#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ESPN	83715	broad.mit.edu	37	1	6504676	6504676	+	Missense_Mutation	SNP	A	A	C			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr1:6504676A>C	ENST00000377828.1	+	6	1294	c.1126A>C	c.(1126-1128)Acc>Ccc	p.T376P	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	376					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GCCTACCAGCACCCTCTCCAA	0.617																																					p.T376P													.	ESPN	32		0			c.A1126C												125.0	93.0	104.0					1																	6504676		2203	4300	6503	SO:0001583	missense	83715	exon6			ACCAGCACCCTCT	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1126A>C	1.37:g.6504676A>C	ENSP00000367059:p.Thr376Pro		Somatic	148	0.2027027027	30		WXS	Illumina HiSeq	Phase_I	169	0.18	30	NM_031475	0		0	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	ENST00000377828.1	37	CCDS70.1	.	.	.	.	.	.	.	.	.	.	a	17.65	3.443230	0.63067	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	T;T	0.43294	0.95;0.95	3.6	3.6	0.41247	.	0.105027	0.39687	N	0.001292	T	0.48314	0.1493	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.33599	-0.9862	10	0.27082	T	0.32	-24.0069	11.1722	0.48577	1.0:0.0:0.0:0.0	.	376	B1AK53	ESPN_HUMAN	P	376;161	ENSP00000367059:T376P;ENSP00000401793:T161P	ENSP00000367059:T376P	T	+	1	0	ESPN	6427263	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	4.671000	0.61590	1.514000	0.48869	0.398000	0.26397	ACC			0.617	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001887.3		NM_031475	
PRPF38A	84950	mdanderson.org	37	1	52876860	52876860	+	Silent	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr1:52876860G>T	ENST00000257181.9	+	4	672	c.486G>T	c.(484-486)ctG>ctT	p.L162L	snoU13_ENST00000458879.1_RNA|PRPF38A_ENST00000474048.1_Intron	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	162					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						ATATCATTCTGCCCCGACTAC	0.403																																					p.L162L													.	.			0			c.G486T												128.0	116.0	120.0					1																	52876860		2203	4300	6503	SO:0001819	synonymous_variant	84950	exon4			CATTCTGCCCCGA	AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.486G>T	1.37:g.52876860G>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_032864	114	0.00	0	Q96JW1|Q9BVZ8	Silent	SNP	ENST00000257181.9	37	CCDS567.1																																																																																					0.403	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022459.2		NM_032864	
LRP8	7804	broad.mit.edu;bcgsc.ca	37	1	53741395	53741395	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr1:53741395T>C	ENST00000306052.6	-	6	1015	c.914A>G	c.(913-915)cAg>cGg	p.Q305R	LRP8_ENST00000371454.2_Missense_Mutation_p.Q305R|LRP8_ENST00000347547.2_Intron|LRP8_ENST00000354412.3_Missense_Mutation_p.Q176R|LRP8_ENST00000465675.1_5'UTR	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	305	LDL-receptor class A 7. {ECO:0000255|PROSITE-ProRule:PRU00124}.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						ATCCCCACACTGGAACTCGTC	0.592																																					p.Q305R													.	LRP8	58		0			c.A914G												151.0	103.0	119.0					1																	53741395		2203	4300	6503	SO:0001583	missense	7804	exon6			CCACACTGGAACT	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.914A>G	1.37:g.53741395T>C	ENSP00000303634:p.Gln305Arg		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	108	0.06	6	NM_004631	1	0.00	0	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.337168	0.41398	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000354412	D;D;D	0.95103	-3.61;-3.61;-3.61	4.05	1.58	0.23477	Growth factor, receptor (1);	.	.	.	.	D	0.87038	0.6078	N	0.16903	0.455	0.80722	D	1	B;B;B	0.13594	0.008;0.0;0.001	B;B;B	0.15052	0.005;0.003;0.012	T	0.76656	-0.2879	9	0.36615	T	0.2	.	8.5683	0.33554	0.0:0.1647:0.0:0.8353	.	176;305;305	Q14114-2;Q14114-3;Q14114	.;.;LRP8_HUMAN	R	305;305;176	ENSP00000303634:Q305R;ENSP00000360509:Q305R;ENSP00000346391:Q176R	ENSP00000303634:Q305R	Q	-	2	0	LRP8	53513983	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.152000	0.42272	0.121000	0.18284	0.379000	0.24179	CAG			0.592	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000024699.1		NM_004631	
TCHH	7062	broad.mit.edu	37	1	152082647	152082647	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr1:152082647A>G	ENST00000368804.1	-	2	3045	c.3046T>C	c.(3046-3048)Tgg>Cgg	p.W1016R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1016	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.W1016R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tgcctctcccactcctggcgc	0.582																																					p.W1016R													TCHH,extremity,malignant_melanoma,0,1	TCHH	275	1	1	Substitution - Missense(1)	skin(1)	c.T3046C												98.0	100.0	99.0					1																	152082647		1974	4149	6123	SO:0001583	missense	7062	exon3			TCTCCCACTCCTG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3046T>C	1.37:g.152082647A>G	ENSP00000357794:p.Trp1016Arg		Somatic	110	0.0545454545	6		WXS	Illumina HiSeq	Phase_I	155	0.04	6	NM_007113	0		0	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	a	1.987	-0.432633	0.04669	.	.	ENSG00000159450	ENST00000368804	T	0.03745	3.82	1.9	-0.341	0.12639	.	.	.	.	.	T	0.00328	0.0010	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38607	-0.9653	9	0.13108	T	0.6	.	2.7919	0.05390	0.17:0.0:0.3552:0.4748	.	1016	Q07283	TRHY_HUMAN	R	1016	ENSP00000357794:W1016R	ENSP00000357794:W1016R	W	-	1	0	TCHH	150349271	0.002000	0.14202	0.001000	0.08648	0.053000	0.15095	0.265000	0.18515	-0.507000	0.06549	-0.381000	0.06696	TGG			0.582	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036671.2		NM_007113	
PKP1	5317	mdanderson.org	37	1	201294223	201294223	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr1:201294223G>T	ENST00000352845.3	+	12	2052	c.2052G>T	c.(2050-2052)atG>atT	p.M684I	PKP1_ENST00000367324.3_Missense_Mutation_p.M663I|PKP1_ENST00000263946.3_Missense_Mutation_p.M684I			Q13835	PKP1_HUMAN	plakophilin 1	684					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CCAGCAGCATGCTCAACAACA	0.602																																					p.M684I													.	.			0			c.G2052T												172.0	142.0	152.0					1																	201294223		2203	4300	6503	SO:0001583	missense	5317	exon12			CAGCATGCTCAAC	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.2052G>T	1.37:g.201294223G>T	ENSP00000295597:p.Met684Ile		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	93	0.04	4	NM_000299	0		0	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.335813	0.41398	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.41758	0.99;0.99;0.99	5.65	5.65	0.86999	Armadillo-like helical (1);Armadillo-type fold (1);	0.108227	0.64402	D	0.000004	T	0.36358	0.0964	L	0.36672	1.1	0.49213	D	0.999769	B;B;B	0.18968	0.0;0.032;0.008	B;B;B	0.12837	0.003;0.008;0.002	T	0.12502	-1.0545	10	0.62326	D	0.03	-19.8842	15.2302	0.73381	0.0:0.1401:0.8599:0.0	.	271;663;684	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	I	663;684;684	ENSP00000356293:M663I;ENSP00000263946:M684I;ENSP00000295597:M684I	ENSP00000263946:M684I	M	+	3	0	PKP1	199560846	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.785000	0.68998	2.659000	0.90383	0.655000	0.94253	ATG			0.602	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000086897.1		NM_000299	
ZC3H11A	9877	broad.mit.edu	37	1	203821424	203821424	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr1:203821424T>C	ENST00000545588.1	+	17	6157	c.2330T>C	c.(2329-2331)aTa>aCa	p.I777T	ZC3H11A_ENST00000367212.3_Missense_Mutation_p.I777T|ZC3H11A_ENST00000332127.4_Missense_Mutation_p.I777T|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.I777T|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.I777T	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	777					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAGAAACTAATATGGGAGATT	0.473																																					p.I777T													.	ZC3H11A	71		0			c.T2330C												55.0	56.0	56.0					1																	203821424		2203	4300	6503	SO:0001583	missense	9877	exon20			AACTAATATGGGA		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.2330T>C	1.37:g.203821424T>C	ENSP00000438527:p.Ile777Thr		Somatic	374	0.0026737968	1		WXS	Illumina HiSeq	Phase_I	357	0.01	5	NM_014827	104	0.00	0	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.650267	0.29336	.	.	ENSG00000058673	ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.61540	0.2355	M	0.77103	2.36	0.50467	D	0.999873	B	0.18461	0.028	B	0.24269	0.052	T	0.60454	-0.7260	10	0.46703	T	0.11	-25.6355	14.9374	0.70967	0.0:0.0:0.0:1.0	.	777	O75152	ZC11A_HUMAN	T	777;723;777;777;777;777	ENSP00000356183:I777T;ENSP00000356181:I777T;ENSP00000333253:I777T;ENSP00000438527:I777T;ENSP00000356179:I777T	ENSP00000333253:I777T	I	+	2	0	ZC3H11A	202088047	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	6.379000	0.73154	2.171000	0.68590	0.528000	0.53228	ATA			0.473	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087471.3		NM_014827	
ZBTB18	10472	mdanderson.org	37	1	244218106	244218106	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr1:244218106G>T	ENST00000358704.4	+	2	1179	c.1030G>T	c.(1030-1032)Gat>Tat	p.D344Y		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	335	Interaction with DNMT3A.				cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGCCAGTGATGATGAGATGAT	0.612																																					p.D344Y													.	.			0			c.G1030T												72.0	66.0	68.0					1																	244218106		2203	4300	6503	SO:0001583	missense	10472	exon2			AGTGATGATGAGA	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1030G>T	1.37:g.244218106G>T	ENSP00000351539:p.Asp344Tyr		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	66	0.06	4	NM_205768	21	0.00	0	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600573	0.46423	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.12569	2.67	5.73	5.73	0.89815	.	0.167072	0.53938	D	0.000058	T	0.18882	0.0453	N	0.19112	0.55	0.80722	D	1	P;P	0.47910	0.842;0.902	P;P	0.51229	0.462;0.663	T	0.00934	-1.1509	10	0.59425	D	0.04	.	19.8983	0.96975	0.0:0.0:1.0:0.0	.	335;344	Q99592;Q99592-2	ZN238_HUMAN;.	Y	344	ENSP00000351539:D344Y	ENSP00000351539:D344Y	D	+	1	0	ZNF238	242284729	1.000000	0.71417	0.524000	0.27887	0.862000	0.49288	6.331000	0.72929	2.718000	0.92993	0.650000	0.86243	GAT			0.612	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096513.2		NM_205768	
PFKFB3	5209	mdanderson.org	37	10	6263368	6263368	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr10:6263368G>T	ENST00000379775.4	+	9	1186	c.856G>T	c.(856-858)Gtg>Ttg	p.V286L	PFKFB3_ENST00000379785.1_Missense_Mutation_p.V286L|PFKFB3_ENST00000540253.1_Missense_Mutation_p.V300L|PFKFB3_ENST00000379782.3_Missense_Mutation_p.V286L|PFKFB3_ENST00000360521.2_Missense_Mutation_p.V286L|PFKFB3_ENST00000317350.4_Missense_Mutation_p.V286L|PFKFB3_ENST00000379789.4_Missense_Mutation_p.V266L|PFKFB3_ENST00000536985.1_3'UTR	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	286	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						GAGCAAGTTCGTGGAGGAGCA	0.637																																					p.V286L													.	.			0			c.G856T												50.0	41.0	44.0					10																	6263368		2203	4300	6503	SO:0001583	missense	5209	exon9			AAGTTCGTGGAGG		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.856G>T	10.37:g.6263368G>T	ENSP00000369100:p.Val286Leu		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	64	0.05	3	NM_004566	16	0.00	0	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	37	CCDS7078.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.32|12.32	1.902994|1.902994	0.33628|0.33628	.|.	.|.	ENSG00000170525|ENSG00000170525	ENST00000450232|ENST00000379789;ENST00000379784;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.|T;T;T;T;T;T;T	.|0.57436	.|0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.5|5.5	3.54|3.54	0.40534|0.40534	.|Histidine phosphatase superfamily, clade-1 (2);	.|0.214744	.|0.42682	.|D	.|0.000668	T|T	0.24431|0.24431	0.0592|0.0592	N|N	0.01656|0.01656	-0.775|-0.775	0.58432|0.58432	D|D	0.999991|0.999991	.|B;B;B;B	.|0.10296	.|0.003;0.001;0.003;0.002	.|B;B;B;B	.|0.14578	.|0.007;0.003;0.009;0.011	T|T	0.05616|0.05616	-1.0874|-1.0874	5|10	.|0.29301	.|T	.|0.29	-4.1036|-4.1036	11.9007|11.9007	0.52682|0.52682	0.0684:0.1223:0.8094:0.0|0.0684:0.1223:0.8094:0.0	.|.	.|300;286;286;266	.|B7Z955;Q16875-2;Q16875;Q5VX15	.|.;.;F263_HUMAN;.	L|L	1|266;47;300;286;286;286;286;286;286	.|ENSP00000369115:V266L;ENSP00000446384:V300L;ENSP00000369105:V286L;ENSP00000369111:V286L;ENSP00000369108:V286L;ENSP00000353712:V286L;ENSP00000369100:V286L	.|ENSP00000369105:V286L	R|V	+|+	2|1	0|0	PFKFB3|PFKFB3	6303374|6303374	1.000000|1.000000	0.71417|0.71417	0.913000|0.913000	0.36048|0.36048	0.929000|0.929000	0.56500|0.56500	3.079000|3.079000	0.50104|0.50104	1.454000|1.454000	0.47793|0.47793	0.655000|0.655000	0.94253|0.94253	CGT|GTG			0.637	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000046647.1			
PCDH15	65217	broad.mit.edu	37	10	55582229	55582229	+	Missense_Mutation	SNP	T	T	G	rs564747270|rs397517462|rs369404101	byFrequency	TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr10:55582229T>G	ENST00000320301.6	-	33	5651	c.5257A>C	c.(5257-5259)Att>Ctt	p.I1753L	PCDH15_ENST00000395432.2_Missense_Mutation_p.I1713L|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.I1755L|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395433.1_Missense_Mutation_p.I1730L|PCDH15_ENST00000437009.1_Missense_Mutation_p.I1684L|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.I1750L	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1753					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.I1760V(1)|p.I1753V(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ggaggagaaataggaggagga	0.463										HNSCC(58;0.16)			T|||	2	0.000399361	0.0	0.0	5008	,	,		18593	0.0		0.001	False		,,,				2504	0.001				p.I1760L													PCDH15_ENST00000417177,colon,carcinoma,0,2	PCDH15	1715	2	2	Substitution - Missense(2)	large_intestine(2)	c.A5278C												17.0	18.0	17.0					10																	55582229		2202	4299	6501	SO:0001583	missense	65217	exon35			GAGAAATAGGAGG	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5257A>C	10.37:g.55582229T>G	ENSP00000322604:p.Ile1753Leu		Somatic	51	0.0392156863	2		WXS	Illumina HiSeq	Phase_I	51	0.12	6	NM_001142763	0		0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	T	8.079	0.771876	0.16051	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T	0.56103	0.51;0.48;0.53;0.49;0.49;0.49	4.43	-7.97	0.01139	.	.	.	.	.	T	0.18635	0.0447	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.23726	-1.0180	9	0.08837	T	0.75	.	0.6259	0.00786	0.2986:0.3001:0.1876:0.2136	.	1730;1753;1755;1760;1684;1713;1750;1753	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;Q96QU1	.;.;.;.;.;.;.;PCD15_HUMAN	L	1713;1755;1730;1753;1750;1760;1684	ENSP00000378820:I1713L;ENSP00000354950:I1755L;ENSP00000378821:I1730L;ENSP00000322604:I1753L;ENSP00000378818:I1750L;ENSP00000412628:I1684L	ENSP00000322604:I1753L	I	-	1	0	PCDH15	55252235	0.170000	0.23016	0.000000	0.03702	0.015000	0.08874	0.703000	0.25646	-1.960000	0.01017	-0.464000	0.05259	ATT			0.463	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000048121.2		NM_033056	
FRAT2	23401	mdanderson.org	37	10	99093719	99093719	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr10:99093719G>T	ENST00000371019.2	-	1	739	c.611C>A	c.(610-612)gCa>gAa	p.A204E	RP11-452K12.4_ENST00000445808.2_RNA	NM_012083.2	NP_036215.1	O75474	FRAT2_HUMAN	frequently rearranged in advanced T-cell lymphomas 2	204					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|Wnt signaling pathway (GO:0016055)					lung(1)	1		Colorectal(252;0.0846)		Epithelial(162;1.34e-09)|all cancers(201;8.42e-08)		GCCCGTGGCTGCAACCGCGGC	0.711																																					p.A204E													.	.			0			c.C611A												4.0	7.0	6.0					10																	99093719		1923	3933	5856	SO:0001583	missense	23401	exon1			GTGGCTGCAACCG	AF062739	CCDS7456.1	10q23-q24.1	2008-08-01			ENSG00000181274	ENSG00000181274			16048	protein-coding gene	gene with protein product	"""GSK-3 binding protein FRAT2"""	605006				9635432, 11237732	Standard	NM_012083		Approved		uc001knd.1	O75474	OTTHUMG00000018850	ENST00000371019.2:c.611C>A	10.37:g.99093719G>T	ENSP00000360058:p.Ala204Glu		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_012083	53	0.00	0	Q5JTI0|Q8WUL9|Q9BYG2	Missense_Mutation	SNP	ENST00000371019.2	37	CCDS7456.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.869245	0.32977	.	.	ENSG00000181274	ENST00000371019	.	.	.	4.26	3.27	0.37495	.	0.282417	0.23144	U	0.051432	T	0.35393	0.0930	N	0.22421	0.69	0.09310	N	1	D	0.76494	0.999	D	0.67231	0.95	T	0.16630	-1.0396	9	0.02654	T	1	-3.1221	11.1171	0.48266	0.0:0.1897:0.8103:0.0	.	204	O75474	FRAT2_HUMAN	E	204	.	ENSP00000360058:A204E	A	-	2	0	FRAT2	99083709	0.595000	0.26857	0.767000	0.31495	0.559000	0.35586	2.163000	0.42377	1.901000	0.55032	0.313000	0.20887	GCA			0.711	FRAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049676.1		NM_012083	
RRP12	23223	mdanderson.org	37	10	99131871	99131871	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr10:99131871C>A	ENST00000370992.4	-	20	2413	c.2302G>T	c.(2302-2304)Gcc>Tcc	p.A768S	RRP12_ENST00000536831.1_Missense_Mutation_p.A486S|RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000315563.6_Missense_Mutation_p.A668S|RRP12_ENST00000414986.1_Missense_Mutation_p.A707S	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	768						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TTACTGATGGCAGCTTCGTCA	0.642																																					p.A768S													.	.			0			c.G2302T												90.0	73.0	78.0					10																	99131871		2203	4300	6503	SO:0001583	missense	23223	exon20			TGATGGCAGCTTC		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.2302G>T	10.37:g.99131871C>A	ENSP00000360031:p.Ala768Ser		Somatic	60	0.0166666667	1		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_015179	58	0.00	0	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	ENST00000370992.4	37	CCDS7457.1	.	.	.	.	.	.	.	.	.	.	C	4.796	0.147950	0.09134	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.71	4.74	0.60224	Armadillo-like helical (1);Armadillo-type fold (1);	0.231303	0.45867	D	0.000336	T	0.29945	0.0749	N	0.02802	-0.49	0.37587	D	0.920056	B;B;B;B	0.15473	0.013;0.003;0.004;0.007	B;B;B;B	0.14023	0.002;0.01;0.007;0.002	T	0.36890	-0.9729	10	0.02654	T	1	-22.6223	8.6944	0.34287	0.2642:0.6532:0.0:0.0826	.	707;668;486;768	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	S	768;668;707;486	ENSP00000360031:A768S;ENSP00000324315:A668S;ENSP00000414863:A707S;ENSP00000446184:A486S	ENSP00000324315:A668S	A	-	1	0	RRP12	99121861	0.109000	0.22037	0.996000	0.52242	0.662000	0.39071	0.449000	0.21744	2.684000	0.91462	0.655000	0.94253	GCC			0.642	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049699.4		NM_015179	
MUC2	4583	hgsc.bcm.edu	37	11	1092884	1092884	+	Missense_Mutation	SNP	C	C	T	rs201415503		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr11:1092884C>T	ENST00000441003.2	+	30	4730	c.4703C>T	c.(4702-4704)aCg>aTg	p.T1568M	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1569M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1569M(2)|p.T1568M(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACCACCACGGTGacccca	0.637																																					p.T1568M													MUC2_ENST00000441003,NS,carcinoma,0,8	MUC2_ENST00000441003	0	8	4	Substitution - Missense(4)	large_intestine(2)|skin(2)	c.C4703T												129.0	172.0	157.0					11																	1092884		1964	3669	5633	SO:0001583	missense	4583	exon30			CCACCACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4703C>T	11.37:g.1092884C>T	ENSP00000415183:p.Thr1568Met		Somatic	61	0.0163934426	1		WXS	Illumina HiSeq	.	69	0.04	3	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.409	-0.335727	0.05278	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14893	2.5;2.47	1.63	0.367	0.16140	.	25.055600	0.00797	U	0.001394	T	0.21841	0.0526	.	.	.	0.09310	N	1	D	0.76494	0.999	P	0.48425	0.577	T	0.35301	-0.9794	9	0.45353	T	0.12	.	8.9064	0.35526	0.0:0.7681:0.2319:0.0	.	1568	E7EUV1	.	M	1568;1569	ENSP00000415183:T1568M;ENSP00000351956:T1569M	ENSP00000351956:T1569M	T	+	2	0	MUC2	1082884	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.878000	0.28126	0.945000	0.37605	0.121000	0.15741	ACG			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
TMEM179B	374395	broad.mit.edu	37	11	62556810	62556810	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr11:62556810G>T	ENST00000333449.4	+	3	336	c.331G>T	c.(331-333)Gtc>Ttc	p.V111F	TMEM179B_ENST00000533861.1_Missense_Mutation_p.V111F|TMEM223_ENST00000525631.1_Intron|RP11-727F15.12_ENST00000601484.1_RNA|TMEM223_ENST00000527073.1_Intron	NM_199337.2	NP_955369.1	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	111						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|liver(1)|lung(1)	4						AGCTATAGCCGTCTTCCTGGT	0.522																																					p.V111F													TMEM179B,NS,carcinoma,0,1	TMEM179B	13	1	0			c.G331T												116.0	88.0	97.0					11																	62556810		2201	4299	6500	SO:0001583	missense	374395	exon3			ATAGCCGTCTTCC	BC051355	CCDS8036.1	11q12.3	2007-11-26			ENSG00000185475	ENSG00000185475			33744	protein-coding gene	gene with protein product							Standard	NM_199337		Approved		uc001nvd.4	Q7Z7N9	OTTHUMG00000167611	ENST00000333449.4:c.331G>T	11.37:g.62556810G>T	ENSP00000333697:p.Val111Phe		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	181	0.02	4	NM_199337	196	0.00	0		Missense_Mutation	SNP	ENST00000333449.4	37	CCDS8036.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.37|16.37	3.103732|3.103732	0.56291|0.56291	.|.	.|.	ENSG00000185475|ENSG00000185475	ENST00000526546|ENST00000533861;ENST00000333449	.|.	.|.	.|.	5.92|5.92	-0.272|-0.272	0.12919|0.12919	.|.	.|0.520091	.|0.22296	.|N	.|0.061940	T|T	0.16085|0.16085	0.0387|0.0387	N|N	0.14661|0.14661	0.345|0.345	0.20821|0.20821	N|N	0.999843|0.999843	.|P	.|0.37636	.|0.603	.|B	.|0.34346	.|0.18	T|T	0.29366|0.29366	-1.0014|-1.0014	5|9	.|0.16896	.|T	.|0.51	.|.	8.839|8.839	0.35131|0.35131	0.536:0.0:0.464:0.0|0.536:0.0:0.464:0.0	.|.	.|111	.|Q7Z7N9	.|T179B_HUMAN	L|F	30|111	.|.	.|ENSP00000333697:V111F	R|V	+|+	2|1	0|0	TMEM179B|TMEM179B	62313386|62313386	0.234000|0.234000	0.23783|0.23783	0.690000|0.690000	0.30148|0.30148	0.982000|0.982000	0.71751|0.71751	-0.153000|-0.153000	0.10144|0.10144	-0.068000|-0.068000	0.12953|0.12953	-0.415000|-0.415000	0.06103|0.06103	CGT|GTC			0.522	TMEM179B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395362.2		NM_199337	
ESRRA	2101	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	64082666	64082666	+	Silent	SNP	A	A	G			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr11:64082666A>G	ENST00000405666.1	+	6	1170	c.936A>G	c.(934-936)ctA>ctG	p.L312L	PRDX5_ENST00000347941.4_5'Flank|PRDX5_ENST00000352435.4_5'Flank|ESRRA_ENST00000000442.6_Silent_p.L312L|PRDX5_ENST00000265462.4_5'Flank|ESRRA_ENST00000406310.1_Silent_p.L311L	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	312	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.L312L(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						TGCTGCAACTAGTGCGGCGGC	0.632																																					p.L312L													ESRRA,colon,carcinoma,0,1	ESRRA	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.A936G												22.0	26.0	24.0					11																	64082666		1970	4152	6122	SO:0001819	synonymous_variant	2101	exon6			GCAACTAGTGCGG	X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.936A>G	11.37:g.64082666A>G			Somatic	66	0	0		WXS	Illumina HiSeq	.	73	0.07	5	NM_004451	71	0.00	0	Q14514	Silent	SNP	ENST00000405666.1	37	CCDS41667.1	.	.	.	.	.	.	.	.	.	.	A	4.821	0.152670	0.09185	.	.	ENSG00000173153	ENST00000545035	.	.	.	4.14	-1.69	0.08186	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7674	0.28988	0.1792:0.5573:0.2635:0.0	.	.	.	.	W	93	.	.	X	+	2	0	ESRRA	63839242	1.000000	0.71417	0.987000	0.45799	0.861000	0.49209	1.544000	0.36158	-0.417000	0.07461	-0.381000	0.06696	TAG			0.632	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000319304.1		NM_004451	
CADM1	23705	hgsc.bcm.edu;mdanderson.org	37	11	115080343	115080343	+	Silent	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr11:115080343G>T	ENST00000452722.3	-	8	1049	c.1029C>A	c.(1027-1029)acC>acA	p.T343T	CADM1_ENST00000542447.2_Intron|CADM1_ENST00000537058.1_Silent_p.T343T|CADM1_ENST00000536727.1_Intron|CADM1_ENST00000331581.6_Silent_p.T343T|CADM1_ENST00000537140.1_Intron	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.T343T(5)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggtggttgttgtgg	0.433																																					p.T343T													CADM1,NS,carcinoma,0,6	CADM1	0	6	5	Substitution - coding silent(5)	kidney(3)|lung(2)	c.C1029A												45.0	50.0	49.0					11																	115080343		2201	4296	6497	SO:0001819	synonymous_variant	23705	exon8			GGTGGTGGTTGTT	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1029C>A	11.37:g.115080343G>T			Somatic	50	0.02	1		WXS	Illumina HiSeq	.	43	0.09	4	NM_014333	11	0.00	0		Silent	SNP	ENST00000452722.3	37	CCDS8373.1																																																																																					0.433	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000398753.2		NM_014333	
TECTA	7007	broad.mit.edu	37	11	120980079	120980079	+	Missense_Mutation	SNP	G	G	A	rs370688947		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr11:120980079G>A	ENST00000392793.1	+	4	629	c.358G>A	c.(358-360)Gcc>Acc	p.A120T	TECTA_ENST00000264037.2_Missense_Mutation_p.A120T			O75443	TECTA_HUMAN	tectorin alpha	120	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CATGGAGCCTGCCATCTTGAA	0.502																																					p.A120T													.	TECTA	329		0			c.G358A												103.0	101.0	102.0					11																	120980079		2203	4299	6502	SO:0001583	missense	7007	exon3			GAGCCTGCCATCT	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.358G>A	11.37:g.120980079G>A	ENSP00000376543:p.Ala120Thr		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	144	0.03	4	NM_005422	1	0.00	0		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695609	0.48202	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.37411	1.2;1.2	5.57	5.57	0.84162	Nidogen, extracellular domain (2);	0.351126	0.28983	N	0.013505	T	0.37237	0.0996	L	0.49256	1.55	0.40470	D	0.980332	B	0.09022	0.002	B	0.14023	0.01	T	0.12192	-1.0557	10	0.27082	T	0.32	.	19.557	0.95354	0.0:0.0:1.0:0.0	.	120	O75443	TECTA_HUMAN	T	120	ENSP00000376543:A120T;ENSP00000264037:A120T	ENSP00000264037:A120T	A	+	1	0	TECTA	120485289	1.000000	0.71417	0.974000	0.42286	0.988000	0.76386	6.756000	0.74919	2.630000	0.89119	0.655000	0.94253	GCC			0.502	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313850.1		NM_005422	
BCL11B	64919	hgsc.bcm.edu	37	14	99641568	99641568	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr14:99641568C>G	ENST00000357195.3	-	4	1614	c.1605G>C	c.(1603-1605)gaG>gaC	p.E535D	BCL11B_ENST00000443726.2_Missense_Mutation_p.E341D|BCL11B_ENST00000345514.2_Missense_Mutation_p.E464D	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	535	Glu-rich.				alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E535_E536delEE(1)		NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		cctcctcctcctcgtcctcct	0.697			T	TLX3	T-ALL																																p.E535D				Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,colon,carcinoma,0,1	BCL11B	0	1	1	Deletion - In frame(1)	prostate(1)	c.G1605C												5.0	5.0	5.0					14																	99641568		2084	4070	6154	SO:0001583	missense	64919	exon4			CTCCTCCTCGTCC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1605G>C	14.37:g.99641568C>G	ENSP00000349723:p.Glu535Asp		Somatic	14	0	0		WXS	Illumina HiSeq	.	16	0.13	2	NM_138576	0		0	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.167616	0.38315	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.13657	2.57;2.6;2.57	3.81	0.863	0.19062	.	0.158674	0.40144	N	0.001176	T	0.07324	0.0185	N	0.22421	0.69	0.40982	D	0.984788	B;B	0.31413	0.322;0.185	B;B	0.31390	0.129;0.048	T	0.38394	-0.9663	10	0.30854	T	0.27	-8.4478	4.8239	0.13407	0.0:0.4986:0.1502:0.3512	.	464;535	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	D	535;464;341	ENSP00000349723:E535D;ENSP00000280435:E464D;ENSP00000387419:E341D	ENSP00000280435:E464D	E	-	3	2	BCL11B	98711321	0.591000	0.26824	0.998000	0.56505	0.990000	0.78478	-0.193000	0.09573	-0.059000	0.13154	0.561000	0.74099	GAG			0.697	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000072332.2		NM_138576	
CDC42BPB	9578	mdanderson.org	37	14	103410270	103410270	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr14:103410270G>A	ENST00000361246.2	-	30	4654	c.4366C>T	c.(4366-4368)Cgc>Tgc	p.R1456C		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TCCTGCGCGCGTGCCCTCCGG	0.567																																					p.R1456C													.	.			0			c.C4366T												56.0	45.0	49.0					14																	103410270		2203	4300	6503	SO:0001583	missense	9578	exon30			GCGCGCGTGCCCT	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.4366C>T	14.37:g.103410270G>A	ENSP00000355237:p.Arg1456Cys		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_006035	32	0.00	0		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050743	0.75960	.	.	ENSG00000198752	ENST00000361246	T	0.07114	3.22	5.4	4.5	0.54988	Citron-like (3);	0.053822	0.85682	D	0.000000	T	0.34542	0.0901	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.40776	-0.9545	10	0.87932	D	0	.	15.7524	0.77997	0.0:0.0:0.8623:0.1377	.	1456;1456	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	C	1456	ENSP00000355237:R1456C	ENSP00000355237:R1456C	R	-	1	0	CDC42BPB	102480023	1.000000	0.71417	0.809000	0.32408	0.997000	0.91878	6.541000	0.73865	1.385000	0.46445	0.655000	0.94253	CGC			0.567	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415711.1		NM_006035	
RAB11A	8766	mdanderson.org	37	15	66170130	66170130	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr15:66170130G>T	ENST00000261890.2	+	3	395	c.267G>T	c.(265-267)ttG>ttT	p.L89F	RAB11A_ENST00000565075.1_Missense_Mutation_p.L89F|RAB11A_ENST00000569896.1_Missense_Mutation_p.L89F|RAB11A_ENST00000435304.2_Missense_Mutation_p.L89F|RAB11A_ENST00000564910.1_Intron	NM_001206836.1|NM_004663.4	NP_001193765.1|NP_004654.1	P62491	RB11A_HUMAN	RAB11A, member RAS oncogene family	89					cytokinesis (GO:0000910)|establishment of protein localization to membrane (GO:0090150)|exosomal secretion (GO:1990182)|GTP catabolic process (GO:0006184)|melanosome transport (GO:0032402)|multivesicular body assembly (GO:0036258)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|positive regulation of axon extension (GO:0045773)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of multivesicular body size (GO:0010796)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	axon (GO:0030424)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|syntaxin binding (GO:0019905)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5						GTGCCTTATTGGTTTATGACA	0.368																																					p.L89F													.	.			0			c.G267T												133.0	121.0	125.0					15																	66170130		2201	4299	6500	SO:0001583	missense	8766	exon3			CTTATTGGTTTAT	X56740	CCDS10212.1, CCDS58373.1	15q22.31	2008-05-14			ENSG00000103769	ENSG00000103769		"""RAB, member RAS oncogene"""	9760	protein-coding gene	gene with protein product		605570				1704119, 9662449	Standard	NM_004663		Approved	YL8	uc002apk.3	P62491	OTTHUMG00000133162	ENST00000261890.2:c.267G>T	15.37:g.66170130G>T	ENSP00000261890:p.Leu89Phe		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	138	0.04	5	NM_004663	114	0.00	0	B2R4B6|B4DT13|P24410|Q5TZN9|Q9JLX1	Missense_Mutation	SNP	ENST00000261890.2	37	CCDS10212.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753920	0.69648	.	.	ENSG00000103769	ENST00000261890;ENST00000435304	D;D	0.81739	-1.53;-1.53	5.27	4.36	0.52297	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88607	0.6482	M	0.76574	2.34	0.58432	D	0.999999	D;D	0.89917	0.997;1.0	D;D	0.76575	0.958;0.988	D	0.89729	0.3925	10	0.87932	D	0	.	13.8327	0.63391	0.0741:0.0:0.9259:0.0	.	89;89	B4DT13;P62491	.;RB11A_HUMAN	F	89	ENSP00000261890:L89F;ENSP00000405767:L89F	ENSP00000261890:L89F	L	+	3	2	RAB11A	63957184	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.601000	0.61090	1.222000	0.43521	0.655000	0.94253	TTG			0.368	RAB11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256864.1			
WDR24	84219	mdanderson.org	37	16	737362	737362	+	Silent	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr16:737362G>T	ENST00000248142.6	-	7	1103	c.1104C>A	c.(1102-1104)acC>acA	p.T368T	JMJD8_ENST00000454700.1_5'Flank|WDR24_ENST00000293883.4_Silent_p.T238T|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000412368.2_5'Flank|LA16c-313D11.12_ENST00000566927.1_RNA			Q96S15	WDR24_HUMAN	WD repeat domain 24	368										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				CACGGTGCGTGGTCATGTCCC	0.642																																					p.T238T													.	.			0			c.C714A												67.0	65.0	65.0					16																	737362		2200	4299	6499	SO:0001819	synonymous_variant	84219	exon3			GTGCGTGGTCATG	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.1104C>A	16.37:g.737362G>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_032259	16	0.00	0	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Silent	SNP	ENST00000248142.6	37																																																																																						0.642	WDR24-201	KNOWN	basic	protein_coding	protein_coding				NM_032259	
LOC653786	653786	broad.mit.edu	37	16	22579566	22579573	+	RNA	DEL	ATTCATCC	ATTCATCC	-	rs370421878|rs200819155		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	ATTCATCC	ATTCATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr16:22579566_22579573delATTCATCC	ENST00000550753.1	+	0	1976					NR_003676.2																						AAATGGGTTAattcatccatccatccat	0.428																																					.													.	.			0			.																																											0	.			GGGTTAATTCATC																													16.37:g.22579566_22579573delATTCATCC			Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	95	0.00	0	.	0		0		RNA	DEL	ENST00000550753.1	37																																																																																						0.428	RP11-368J21.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409041.1			
IGHV3OR16-9	28307	broad.mit.edu	37	16	32077601	32077601	+	RNA	SNP	G	G	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr16:32077601G>A	ENST00000354689.6	+	0	216				RP11-1166P10.6_ENST00000566806.1_RNA					immunoglobulin heavy variable 3/OR16-9 (non-functional)																		CCATCTCCAGGGACAACGCCA	0.502																																					.													.	.			0			.																																											0	.			CTCCAGGGACAAC	Z29606		16p11.2	2013-12-06	2008-09-11		ENSG00000270472	ENSG00000270472		"""Immunoglobulins / IGH orphons"""	5644	other	immunoglobulin gene			"""immunoglobulin heavy variable 3/OR16-9"""				Standard			Approved	IGHV3/OR16-9			OTTHUMG00000184753		16.37:g.32077601G>A			Somatic	265	0	0		WXS	Illumina HiSeq	Phase_I	322	0.02	6	.	7	1.00	7		RNA	SNP	ENST00000354689.6	37																																																																																						0.502	IGHV3OR16-9-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000432530.2	rescued with RNA-seq		
HSF4	3299	mdanderson.org	37	16	67203614	67203614	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr16:67203614G>T	ENST00000521374.1	+	13	1405	c.1405G>T	c.(1405-1407)Gct>Tct	p.A469S	HSF4_ENST00000264009.8_Missense_Mutation_p.A469S|HSF4_ENST00000421453.1_Missense_Mutation_p.A439S|NOL3_ENST00000564053.1_5'Flank|HSF4_ENST00000584272.1_Missense_Mutation_p.A439S|NOL3_ENST00000432069.2_5'Flank			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	469					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CCTGCCTGGGGCTTTAACCAT	0.667											OREG0023873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A469S													.	.			0			c.G1405T												45.0	51.0	49.0					16																	67203614		1840	4087	5927	SO:0001583	missense	3299	exon15			CCTGGGGCTTTAA	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.1405G>T	16.37:g.67203614G>T	ENSP00000430947:p.Ala469Ser		Somatic	49	0	0	1097	WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001040667	7	0.00	0	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.512387|4.512387	0.85389|0.85389	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374|ENST00000519601	.|.	.|.	.|.	4.63|4.63	4.63|4.63	0.57726|0.57726	.|.	0.128188|.	0.35739|.	N|.	0.003010|.	T|T	0.33789|0.33789	0.0875|0.0875	N|N	0.12746|0.12746	0.255|0.255	0.30005|0.30005	N|N	0.815694|0.815694	D;D|.	0.71674|.	0.998;0.997|.	D;D|.	0.80764|.	0.994;0.985|.	T|T	0.36040|0.36040	-0.9764|-0.9764	9|6	0.05833|0.66056	T|D	0.94|0.02	-27.7356|-27.7356	13.1608|13.1608	0.59542|0.59542	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	439;469|.	Q9ULV5-2;Q9ULV5|.	.;HSF4_HUMAN|.	S|V	439;469;393;469|200	.|.	ENSP00000264009:A469S|ENSP00000428077:G200V	A|G	+|+	1|2	0|0	HSF4|HSF4	65761115|65761115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.552000|4.552000	0.60747|0.60747	2.552000|2.552000	0.86080|0.86080	0.563000|0.563000	0.77884|0.77884	GCT|GGC			0.667	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375080.1		NM_001538	
ANKRD11	29123	broad.mit.edu;bcgsc.ca	37	16	89351844	89351844	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr16:89351844T>C	ENST00000301030.4	-	9	1566	c.1106A>G	c.(1105-1107)aAg>aGg	p.K369R	ANKRD11_ENST00000378330.2_Missense_Mutation_p.K369R	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	369					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCTGTAGTCCTTTTTCAATAG	0.453																																					p.K369R													.	ANKRD11	195		0			c.A1106G												158.0	162.0	160.0					16																	89351844		2198	4300	6498	SO:0001583	missense	29123	exon9			TAGTCCTTTTTCA	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1106A>G	16.37:g.89351844T>C	ENSP00000301030:p.Lys369Arg		Somatic	188	0.0053191489	1		WXS	Illumina HiSeq	Phase_I	177	0.04	7	NM_001256183	34	0.00	0	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.112102	0.56398	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000378332	T;T	0.46063	0.88;0.88	5.4	5.4	0.78164	.	0.046390	0.85682	N	0.000000	T	0.63189	0.2490	M	0.71581	2.175	0.80722	D	1	D	0.59767	0.986	D	0.69654	0.965	T	0.66666	-0.5866	10	0.62326	D	0.03	.	15.4164	0.74974	0.0:0.0:0.0:1.0	.	369	Q6UB99	ANR11_HUMAN	R	369;369;383	ENSP00000301030:K369R;ENSP00000367581:K369R	ENSP00000301030:K369R	K	-	2	0	ANKRD11	87879345	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	7.836000	0.86788	2.052000	0.61016	0.460000	0.39030	AAG			0.453	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430462.3		NM_013275	
SMCR2	140768	broad.mit.edu	37	17	17579770	17579771	+	lincRNA	DEL	TG	TG	-	rs377428889|rs111841324		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr17:17579770_17579771delTG	ENST00000456090.2	-	0	114									Smith-Magenis syndrome chromosome region, candidate 2 (non-protein coding)																		AACCCAAGGCtgtgtgtgtgtg	0.495																																					.													.	.			0			.																																											0	.			CAAGGCTGTGTGT	AI821758		17p11.2	2012-10-16	2011-06-10		ENSG00000223979	ENSG00000223979		"""Long non-coding RNAs"""	17914	non-coding RNA	RNA, long non-coding			"""Smith-Magenis syndrome chromosome region, candidate 2"""			11997338	Standard			Approved				OTTHUMG00000059291		17.37:g.17579780_17579781delTG			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	0		0		RNA	DEL	ENST00000456090.2	37																																																																																						0.495	SMCR2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000131667.2			
SPOP	8405	broad.mit.edu	37	17	47688679	47688679	+	Silent	SNP	G	G	A	rs148282868		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr17:47688679G>A	ENST00000393328.2	-	7	986	c.621C>T	c.(619-621)gcC>gcT	p.A207A	SPOP_ENST00000504102.1_Silent_p.A207A|SPOP_ENST00000347630.2_Silent_p.A207A|SPOP_ENST00000503676.1_Silent_p.A207A|SPOP_ENST00000393331.3_Silent_p.A207A	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	207	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.|Important for homodimerization.				glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						ATTCCTGGCCGGCAACACACA	0.453										Prostate(2;0.17)																											p.A207A													.	SPOP	91		0			c.C621T							G	,,,,,	1,4405	2.1+/-5.4	0,1,2202	110.0	115.0	113.0		621,621,621,621,621,621	3.2	1.0	17	dbSNP_134	113	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SPOP	NM_001007226.1,NM_001007227.1,NM_001007228.1,NM_001007229.1,NM_001007230.1,NM_003563.3	,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,	207/375,207/375,207/375,207/375,207/375,207/375	47688679	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8405	exon6			CTGGCCGGCAACA	AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.621C>T	17.37:g.47688679G>A			Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	138	0.02	3	NM_001007228	40	0.00	0	B2R6S3|D3DTW7|Q53HJ1	Silent	SNP	ENST00000393328.2	37	CCDS11551.1																																																																																					0.453	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365154.2		NM_003563	
PRPSAP1	5635	mdanderson.org	37	17	74349677	74349677	+	Silent	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr17:74349677G>T	ENST00000446526.3	-	1	553	c.108C>A	c.(106-108)ggC>ggA	p.G36G	PRPSAP1_ENST00000324684.4_Intron	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	7					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						AGACTCGGTAGCCGGTGCGAG	0.751																																					p.G36G													.	.			0			c.C108A												4.0	4.0	4.0					17																	74349677		1975	3973	5948	SO:0001819	synonymous_variant	5635	exon1			TCGGTAGCCGGTG	D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.108C>A	17.37:g.74349677G>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_002766	35	0.00	0	B2R6M4|Q96H06	Silent	SNP	ENST00000446526.3	37	CCDS11743.2																																																																																					0.751	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342480.2		NM_002766	
GRIN3B	116444	broad.mit.edu	37	19	1009551	1009577	+	In_Frame_Del	DEL	GCCCCCGCGGAGGCCCCACCACACTCT	GCCCCCGCGGAGGCCCCACCACACTCT	-	rs573396231|rs58448123|rs142516571	byFrequency	TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	GCCCCCGCGGAGGCCCCACCACACTCT	GCCCCCGCGGAGGCCCCACCACACTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr19:1009551_1009577delGCCCCCGCGGAGGCCCCACCACACTCT	ENST00000234389.3	+	9	3101_3127	c.3082_3108delGCCCCCGCGGAGGCCCCACCACACTCT	c.(3082-3108)gcccccgcggaggccccaccacactctdel	p.APAEAPPHS1028del		NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	1028					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGCCAGAGCGGCCCCCGCGGAGGCCCCACCACACTCTGGCCGACCGG	0.692														895	0.178714	0.1959	0.1744	5008	,	,		11397	0.1042		0.2167	False		,,,				2504	0.1963				p.1028_1036del													GRIN3B,NS,carcinoma,-1,1	GRIN3B	46	1	0			c.3082_3108del									362,1598		137,88,755						-8.8	0.0		dbSNP_129	2	883,3849		318,247,1801	no	coding	GRIN3B	NM_138690.1		455,335,2556	A1A1,A1R,RR		18.6602,18.4694,18.6043				1245,5447				SO:0001651	inframe_deletion	116444	exon9			AGAGCGGCCCCCG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.3082_3108delGCCCCCGCGGAGGCCCCACCACACTCT	19.37:g.1009551_1009577delGCCCCCGCGGAGGCCCCACCACACTCT	ENSP00000234389:p.Ala1028_Ser1036del		Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.83	5	NM_138690	0		0	Q5EAK7|Q7RTW9	In_Frame_Del	DEL	ENST00000234389.3	37	CCDS32861.1																																																																																					0.692	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103923.2			
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	10610444	10610444	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr19:10610444G>A	ENST00000171111.5	-	2	813	c.266C>T	c.(265-267)cCg>cTg	p.P89L	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.P89L	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	89	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CTGGGCGGCCGGTGCATCCTG	0.612																																					p.P89L													.	.			0			c.C266T												95.0	72.0	80.0					19																	10610444		2203	4300	6503	SO:0001583	missense	9817	exon2			GCGGCCGGTGCAT	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.266C>T	19.37:g.10610444G>A	ENSP00000171111:p.Pro89Leu		Somatic	87	0	0		WXS	Illumina HiSeq	.	89	0.04	4	NM_012289	40	0.00	0	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981897	0.34942	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.72282	-0.64;-0.64	4.68	4.68	0.58851	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.234176	0.44097	D	0.000491	T	0.53818	0.1820	L	0.33293	1	0.41368	D	0.987472	P	0.36378	0.55	B	0.28784	0.094	T	0.56238	-0.8012	10	0.33940	T	0.23	.	10.3791	0.44101	0.0:0.0:0.8042:0.1958	.	89	Q14145	KEAP1_HUMAN	L	89	ENSP00000171111:P89L;ENSP00000377245:P89L	ENSP00000171111:P89L	P	-	2	0	KEAP1	10471444	1.000000	0.71417	0.048000	0.18961	0.137000	0.21094	4.407000	0.59754	2.162000	0.67917	0.462000	0.41574	CCG			0.612	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452000.1		NM_012289	
PSG4	5672	hgsc.bcm.edu;mdanderson.org	37	19	43699192	43699192	+	Silent	SNP	G	G	T	rs367853186		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr19:43699192G>T	ENST00000405312.3	-	4	1180	c.943C>A	c.(943-945)Cga>Aga	p.R315R	PSG4_ENST00000244295.9_Intron|PSG4_ENST00000433626.2_Silent_p.R222R	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	315	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				CCACCATATCGGTCCCGTATT	0.488																																					p.H315N													.	.			0			c.C943A												154.0	140.0	145.0					19																	43699192		2201	4293	6494	SO:0001819	synonymous_variant	5672	exon4			CATATCGGTCCCG		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.943C>A	19.37:g.43699192G>T			Somatic	42	0	0		WXS	Illumina HiSeq	.	55	0.07	4	NM_002780	0		0	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	ENST00000405312.3	37	CCDS46093.1																																																																																					0.488	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323073.1		NM_213633	
PRR12	57479	mdanderson.org	37	19	50117808	50117808	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr19:50117808C>T	ENST00000418929.2	+	7	4804	c.4792C>T	c.(4792-4794)Cgt>Tgt	p.R1598C		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	777							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GCAGACGGGGCGTGAACCCCC	0.617																																					p.R1598C													.	.			0			c.C4792T												18.0	21.0	20.0					19																	50117808		2015	4126	6141	SO:0001583	missense	57479	exon7			ACGGGGCGTGAAC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4792C>T	19.37:g.50117808C>T	ENSP00000394510:p.Arg1598Cys		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_020719	48	0.00	0	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334890	0.24253	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.12	4.12	0.48240	.	0.000000	0.42964	D	0.000640	T	0.66607	0.2806	L	0.46157	1.445	0.58432	D	0.999991	D	0.89917	1.0	D	0.85130	0.997	T	0.68644	-0.5354	9	0.87932	D	0	-13.9369	9.3298	0.38014	0.3405:0.6595:0.0:0.0	.	1598	Q9ULL5-3	.	C	1598;778;778	.	ENSP00000246798:R778C	R	+	1	0	PRR12	54809620	0.667000	0.27484	0.630000	0.29268	0.060000	0.15804	1.331000	0.33793	2.147000	0.66899	0.467000	0.42956	CGT			0.617	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465915.1		NM_020719	
MBOAT7	79143	broad.mit.edu	37	19	54682579	54682579	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr19:54682579G>A	ENST00000245615.1	-	7	1414	c.934C>T	c.(934-936)Cgg>Tgg	p.R312W	MBOAT7_ENST00000338624.6_Missense_Mutation_p.R239W|MBOAT7_ENST00000391754.1_Missense_Mutation_p.R312W|MBOAT7_ENST00000431666.2_Missense_Mutation_p.R239W	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	312					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TCGCGCACCCGCACGCAGAAA	0.592																																					p.R312W	NSCLC(97;826 2151 10470 22540)												.	MBOAT7	37		0			c.C934T												85.0	64.0	71.0					19																	54682579		2203	4300	6503	SO:0001583	missense	79143	exon7			GCACCCGCACGCA	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.934C>T	19.37:g.54682579G>A	ENSP00000245615:p.Arg312Trp		Somatic	160	0.00625	1		WXS	Illumina HiSeq	Phase_I	164	0.02	4	NM_001146082	99	0.00	0	A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Missense_Mutation	SNP	ENST00000245615.1	37	CCDS12883.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901211	0.72754	.	.	ENSG00000125505	ENST00000431666;ENST00000338624;ENST00000245615;ENST00000391754	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	4.64	3.58	0.41010	.	0.153481	0.42548	U	0.000694	T	0.72407	0.3456	L	0.44542	1.39	0.36791	D	0.884843	D;D;D	0.69078	0.964;0.997;0.964	P;P;B	0.50708	0.536;0.648;0.373	T	0.78237	-0.2282	10	0.66056	D	0.02	-16.4567	11.0519	0.47894	0.0:0.0:0.5392:0.4608	.	294;239;312	B4DDH8;Q96N66-2;Q96N66	.;.;MBOA7_HUMAN	W	239;239;312;312	ENSP00000410503:R239W;ENSP00000344377:R239W;ENSP00000245615:R312W;ENSP00000375634:R312W	ENSP00000245615:R312W	R	-	1	2	MBOAT7	59374391	1.000000	0.71417	0.919000	0.36401	0.851000	0.48451	4.041000	0.57339	1.064000	0.40671	0.586000	0.80456	CGG			0.592	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000142203.1		NM_024298	
ZNF579	163033	mdanderson.org	37	19	56090220	56090220	+	Silent	SNP	C	C	G			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr19:56090220C>G	ENST00000325421.4	-	2	814	c.786G>C	c.(784-786)ggG>ggC	p.G262G	CTD-2537I9.5_ENST00000589396.1_lincRNA	NM_152600.2	NP_689813.2	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		GTGGCGGGGGCCCCCCTTCCC	0.716																																					p.G262G													.	.			0			c.G786C												16.0	20.0	19.0					19																	56090220		2198	4295	6493	SO:0001819	synonymous_variant	163033	exon2			CGGGGGCCCCCCT	AK092772	CCDS12927.1	19q13.42	2013-09-20			ENSG00000218891	ENSG00000218891		"""Zinc fingers, C2H2-type"""	26646	protein-coding gene	gene with protein product							Standard	NM_152600		Approved	FLJ35453	uc002qlh.3	Q8NAF0	OTTHUMG00000180857	ENST00000325421.4:c.786G>C	19.37:g.56090220C>G			Somatic	91	0.043956044	4		WXS	Illumina HiSeq	Phase_I	112	0.17	19	NM_152600	12	0.00	0		Silent	SNP	ENST00000325421.4	37	CCDS12927.1																																																																																					0.716	ZNF579-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453348.1		NM_152600	
EPCAM	4072	broad.mit.edu	37	2	47596282	47596282	+	5'Flank	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr2:47596282G>T	ENST00000263735.4	+	0	0				EPCAM_ENST00000405271.1_Missense_Mutation_p.R23L	NM_002354.2	NP_002345.2	P16422	EPCAM_HUMAN	epithelial cell adhesion molecule						negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|stem cell differentiation (GO:0048863)|ureteric bud development (GO:0001657)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein complex binding (GO:0032403)	p.0?(2)|p.?(1)		endometrium(3)|large_intestine(1)|liver(2)|lung(7)|skin(1)|stomach(1)	15						AGAGGGCCGCGCCCCAACTGC	0.721																																					.													.	EPCAM	27		3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	.																																									SO:0001631	upstream_gene_variant	4072	.			GGCCGCGCCCCAA	M33011	CCDS1833.1	2p21	2014-09-17	2008-12-16	2008-12-16	ENSG00000119888	ENSG00000119888		"""CD molecules"""	11529	protein-coding gene	gene with protein product		185535	"""antigen identified by monoclonal antibody AUA1"", ""tumor-associated calcium signal transducer 1"""	M4S1, MIC18, TACSTD1		8382772, 11306819	Standard	NM_002354		Approved	Ly74, TROP1, GA733-2, EGP34, EGP40, EGP-2, KSA, CD326, Ep-CAM, HEA125, KS1/4, MK-1, MH99, MOC31, 323/A3, 17-1A, TACST-1, CO-17A, ESA	uc002rvx.3	P16422	OTTHUMG00000128853		2.37:g.47596282G>T	Exception_encountered		Somatic	27	0.0740740741	2		WXS	Illumina HiSeq	Phase_I	21	0.24	5	.	2	0.00	0	P18180|Q6FG26|Q6FG49|Q96C47|Q9UCD0	Missense_Mutation	SNP	ENST00000263735.4	37	CCDS1833.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308973	0.40895	.	.	ENSG00000119888	ENST00000405271	T	0.73047	-0.71	3.84	-2.52	0.06346	.	.	.	.	.	T	0.52289	0.1725	.	.	.	0.09310	N	0.999994	B	0.15141	0.012	B	0.12837	0.008	T	0.27872	-1.0061	8	0.27785	T	0.31	.	8.8599	0.35251	0.717:0.0:0.283:0.0	.	23	B5MCA4	.	L	23	ENSP00000385476:R23L	ENSP00000385476:R23L	R	+	2	0	EPCAM	47449786	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.572000	0.05881	-0.966000	0.03587	-0.199000	0.12753	CGC			0.721	EPCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250792.2			
STAMBP	10617	broad.mit.edu	37	2	74077544	74077544	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr2:74077544G>T	ENST00000394070.2	+	7	1412	c.909G>T	c.(907-909)aaG>aaT	p.K303N	STAMBP_ENST00000394073.1_Missense_Mutation_p.K303N|STAMBP_ENST00000409707.1_Missense_Mutation_p.K303N|STAMBP_ENST00000486458.1_3'UTR|STAMBP_ENST00000339566.3_Missense_Mutation_p.K303N	NM_213622.2	NP_998787.1	O95630	STABP_HUMAN	STAM binding protein	303	MPN.				JAK-STAT cascade (GO:0007259)|mitotic cytokinesis (GO:0000281)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of cell proliferation (GO:0008284)|protein deubiquitination (GO:0016579)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	18						TCATCCCCAAGCAAAGTGCTG	0.478																																					p.K303N													.	STAMBP	37		0			c.G909T												151.0	134.0	140.0					2																	74077544		2203	4300	6503	SO:0001583	missense	10617	exon8			CCCCAAGCAAAGT	BC007682	CCDS1929.1	2p24.3-p24.1	2008-02-05			ENSG00000124356	ENSG00000124356			16950	protein-coding gene	gene with protein product		606247				10383417	Standard	NM_006463		Approved	AMSH	uc002sjs.3	O95630	OTTHUMG00000129817	ENST00000394070.2:c.909G>T	2.37:g.74077544G>T	ENSP00000377633:p.Lys303Asn		Somatic	283	0	0		WXS	Illumina HiSeq	Phase_I	320	0.02	5	NM_006463	52	0.00	0	B5M0B6|D6W5H7|Q3MJE7	Missense_Mutation	SNP	ENST00000394070.2	37	CCDS1929.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141675	0.77775	.	.	ENSG00000124356	ENST00000339566;ENST00000539933;ENST00000409707;ENST00000432295;ENST00000394073;ENST00000394070	T;T;T;T;T	0.63255	0.53;0.53;-0.03;0.53;0.53	4.66	3.77	0.43336	.	0.051098	0.85682	D	0.000000	T	0.79131	0.4394	M	0.91140	3.18	0.58432	D	0.999999	D	0.59357	0.985	D	0.64506	0.926	T	0.80612	-0.1305	10	0.72032	D	0.01	-1.8925	7.62	0.28179	0.1989:0.0:0.8011:0.0	.	303	O95630	STABP_HUMAN	N	303	ENSP00000344742:K303N;ENSP00000386548:K303N;ENSP00000413874:K303N;ENSP00000377636:K303N;ENSP00000377633:K303N	ENSP00000344742:K303N	K	+	3	2	STAMBP	73931052	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.961000	0.56759	1.166000	0.42689	0.563000	0.77884	AAG			0.478	STAMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252048.2		NM_006463	
ANKRD36BP2	645784	broad.mit.edu	37	2	89102230	89102230	+	RNA	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr2:89102230G>T	ENST00000393525.3	+	0	2704									ankyrin repeat domain 36B pseudogene 2																		ATAACATCAGGTAGCTGTGAG	0.318																																					.													.	.			0			.																																											0	.			CATCAGGTAGCTG			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89102230G>T			Somatic	40	0.025	1		WXS	Illumina HiSeq	Phase_I	49	0.08	4	.	0		0		RNA	SNP	ENST00000393525.3	37																																																																																						0.318	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
MZT2B	80097	broad.mit.edu	37	2	130948058	130948058	+	Silent	SNP	C	C	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr2:130948058C>T	ENST00000281871.6	+	3	691	c.336C>T	c.(334-336)agC>agT	p.S112S	MZT2B_ENST00000409255.1_Silent_p.S172S	NM_025029.3	NP_079305.2	Q6NZ67	MZT2B_HUMAN	mitotic spindle organizing protein 2B	112						centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				lung(1)	1						ACAAAGGCAGCGCTGCCCTCG	0.627																																					p.S112S													MZT2B,caecum,carcinoma,0,1	MZT2B	5	1	0			c.C336T												30.0	29.0	30.0					2																	130948058		2201	4300	6501	SO:0001819	synonymous_variant	80097	exon3			AGGCAGCGCTGCC	BC066296	CCDS2157.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000152082	ENSG00000152082			25886	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2B"""	613450	"""family with sequence similarity 128, member B"""	FAM128B		20360068	Standard	NM_025029		Approved	FLJ14346, MOZART2B	uc002tqu.3	Q6NZ67	OTTHUMG00000131625	ENST00000281871.6:c.336C>T	2.37:g.130948058C>T			Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	155	0.03	4	NM_025029	462	0.00	1	Q96CG4	Silent	SNP	ENST00000281871.6	37	CCDS2157.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.120|0.120	-1.126970|-1.126970	0.01770|0.01770	.|.	.|.	ENSG00000152082|ENSG00000152082	ENST00000425361|ENST00000455239	.|.	.|.	.|.	3.47|3.47	0.573|0.573	0.17363|0.17363	.|.	.|.	.|.	.|.	.|.	T|T	0.36908|0.36908	0.0984|0.0984	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999993|0.999993	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.31280|0.31280	-0.9949|-0.9949	4|5	.|0.48119	.|T	.|0.1	-5.8906|-5.8906	6.3318|6.3318	0.21274|0.21274	0.0:0.5373:0.0:0.4627|0.0:0.5373:0.0:0.4627	.|.	.|.	.|.	.|.	V|C	76|53	.|.	.|ENSP00000404629:R53C	A|R	+|+	2|1	0|0	MZT2B|MZT2B	130664528|130664528	0.000000|0.000000	0.05858|0.05858	0.071000|0.071000	0.20095|0.20095	0.062000|0.062000	0.15995|0.15995	-0.131000|-0.131000	0.10482|0.10482	-0.004000|-0.004000	0.14419|0.14419	-0.372000|-0.372000	0.07161|0.07161	GCG|CGC			0.627	MZT2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000254518.1		NM_025029	
DES	1674	broad.mit.edu	37	2	220286080	220286080	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr2:220286080C>A	ENST00000373960.3	+	6	1128	c.1042C>A	c.(1042-1044)Cag>Aag	p.Q348K		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	348	Coil 2B.|Rod.				cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCTGATGAGGCAGATGCGGGA	0.572																																					p.Q348K													.	DES	53		0			c.C1042A												55.0	57.0	57.0					2																	220286080		2203	4300	6503	SO:0001583	missense	1674	exon6			ATGAGGCAGATGC	AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	ENST00000373960.3:c.1042C>A	2.37:g.220286080C>A	ENSP00000363071:p.Gln348Lys		Somatic	97	0.0103092784	1		WXS	Illumina HiSeq	Phase_I	130	0.05	7	NM_001927	8	0.00	0	Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Missense_Mutation	SNP	ENST00000373960.3	37	CCDS33383.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971291	0.92919	.	.	ENSG00000175084	ENST00000373960	D	0.88975	-2.45	5.24	5.24	0.73138	Filament (1);	0.000000	0.48286	D	0.000199	D	0.94716	0.8295	M	0.82716	2.605	0.53005	D	0.999964	D	0.63880	0.993	D	0.69479	0.964	D	0.94930	0.8081	10	0.66056	D	0.02	.	18.6284	0.91350	0.0:1.0:0.0:0.0	.	348	P17661	DESM_HUMAN	K	348	ENSP00000363071:Q348K	ENSP00000363071:Q348K	Q	+	1	0	DES	219994324	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.403000	0.79983	2.706000	0.92434	0.655000	0.94253	CAG			0.572	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130240.1		NM_001927	
BAGE2	85319	broad.mit.edu	37	21	11071942	11071942	+	RNA	DEL	G	G	-	rs138066060	byFrequency	TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr21:11071942delG	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		acatacacctgggagtagtaa	0.423													|||unknown(ALL_OTHER_Ns)	2396	0.478435	0.4576	0.4841	5008	,	,		62603	0.4752		0.497	False		,,,				2504	0.4867				.													.	.			0			.																																											85319	.			ACACCTGGGAGTA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11071942delG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	11	0.55	6	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.423	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
GATSL3	652968	mdanderson.org	37	22	30682339	30682339	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr22:30682339C>A	ENST00000407689.3	-	6	785	c.656G>T	c.(655-657)aGt>aTt	p.S219I	GATSL3_ENST00000459785.1_Intron|GATSL3_ENST00000404953.3_Intron|RP1-130H16.18_ENST00000447976.1_3'UTR	NM_001037666.2	NP_001032755.1	Q8WTX7	GATL3_HUMAN	GATS protein-like 3	219										breast(1)|endometrium(1)|lung(1)	3						GGGTTCAGGACTGCTAGAGGC	0.572																																					p.S219I													.	.			0			c.G656T												76.0	91.0	86.0					22																	30682339		2083	4218	6301	SO:0001583	missense	652968	exon6			TCAGGACTGCTAG		CCDS43001.1	22q12	2010-06-23			ENSG00000239282	ENSG00000239282			34423	protein-coding gene	gene with protein product							Standard	NM_001037666		Approved			Q8WTX7	OTTHUMG00000150929	ENST00000407689.3:c.656G>T	22.37:g.30682339C>A	ENSP00000384183:p.Ser219Ile		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001037666	41	0.00	0	O76052|Q96ND9|Q9UIE8	Missense_Mutation	SNP	ENST00000407689.3	37	CCDS43001.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.201251	0.38905	.	.	ENSG00000239282	ENST00000407689	.	.	.	5.06	1.15	0.20763	.	1.158660	0.06306	N	0.701843	T	0.29817	0.0745	L	0.34521	1.04	0.09310	N	1	B	0.28512	0.214	B	0.22386	0.039	T	0.26087	-1.0113	9	0.45353	T	0.12	-9.2258	5.1079	0.14794	0.0:0.4418:0.308:0.2502	.	219	Q8WTX7	GATL3_HUMAN	I	219	.	ENSP00000384183:S219I	S	-	2	0	GATSL3	29012339	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	0.511000	0.22739	0.416000	0.25844	0.563000	0.77884	AGT			0.572	GATSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320581.2		NM_001037666	
MTFP1	51537	mdanderson.org	37	22	30821931	30821931	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr22:30821931C>A	ENST00000266263.5	+	1	414	c.64C>A	c.(64-66)Ctg>Atg	p.L22M	MTFP1_ENST00000355143.4_Missense_Mutation_p.L22M|RP4-539M6.19_ENST00000439838.1_Intron|MTFP1_ENST00000407550.3_Missense_Mutation_p.L22M	NM_016498.4	NP_057582.2	Q9UDX5	MTFP1_HUMAN	mitochondrial fission process 1	22					apoptotic process (GO:0006915)|mitochondrial fission (GO:0000266)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|large_intestine(1)|lung(2)	4						GGTGCGATACCTGGGTGAGCG	0.746											OREG0026460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L22M													.	.			0			c.C64A												7.0	13.0	11.0					22																	30821931		1640	3009	4649	SO:0001583	missense	51537	exon1			CGATACCTGGGTG	AF151076	CCDS33634.1, CCDS33635.1	22q	2010-09-02			ENSG00000242114	ENSG00000242114			26945	protein-coding gene	gene with protein product		610235				15155745, 15985469	Standard	NM_016498		Approved	MTP18, HSPC242		Q9UDX5	OTTHUMG00000151057	ENST00000266263.5:c.64C>A	22.37:g.30821931C>A	ENSP00000266263:p.Leu22Met		Somatic	32	0	0	820	WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_016498	52	0.00	0	A6NFQ5|Q9H3K1|Q9P0N6	Missense_Mutation	SNP	ENST00000266263.5	37	CCDS33635.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066417	0.76187	.	.	ENSG00000242114	ENST00000266263;ENST00000355143;ENST00000407550	.	.	.	3.85	2.83	0.33086	.	0.000000	0.56097	U	0.000034	T	0.65207	0.2669	L	0.46947	1.48	0.80722	D	1	D;P	0.89917	1.0;0.891	D;P	0.91635	0.999;0.852	T	0.60347	-0.7281	9	0.30854	T	0.27	-1.7492	10.1048	0.42526	0.0:0.8984:0.0:0.1015	.	22;22	Q9UDX5-2;Q9UDX5	.;MTFP1_HUMAN	M	22	.	ENSP00000266263:L22M	L	+	1	2	MTFP1	29151931	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.809000	0.38922	0.824000	0.34613	0.453000	0.30009	CTG			0.746	MTFP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321126.3		NM_016498	
ZNF621	285268	mdanderson.org	37	3	40573808	40573808	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr3:40573808G>T	ENST00000339296.5	+	5	999	c.547G>T	c.(547-549)Gag>Tag	p.E183*	ZNF621_ENST00000403205.2_Nonsense_Mutation_p.E183*|ZNF621_ENST00000490457.1_Intron|ZNF621_ENST00000431278.1_Nonsense_Mutation_p.E72*|ZNF621_ENST00000310898.1_Intron	NM_198484.3	NP_940886.1	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E183Q(2)		endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		TAAGTGTAAGGAGTGTGGCAA	0.403																																					p.E183X													ZNF621,NS,carcinoma,0,1	ZNF621	0	1	2	Substitution - Missense(2)	lung(2)	c.G547T												94.0	89.0	91.0					3																	40573808		2203	4300	6503	SO:0001587	stop_gained	285268	exon5			TGTAAGGAGTGTG	AK127181	CCDS2693.1, CCDS74920.1	3p21.33	2013-01-08			ENSG00000172888	ENSG00000172888		"""Zinc fingers, C2H2-type"", ""-"""	24787	protein-coding gene	gene with protein product							Standard	XM_005265079		Approved	FLJ45246	uc003ckm.2	Q6ZSS3	OTTHUMG00000131389	ENST00000339296.5:c.547G>T	3.37:g.40573808G>T	ENSP00000340841:p.Glu183*		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_001098414	5	0.00	0	Q14DC7|Q8TE91	Nonsense_Mutation	SNP	ENST00000339296.5	37	CCDS2693.1	.	.	.	.	.	.	.	.	.	.	g	37	6.413092	0.97546	.	.	ENSG00000172888	ENST00000403205;ENST00000339296;ENST00000431278	.	.	.	4.07	3.16	0.36331	.	0.168842	0.28312	N	0.015816	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	11.846	0.52385	0.0:0.1789:0.821:0.0	.	.	.	.	X	183;183;72	.	ENSP00000340841:E183X	E	+	1	0	ZNF621	40548812	0.000000	0.05858	0.999000	0.59377	0.708000	0.40852	0.197000	0.17197	1.258000	0.44101	0.655000	0.94253	GAG			0.403	ZNF621-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254178.2		NM_198484	
GLYCTK	132158	mdanderson.org	37	3	52325040	52325040	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr3:52325040G>T	ENST00000436784.2	+	3	502	c.442G>T	c.(442-444)Gac>Tac	p.D148Y	GLYCTK_ENST00000473032.1_Missense_Mutation_p.D148Y|GLYCTK_ENST00000477382.1_Missense_Mutation_p.D148Y|GLYCTK_ENST00000461183.1_Missense_Mutation_p.D64Y|GLYCTK_ENST00000305690.8_Missense_Mutation_p.D148Y|GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000471180.1_Missense_Mutation_p.D21Y|GLYCTK_ENST00000354773.4_Missense_Mutation_p.D148Y			Q8IVS8	GLCTK_HUMAN	glycerate kinase	148					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		CAACCTCCCGGACCGCGATGC	0.617																																					p.D148Y													.	.			0			c.G442T												99.0	79.0	86.0					3																	52325040		2203	4300	6503	SO:0001583	missense	132158	exon3			CTCCCGGACCGCG		CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.442G>T	3.37:g.52325040G>T	ENSP00000389175:p.Asp148Tyr		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_145262	31	0.00	0	Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	ENST00000436784.2	37	CCDS2852.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606828	0.66558	.	.	ENSG00000168237	ENST00000461183;ENST00000473032;ENST00000305690;ENST00000354773;ENST00000471180;ENST00000436784;ENST00000477382	T;T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39;0.39	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.82332	0.5014	H	0.95950	3.745	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.88123	0.2833	10	0.87932	D	0	-28.1859	19.1152	0.93336	0.0:0.0:1.0:0.0	.	148;148;148	Q8IVS8-2;Q8IVS8-4;Q8IVS8	.;.;GLCTK_HUMAN	Y	64;148;148;148;21;148;148	ENSP00000417264:D64Y;ENSP00000418951:D148Y;ENSP00000301965:D148Y;ENSP00000346825:D148Y;ENSP00000417526:D21Y;ENSP00000389175:D148Y;ENSP00000419008:D148Y	ENSP00000301965:D148Y	D	+	1	0	GLYCTK	52300080	1.000000	0.71417	0.533000	0.28001	0.309000	0.27889	9.172000	0.94808	2.503000	0.84419	0.655000	0.94253	GAC			0.617	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350835.1		NM_145262	
CCDC37	348807	broad.mit.edu	37	3	126135309	126135309	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr3:126135309G>T	ENST00000352312.1	+	5	475	c.376G>T	c.(376-378)Gcc>Tcc	p.A126S	CCDC37_ENST00000505024.1_Missense_Mutation_p.A126S|CCDC37_ENST00000393425.1_Missense_Mutation_p.A126S	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	126										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		GCATCAGCGCGCCTTCCGCGA	0.687																																					p.A126S													.	CCDC37	69		0			c.G376T												17.0	17.0	17.0					3																	126135309		2198	4292	6490	SO:0001583	missense	348807	exon5			CAGCGCGCCTTCC	AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.376G>T	3.37:g.126135309G>T	ENSP00000344749:p.Ala126Ser		Somatic	63	0.0158730159	1		WXS	Illumina HiSeq	Phase_I	91	0.07	6	NM_182628	0		0	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	ENST00000352312.1	37	CCDS3037.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.641105	0.29157	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.33216	1.49;1.42;1.42	4.59	0.454	0.16644	.	0.796770	0.11394	N	0.568519	T	0.15219	0.0367	N	0.19112	0.55	0.09310	N	1	B;B	0.16802	0.019;0.011	B;B	0.19148	0.024;0.011	T	0.33727	-0.9857	10	0.16420	T	0.52	-1.1007	3.7306	0.08491	0.3092:0.0:0.5231:0.1677	.	126;126	Q494V2-2;Q494V2	.;CCD37_HUMAN	S	126	ENSP00000344749:A126S;ENSP00000377076:A126S;ENSP00000423046:A126S	ENSP00000344749:A126S	A	+	1	0	CCDC37	127617999	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.134000	0.10436	-0.255000	0.09486	0.491000	0.48974	GCC			0.687	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000370099.4		NM_182628	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	55594221	55594221	+	Missense_Mutation	SNP	A	A	G	rs121913512		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr4:55594221A>G	ENST00000288135.5	+	13	2021	c.1924A>G	c.(1924-1926)Aaa>Gaa	p.K642E		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	642	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.K642E(25)|p.K642Q(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTCTGAACTCAAAGTCCTGAG	0.438		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.K642E			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,0,38	KIT	0	38	26	Substitution - Missense(26)	soft_tissue(14)|skin(12)	c.A1924G	GRCh37	CM002803	KIT	M	rs121913512							127.0	116.0	119.0					4																	55594221		2203	4300	6503	SO:0001583	missense	3815	exon13	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GAACTCAAAGTCC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1924A>G	4.37:g.55594221A>G	ENSP00000288135:p.Lys642Glu		Somatic	164	0	0		WXS	Illumina HiSeq	.	160	0.05	8	NM_000222	29	0.45	13	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.033413	0.93575	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82893	-1.66;-1.66	6.06	6.06	0.98353	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	D	0.85978	0.5823	N	0.25060	0.705	0.80722	A	1	D;D;D	0.89917	0.984;1.0;1.0	P;D;D	0.97110	0.848;1.0;0.999	D	0.88226	0.2900	9	0.87932	D	0	.	16.6093	0.84858	1.0:0.0:0.0:0.0	.	149;638;642	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	E	642;638	ENSP00000288135:K642E;ENSP00000390987:K638E	ENSP00000288135:K642E	K	+	1	0	KIT	55288978	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.248000	0.95456	2.324000	0.78689	0.533000	0.62120	AAA			0.438	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
UGT2B11	10720	mdanderson.org	37	4	70066408	70066408	+	Missense_Mutation	SNP	C	C	A	rs200919649		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr4:70066408C>A	ENST00000446444.1	-	6	1348	c.1340G>T	c.(1339-1341)aGa>aTa	p.R447I	RP11-704M14.1_ENST00000504301.1_RNA|RP11-704M14.1_ENST00000505646.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	447					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						ATGTTGAATTCTTGATAATTT	0.373																																					p.R447I													.	.			0			c.G1340T												66.0	71.0	69.0					4																	70066408		2203	4298	6501	SO:0001583	missense	10720	exon6			TGAATTCTTGATA	AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.1340G>T	4.37:g.70066408C>A	ENSP00000387683:p.Arg447Ile		Somatic	104	0.0096153846	1		WXS	Illumina HiSeq	Phase_I	91	0.08	7	NM_001073	0		0	Q3KNV9	Missense_Mutation	SNP	ENST00000446444.1	37	CCDS3527.1	.	.	.	.	.	.	.	.	.	.	-	4.019	0.000882	0.07819	.	.	ENSG00000213759	ENST00000446444	T	0.62788	0.0	1.27	0.283	0.15696	.	0.310296	0.24102	U	0.041536	T	0.51787	0.1695	L	0.50993	1.605	0.30965	N	0.723211	B	0.20780	0.048	B	0.25987	0.065	T	0.53351	-0.8451	10	0.72032	D	0.01	.	7.0366	0.24996	0.0:0.7131:0.2869:0.0	.	447	O75310	UDB11_HUMAN	I	447	ENSP00000387683:R447I	ENSP00000387683:R447I	R	-	2	0	UGT2B11	70100997	0.000000	0.05858	0.541000	0.28102	0.201000	0.24016	-0.075000	0.11431	0.079000	0.16929	0.184000	0.17185	AGA			0.373	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251551.2		NM_001073	
F11-AS1	285441	bcgsc.ca	37	4	187250120	187250120	+	RNA	SNP	C	C	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr4:187250120C>A	ENST00000505103.1	-	0	153					NR_033900.1				F11 antisense RNA 1																		CGCGATCATACGGCTGATGAC	0.522																																					.													.	.			0			.																																											644042	.			ATCATACGGCTGA	BC038717		4q35.2	2013-09-17			ENSG00000251165	ENSG00000251165		"""Long non-coding RNAs"""	27725	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_033900		Approved				OTTHUMG00000160319		4.37:g.187250120C>A			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_1	39	0.10	4	.	0		0		RNA	SNP	ENST00000505103.1	37																																																																																						0.522	F11-AS1-004	KNOWN	basic	antisense	antisense		OTTHUMT00000360442.1			
TRIP13	9319	mdanderson.org	37	5	908524	908524	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr5:908524G>T	ENST00000166345.3	+	9	1170	c.814G>T	c.(814-816)Gat>Tat	p.D272Y		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	272					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			CGAGCCATCAGATGCCATCCG	0.542																																					p.D272Y													.	.			0			c.G814T												78.0	79.0	79.0					5																	908524		2203	4300	6503	SO:0001583	missense	9319	exon9			CCATCAGATGCCA	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.814G>T	5.37:g.908524G>T	ENSP00000166345:p.Asp272Tyr		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001166260	8	0.00	0	C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	ENST00000166345.3	37	CCDS3858.1	.	.	.	.	.	.	.	.	.	.	.	19.96	3.924294	0.73213	.	.	ENSG00000071539	ENST00000166345	D	0.93307	-3.2	5.95	5.95	0.96441	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97964	0.9330	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98429	1.0581	10	0.87932	D	0	-8.6372	19.9739	0.97296	0.0:0.0:1.0:0.0	.	272	Q15645	PCH2_HUMAN	Y	272	ENSP00000166345:D272Y	ENSP00000166345:D272Y	D	+	1	0	TRIP13	961524	1.000000	0.71417	0.702000	0.30337	0.335000	0.28730	9.140000	0.94607	2.826000	0.97356	0.563000	0.77884	GAT			0.542	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206721.2		NM_004237	
NEUROG1	4762	mdanderson.org	37	5	134871333	134871333	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr5:134871333G>T	ENST00000314744.4	-	1	306	c.48C>A	c.(46-48)agC>agA	p.S16R		NM_006161.2	NP_006152.2	Q92886	NGN1_HUMAN	neurogenin 1	16					cell fate commitment (GO:0045165)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perikaryon (GO:0043204)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			endometrium(1)|liver(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGCCGCTGCTGCTGGCGCAGT	0.672																																					p.S16R													.	.			0			c.C48A												24.0	22.0	22.0					5																	134871333		1994	4005	5999	SO:0001583	missense	4762	exon1			GCTGCTGCTGGCG	U63842	CCDS4187.1	5q23-q31	2013-05-21			ENSG00000181965	ENSG00000181965		"""Basic helix-loop-helix proteins"""	7764	protein-coding gene	gene with protein product	"""neurogenic differentiation 3"""	601726		NEUROD3		9119405	Standard	NM_006161		Approved	AKA, Math4C, ngn1, bHLHa6	uc003lax.3	Q92886	OTTHUMG00000129138	ENST00000314744.4:c.48C>A	5.37:g.134871333G>T	ENSP00000317580:p.Ser16Arg		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_006161	0		0	Q5U0Q9|Q96HE1	Missense_Mutation	SNP	ENST00000314744.4	37	CCDS4187.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.678266	0.29783	.	.	ENSG00000181965	ENST00000314744	D	0.96136	-3.92	4.32	2.39	0.29439	.	0.374279	0.19629	N	0.109727	D	0.87038	0.6078	N	0.19112	0.55	0.29366	N	0.864367	P	0.38195	0.622	B	0.28709	0.093	D	0.83643	0.0151	10	0.62326	D	0.03	-1.0911	5.7214	0.17988	0.1844:0.1617:0.6539:0.0	.	16	Q92886	NGN1_HUMAN	R	16	ENSP00000317580:S16R	ENSP00000317580:S16R	S	-	3	2	NEUROG1	134899232	0.994000	0.37717	0.998000	0.56505	0.939000	0.58152	2.091000	0.41691	1.013000	0.39391	0.561000	0.74099	AGC			0.672	NEUROG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251192.1		NM_006161	
SLC4A9	83697	mdanderson.org	37	5	139747091	139747091	+	Silent	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr5:139747091G>T	ENST00000230993.6	+	15	2207	c.2172G>T	c.(2170-2172)ctG>ctT	p.L724L	SLC4A9_ENST00000506545.1_Silent_p.L637L|SLC4A9_ENST00000432095.2_Silent_p.L686L|SLC4A9_ENST00000506757.2_Silent_p.L700L|SLC4A9_ENST00000507527.1_Silent_p.L724L	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	724	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCTGCCCTGCTGCTGTCTA	0.597																																					p.L724L													.	.			0			c.G2172T												31.0	34.0	33.0					5																	139747091		2106	4242	6348	SO:0001819	synonymous_variant	83697	exon15			TGCCCTGCTGCTG	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.2172G>T	5.37:g.139747091G>T			Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_001258428	0		0	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Silent	SNP	ENST00000230993.6	37	CCDS58973.1																																																																																					0.597	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000372823.1		NM_031467	
SIMC1	375484	mdanderson.org	37	5	175665527	175665527	+	5'UTR	SNP	G	G	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr5:175665527G>A	ENST00000443967.1	+	0	158				SIMC1_ENST00000430704.2_Missense_Mutation_p.V6M|SIMC1_ENST00000341199.6_Missense_Mutation_p.V6M|SIMC1_ENST00000429602.2_Missense_Mutation_p.V6M			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1								SUMO polymer binding (GO:0032184)										GGATTTCATCGTGATCTCGGA	0.756																																					p.V6M													.	.			0			c.G16A												2.0	2.0	2.0					5																	175665527		479	1202	1681	SO:0001623	5_prime_UTR_variant	375484	exon1			TTCATCGTGATCT	BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.-250G>A	5.37:g.175665527G>A			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_198567	0		0	J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	ENST00000443967.1	37		.	.	.	.	.	.	.	.	.	.	N	13.61	2.287103	0.40494	.	.	ENSG00000170085	ENST00000341199;ENST00000430704;ENST00000429602	T;T;T	0.38560	1.6;1.6;1.13	1.99	1.99	0.26369	.	.	.	.	.	T	0.45796	0.1360	N	0.24115	0.695	0.23855	N	0.996656	D;D	0.76494	0.999;0.997	D;D	0.81914	0.995;0.938	T	0.18967	-1.0320	9	0.87932	D	0	.	7.4915	0.27464	0.0:0.0:1.0:0.0	.	6;6	B4DRM7;Q8NDZ2-3	.;.	M	6	ENSP00000342075:V6M;ENSP00000409287:V6M;ENSP00000410552:V6M	ENSP00000342075:V6M	V	+	1	0	C5orf25	175598133	1.000000	0.71417	1.000000	0.80357	0.084000	0.17831	2.735000	0.47377	1.423000	0.47198	0.197000	0.17608	GTG			0.756	SIMC1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000253155.2		NM_198567	
MDC1	9656	broad.mit.edu	37	6	30681594	30681594	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr6:30681594G>T	ENST00000376406.3	-	3	1150	c.503C>A	c.(502-504)tCg>tAg	p.S168*	MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Nonsense_Mutation_p.S168*|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	168	Interaction with the MRN complex.|Required for nuclear localization (NLS1).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TTCCTCCTCCGAGTCCTCAGC	0.493								Other conserved DNA damage response genes																													p.S168X													.	MDC1	218		0			c.C503A												83.0	100.0	94.0					6																	30681594		1510	2709	4219	SO:0001587	stop_gained	9656	exon3			TCCTCCGAGTCCT	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.503C>A	6.37:g.30681594G>T	ENSP00000365588:p.Ser168*		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	129	0.04	5	NM_014641	3	0.00	0	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Nonsense_Mutation	SNP	ENST00000376406.3	37	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	G	38	7.283200	0.98186	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104;ENST00000435797;ENST00000452213	.	.	.	5.68	5.68	0.88126	.	0.000000	0.32106	N	0.006571	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9214	15.285	0.73822	0.0:0.0:1.0:0.0	.	.	.	.	X	168;168;168;40;168;168	.	ENSP00000365587:S168X	S	-	2	0	MDC1	30789573	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	4.711000	0.61881	2.671000	0.90904	0.650000	0.86243	TCG			0.493	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000076103.1		NM_014641	
MUC21	394263	broad.mit.edu	37	6	30954534	30954534	+	Silent	SNP	T	T	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr6:30954534T>A	ENST00000376296.3	+	2	823	c.582T>A	c.(580-582)acT>acA	p.T194T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	194	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T194T(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GGGCCAGCACTGCCACCAACT	0.612																																					p.T194T													MUC21,NS,carcinoma,0,3	MUC21	98	3	1	Substitution - coding silent(1)	endometrium(1)	c.T582A												178.0	168.0	171.0					6																	30954534		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CAGCACTGCCACC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.582T>A	6.37:g.30954534T>A			Somatic	65	0.0153846154	1		WXS	Illumina HiSeq	Phase_I	63	0.06	4	NM_001010909	4	0.00	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																					0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
SKIV2L	6499	bcgsc.ca;mdanderson.org	37	6	31933780	31933780	+	Missense_Mutation	SNP	G	G	T	rs372669695		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr6:31933780G>T	ENST00000375394.2	+	18	2305	c.2192G>T	c.(2191-2193)cGc>cTc	p.R731L	SKIV2L_ENST00000544581.1_Missense_Mutation_p.R538L	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	731	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GACCTGCACCGCATGATGATG	0.627																																					p.R731L													.	SKIV2L	97		0			c.G2192T												18.0	16.0	17.0					6																	31933780		1506	2706	4212	SO:0001583	missense	6499	exon18			TGCACCGCATGAT		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.2192G>T	6.37:g.31933780G>T	ENSP00000364543:p.Arg731Leu		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_1	59	0.08	5	NM_006929	50	0.00	0	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474465	0.43942	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.50001	0.89;0.76	5.42	4.55	0.56014	Helicase, C-terminal (1);	0.427897	0.27092	N	0.020978	T	0.23886	0.0578	L	0.60904	1.88	0.31278	N	0.690937	P	0.43287	0.802	B	0.37451	0.25	T	0.08722	-1.0708	10	0.35671	T	0.21	-11.6895	9.4579	0.38767	0.1651:0.0:0.8349:0.0	.	731	Q15477	SKIV2_HUMAN	L	731;573;538	ENSP00000364543:R731L;ENSP00000442645:R538L	ENSP00000364543:R731L	R	+	2	0	SKIV2L	32041759	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.690000	0.37711	1.297000	0.44761	-0.136000	0.14681	CGC			0.627	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076264.3			
UNC93A	54346	ucsc.edu	37	6	167728900	167728901	+	Missense_Mutation	DNP	TC	TC	CG			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr6:167728900_167728901TC>CG	ENST00000230256.3	+	8	1509_1510	c.1334_1335TC>CG	c.(1333-1335)gTC>gCG	p.V445A	UNC93A_ENST00000366829.2_Missense_Mutation_p.V403A	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	445			V -> A. {ECO:0000269|PubMed:12381271}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V445A(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CCAGGACAGGTCAACCAGGCAG	0.525																																					p.V445A													UNC93A,ear,carcinoma,+1,2	UNC93A	66	2	1	Substitution - Missense(1)	skin(1)	c.C1335G																																									SO:0001583	missense	54346	exon8			GACAGGTCAACCA	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	Exception_encountered	6.37:g.167728900_167728901delinsCG	ENSP00000230256:p.Val445Ala		Somatic	58	0.1379310345	8		WXS	Illumina HiSeq		80	0.14	11	NM_018974	0		0	B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	DNP	ENST00000230256.3	37	CCDS5300.1																																																																																					0.525	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043125.2		NM_018974	
PKN3	29941	mdanderson.org	37	9	131467791	131467791	+	Silent	SNP	C	C	A			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr9:131467791C>A	ENST00000291906.4	+	2	627	c.234C>A	c.(232-234)atC>atA	p.I78I		NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	78					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						ACGCCCGAATCCTGCTGCCCG	0.701																																					p.I78I													.	.			0			c.C234A												4.0	4.0	4.0					9																	131467791		2064	4043	6107	SO:0001819	synonymous_variant	29941	exon2			CCGAATCCTGCTG	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.234C>A	9.37:g.131467791C>A			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_013355	1	0.00	0	Q9UM03	Silent	SNP	ENST00000291906.4	37	CCDS6908.1																																																																																					0.701	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054487.1		NM_013355	
EHMT1	79813	mdanderson.org	37	9	140707983	140707983	+	Splice_Site	SNP	G	G	T	rs137852724		TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chr9:140707983G>T	ENST00000460843.1	+	21	3207		c.e21+1			NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TCATCTGCAGGTGAGTGACGG	0.577																																					.													.	.			0			c.3180+1G>T												92.0	67.0	76.0					9																	140707983		2203	4300	6503	SO:0001630	splice_region_variant	79813	exon21			CTGCAGGTGAGTG	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3180+1G>T	9.37:g.140707983G>T			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_024757	0		0	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Splice_Site	SNP	ENST00000460843.1	37	CCDS7050.2	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681467	0.29872	.	.	ENSG00000181090	ENST00000371400;ENST00000460843	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.431	0.90625	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EHMT1	139827804	1.000000	0.71417	0.996000	0.52242	0.049000	0.14656	9.704000	0.98716	2.327000	0.79052	0.655000	0.94253	.			0.577	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055371.2		NM_024757	Intron
GATA1	2623	mdanderson.org	37	X	48651622	48651622	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chrX:48651622C>T	ENST00000376670.3	+	5	899	c.788C>T	c.(787-789)aCg>aTg	p.T263M	GATA1_ENST00000376665.3_Missense_Mutation_p.T263M	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	263					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						AACTGCCAGACGACCACCACG	0.592			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																p.T263M	Pancreas(9;429 505 11287 29617)			Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	.			0			c.C788T												168.0	112.0	131.0					X																	48651622		2203	4300	6503	SO:0001583	missense	2623	exon5			GCCAGACGACCAC	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.788C>T	X.37:g.48651622C>T	ENSP00000365858:p.Thr263Met		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_002049	0		0	Q96GB8	Missense_Mutation	SNP	ENST00000376670.3	37	CCDS14305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	21.6|21.6	4.168240|4.168240	0.78339|0.78339	.|.	.|.	ENSG00000102145|ENSG00000102145	ENST00000447551|ENST00000376670;ENST00000376665	.|D;D	.|0.99737	.|-6.59;-6.59	4.01|4.01	4.01|4.01	0.46588|0.46588	.|Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (4);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.99857	.|0.9933	H|H	0.99415|0.99415	4.555|4.555	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	.|D	.|0.96424	.|0.9314	.|10	.|0.87932	.|D	.|0	-8.6698|-8.6698	12.9188|12.9188	0.58220|0.58220	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|263	.|P15976	.|GATA1_HUMAN	X|M	28|263	.|ENSP00000365858:T263M;ENSP00000365853:T263M	.|ENSP00000365853:T263M	R|T	+|+	1|2	2|0	GATA1|GATA1	48536566|48536566	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	7.342000|7.342000	0.79310|0.79310	1.995000|1.995000	0.58328|0.58328	0.287000|0.287000	0.19450|0.19450	CGA|ACG			0.592	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056517.1		NM_002049	
TSPYL2	64061	broad.mit.edu	37	X	53112000	53112000	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chrX:53112000A>G	ENST00000375442.4	+	1	452	c.320A>G	c.(319-321)gAg>gGg	p.E107G		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	107					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						GGGTATGGGGAGGCGCCCCCG	0.622																																					p.E107G													.	TSPYL2	53		0			c.A320G												12.0	14.0	14.0					X																	53112000		2187	4269	6456	SO:0001583	missense	64061	exon1			ATGGGGAGGCGCC	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.320A>G	X.37:g.53112000A>G	ENSP00000364591:p.Glu107Gly		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	120	0.04	5	NM_022117	22	0.00	0	O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	ENST00000375442.4	37	CCDS14350.1	.	.	.	.	.	.	.	.	.	.	A	7.909	0.736140	0.15574	.	.	ENSG00000184205	ENST00000375442	T	0.29142	1.58	3.38	-0.801	0.10893	.	0.725545	0.11886	N	0.520051	T	0.27798	0.0684	M	0.65498	2.005	0.09310	N	0.999995	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.27839	-1.0062	10	0.48119	T	0.1	-22.7446	6.2452	0.20813	0.4954:0.0:0.5046:0.0	.	107;107	Q9H2G4;A8K8U7	TSYL2_HUMAN;.	G	107	ENSP00000364591:E107G	ENSP00000364591:E107G	E	+	2	0	TSPYL2	53128725	0.163000	0.22920	0.223000	0.23860	0.538000	0.34931	-0.037000	0.12164	-0.233000	0.09797	-0.528000	0.04320	GAG			0.622	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056718.1		NM_022117	
CDX4	1046	broad.mit.edu	37	X	72667531	72667531	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90S-01A-11D-A435-10	TCGA-YU-A90S-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	786db3db-1833-4d7f-8168-a9f029de4c19	d44ef07d-f21c-4327-893b-536b55976470	g.chrX:72667531T>C	ENST00000373514.2	+	1	442	c.442T>C	c.(442-444)Tcc>Ccc	p.S148P		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	148					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S148A(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					CAAGGCCAGTTCCCCCAGCAG	0.642																																					p.S148P													.	CDX4	52		1	Substitution - Missense(1)	lung(1)	c.T442C												24.0	23.0	23.0					X																	72667531		2148	4207	6355	SO:0001583	missense	1046	exon1			GCCAGTTCCCCCA	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.442T>C	X.37:g.72667531T>C	ENSP00000362613:p.Ser148Pro		Somatic	21	0.0952380952	2		WXS	Illumina HiSeq	Phase_I	29	0.17	5	NM_005193	0		0	A1A513|Q5JS20	Missense_Mutation	SNP	ENST00000373514.2	37	CCDS14424.1	.	.	.	.	.	.	.	.	.	.	.	16.79	3.221663	0.58560	.	.	ENSG00000131264	ENST00000373514	T	0.56444	0.46	2.32	2.32	0.28847	Caudal-like activation domain (1);	0.146256	0.47852	D	0.000213	T	0.69142	0.3078	M	0.82323	2.585	0.42892	D	0.994206	D	0.76494	0.999	D	0.85130	0.997	T	0.69957	-0.5004	10	0.51188	T	0.08	-5.7003	7.8501	0.29448	0.0:0.0:0.0:1.0	.	148	O14627	CDX4_HUMAN	P	148	ENSP00000362613:S148P	ENSP00000362613:S148P	S	+	1	0	CDX4	72584256	1.000000	0.71417	0.958000	0.39756	0.817000	0.46193	3.701000	0.54793	1.182000	0.42928	0.352000	0.21897	TCC			0.642	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057229.2		NM_005193	
