726	broad.mit.edu	37	16	31092943	31092943	+	Silent	SNP	T	T	C	rs200049061		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr16:31092943T>C	ENST00000394979.2	+	1	5721	c.5298T>C	c.(5296-5298)tgT>tgC	p.C1766C	ZNF646_ENST00000300850.5_Silent_p.C1766C			O15015	ZN646_HUMAN	zinc finger protein 646	1766					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						GCCCCCATTGTCCCCGCCACT	0.697																																					p.C1766C													.	ZNF646	133		0			c.T5298C																																									SO:0001819	synonymous_variant	9726	exon2			CCATTGTCCCCGC	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.5298T>C	16.37:g.31092943T>C			Somatic	50	0.44	22		WXS	Illumina HiSeq	Phase_I	55	0.58	32	NM_014699	62	0.15	9	Q8IVD8	Silent	SNP	ENST00000394979.2	37																																																																																						0.697	ZNF646-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000108510.2		NM_014699	
Unknown	0	bcgsc.ca	37	16	32403388	32403388	+	IGR	SNP	C	C	A			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr16:32403388C>A								RP11-17M15.2 (81512 upstream) : RP11-626K17.3 (62544 downstream)																							GGCTTTGAGACATTTGAAGGT	0.378																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTGAGACATTTGA																													16.37:g.32403388C>A			Somatic	122	0	0		WXS	Illumina HiSeq	Phase_1	116	0.04	5	.	0		0		RNA	SNP		37																																																																																					0	0.378										
MYBBP1A	10514	mdanderson.org	37	17	4443182	4443182	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr17:4443182T>C	ENST00000254718.4	-	26	3821	c.3515A>G	c.(3514-3516)aAg>aGg	p.K1172R	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.K1172R			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1172	Required for nuclear and nucleolar localization. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						CAAGAATCCCTTTTTCTTCCG	0.597																																					p.K1172R													.	.			0			c.A3515G												89.0	93.0	91.0					17																	4443182		2203	4300	6503	SO:0001583	missense	10514	exon26			AATCCCTTTTTCT	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3515A>G	17.37:g.4443182T>C	ENSP00000254718:p.Lys1172Arg		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_014520	451	0.00	0	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	37	CCDS11046.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175056	0.78564	.	.	ENSG00000132382	ENST00000381556;ENST00000254718	T;T	0.28454	1.61;1.62	4.72	3.64	0.41730	.	0.103525	0.64402	D	0.000004	T	0.40448	0.1117	L	0.36672	1.1	0.33051	D	0.53272	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.51957	-0.8639	10	0.62326	D	0.03	-38.232	7.0805	0.25229	0.0:0.1014:0.0:0.8986	.	1172;1172	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	R	1172	ENSP00000370968:K1172R;ENSP00000254718:K1172R	ENSP00000254718:K1172R	K	-	2	0	MYBBP1A	4389931	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	2.446000	0.44908	0.953000	0.37825	0.459000	0.35465	AAG			0.597	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000207488.2		NM_014520	
LRRC37BP1	147172	broad.mit.edu	37	17	28960991	28960991	+	RNA	DEL	C	C	-	rs375551118|rs373494507|rs57752761|rs543292747	byFrequency	TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr17:28960991delC	ENST00000417404.1	+	0	1269									leucine rich repeat containing 37B pseudogene 1																		tttcttttttctttttttttt	0.299																																					.													.	.			0			.																																											0	.			TTTTTTCTTTTTT	BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28960991delC			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	98	0.16	16	.	1	0.00	0		RNA	DEL	ENST00000417404.1	37																																																																																						0.299	LRRC37BP1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000256203.1		NR_015341	
UBE2O	63893	mdanderson.org	37	17	74449144	74449144	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr17:74449144G>T	ENST00000319380.7	-	1	144	c.80C>A	c.(79-81)gCc>gAc	p.A27D	AANAT_ENST00000250615.3_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	27	Ala-rich.				positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						tgcggctggggccgggactgc	0.791																																					p.A27D													.	.			0			c.C80A												1.0	1.0	1.0					17																	74449144		508	1076	1584	SO:0001583	missense	63893	exon1			GCTGGGGCCGGGA	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.80C>A	17.37:g.74449144G>T	ENSP00000323687:p.Ala27Asp		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_022066	3	0.00	0	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	ENST00000319380.7	37	CCDS32742.1	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792017	0.31685	.	.	ENSG00000175931	ENST00000319380	T	0.73897	-0.79	2.78	1.8	0.24995	.	0.499043	0.16392	U	0.216417	T	0.50514	0.1620	N	0.08118	0	0.28453	N	0.916242	B	0.13594	0.008	B	0.15870	0.014	T	0.36744	-0.9735	10	0.18276	T	0.48	-0.3321	10.0915	0.42449	0.1064:0.0:0.8936:0.0	.	27	Q9C0C9	UBE2O_HUMAN	D	27	ENSP00000323687:A27D	ENSP00000323687:A27D	A	-	2	0	UBE2O	71960739	0.000000	0.05858	0.089000	0.20774	0.338000	0.28826	0.072000	0.14617	0.717000	0.32145	0.557000	0.71058	GCC			0.791	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450123.1		NM_022066	
GALR1	2587	mdanderson.org	37	18	74962916	74962916	+	Missense_Mutation	SNP	G	G	T	rs375468486		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr18:74962916G>T	ENST00000299727.3	+	1	412	c.412G>T	c.(412-414)Gtg>Ttg	p.V138L		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	138					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CGTGGCCATCGTGCACTCGCG	0.652																																					p.V138L													.	.			0			c.G412T												69.0	59.0	62.0					18																	74962916		2203	4300	6503	SO:0001583	missense	2587	exon1			GCCATCGTGCACT	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.412G>T	18.37:g.74962916G>T	ENSP00000299727:p.Val138Leu		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_001480	0		0	Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218629	0.79464	.	.	ENSG00000166573	ENST00000299727	T	0.38722	1.12	4.49	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61800	0.2376	M	0.79258	2.445	0.80722	D	1	P	0.50272	0.933	P	0.59703	0.862	T	0.62863	-0.6764	10	0.33141	T	0.24	.	16.7748	0.85548	0.0:0.0:1.0:0.0	.	138	P47211	GALR1_HUMAN	L	138	ENSP00000299727:V138L	ENSP00000299727:V138L	V	+	1	0	GALR1	73091904	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	9.379000	0.97198	2.044000	0.60594	0.591000	0.81541	GTG			0.652	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256362.1			
AKAP8L	26993	mdanderson.org	37	19	15510124	15510124	+	Silent	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr19:15510124G>T	ENST00000397410.5	-	9	1276	c.1146C>A	c.(1144-1146)cgC>cgA	p.R382R	AKAP8L_ENST00000595879.1_5'UTR|AKAP8L_ENST00000595465.2_Silent_p.R321R	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	382						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						TTTCCACCATGCGGTCTCGCT	0.627																																					p.R382R													.	.			0			c.C1146A												173.0	174.0	174.0					19																	15510124		2114	4222	6336	SO:0001819	synonymous_variant	26993	exon9			CACCATGCGGTCT	BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.1146C>A	19.37:g.15510124G>T			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	77	0.05	4	NM_014371	301	0.00	0	B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Silent	SNP	ENST00000397410.5	37	CCDS46005.1																																																																																					0.627	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461301.2		NM_014371	
CAPNS1	826	mdanderson.org	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	CAPNS1_ENST00000587718.1_Silent_p.G47G|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000588780.1_Silent_p.G47G|CAPNS1_ENST00000588815.1_Silent_p.G47G|CAPNS1_ENST00000590874.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					p.G47G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	.			0			c.C141T																																									SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGTGGT	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			Somatic	56	0.0357142857	2		WXS	Illumina HiSeq	Phase_I	32	0.13	4	NM_001749	1	0.00	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																			0.006		0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
PSMC4	5704	mdanderson.org	37	19	40485823	40485823	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr19:40485823C>T	ENST00000157812.2	+	7	971	c.773C>T	c.(772-774)gCa>gTa	p.A258V	PSMC4_ENST00000455878.2_Missense_Mutation_p.A227V	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	258					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A258V(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AAGGAGAATGCACCTGCCATC	0.567																																					p.A258V	Colon(105;1478 1543 4034 6132 38638)												PSMC4,NS,carcinoma,-1,2	PSMC4	-1	2	1	Substitution - Missense(1)	endometrium(1)	c.C773T												70.0	69.0	70.0					19																	40485823		2203	4300	6503	SO:0001583	missense	5704	exon7			AGAATGCACCTGC	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.773C>T	19.37:g.40485823C>T	ENSP00000157812:p.Ala258Val		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	65	0.06	4	NM_006503	1276	0.00	1	Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	ENST00000157812.2	37	CCDS12547.1	.	.	.	.	.	.	.	.	.	.	c	21.7	4.193836	0.78902	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95103	-3.61;-3.61	6.06	6.06	0.98353	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.101956	0.64402	D	0.000003	D	0.95962	0.8685	M	0.72624	2.21	0.80722	D	1	P;D	0.65815	0.857;0.995	P;P	0.53549	0.454;0.729	D	0.95965	0.8965	10	0.87932	D	0	-11.5399	18.1147	0.89549	0.0:1.0:0.0:0.0	.	227;258	P43686-2;P43686	.;PRS6B_HUMAN	V	258;227	ENSP00000157812:A258V;ENSP00000413869:A227V	ENSP00000157812:A258V	A	+	2	0	PSMC4	45177663	1.000000	0.71417	0.994000	0.49952	0.063000	0.16089	7.724000	0.84798	2.882000	0.98803	0.655000	0.94253	GCA			0.567	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462485.1		NM_006503	
FOXA3	3171	mdanderson.org	37	19	46375770	46375770	+	Silent	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr19:46375770G>T	ENST00000302177.2	+	2	704	c.507G>T	c.(505-507)ctG>ctT	p.L169L		NM_004497.2	NP_004488.2	P55318	FOXA3_HUMAN	forkhead box A3	169					cell differentiation (GO:0030154)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|chromatin modification (GO:0016568)|endocrine pancreas development (GO:0031018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	13		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		GCCACTCGCTGTCTTTCAACG	0.557																																					p.L169L													.	.			0			c.G507T												74.0	70.0	72.0					19																	46375770		2203	4300	6503	SO:0001819	synonymous_variant	3171	exon2			CTCGCTGTCTTTC	L12141	CCDS12677.1	19q13.32	2014-09-11		2002-09-20	ENSG00000170608	ENSG00000170608		"""Forkhead boxes"""	5023	protein-coding gene	gene with protein product		602295	"""hepatocyte nuclear factor 3, gamma"""	HNF3G		9119385	Standard	NM_004497		Approved		uc002pdr.3	P55318	OTTHUMG00000182484	ENST00000302177.2:c.507G>T	19.37:g.46375770G>T			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_004497	21	0.00	0	A9LYI5|Q53F16|Q9UMW9	Silent	SNP	ENST00000302177.2	37	CCDS12677.1																																																																																					0.557	FOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461682.1			
ANKRD36	375248	hgsc.bcm.edu	37	2	97853095	97853095	+	Silent	SNP	G	G	T	rs553912698		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr2:97853095G>T	ENST00000461153.2	+	32	2344	c.2100G>T	c.(2098-2100)tcG>tcT	p.S700S	ANKRD36_ENST00000420699.2_Silent_p.S700S			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	700										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						ACTCTGTTTCGAATATAGCCA	0.313																																					p.S700S													ANKRD36_ENST00000420699,NS,carcinoma,0,4	ANKRD36_ENST00000420699	0	4	0			c.G2100T												33.0	28.0	30.0					2																	97853095		692	1590	2282	SO:0001819	synonymous_variant	375248	exon32			TGTTTCGAATATA	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2100G>T	2.37:g.97853095G>T			Somatic	89	0	0		WXS	Illumina HiSeq	.	74	0.05	4	NM_001164315	0		0	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Silent	SNP	ENST00000461153.2	37	CCDS54379.1																																																																																					0.313	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339154.5			
SIGLEC1	6614	mdanderson.org	37	20	3677793	3677793	+	Silent	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr20:3677793G>T	ENST00000344754.4	-	9	2318	c.2319C>A	c.(2317-2319)gcC>gcA	p.A773A	SIGLEC1_ENST00000202578.4_Silent_p.A773A	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	773	Ig-like C2-type 7.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GGATGCGGCAGGCGTAAAGGG	0.632																																					p.A773A													SIGLEC1_ENST00000202578,NS,carcinoma,-2,2	SIGLEC1_ENST00000202578	-2	2	0			c.C2319A												65.0	64.0	65.0					20																	3677793		2203	4300	6503	SO:0001819	synonymous_variant	6614	exon9			GCGGCAGGCGTAA	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.2319C>A	20.37:g.3677793G>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_023068	12	0.00	0	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1																																																																																					0.632	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077761.2		NM_023068	
TCEA2	6919	mdanderson.org	37	20	62701155	62701155	+	Silent	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr20:62701155G>T	ENST00000343484.5	+	6	667	c.498G>T	c.(496-498)ctG>ctT	p.L166L	TCEA2_ENST00000395053.3_Silent_p.L166L|TCEA2_ENST00000361317.2_Silent_p.L139L|TCEA2_ENST00000465111.1_3'UTR	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	166	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					GCGAGCGCCTGTCGGCTCAGA	0.632											OREG0026140	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L166L													.	.			0			c.G498T												91.0	89.0	90.0					20																	62701155		2203	4300	6503	SO:0001819	synonymous_variant	6919	exon6			GCGCCTGTCGGCT	U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.498G>T	20.37:g.62701155G>T			Somatic	48	0	0	1063	WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_003195	114	0.00	0	B3KNM1|Q8TD37|Q8TD38	Silent	SNP	ENST00000343484.5	37	CCDS13553.1																																																																																					0.632	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080277.2		NM_198723	
COL6A1	1291	mdanderson.org	37	21	47421228	47421228	+	Silent	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr21:47421228G>T	ENST00000361866.3	+	30	1998	c.1884G>T	c.(1882-1884)ctG>ctT	p.L628L	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	628	C-terminal globular domain.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GCATTGGCCTGCAGAACTTCG	0.647																																					p.L628L													COL6A1,colon,carcinoma,0,1	COL6A1	0	1	0			c.G1884T												127.0	125.0	126.0					21																	47421228		2203	4300	6503	SO:0001819	synonymous_variant	1291	exon30			TGGCCTGCAGAAC	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1884G>T	21.37:g.47421228G>T			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001848	406	0.00	0	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Silent	SNP	ENST00000361866.3	37	CCDS13727.1																																																																																					0.647	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206877.1		NM_001848	
MN1	4330	mdanderson.org	37	22	28194894	28194894	+	Silent	SNP	C	C	T	rs202212250		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr22:28194894C>T	ENST00000302326.4	-	1	2592	c.1638G>A	c.(1636-1638)caG>caA	p.Q546Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	546	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgctgttgct	0.642			T	ETV6	"""AML, meningioma"""																																p.Q546Q				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	.			0			c.G1638A												4.0	5.0	5.0					22																	28194894		1986	4018	6004	SO:0001819	synonymous_variant	4330	exon1			CTGCTGCTGCTGT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1638G>A	22.37:g.28194894C>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_002430	5	0.00	0	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																					0.642	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
MN1	4330	broad.mit.edu	37	22	28194910	28194912	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr22:28194910_28194912delTGT	ENST00000302326.4	-	1	2574_2576	c.1620_1622delACA	c.(1618-1623)caacag>cag	p.540_541QQ>Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	540	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ttgctgttgctgttgctgctgct	0.655			T	ETV6	"""AML, meningioma"""																																p.540_541del				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	122		0			c.1620_1622del									259,3347		25,209,1569						1.4	1.0		dbSNP_130	5	283,7069		26,231,3419	no	coding	MN1	NM_002430.2		51,440,4988	A1A1,A1R,RR		3.8493,7.1825,4.9462				542,10416				SO:0001651	inframe_deletion	4330	exon1			TGTTGCTGTTGCT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1620_1622delACA	22.37:g.28194910_28194912delTGT	ENSP00000304956:p.Gln550del		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	26	0.27	7	NM_002430	10	0.00	0	A9Z1V9	In_Frame_Del	DEL	ENST00000302326.4	37	CCDS42998.1																																																																																					0.655	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
PLXNB2	23654	bcgsc.ca	37	22	50722618	50722618	+	Missense_Mutation	SNP	G	G	T	rs372542578		TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr22:50722618G>T	ENST00000449103.1	-	13	2346	c.2206C>A	c.(2206-2208)Ctg>Atg	p.L736M	PLXNB2_ENST00000359337.4_Missense_Mutation_p.L736M|PLXNB2_ENST00000496720.1_5'UTR			O15031	PLXB2_HUMAN	plexin B2	736					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGCAGGGGCAGCGTCTCGTTG	0.682																																					p.L736M													.	PLXNB2	172		0			c.C2206A								MET/LEU	0,4250		0,0,2125	53.0	59.0	57.0		2206	3.4	0.9	22		57	1,8477		0,1,4238	no	missense	PLXNB2	NM_012401.3	15	0,1,6363	TT,TG,GG		0.0118,0.0,0.0079	probably-damaging	736/1839	50722618	1,12727	2125	4239	6364	SO:0001583	missense	23654	exon13			GGGGCAGCGTCTC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2206C>A	22.37:g.50722618G>T	ENSP00000409171:p.Leu736Met		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_1	44	0.09	4	NM_012401	55	0.00	0	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	g	13.23	2.174314	0.38413	0.0	1.18E-4	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.04015	3.73;3.73	4.39	3.38	0.38709	.	0.000000	0.43919	D	0.000501	T	0.10078	0.0247	M	0.64170	1.965	0.33825	D	0.62954	D	0.54047	0.964	P	0.51777	0.679	T	0.14117	-1.0484	10	0.48119	T	0.1	.	8.0574	0.30612	0.1115:0.0:0.8885:0.0	.	736	O15031	PLXB2_HUMAN	M	736	ENSP00000409171:L736M;ENSP00000352288:L736M	ENSP00000352288:L736M	L	-	1	2	PLXNB2	49064745	0.436000	0.25586	0.936000	0.37596	0.014000	0.08584	0.299000	0.19138	1.075000	0.40932	-0.359000	0.07587	CTG			0.682	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316874.3		NM_012401	
TAMM41	132001	mdanderson.org	37	3	11871318	11871318	+	Missense_Mutation	SNP	G	G	T	rs144979072	byFrequency	TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr3:11871318G>T	ENST00000444133.2	-	4	574	c.432C>A	c.(430-432)aaC>aaA	p.N144K	TAMM41_ENST00000273037.5_Missense_Mutation_p.N144K|TAMM41_ENST00000455809.1_Missense_Mutation_p.N144K			Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)	144					cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)										TGACATCCTCGTTCACTGAGA	0.443																																					p.N144K													.	.			0			c.C432A												90.0	92.0	92.0					3																	11871318		2203	4300	6503	SO:0001583	missense	132001	exon4			ATCCTCGTTCACT		CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000444133.2:c.432C>A	3.37:g.11871318G>T	ENSP00000388598:p.Asn144Lys		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_138807	66	0.00	0	B4DIY7|C9J2U4	Missense_Mutation	SNP	ENST00000444133.2	37		.	.	.	.	.	.	.	.	.	.	G	6.482	0.457101	0.12283	.	.	ENSG00000144559	ENST00000455809;ENST00000273037;ENST00000444133	T;T;T	0.28666	1.6;1.6;1.6	5.41	-1.66	0.08265	.	0.293563	0.42420	D	0.000711	T	0.14960	0.0361	L	0.35288	1.05	0.42164	D	0.991617	B;B;B	0.26902	0.163;0.002;0.002	B;B;B	0.22880	0.042;0.006;0.016	T	0.15150	-1.0447	10	0.11794	T	0.64	-54.0136	5.4982	0.16815	0.4267:0.252:0.3212:0.0	.	144;144;144	B4DIY7;C9J2U4;Q96BW9	.;.;TAM41_HUMAN	K	144	ENSP00000398596:N144K;ENSP00000273037:N144K;ENSP00000388598:N144K	ENSP00000273037:N144K	N	-	3	2	TAMM41	11846318	0.999000	0.42202	0.960000	0.40013	0.018000	0.09664	1.071000	0.30666	-0.102000	0.12197	-1.264000	0.01445	AAC			0.443	TAMM41-008	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000339258.2		NM_138807	
NEK10	152110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	27326130	27326130	+	Missense_Mutation	SNP	G	G	C			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr3:27326130G>C	ENST00000429845.2	-	23	2339	c.1977C>G	c.(1975-1977)aaC>aaG	p.N659K	NEK10_ENST00000341435.5_Missense_Mutation_p.N659K|NEK10_ENST00000357467.2_Missense_Mutation_p.N56K			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	659	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> S (in dbSNP:rs55833401). {ECO:0000269|PubMed:17344846}.		positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						ACATAATGTTGTTTGGTGTCA	0.338																																					p.N659K													NEK10_ENST00000429845,NS,lymphoid_neoplasm,0,3	NEK10_ENST00000429845	0	3	0			c.C1977G												157.0	146.0	149.0					3																	27326130		2203	4300	6503	SO:0001583	missense	152110	exon23			AATGTTGTTTGGT	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.1977C>G	3.37:g.27326130G>C	ENSP00000395849:p.Asn659Lys		Somatic	73	0	0		WXS	Illumina HiSeq	.	111	0.24	27	NM_199347	1	0.00	0	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	24.6|24.6|24.6	4.544765|4.544765|4.544765	0.86022|0.86022|0.86022	.|.|.	.|.|.	ENSG00000163491|ENSG00000163491|ENSG00000163491	ENST00000357467;ENST00000341435;ENST00000396636|ENST00000435584|ENST00000424275	T;T|.|.	0.39056|.|.	1.1;1.1|.|.	6.02|6.02|6.02	6.02|6.02|6.02	0.97574|0.97574|0.97574	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.52789|0.52789|0.52789	0.1756|0.1756|0.1756	N|N|N	0.12961|0.12961|0.12961	0.28|0.28|0.28	0.50632|0.50632|0.50632	D|D|D	0.99988|0.99988|0.99988	D;D|.|.	0.76494|.|.	0.999;0.987|.|.	D;P|.|.	0.74674|.|.	0.984;0.872|.|.	T|T|T	0.43782|0.43782|0.43782	-0.9370|-0.9370|-0.9370	10|5|5	0.72032|.|.	D|.|.	0.01|.|.	.|.|.	20.5373|20.5373|20.5373	0.99239|0.99239|0.99239	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	659;56|.|.	Q6ZWH5;Q8N774|.|.	NEK10_HUMAN;.|.|.	K|E|R	56;659;659|116|146	ENSP00000350059:N56K;ENSP00000343847:N659K|.|.	ENSP00000343847:N659K|.|.	N|Q|T	-|-|-	3|1|2	2|0|0	NEK10|NEK10|NEK10	27301134|27301134|27301134	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.995000|0.995000|0.995000	0.86356|0.86356|0.86356	4.877000|4.877000|4.877000	0.63086|0.63086|0.63086	2.857000|2.857000|2.857000	0.98124|0.98124|0.98124	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	AAC|CAA|ACA			0.338	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000438156.1		NM_152534	
BSN	8927	mdanderson.org	37	3	49691578	49691578	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr3:49691578T>C	ENST00000296452.4	+	5	4703	c.4589T>C	c.(4588-4590)gTa>gCa	p.V1530A		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1530					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCACCTATGGTAGCCCAGGGT	0.612																																					p.V1530A													.	.			0			c.T4589C												83.0	94.0	90.0					3																	49691578		2203	4300	6503	SO:0001583	missense	8927	exon5			CTATGGTAGCCCA	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.4589T>C	3.37:g.49691578T>C	ENSP00000296452:p.Val1530Ala		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_003458	7	0.00	0	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123162	0.56613	.	.	ENSG00000164061	ENST00000296452	T	0.18016	2.24	5.25	5.25	0.73442	.	0.374770	0.28354	N	0.015658	T	0.19485	0.0468	L	0.57536	1.79	0.34993	D	0.755192	P	0.48089	0.905	B	0.44224	0.444	T	0.13045	-1.0524	10	0.07030	T	0.85	.	15.1443	0.72637	0.0:0.0:0.0:1.0	.	1530	Q9UPA5	BSN_HUMAN	A	1530	ENSP00000296452:V1530A	ENSP00000296452:V1530A	V	+	2	0	BSN	49666582	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.560000	0.45896	1.996000	0.58369	0.379000	0.24179	GTA			0.612	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000258164.1		NM_003458	
LINC00882	100302640	broad.mit.edu	37	3	106824709	106824709	+	lincRNA	DEL	C	C	-	rs57565986	byFrequency	TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr3:106824709delC	ENST00000484698.1	-	0	295									long intergenic non-protein coding RNA 882																		Gtttttatatctttttttttt	0.443																																					.													.	.			0			.																																											0	.			TTATATCTTTTTT			3q13.12	2014-06-03			ENSG00000242759	ENSG00000242759		"""Long non-coding RNAs"""	48568	non-coding RNA	RNA, long non-coding						24886442	Standard	NR_028303		Approved				OTTHUMG00000159196		3.37:g.106824709delC			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0		RNA	DEL	ENST00000484698.1	37																																																																																						0.443	LINC00882-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000353788.1			
FAM86JP	100125556	broad.mit.edu	37	3	125637503	125637510	+	RNA	DEL	AGTCTTCT	AGTCTTCT	-	rs575299313	byFrequency	TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	AGTCTTCT	AGTCTTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr3:125637503_125637510delAGTCTTCT	ENST00000485843.1	+	0	188					NR_024251.1				family with sequence similarity 86, member J, pseudogene																		GCCAAGAGTCAGTCTTCTAGCCTTCTTC	0.572														158	0.0315495	0.0318	0.0173	5008	,	,		21125	0.0268		0.0298	False		,,,				2504	0.0481				.													.	.			0			.																																											0	.			AGAGTCAGTCTTC			3q21.2	2012-06-28			ENSG00000171084	ENSG00000171084			44097	pseudogene	pseudogene							Standard	NR_024250		Approved		uc003eif.4		OTTHUMG00000159586		3.37:g.125637503_125637510delAGTCTTCT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	7	0.57	4	.	0		0		RNA	DEL	ENST00000485843.1	37																																																																																						0.572	FAM86JP-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000356339.1		NR_024251	
IGSF10	285313	mdanderson.org	37	3	151166918	151166918	+	Missense_Mutation	SNP	A	A	G			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr3:151166918A>G	ENST00000282466.3	-	4	850	c.851T>C	c.(850-852)aTt>aCt	p.I284T		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	284					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GGATGAGTCAATGGTTGGCTT	0.498																																					p.I284T													.	.			0			c.T851C												138.0	133.0	135.0					3																	151166918		2203	4300	6503	SO:0001583	missense	285313	exon4			GAGTCAATGGTTG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.851T>C	3.37:g.151166918A>G	ENSP00000282466:p.Ile284Thr		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_178822	0		0	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.704780	0.68615	.	.	ENSG00000152580	ENST00000282466	T	0.76186	-1.0	5.37	5.37	0.77165	.	0.000000	0.48286	D	0.000185	D	0.84202	0.5420	M	0.62723	1.935	0.47905	D	0.999544	D	0.89917	1.0	D	0.77004	0.989	D	0.86061	0.1532	10	0.87932	D	0	.	15.3735	0.74587	1.0:0.0:0.0:0.0	.	284	Q6WRI0	IGS10_HUMAN	T	284	ENSP00000282466:I284T	ENSP00000282466:I284T	I	-	2	0	IGSF10	152649608	1.000000	0.71417	0.333000	0.25482	0.884000	0.51177	8.962000	0.93254	2.041000	0.60428	0.528000	0.53228	ATT			0.498	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357782.1		NM_178822	
TTC14	151613	mdanderson.org	37	3	180320160	180320160	+	Silent	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr3:180320160G>T	ENST00000296015.4	+	1	243	c.111G>T	c.(109-111)tcG>tcT	p.S37S	RP11-496B10.3_ENST00000472596.1_lincRNA|TTC14_ENST00000412756.2_Silent_p.S37S|TTC14_ENST00000382584.4_Silent_p.S37S	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	37							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCCTGGGGTCGGCCGCCGAGC	0.647																																					p.S37S													.	.			0			c.G111T												16.0	17.0	16.0					3																	180320160		2200	4298	6498	SO:0001819	synonymous_variant	151613	exon1			GGGGTCGGCCGCC	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.111G>T	3.37:g.180320160G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001042601	11	0.00	0	G5E9X0|Q6UWJ7|Q8TF22	Silent	SNP	ENST00000296015.4	37	CCDS3237.1																																																																																					0.647	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349786.1		NM_133462	
PAPD4	167153	mdanderson.org	37	5	78919198	78919198	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr5:78919198G>T	ENST00000296783.3	+	5	650	c.351G>T	c.(349-351)atG>atT	p.M117I	PAPD4_ENST00000428308.2_Missense_Mutation_p.M117I|PAPD4_ENST00000453514.1_Missense_Mutation_p.M117I|PAPD4_ENST00000423041.2_Missense_Mutation_p.M117I|PAPD4_ENST00000504233.1_Missense_Mutation_p.M117I			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	117					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		GATACTCAATGCCACCATTGT	0.418																																					p.M117I													.	.			0			c.G351T												186.0	166.0	173.0					5																	78919198		2203	4300	6503	SO:0001583	missense	167153	exon5			CTCAATGCCACCA	AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.351G>T	5.37:g.78919198G>T	ENSP00000296783:p.Met117Ile		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001114393	32	0.00	0	Q86WZ2|Q8N927	Missense_Mutation	SNP	ENST00000296783.3	37	CCDS4048.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332735	0.24167	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.92	4.98	0.66077	.	0.434204	0.26734	N	0.022779	T	0.26340	0.0643	N	0.08118	0	0.19575	N	0.999962	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.08472	-1.0720	10	0.22109	T	0.4	-3.669	11.8491	0.52401	0.0:0.167:0.6479:0.1851	.	117;117;117	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	I	117	ENSP00000397563:M117I;ENSP00000393412:M117I;ENSP00000396861:M117I;ENSP00000296783:M117I	ENSP00000296783:M117I	M	+	3	0	PAPD4	78954954	0.984000	0.35163	1.000000	0.80357	0.951000	0.60555	0.634000	0.24614	2.810000	0.96702	0.585000	0.79938	ATG			0.418	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226967.1		NM_173797	
NR3C1	2908	bcgsc.ca	37	5	142779960	142779960	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr5:142779960C>T	ENST00000343796.2	-	2	1438	c.445G>A	c.(445-447)Gct>Act	p.A149T	NR3C1_ENST00000503201.1_Missense_Mutation_p.A149T|NR3C1_ENST00000415690.2_Missense_Mutation_p.A149T|NR3C1_ENST00000394464.2_Missense_Mutation_p.A149T|NR3C1_ENST00000504572.1_Missense_Mutation_p.A149T|NR3C1_ENST00000424646.2_Missense_Mutation_p.A149T|NR3C1_ENST00000231509.3_Missense_Mutation_p.A149T|NR3C1_ENST00000394466.2_Missense_Mutation_p.A149T|NR3C1_ENST00000416954.2_Intron	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	149	Modulating.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	GTGGGGGCAGCAGACACAGCA	0.478																																					p.A149T													.	NR3C1	124		0			c.G445A												69.0	75.0	73.0					5																	142779960		2203	4300	6503	SO:0001583	missense	2908	exon2			GGGCAGCAGACAC	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.445G>A	5.37:g.142779960C>T	ENSP00000343205:p.Ala149Thr		Somatic	130	0.0076923077	1		WXS	Illumina HiSeq	Phase_1	82	0.06	5	NM_001018077	1	0.00	0	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698492	0.48307	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000361001;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000503201	T;T;T;D;T;T;T;T	0.82433	-1.49;-1.49;-1.44;-1.61;-1.49;-1.49;-1.49;-1.49	5.32	5.32	0.75619	.	1.220170	0.05469	N	0.552640	T	0.79896	0.4525	L	0.29908	0.895	0.80722	D	1	B;B;B	0.31459	0.324;0.324;0.324	B;B;B	0.33121	0.129;0.158;0.158	T	0.58769	-0.7578	10	0.15952	T	0.53	.	18.9962	0.92813	0.0:1.0:0.0:0.0	.	149;149;149	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	T	149	ENSP00000377977:A149T;ENSP00000343205:A149T;ENSP00000387672:A149T;ENSP00000405282:A149T;ENSP00000422518:A149T;ENSP00000377979:A149T;ENSP00000231509:A149T;ENSP00000427672:A149T	ENSP00000231509:A149T	A	-	1	0	NR3C1	142760153	0.012000	0.17670	0.988000	0.46212	0.582000	0.36321	1.855000	0.39378	2.493000	0.84123	0.655000	0.94253	GCT			0.478	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000370829.1			
ARHGEF37	389337	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	5	149008389	149008389	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr5:149008389C>T	ENST00000333677.6	+	12	1841	c.1678C>T	c.(1678-1680)Ccg>Tcg	p.P560S		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	560	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						TGGGTATGTGCCGGCTGGGAA	0.562																																					p.P560S													.	.			0			c.C1678T												32.0	36.0	35.0					5																	149008389		2014	4179	6193	SO:0001583	missense	389337	exon12			TATGTGCCGGCTG	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.1678C>T	5.37:g.149008389C>T	ENSP00000328083:p.Pro560Ser		Somatic	64	0	0		WXS	Illumina HiSeq	.	67	0.07	5	NM_001001669	2	0.00	0	Q6ZW51	Missense_Mutation	SNP	ENST00000333677.6	37	CCDS43385.1	.	.	.	.	.	.	.	.	.	.	C	6.859	0.527733	0.13127	.	.	ENSG00000183111	ENST00000333677	D	0.91124	-2.79	5.47	4.6	0.57074	Src homology-3 domain (2);Variant SH3 (1);	0.109057	0.64402	N	0.000006	D	0.89976	0.6871	M	0.85373	2.75	0.51233	D	0.999915	P	0.41102	0.738	B	0.42138	0.377	D	0.86910	0.2060	10	0.08837	T	0.75	-8.0728	10.1375	0.42715	0.0:0.9078:0.0:0.0922	.	560	A1IGU5	ARH37_HUMAN	S	560	ENSP00000328083:P560S	ENSP00000328083:P560S	P	+	1	0	ARHGEF37	148988582	0.993000	0.37304	0.943000	0.38184	0.415000	0.31203	2.604000	0.46274	1.321000	0.45227	0.491000	0.48974	CCG			0.562	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000373763.1		NM_001001669	
SERPINB6	5269	bcgsc.ca;mdanderson.org	37	6	2955761	2955761	+	Silent	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr6:2955761G>T	ENST00000380520.1	-	2	2303	c.309C>A	c.(307-309)ctC>ctA	p.L103L	SERPINB6_ENST00000380539.1_Silent_p.L103L|SERPINB6_ENST00000380524.1_Silent_p.L103L|SERPINB6_ENST00000380546.3_Silent_p.L103L|SERPINB6_ENST00000380529.1_Silent_p.L103L|SERPINB6_ENST00000335686.5_Silent_p.L103L			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	103					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	GACTTACTGAGAGGAAATCAC	0.493																																					p.L122L													.	SERPINB6	31		0			c.C366A												78.0	78.0	78.0					6																	2955761		2203	4300	6503	SO:0001819	synonymous_variant	5269	exon3			TACTGAGAGGAAA	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.309C>A	6.37:g.2955761G>T			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_1	78	0.06	5	NM_001271823	380	0.00	0	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Silent	SNP	ENST00000380520.1	37	CCDS4479.1																																																																																					0.493	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043422.1			
TREML4	285852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41196569	41196569	+	Missense_Mutation	SNP	A	A	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr6:41196569A>T	ENST00000341495.2	+	2	285	c.181A>T	c.(181-183)Agt>Tgt	p.S61C	TREML4_ENST00000448827.2_Missense_Mutation_p.S61C	NM_198153.2	NP_937796.1	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid cells-like 4	61	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.196)					GACATCTCCAAGTCGGTGTAC	0.522																																					p.S61C													.	.			0			c.A181T												89.0	84.0	86.0					6																	41196569		2203	4300	6503	SO:0001583	missense	285852	exon2			TCTCCAAGTCGGT	AF534826	CCDS34446.1	6p21.1	2013-01-11			ENSG00000188056	ENSG00000188056		"""Immunoglobulin superfamily / V-set domain containing"""	30807	protein-coding gene	gene with protein product	"""TREM like transcript 4"""	614664				12645956	Standard	NM_198153		Approved	TLT4	uc003oqc.3	Q6UXN2	OTTHUMG00000016408	ENST00000341495.2:c.181A>T	6.37:g.41196569A>T	ENSP00000342570:p.Ser61Cys		Somatic	66	0	0		WXS	Illumina HiSeq	.	68	0.34	23	NM_198153	0		0	B7ZL92	Missense_Mutation	SNP	ENST00000341495.2	37	CCDS34446.1	.	.	.	.	.	.	.	.	.	.	.	12.64	1.999587	0.35320	.	.	ENSG00000188056	ENST00000341495;ENST00000445267;ENST00000448827	T;T	0.68479	-0.33;-0.33	4.35	-1.18	0.09617	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56202	0.1969	M	0.67397	2.05	0.09310	N	1	D	0.58970	0.984	P	0.59288	0.855	T	0.50775	-0.8788	9	0.38643	T	0.18	-0.542	5.2279	0.15406	0.5444:0.279:0.1765:0.0	.	61	Q6UXN2	TRML4_HUMAN	C	61	ENSP00000342570:S61C;ENSP00000418078:S61C	ENSP00000342570:S61C	S	+	1	0	TREML4	41304547	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.294000	0.02767	-0.758000	0.04690	-1.431000	0.01090	AGT			0.522	TREML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043873.2			
ECT2L	345930	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	139175243	139175245	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr6:139175243_139175245delGAA	ENST00000423192.1	+	9	1311_1313	c.1150_1152delGAA	c.(1150-1152)gaadel	p.E386del	ECT2L_ENST00000367682.2_In_Frame_Del_p.E386del|ECT2L_ENST00000541398.1_In_Frame_Del_p.E317del|ECT2L_ENST00000495970.1_3'UTR			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	386							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E384D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						TGTGGCCACTGAAGAAGAAGGGG	0.443			"""N, Splice, Mis"""		ETP ALL																																p.383_384del				Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	ECT2L	75		1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.1149_1151del																																									SO:0001651	inframe_deletion	345930	exon9			GCCACTGAAGAAG		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.1150_1152delGAA	6.37:g.139175249_139175251delGAA	ENSP00000387388:p.Glu386del		Somatic	88	0	0		WXS	Illumina HiSeq	.	49	0.31	15	NM_001195037	0		0	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	In_Frame_Del	DEL	ENST00000423192.1	37	CCDS43508.1																																																																																					0.443	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042441.3		NM_001077706	
SYTL3	94120	broad.mit.edu	37	6	159183173	159183173	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr6:159183173G>T	ENST00000297239.9	+	15	1674	c.1480G>T	c.(1480-1482)Gtg>Ttg	p.V494L	SYTL3_ENST00000367081.3_Missense_Mutation_p.V220L|SYTL3_ENST00000360448.3_Missense_Mutation_p.V426L|MIR3918_ENST00000581555.1_RNA			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	494	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		GAATTTACCTGTGCGGCCAGA	0.433																																					p.V494L													.	SYTL3	49		0			c.G1480T												223.0	177.0	192.0					6																	159183173		2203	4300	6503	SO:0001583	missense	94120	exon17			TTACCTGTGCGGC	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1480G>T	6.37:g.159183173G>T	ENSP00000297239:p.Val494Leu		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	91	0.04	4	NM_001242384	6	0.00	0	Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	ENST00000297239.9	37	CCDS56458.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.389969	0.42410	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	T;T;T	0.06933	3.24;3.24;3.24	5.02	3.17	0.36434	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.234953	0.28166	N	0.016358	T	0.01800	0.0057	N	0.16307	0.4	0.25126	N	0.990607	B;P;B	0.36944	0.4;0.574;0.216	B;B;B	0.37650	0.075;0.255;0.122	T	0.40403	-0.9565	10	0.51188	T	0.08	.	5.7185	0.17974	0.1719:0.1844:0.6437:0.0	.	220;494;426	F8W7H4;Q4VX76;Q4VX76-2	.;SYTL3_HUMAN;.	L	426;494;494;220	ENSP00000353631:V426L;ENSP00000297239:V494L;ENSP00000356048:V220L	ENSP00000297239:V494L	V	+	1	0	SYTL3	159103161	0.715000	0.27946	0.999000	0.59377	0.996000	0.88848	0.535000	0.23114	1.381000	0.46364	0.655000	0.94253	GTG			0.433	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042876.1			
SFRP1	6422	mdanderson.org	37	8	41166542	41166542	+	Missense_Mutation	SNP	T	T	C			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr8:41166542T>C	ENST00000220772.3	-	1	474	c.137A>G	c.(136-138)tAc>tGc	p.Y46C	SFRP1_ENST00000379845.3_5'Flank	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	46					bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			CCCGCTCTGGTACGGGCCGAT	0.682																																					p.Y46C													.	.			0			c.A137G												44.0	45.0	44.0					8																	41166542		2203	4300	6503	SO:0001583	missense	6422	exon1			CTCTGGTACGGGC	AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.137A>G	8.37:g.41166542T>C	ENSP00000220772:p.Tyr46Cys		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_003012	6	0.00	0	O00546|O14779	Missense_Mutation	SNP	ENST00000220772.3	37	CCDS34886.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.948520	0.53186	.	.	ENSG00000104332	ENST00000220772;ENST00000535263	T	0.64438	-0.1	4.52	4.52	0.55395	.	0.000000	0.64402	D	0.000013	T	0.68677	0.3027	L	0.46157	1.445	0.50632	D	0.999884	D	0.76494	0.999	P	0.58820	0.846	T	0.71705	-0.4512	10	0.62326	D	0.03	.	13.0387	0.58887	0.0:0.0:0.0:1.0	.	46	Q8N474	SFRP1_HUMAN	C	46	ENSP00000220772:Y46C	ENSP00000220772:Y46C	Y	-	2	0	SFRP1	41285699	1.000000	0.71417	0.989000	0.46669	0.466000	0.32739	1.975000	0.40569	1.661000	0.50771	0.372000	0.22366	TAC			0.682	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377132.1		NM_003012	
TIGD5	84948	mdanderson.org	37	8	144681631	144681631	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr8:144681631G>T	ENST00000504548.2	+	1	1558	c.1558G>T	c.(1558-1560)Gcc>Tcc	p.A520S	EEF1D_ENST00000524624.1_5'Flank|EEF1D_ENST00000442189.2_5'Flank|EEF1D_ENST00000531770.1_5'Flank|EEF1D_ENST00000317198.6_5'Flank|EEF1D_ENST00000529272.1_5'Flank|EEF1D_ENST00000395119.3_5'Flank|EEF1D_ENST00000419152.2_5'Flank|EEF1D_ENST00000528610.1_5'Flank|EEF1D_ENST00000531621.1_5'Flank|TIGD5_ENST00000321385.3_Missense_Mutation_p.A471S|EEF1D_ENST00000532400.1_5'Flank|RP11-661A12.14_ENST00000606452.1_lincRNA|EEF1D_ENST00000526838.1_5'Flank|EEF1D_ENST00000423316.2_5'Flank	NM_032862.4	NP_116251.4	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	520						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	7	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GGCGGCTCTGGCCTACAAGTG	0.731																																					p.A520S													.	.			0			c.G1558T												11.0	13.0	12.0					8																	144681631		2163	4275	6438	SO:0001583	missense	84948	exon1			GCTCTGGCCTACA	AK027832	CCDS6406.1, CCDS6406.2	8q24.3	2008-02-01				ENSG00000179886			18336	protein-coding gene	gene with protein product							Standard	NM_032862		Approved	FLJ14926	uc003yyx.2	Q53EQ6		ENST00000504548.2:c.1558G>T	8.37:g.144681631G>T	ENSP00000421489:p.Ala520Ser		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_032862	43	0.00	0	E7EWS2|Q6NT83|Q8N5A1|Q96JW8	Missense_Mutation	SNP	ENST00000504548.2	37	CCDS6406.2	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853889	0.32791	.	.	ENSG00000179886	ENST00000504548;ENST00000321385	T;T	0.32023	1.47;1.5	4.57	1.23	0.21249	.	0.151725	0.28766	U	0.014214	T	0.15696	0.0378	N	0.24115	0.695	0.22500	N	0.999045	B	0.34103	0.437	B	0.32090	0.14	T	0.26916	-1.0089	10	0.09084	T	0.74	.	10.1742	0.42929	0.2664:0.0:0.7336:0.0	.	471	Q53EQ6	TIGD5_HUMAN	S	520;471	ENSP00000421489:A520S;ENSP00000315906:A471S	ENSP00000315906:A471S	A	+	1	0	TIGD5	144752774	1.000000	0.71417	0.738000	0.30950	0.976000	0.68499	2.406000	0.44557	0.380000	0.24823	0.650000	0.86243	GCC			0.731	TIGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368269.1		NM_032862	
BNC2	54796	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	9	16727865	16727865	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr9:16727865G>A	ENST00000380672.4	-	3	317	c.260C>T	c.(259-261)aCg>aTg	p.T87M	RP11-62F24.2_ENST00000450445.1_RNA|BNC2_ENST00000545497.1_Intron|BNC2_ENST00000380667.2_Intron|BNC2_ENST00000380666.2_Missense_Mutation_p.T87M	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TGGTTCAGCCGTAGTCGTTCT	0.443																																					p.T87M													.	.			0			c.C260T												268.0	240.0	249.0					9																	16727865		2203	4300	6503	SO:0001583	missense	54796	exon3			TCAGCCGTAGTCG	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.260C>T	9.37:g.16727865G>A	ENSP00000370047:p.Thr87Met		Somatic	128	0	0		WXS	Illumina HiSeq	.	145	0.07	10	NM_017637	21	0.24	5		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825001	0.50739	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000456672;ENST00000436939;ENST00000380666;ENST00000540340	T;T;T	0.04015	3.73;3.73;3.73	6.17	6.17	0.99709	.	0.596298	0.17232	N	0.181903	T	0.07234	0.0183	N	0.08118	0	0.29500	N	0.855001	D;B;P;P	0.59357	0.985;0.423;0.606;0.606	P;B;B;B	0.51016	0.656;0.256;0.099;0.143	T	0.19192	-1.0313	10	0.66056	D	0.02	0.1909	20.8794	0.99867	0.0:0.0:1.0:0.0	.	87;87;45;87	Q06HC4;Q6ZN30-2;Q5H9S4;Q6ZN30	.;.;.;BNC2_HUMAN	M	87;44;87;87;87;87	ENSP00000370047:T87M;ENSP00000408370:T44M;ENSP00000370041:T87M	ENSP00000370041:T87M	T	-	2	0	BNC2	16717865	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	6.718000	0.74713	2.941000	0.99782	0.655000	0.94253	ACG			0.443	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000216901.5		NM_017637	
LAMC3	10319	mdanderson.org	37	9	133936593	133936593	+	Missense_Mutation	SNP	G	G	A			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chr9:133936593G>A	ENST00000361069.4	+	13	2463	c.2330G>A	c.(2329-2331)tGc>tAc	p.C777Y	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	777	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TGTACCCACTGCCCCCCGGGC	0.697																																					p.C777Y													.	.			0			c.G2330A												28.0	27.0	28.0					9																	133936593		2203	4299	6502	SO:0001583	missense	10319	exon13			CCCACTGCCCCCC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.2330G>A	9.37:g.133936593G>A	ENSP00000354360:p.Cys777Tyr		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_006059	45	0.00	0	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198466	0.79015	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	D	0.95171	-3.63	4.79	4.79	0.61399	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.98451	0.9484	H	0.98525	4.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99833	1.1055	10	0.87932	D	0	.	16.4026	0.83647	0.0:0.0:1.0:0.0	.	777	Q9Y6N6	LAMC3_HUMAN	Y	777	ENSP00000354360:C777Y	ENSP00000347156:C777Y	C	+	2	0	LAMC3	132926414	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.381000	0.97205	2.216000	0.71823	0.557000	0.71058	TGC			0.697	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054717.3		NM_006059	
MT-CO3	4514	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	9607	9607	+	Missense_Mutation	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chrM:9607C>T	ENST00000362079.2	+	1	401	c.401C>T	c.(400-402)aCa>aTa	p.T134I	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	134					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						ACTCCTAAACACATCCGTATT	0.483																																					p.T134M													.	.			0			c.C401T																																									SO:0001583	missense	5742	exon1			TAAACACATCCGT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.401C>T	M.37:g.9607C>T	ENSP00000354982:p.Thr134Ile		Somatic	13	0	0		WXS	Illumina HiSeq	.	12	1.00	12	ENST00000362079	0		0	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	37																																																																																						0.483	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024032	
ZNF81	347344	mdanderson.org	37	X	47705716	47705716	+	Missense_Mutation	SNP	G	G	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chrX:47705716G>T	ENST00000376954.1	+	3	418	c.50G>T	c.(49-51)tGt>tTt	p.C17F	ZNF81_ENST00000483520.1_3'UTR|ZNF81_ENST00000338637.7_Missense_Mutation_p.C17F|ZNF81_ENST00000334937.4_Missense_Mutation_p.C17F			P51508	ZNF81_HUMAN	zinc finger protein 81	17					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				GGCAGTGCCTGTGAGGTGAGG	0.512																																					p.C17F													.	.			0			c.G50T												29.0	31.0	31.0					X																	47705716		1997	4141	6138	SO:0001583	missense	347344	exon2			GTGCCTGTGAGGT	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.50G>T	X.37:g.47705716G>T	ENSP00000366153:p.Cys17Phe		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_007137	15	0.00	0	Q6RX22|Q96QH6	Missense_Mutation	SNP	ENST00000376954.1	37	CCDS43933.1	.	.	.	.	.	.	.	.	.	.	G	6.761	0.509315	0.12883	.	.	ENSG00000197779	ENST00000376954;ENST00000338637;ENST00000334937;ENST00000376950;ENST00000399918	T;T;T;T	0.00724	5.78;5.78;5.78;5.78	3.56	1.73	0.24493	Krueppel-associated box (1);	0.737124	0.11185	N	0.590571	T	0.00384	0.0012	N	0.04508	-0.205	0.26345	N	0.977308	P	0.43826	0.818	B	0.34536	0.185	T	0.30416	-0.9979	10	0.09590	T	0.72	.	4.1333	0.10159	0.1389:0.2384:0.6227:0.0	.	17	P51508	ZNF81_HUMAN	F	17	ENSP00000366153:C17F;ENSP00000341151:C17F;ENSP00000334641:C17F;ENSP00000366149:C17F	ENSP00000334641:C17F	C	+	2	0	ZNF81	47590660	0.971000	0.33674	0.981000	0.43875	0.890000	0.51754	0.947000	0.29082	0.333000	0.23563	-0.516000	0.04426	TGT			0.512	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056455.2		NM_007137	
Unknown	0	bcgsc.ca	37	X	48136231	48136231	+	IGR	SNP	C	C	T			TCGA-XY-A8S3-01B-11D-A435-10	TCGA-XY-A8S3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3d16a6b4-e512-4c73-b4e5-3790bab36b40	4b44ec78-47bf-4365-8e9f-9d227503f3d0	g.chrX:48136231C>T								SSX1 (9352 upstream) : SSX9 (24753 downstream)																							GGAGGGTTGCCTTGAAACCTA	0.438																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTTGCCTTGAAA																													X.37:g.48136231C>T			Somatic	314	0	0		WXS	Illumina HiSeq	Phase_1	393	0.33	129	.	0		0		RNA	SNP		37																																																																																					0	0.438										
