#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
DAB1	1600	mdanderson.org	37	1	57480875	57480875	+	Silent	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr1:57480875C>T	ENST00000371231.1	-	13	1258	c.1224G>A	c.(1222-1224)ttG>ttA	p.L408L	DAB1_ENST00000371236.2_Silent_p.L375L|DAB1_ENST00000371234.4_Silent_p.L375L|DAB1_ENST00000414851.2_Silent_p.L357L|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Silent_p.L289L|DAB1_ENST00000420954.2_Silent_p.L373L			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	408					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						TGGCAGCTGGCAAAGGCATAA	0.632																																					p.L375L													.	.			0			c.G1125A												86.0	73.0	77.0					1																	57480875		2203	4300	6503	SO:0001819	synonymous_variant	1600	exon14			AGCTGGCAAAGGC	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1224G>A	1.37:g.57480875C>T			Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_021080	1	0.00	0	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	37																																																																																						0.632	DAB1-010	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000027962.1		NM_021080	
RNPC3	55599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	104068861	104068861	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr1:104068861G>A	ENST00000533099.1	+	2	405	c.169G>A	c.(169-171)Gtc>Atc	p.V57I	RN7SKP285_ENST00000410137.1_RNA|RNPC3_ENST00000423855.2_Missense_Mutation_p.V57I|RP11-153F1.1_ENST00000444810.1_RNA|RP11-153F1.1_ENST00000447322.2_RNA|RNPC3_ENST00000524631.1_Missense_Mutation_p.V57I			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	57	Necessary for interaction with PDCD7.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		GTCTGTGCGGGTCCTGTCAGA	0.627																																					p.V57I													.	.			0			c.G169A												52.0	50.0	51.0					1																	104068861		692	1591	2283	SO:0001583	missense	55599	exon1			GTGCGGGTCCTGT	AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.169G>A	1.37:g.104068861G>A	ENSP00000432886:p.Val57Ile		Somatic	162	0	0		WXS	Illumina HiSeq	.	117	0.15	17	NM_017619	6	0.17	1	A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	ENST00000533099.1	37	CCDS781.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.943440	0.53079	.	.	ENSG00000185946	ENST00000524631;ENST00000531883;ENST00000533099;ENST00000423855	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	4.95	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.116998	0.56097	D	0.000026	T	0.11281	0.0275	L	0.39633	1.23	0.41843	D	0.990132	B;B	0.27853	0.191;0.055	B;B	0.39152	0.292;0.109	T	0.11991	-1.0565	10	0.25106	T	0.35	-40.0503	16.1396	0.81513	0.0:0.0:1.0:0.0	.	57;57	A8K1C9;Q96LT9	.;RBM40_HUMAN	I	57	ENSP00000437278:V57I;ENSP00000431344:V57I;ENSP00000432886:V57I;ENSP00000391432:V57I	ENSP00000391432:V57I	V	+	1	0	RNPC3	103841449	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.457000	0.60088	2.564000	0.86499	0.462000	0.41574	GTC			0.627	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000390812.1		NM_017619	
NHLH2	4808	broad.mit.edu	37	1	116383281	116383281	+	De_novo_Start_InFrame	SNP	C	C	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr1:116383281C>A	ENST00000369506.1	-	0	3257				NHLH2_ENST00000320238.3_Intron			Q02577	HEN2_HUMAN	nescient helix loop helix 2						cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|mating behavior (GO:0007617)|ovulation cycle (GO:0042698)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)			prostate(1)	1	Lung SC(450;0.184)	all_cancers(81;1.75e-06)|all_epithelial(167;1.16e-06)|all_lung(203;9.55e-06)|Lung NSC(69;5.83e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GATTCCGCTCCTATCGTATGC	0.383																																					.													.	NHLH2	8		0			.																																											4808	.			CCGCTCCTATCGT		CCDS885.1	1p12-p11	2013-05-21			ENSG00000177551	ENSG00000177551		"""Basic helix-loop-helix proteins"""	7818	protein-coding gene	gene with protein product		162361		HEN2		1528853	Standard	NM_005599		Approved	NSCL2, bHLHa34	uc001efy.3	Q02577	OTTHUMG00000011969		1.37:g.116383281C>A			Somatic	80	0.0125	1		WXS	Illumina HiSeq	Phase_I	88	0.05	4	.	0		0	Q5T1P6	Translation_Start_Site	SNP	ENST00000369506.1	37	CCDS885.1																																																																																					0.383	NHLH2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033090.1		NM_005599	
ZNF697	90874	broad.mit.edu;mdanderson.org	37	1	120165996	120165996	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr1:120165996C>G	ENST00000421812.2	-	3	1089	c.970G>C	c.(970-972)Gag>Cag	p.E324Q		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		CTGAAGGCCTCGCCGCACTCG	0.761																																					p.E324Q													.	ZNF697	26		0			c.G970C												3.0	4.0	4.0					1																	120165996		1943	3861	5804	SO:0001583	missense	90874	exon3			AGGCCTCGCCGCA	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.970G>C	1.37:g.120165996C>G	ENSP00000396857:p.Glu324Gln		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	17	0.18	3	NM_001080470	2	0.00	0	Q96IT2	Missense_Mutation	SNP	ENST00000421812.2	37	CCDS44202.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513052	0.27123	.	.	ENSG00000143067	ENST00000421812	T	0.18016	2.24	4.38	3.47	0.39725	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08670	0.0215	N	0.11673	0.155	0.26498	N	0.974824	D	0.64830	0.994	D	0.64321	0.924	T	0.12630	-1.0540	9	0.54805	T	0.06	.	7.1213	0.25446	0.0:0.792:0.0:0.208	.	324	Q5TEC3	ZN697_HUMAN	Q	324	ENSP00000396857:E324Q	ENSP00000396857:E324Q	E	-	1	0	ZNF697	119967519	0.146000	0.22672	0.991000	0.47740	0.038000	0.13279	0.859000	0.27858	0.984000	0.38629	-0.373000	0.07131	GAG			0.761	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036349.3		XM_371286	
NUDT17	200035	hgsc.bcm.edu	37	1	145589328	145589328	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr1:145589328C>T	ENST00000334513.5	-	1	111	c.100G>A	c.(100-102)Ggg>Agg	p.G34R	NUDT17_ENST00000444015.2_5'Flank	NM_001012758.2	NP_001012776.1	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 17	34							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(2)	9	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGCCACGTCCCGAGCCCTGGT	0.687											OREG0013751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G34R													NUDT17,NS,carcinoma,+2,1	NUDT17	2	1	0			c.G100A												13.0	12.0	12.0					1																	145589328		2188	4281	6469	SO:0001583	missense	200035	exon1			ACGTCCCGAGCCC	BC046352	CCDS72865.1	1q21.1	2008-02-05			ENSG00000186364	ENSG00000186364		"""Nudix motif containing"""	26618	protein-coding gene	gene with protein product						12477932	Standard	NM_001012758		Approved	FLJ34433	uc001eoe.3	P0C025	OTTHUMG00000013752	ENST00000334513.5:c.100G>A	1.37:g.145589328C>T	ENSP00000334437:p.Gly34Arg		Somatic	80	0	0	1695	WXS	Illumina HiSeq	.	73	0.05	4	NM_001012758	2	0.00	0		Missense_Mutation	SNP	ENST00000334513.5	37	CCDS30830.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228986	0.58777	.	.	ENSG00000186364	ENST00000334513	.	.	.	3.93	3.93	0.45458	.	0.139265	0.48286	D	0.000199	T	0.65678	0.2714	M	0.72479	2.2	0.34499	D	0.705864	D;D	0.89917	1.0;1.0	D;D	0.87578	0.979;0.998	T	0.70999	-0.4719	9	0.72032	D	0.01	-19.2691	11.3342	0.49494	0.0:1.0:0.0:0.0	.	34;34	B4DNV8;P0C025	.;NUD17_HUMAN	R	34	.	ENSP00000334437:G34R	G	-	1	0	NUDT17	144300685	0.946000	0.32159	0.873000	0.34254	0.113000	0.19764	1.010000	0.29898	2.026000	0.59711	0.585000	0.79938	GGG			0.687	NUDT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000038541.3		XM_496395	
OR13A1	79290	mdanderson.org	37	10	45799291	45799291	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr10:45799291G>T	ENST00000553795.1	-	4	888	c.580C>A	c.(580-582)Cat>Aat	p.H194N	OR13A1_ENST00000536058.1_Missense_Mutation_p.H194N|OR13A1_ENST00000374401.2_Missense_Mutation_p.H194N	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						CAGAAGAAATGGATAATGACA	0.592																																					p.H194N													.	.			0			c.C580A												52.0	54.0	54.0					10																	45799291		2203	4300	6503	SO:0001583	missense	79290	exon4			AGAAATGGATAAT	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.580C>A	10.37:g.45799291G>T	ENSP00000451950:p.His194Asn		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001004297	0		0	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	ENST00000553795.1	37	CCDS31188.1	.	.	.	.	.	.	.	.	.	.	g	14.66	2.602514	0.46423	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.00164	8.64;8.64;8.64	5.6	5.6	0.85130	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000169	T	0.00412	0.0013	M	0.78456	2.415	0.31031	N	0.717436	P	0.45902	0.868	P	0.55087	0.768	T	0.53251	-0.8465	10	0.72032	D	0.01	-56.9012	17.1748	0.86838	0.0:0.0:1.0:0.0	.	194	Q8NGR1	O13A1_HUMAN	N	194	ENSP00000451950:H194N;ENSP00000438657:H194N;ENSP00000363522:H194N	ENSP00000311379:H194N	H	-	1	0	OR13A1	45119297	0.999000	0.42202	0.780000	0.31762	0.146000	0.21551	3.564000	0.53791	2.622000	0.88805	0.650000	0.86243	CAT			0.592	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047779.2		NM_001004297	
NOC3L	64318	bcgsc.ca	37	10	96094473	96094473	+	Missense_Mutation	SNP	G	G	T	rs201691751		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr10:96094473G>T	ENST00000371361.3	-	20	2292	c.2192C>A	c.(2191-2193)tCt>tAt	p.S731Y	NOC3L_ENST00000371350.1_Missense_Mutation_p.S731Y|NOC3L_ENST00000543788.1_Missense_Mutation_p.S469Y	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	731					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TTCAGTAGCAGATCTAAATCA	0.323																																					p.S731Y													.	NOC3L	67		0			c.C2192A												115.0	122.0	119.0					10																	96094473		2203	4298	6501	SO:0001583	missense	64318	exon20			GTAGCAGATCTAA	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.2192C>A	10.37:g.96094473G>T	ENSP00000360412:p.Ser731Tyr		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_1	56	0.07	4	NM_022451	68	0.00	0	Q9H5M6|Q9H9D8	Missense_Mutation	SNP	ENST00000371361.3	37	CCDS7433.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355603	0.82243	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	T;T;T	0.15603	2.41;2.57;2.57	5.53	5.53	0.82687	.	0.164678	0.56097	D	0.000037	T	0.29093	0.0723	L	0.55481	1.735	0.53005	D	0.999966	P	0.36183	0.542	P	0.44477	0.451	T	0.00984	-1.1491	10	0.51188	T	0.08	-7.6433	19.808	0.96537	0.0:0.0:1.0:0.0	.	731	Q8WTT2	NOC3L_HUMAN	Y	469;731;731	ENSP00000437838:S469Y;ENSP00000360412:S731Y;ENSP00000360401:S731Y	ENSP00000360401:S731Y	S	-	2	0	NOC3L	96084463	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	8.337000	0.90036	2.762000	0.94881	0.655000	0.94253	TCT			0.323	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049466.1		NM_022451	
C10orf76	79591	mdanderson.org	37	10	103769735	103769735	+	Splice_Site	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr10:103769735G>T	ENST00000370033.4	-	12	996	c.877C>A	c.(877-879)Caa>Aaa	p.Q293K		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	293						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		GGCACTTACTGTACTGAGATT	0.453																																					p.Q293K													.	.			0			c.C877A												119.0	122.0	121.0					10																	103769735		1959	4174	6133	SO:0001630	splice_region_variant	79591	exon12			CTTACTGTACTGA	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.878+1C>A	10.37:g.103769735G>T			Somatic	66	0.0151515152	1		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_024541	17	0.06	1	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	37	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.337926	0.24253	.	.	ENSG00000120029	ENST00000370033	T	0.66638	-0.22	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.51770	0.1694	N	0.24115	0.695	0.80722	D	1	B	0.13594	0.008	B	0.14578	0.011	T	0.51896	-0.8647	10	0.02654	T	1	-9.003	19.5603	0.95369	0.0:0.0:1.0:0.0	.	293	Q5T2E6	CJ076_HUMAN	K	293	ENSP00000359050:Q293K	ENSP00000359050:Q293K	Q	-	1	0	C10orf76	103759725	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.350000	0.90069	2.611000	0.88343	0.563000	0.77884	CAA			0.453	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050007.1		NM_024541	Missense_Mutation
CDHR5	53841	broad.mit.edu	37	11	621227	621227	+	Missense_Mutation	SNP	T	T	G			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr11:621227T>G	ENST00000358353.3	-	8	964	c.642A>C	c.(640-642)gaA>gaC	p.E214D	CDHR5_ENST00000397542.2_Missense_Mutation_p.E214D|CDHR5_ENST00000349570.7_Missense_Mutation_p.E214D|CDHR5_ENST00000529337.1_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	214	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						TGTGGCTGGGTTCCACATTCT	0.672																																					p.E214D													.	CDHR5	77		0			c.A642C												58.0	60.0	59.0					11																	621227		2203	4299	6502	SO:0001583	missense	53841	exon7			GCTGGGTTCCACA	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.642A>C	11.37:g.621227T>G	ENSP00000351118:p.Glu214Asp		Somatic	100	0.09	9		WXS	Illumina HiSeq	Phase_I	87	0.13	11	NM_021924	7	0.00	0	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.03|10.03	1.239625|1.239625	0.22711|0.22711	.|.	.|.	ENSG00000099834|ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000326366;ENST00000349570|ENST00000526077	T;T;T|T	0.37915|0.48201	1.17;1.17;1.17|0.82	4.08|4.08	-0.241|-0.241	0.13043|0.13043	Cadherin (3);Cadherin-like (1);|.	4.110590|.	0.00899|.	N|.	0.002325|.	T|T	0.36799|0.36799	0.0980|0.0980	L|L	0.37630|0.37630	1.12|1.12	0.19300|0.19300	N|N	0.999978|0.999978	B;P;B;P;P|.	0.42248|.	0.103;0.774;0.372;0.628;0.628|.	B;B;B;B;B|.	0.39299|.	0.039;0.296;0.083;0.121;0.254|.	T|T	0.38436|0.38436	-0.9661|-0.9661	10|7	0.13853|0.87932	T|D	0.58|0	0.0377|0.0377	3.1544|3.1544	0.06499|0.06499	0.3649:0.4226:0.0:0.2125|0.3649:0.4226:0.0:0.2125	.|.	214;214;207;214;214|.	Q58EZ6;Q9HBB8-4;B4DV98;Q9HBB8-2;Q9HBB8|.	.;.;.;.;CDHR5_HUMAN|.	D|P	214|188	ENSP00000380676:E214D;ENSP00000351118:E214D;ENSP00000345726:E214D|ENSP00000435082:T188P	ENSP00000326527:E214D|ENSP00000435082:T188P	E|T	-|-	3|1	2|0	CDHR5|CDHR5	611227|611227	0.000000|0.000000	0.05858|0.05858	0.203000|0.203000	0.23512|0.23512	0.173000|0.173000	0.22820|0.22820	-1.475000|-1.475000	0.02335|0.02335	0.002000|0.002000	0.14630|0.14630	-0.232000|-0.232000	0.12228|0.12228	GAA|ACC			0.672	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255023.2		NM_021924	
RAB3IL1	5866	ucsc.edu;bcgsc.ca	37	11	61675532	61675532	+	Silent	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr11:61675532C>T	ENST00000394836.2	-	2	415	c.258G>A	c.(256-258)gcG>gcA	p.A86A	RAB3IL1_ENST00000301773.5_Silent_p.A133A	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	86					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						CCACCTTCTGCGCTCTGTGCA	0.642																																					p.A133A													RAB3IL1,NS,carcinoma,-1,1	RAB3IL1	39	1	0			c.G399A												36.0	40.0	39.0					11																	61675532		2202	4298	6500	SO:0001819	synonymous_variant	5866	exon2			CTTCTGCGCTCTG	AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.258G>A	11.37:g.61675532C>T			Somatic	38	0	0		WXS	Illumina HiSeq		30	0.13	4	NM_001271686	24	0.00	0	Q86V32|Q9P1Q8	Silent	SNP	ENST00000394836.2	37	CCDS8014.1																																																																																					0.642	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394917.1		NM_013401	
ANKRD13D	338692	mdanderson.org	37	11	67066580	67066580	+	Silent	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr11:67066580C>T	ENST00000447274.2	+	7	1697	c.522C>T	c.(520-522)agC>agT	p.S174S	ANKRD13D_ENST00000511455.2_Silent_p.S261S|ANKRD13D_ENST00000515828.1_5'Flank|ANKRD13D_ENST00000514166.1_Silent_p.S174S|ANKRD13D_ENST00000308440.6_Silent_p.S174S			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	174						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			AAACTGTTAGCGGCTACGAGG	0.587																																					p.S261S													.	.			0			c.C783T												123.0	118.0	120.0					11																	67066580		2200	4295	6495	SO:0001819	synonymous_variant	338692	exon7			TGTTAGCGGCTAC	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.522C>T	11.37:g.67066580C>T			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_207354	52	0.00	0	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Silent	SNP	ENST00000447274.2	37																																																																																						0.587	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000371067.2		NM_207354	
HEPHL1	341208	mdanderson.org	37	11	93836181	93836181	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr11:93836181G>T	ENST00000315765.9	+	15	2685	c.2677G>T	c.(2677-2679)Gtg>Ttg	p.V893L		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	893	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				AGTAAACTTTGTGAAGGTAAG	0.378																																					p.V893L													HEPHL1,NS,carcinoma,-1,1	HEPHL1	-1	1	0			c.G2677T												61.0	58.0	59.0					11																	93836181		1822	4070	5892	SO:0001583	missense	341208	exon15			AACTTTGTGAAGG	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2677G>T	11.37:g.93836181G>T	ENSP00000313699:p.Val893Leu		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001098672	0		0	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783763	0.49891	.	.	ENSG00000181333	ENST00000315765	D	0.98876	-5.2	5.16	1.79	0.24919	Cupredoxin (2);	0.244638	0.42294	D	0.000723	D	0.97660	0.9233	M	0.80422	2.495	0.32336	N	0.560459	B	0.27656	0.184	B	0.34931	0.192	D	0.98083	1.0405	10	0.40728	T	0.16	-19.1856	9.9419	0.41585	0.3022:0.0:0.6978:0.0	.	893	Q6MZM0	HPHL1_HUMAN	L	893	ENSP00000313699:V893L	ENSP00000313699:V893L	V	+	1	0	HEPHL1	93475829	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	2.380000	0.44327	0.578000	0.29487	0.650000	0.86243	GTG			0.378	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396103.2		XM_291947	
ATM	472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108139142	108139142	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr11:108139142A>G	ENST00000452508.2	+	19	2833	c.2644A>G	c.(2644-2646)Att>Gtt	p.I882V	ATM_ENST00000278616.4_Missense_Mutation_p.I882V|AP001925.1_ENST00000596081.1_5'Flank			Q13315	ATM_HUMAN	ATM serine/threonine kinase	882					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTTAGGTGCCATTAATCCTTT	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.I882V			yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.			0			c.A2644G												140.0	148.0	145.0					11																	108139142		2201	4298	6499	SO:0001583	missense	472	exon18	Familial Cancer Database	AT, Louis-Bar syndrome	GGTGCCATTAATC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2644A>G	11.37:g.108139142A>G	ENSP00000388058:p.Ile882Val		Somatic	72	0	0		WXS	Illumina HiSeq	.	87	0.30	26	NM_000051	3	0.33	1	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	2.017	-0.425769	0.04701	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.70164	-0.46;-0.46;-0.46	5.96	3.47	0.39725	Armadillo-type fold (1);	0.539938	0.23736	N	0.045069	T	0.42314	0.1197	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20107	-1.0285	10	0.07175	T	0.84	.	2.8206	0.05470	0.4584:0.0:0.2493:0.2923	.	882	Q13315	ATM_HUMAN	V	882	ENSP00000435747:I882V;ENSP00000278616:I882V;ENSP00000388058:I882V	ENSP00000278616:I882V	I	+	1	0	ATM	107644352	0.995000	0.38212	0.945000	0.38365	0.945000	0.59286	1.094000	0.30951	1.035000	0.39972	0.533000	0.62120	ATT			0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389938.1		NM_000051	
CHD4	1108	hgsc.bcm.edu	37	12	6711150	6711150	+	Missense_Mutation	SNP	C	C	A	rs150832622	byFrequency	TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr12:6711150C>A	ENST00000357008.2	-	4	577	c.414G>T	c.(412-414)gaG>gaT	p.E138D	CHD4_ENST00000544484.1_Missense_Mutation_p.E135D|CHD4_ENST00000309577.6_Missense_Mutation_p.E138D|CHD4_ENST00000544040.1_Missense_Mutation_p.E131D	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	138	Poly-Glu.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CATCAtcctcctcctcctcct	0.458													.|||	6	0.00119808	0.0023	0.0043	5008	,	,		21622	0.0		0.0	False		,,,				2504	0.0				p.E138D	Colon(32;586 792 4568 16848 45314)												.	.			0			c.G414T												36.0	38.0	37.0					12																	6711150		2188	4279	6467	SO:0001583	missense	1108	exon4			ATCCTCCTCCTCC	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.414G>T	12.37:g.6711150C>A	ENSP00000349508:p.Glu138Asp		Somatic	33	0	0		WXS	Illumina HiSeq	.	95	0.04	4	NM_001273	104	0.00	0	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	4	0.0018315018315018315	2	0.0040650406504065045	2	0.0055248618784530384	0	0.0	0	0.0	C	1.250	-0.618946	0.03663	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90324	-2.64;-2.65;-2.65;-2.65;0.9	5.64	0.387	0.16259	.	0.062426	0.64402	D	0.000007	T	0.65903	0.2736	N	0.03983	-0.305	0.41034	D	0.985179	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.52668	-0.8545	10	0.19590	T	0.45	.	5.795	0.18381	0.0:0.5151:0.1262:0.3587	.	138;138;131	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	D	135;131;138;138;112;138	ENSP00000440392:E135D;ENSP00000440542:E131D;ENSP00000312419:E138D;ENSP00000349508:E138D;ENSP00000437506:E138D	ENSP00000312419:E138D	E	-	3	2	CHD4	6581411	0.727000	0.28069	0.982000	0.44146	0.111000	0.19643	-0.175000	0.09825	0.062000	0.16340	-0.237000	0.12165	GAG	0.002		0.458	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001273	
RP1-288H2.2	0	broad.mit.edu	37	12	52493869	52493869	+	RNA	DEL	C	C	-	rs34419454	byFrequency	TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr12:52493869delC	ENST00000547538.1	-	0	139				OR7E47P_ENST00000546390.1_RNA																							atgatcctctccccccccgga	0.433													|||unknown(ALL_OTHER_Ns)	1771	0.353634	0.1762	0.487	5008	,	,		17194	0.5327		0.3032	False		,,,				2504	0.3661				.													.	.			0			.																																											0	.			TCCTCTCCCCCCC																													12.37:g.52493869delC			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	DEL	ENST00000547538.1	37																																																																																						0.433	RP1-288H2.2-001	PUTATIVE	basic	processed_transcript	processed_transcript		OTTHUMT00000405073.1			
KRT3	3850	hgsc.bcm.edu	37	12	53183951	53183951	+	Missense_Mutation	SNP	C	C	T	rs570613061|rs60125653	byFrequency	TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr12:53183951C>T	ENST00000417996.2	-	9	1836	c.1762G>A	c.(1762-1764)Ggc>Agc	p.G588S	KRT3_ENST00000309505.3_Missense_Mutation_p.G589S	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	588	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GAGCCAAAgccgctgccaccg	0.697																																					p.G588S													KRT3,rectum,carcinoma,0,1	KRT3	0	1	0			c.G1762A												14.0	31.0	25.0					12																	53183951		1574	3123	4697	SO:0001583	missense	3850	exon9			CAAAGCCGCTGCC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1762G>A	12.37:g.53183951C>T	ENSP00000413479:p.Gly588Ser		Somatic	20	0	0		WXS	Illumina HiSeq	.	25	0.24	6	NM_057088	0		0	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	37	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307617	0.40795	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.91351	-2.83;-2.83	3.4	-1.34	0.09143	.	0.507655	0.14827	N	0.296110	T	0.80149	0.4570	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.65302	-0.6201	10	0.34782	T	0.22	.	7.4497	0.27231	0.0:0.4872:0.0:0.5128	.	588	P12035	K2C3_HUMAN	S	588;589	ENSP00000413479:G588S;ENSP00000312206:G589S	ENSP00000312206:G589S	G	-	1	0	KRT3	51470218	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.682000	0.01935	-0.284000	0.09102	-0.258000	0.10820	GGC			0.697	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000405930.1		NM_057088	
ITGB7	3695	mdanderson.org	37	12	53586314	53586314	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr12:53586314G>T	ENST00000267082.5	-	14	2186	c.1955C>A	c.(1954-1956)gCa>gAa	p.A652E	ITGB7_ENST00000422257.3_Missense_Mutation_p.A652E|ITGB7_ENST00000550743.2_Missense_Mutation_p.A504E|ITGB7_ENST00000338737.4_Missense_Mutation_p.A504E	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	652					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCACACTCTGCACAGTCCCT	0.567																																					p.A652E													.	.			0			c.C1955A												68.0	63.0	65.0					12																	53586314		2203	4300	6503	SO:0001583	missense	3695	exon14			CACTCTGCACAGT		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.1955C>A	12.37:g.53586314G>T	ENSP00000267082:p.Ala652Glu		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_000889	57	0.00	0	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	37	CCDS8849.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.152164|6.152164	0.97329|0.97329	.|.	.|.	ENSG00000139626|ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737|ENST00000542497	D;D;D|.	0.91011|.	-1.82;-1.82;-2.77|.	4.3|4.3	4.3|4.3	0.51218|0.51218	Integrin beta subunit, tail (1);|.	0.000000|.	0.40385|.	N|.	0.001118|.	T|.	0.63768|.	0.2539|.	M|M	0.78801|0.78801	2.425|2.425	0.22457|0.22457	N|N	0.999081|0.999081	D|.	0.76494|.	0.999|.	D|.	0.64144|.	0.922|.	T|.	0.57505|.	-0.7800|.	9|.	.|.	.|.	.|.	.|.	16.1027|16.1027	0.81194|0.81194	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	652|.	P26010|.	ITB7_HUMAN|.	E|X	652;652;504|439	ENSP00000408741:A652E;ENSP00000267082:A652E;ENSP00000345501:A504E|.	.|.	A|C	-|-	2|3	0|2	ITGB7|ITGB7	51872581|51872581	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	3.667000|3.667000	0.54547|0.54547	2.420000|2.420000	0.82092|0.82092	0.561000|0.561000	0.74099|0.74099	GCA|TGC			0.567	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405821.2			
TAOK3	51347	broad.mit.edu;mdanderson.org	37	12	118682740	118682740	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr12:118682740C>T	ENST00000392533.3	-	4	641	c.151G>A	c.(151-153)Gca>Aca	p.A51T	TAOK3_ENST00000419821.2_Missense_Mutation_p.A51T	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTCTTAATTGCCACCACCTCA	0.358																																					p.A51T													.	TAOK3	151		0			c.G151A												157.0	148.0	151.0					12																	118682740		2203	4300	6503	SO:0001583	missense	51347	exon4			TAATTGCCACCAC	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.151G>A	12.37:g.118682740C>T	ENSP00000376317:p.Ala51Thr		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	62	0.06	4	NM_016281	13	0.00	0	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	ENST00000392533.3	37	CCDS9188.1	.	.	.	.	.	.	.	.	.	.	C	35	5.440983	0.96168	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000535570;ENST00000541186;ENST00000541878;ENST00000542902	T;T;T;T;T;T	0.73681	0.01;0.01;0.01;0.01;-0.77;-0.77	5.14	5.14	0.70334	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89125	0.6626	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91056	0.4882	10	0.87932	D	0	.	18.8034	0.92027	0.0:1.0:0.0:0.0	.	51	Q9H2K8	TAOK3_HUMAN	T	51	ENSP00000416374:A51T;ENSP00000376317:A51T;ENSP00000443465:A51T;ENSP00000438820:A51T;ENSP00000444057:A51T;ENSP00000440315:A51T	ENSP00000376317:A51T	A	-	1	0	TAOK3	117167123	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.507000	0.81676	2.665000	0.90641	0.591000	0.81541	GCA			0.358	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401456.2		NM_016281	
EXOC3L4	91828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	103568544	103568544	+	Nonsense_Mutation	SNP	G	G	T	rs373034943		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr14:103568544G>T	ENST00000380069.3	+	2	560	c.484G>T	c.(484-486)Gag>Tag	p.E162*		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	162					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						GCTGGTGGCCGAGAAGGCCTC	0.657																																					p.E162X													.	.			0			c.G484T												13.0	14.0	13.0					14																	103568544		2198	4292	6490	SO:0001587	stop_gained	91828	exon2			GTGGCCGAGAAGG	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.484G>T	14.37:g.103568544G>T	ENSP00000369409:p.Glu162*		Somatic	62	0	0		WXS	Illumina HiSeq	.	70	0.34	24	NM_001077594	5	0.00	0	Q14CR2	Nonsense_Mutation	SNP	ENST00000380069.3	37	CCDS32163.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530076	0.64860	.	.	ENSG00000205436	ENST00000380069	.	.	.	4.11	3.22	0.36961	.	0.287593	0.26692	N	0.022983	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-5.4548	5.6576	0.17650	0.1089:0.2001:0.691:0.0	.	.	.	.	X	162	.	ENSP00000369409:E162X	E	+	1	0	EXOC3L4	102638297	0.070000	0.21116	0.001000	0.08648	0.200000	0.23975	2.372000	0.44257	0.934000	0.37316	0.555000	0.69702	GAG			0.657	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415663.1		XM_941093	
CYFIP1	23191	broad.mit.edu;mdanderson.org	37	15	22954288	22954288	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr15:22954288G>T	ENST00000313077.7	+	14	1563	c.1438G>T	c.(1438-1440)Gtc>Ttc	p.V480F	CYFIP1_ENST00000435939.2_5'Flank|CYFIP1_ENST00000560848.1_Missense_Mutation_p.V480F	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CCGGCACACCGTCTATGCCGC	0.607																																					p.V480F													.	CYFIP1	159		0			c.G1438T												81.0	69.0	73.0					15																	22954288		2203	4300	6503	SO:0001583	missense	23191	exon14			CACACCGTCTATG	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1438G>T	15.37:g.22954288G>T	ENSP00000324549:p.Val480Phe		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	92	0.04	4	NM_014608	66	0.00	0		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.360001	0.82353	.	.	ENSG00000068793	ENST00000313077;ENST00000412127	T	0.25749	1.78	5.71	2.47	0.30058	.	0.157513	0.42548	D	0.000690	T	0.28863	0.0716	M	0.68952	2.095	0.80722	D	1	P;P	0.47841	0.901;0.653	B;P	0.46510	0.445;0.519	T	0.05099	-1.0906	10	0.87932	D	0	-28.1692	5.2793	0.15666	0.5117:0.0:0.4883:0.0	.	508;480	E7EQ04;Q7L576	.;CYFP1_HUMAN	F	480;508	ENSP00000324549:V480F	ENSP00000324549:V480F	V	+	1	0	CYFIP1	20505729	1.000000	0.71417	0.724000	0.30704	0.971000	0.66376	4.553000	0.60753	0.766000	0.33244	0.563000	0.77884	GTC			0.607	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251136.2		NM_014608	
RP11-467N20.5	0	bcgsc.ca	37	15	23407031	23407031	+	Missense_Mutation	SNP	T	T	C	rs376343793		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr15:23407031T>C	ENST00000558241.1	-	8	1895	c.1805A>G	c.(1804-1806)aAg>aGg	p.K602R																	endometrium(1)	1						ctcctcctgcttccacatctt	0.557																																					.													.	.			0			.																																									SO:0001583	missense	0	.			TCCTGCTTCCACA																												ENST00000558241.1:c.1805A>G	15.37:g.23407031T>C	ENSP00000453436:p.Lys602Arg		Somatic	195	0.0153846154	3		WXS	Illumina HiSeq	Phase_1	164	0.09	14	.	0		0		Missense_Mutation	SNP	ENST00000558241.1	37																																																																																						0.557	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000415942.1			
FMN1	342184	mdanderson.org	37	15	33261197	33261197	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr15:33261197G>T	ENST00000559047.1	-	5	2704	c.2705C>A	c.(2704-2706)cCg>cAg	p.P902Q	FMN1_ENST00000561249.1_Missense_Mutation_p.P804Q|SNORD77_ENST00000391113.1_RNA|FMN1_ENST00000334528.9_Missense_Mutation_p.P679Q			Q68DA7	FMN1_HUMAN	formin 1	902	FH1.|Pro-rich.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		aggtggtagcggtggCCCAGC	0.672																																					p.P679Q													.	.			0			c.C2036A												13.0	13.0	13.0					15																	33261197		1996	4138	6134	SO:0001583	missense	342184	exon4			GGTAGCGGTGGCC	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2705C>A	15.37:g.33261197G>T	ENSP00000454047:p.Pro902Gln		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	27	0.07	2	NM_001103184	1	0.00	0	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	G	5.578	0.291442	0.10567	.	.	ENSG00000248905	ENST00000334528	T	0.52057	0.68	3.89	3.89	0.44902	.	0.147956	0.44285	D	0.000471	T	0.54935	0.1889	L	0.29908	0.895	.	.	.	D	0.76494	0.999	D	0.68943	0.961	T	0.64892	-0.6300	9	0.51188	T	0.08	.	14.9997	0.71462	0.0:0.0:1.0:0.0	.	679	Q68DA7-5	.	Q	679	ENSP00000333950:P679Q	ENSP00000333950:P679Q	P	-	2	0	FMN1	31048489	0.162000	0.22906	0.143000	0.22291	0.248000	0.25809	1.111000	0.31159	1.990000	0.58119	0.484000	0.47621	CCG			0.672	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000417414.1		NM_001103184	
VPS13C	54832	mdanderson.org	37	15	62276086	62276086	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr15:62276086G>T	ENST00000261517.5	-	20	1920	c.1847C>A	c.(1846-1848)cCg>cAg	p.P616Q	VPS13C_ENST00000395898.3_Missense_Mutation_p.P573Q|VPS13C_ENST00000249837.3_Missense_Mutation_p.P573Q|VPS13C_ENST00000395896.4_Missense_Mutation_p.P616Q	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ACTATCCTCCGGATTGGTTTC	0.408																																					p.P616Q													.	.			0			c.C1847A												80.0	75.0	77.0					15																	62276086		2203	4300	6503	SO:0001583	missense	54832	exon20			TCCTCCGGATTGG	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.1847C>A	15.37:g.62276086G>T	ENSP00000261517:p.Pro616Gln		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_020821	2	0.00	0		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437507	0.83885	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.53640	0.61;0.61;0.61	5.9	5.9	0.94986	.	0.122706	0.56097	D	0.000030	T	0.74543	0.3730	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	T	0.77199	-0.2675	10	0.87932	D	0	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	573;616;573;616	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	Q	573;616;616;616	ENSP00000249837:P573Q;ENSP00000261517:P616Q;ENSP00000379233:P616Q	ENSP00000249837:P573Q	P	-	2	0	VPS13C	60063378	1.000000	0.71417	0.999000	0.59377	0.493000	0.33554	9.205000	0.95048	2.788000	0.95919	0.650000	0.86243	CCG			0.408	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000415997.1		NM_017684	
SOX8	30812	mdanderson.org	37	16	1032207	1032207	+	Silent	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr16:1032207G>A	ENST00000293894.3	+	1	400	c.285G>A	c.(283-285)gcG>gcA	p.A95A	RP11-161M6.2_ENST00000565467.1_lincRNA	NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	95					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				gcggcggcgcgcTCAAAGCCA	0.706																																					p.A95A													.	.			0			c.G285A												4.0	5.0	4.0					16																	1032207		2006	4002	6008	SO:0001819	synonymous_variant	30812	exon1			CGGCGCGCTCAAA	AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.285G>A	16.37:g.1032207G>A			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_014587	4	0.00	0	Q9NZW2	Silent	SNP	ENST00000293894.3	37	CCDS10428.1																																																																																					0.706	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000242867.1			
PPL	5493	mdanderson.org	37	16	4945266	4945266	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr16:4945266T>C	ENST00000345988.2	-	11	1327	c.1238A>G	c.(1237-1239)gAg>gGg	p.E413G	PPL_ENST00000590782.2_Missense_Mutation_p.E411G	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	413					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						ACGCACCTGCTCCCCCTCAAA	0.627																																					p.E413G													.	.			0			c.A1238G												45.0	41.0	42.0					16																	4945266		2197	4300	6497	SO:0001583	missense	5493	exon11			ACCTGCTCCCCCT	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1238A>G	16.37:g.4945266T>C	ENSP00000340510:p.Glu413Gly		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_002705	13	0.00	0	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	T	3.648	-0.072034	0.07228	.	.	ENSG00000118898	ENST00000345988	T	0.69561	-0.41	4.57	4.57	0.56435	.	0.193201	0.45126	D	0.000385	T	0.52240	0.1722	L	0.31664	0.95	0.38769	D	0.954497	B	0.31383	0.321	B	0.26770	0.073	T	0.54886	-0.8226	10	0.27785	T	0.31	.	14.0801	0.64914	0.0:0.0:0.0:1.0	.	413	O60437	PEPL_HUMAN	G	413	ENSP00000340510:E413G	ENSP00000340510:E413G	E	-	2	0	PPL	4885267	1.000000	0.71417	0.972000	0.41901	0.342000	0.28953	5.567000	0.67378	1.921000	0.55644	0.459000	0.35465	GAG			0.627	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251715.1		NM_002705	
LOC653786	653786	broad.mit.edu	37	16	22579566	22579569	+	RNA	DEL	ATTC	ATTC	-	rs370421878|rs200819155		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	ATTC	ATTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr16:22579566_22579569delATTC	ENST00000550753.1	+	0	1976					NR_003676.2																						AAATGGGTTAattcatccatccat	0.426																																					.													.	.			0			.																																											0	.			GGGTTAATTCATC																													16.37:g.22579566_22579569delATTC			Somatic	99	0.0606060606	6		WXS	Illumina HiSeq	Phase_I	88	0.13	11	.	0		0		RNA	DEL	ENST00000550753.1	37																																																																																						0.426	RP11-368J21.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409041.1			
NOD2	64127	mdanderson.org	37	16	50741855	50741855	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr16:50741855G>T	ENST00000300589.2	+	3	735	c.630G>T	c.(628-630)ttG>ttT	p.L210F	NOD2_ENST00000526417.2_3'UTR	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	210	CARD 2. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CAGTCCCATTGGCCCTGCCTT	0.488																																					p.L210F													.	.			0			c.G630T												144.0	114.0	124.0					16																	50741855		2198	4300	6498	SO:0001583	missense	64127	exon3			CCCATTGGCCCTG	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.630G>T	16.37:g.50741855G>T	ENSP00000300589:p.Leu210Phe		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	92	0.04	4	NM_022162	3	0.00	0	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	G	6.518	0.463791	0.12402	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	T	0.21361	2.01	4.71	-1.23	0.09465	DEATH-like (2);Caspase Recruitment (1);	1.881580	0.03033	N	0.152318	T	0.21801	0.0525	L	0.44542	1.39	0.09310	N	1	P	0.46784	0.884	P	0.49887	0.625	T	0.28299	-1.0048	10	0.09843	T	0.71	.	4.0751	0.09901	0.3027:0.3404:0.3568:0.0	.	210	Q9HC29	NOD2_HUMAN	F	183;210	ENSP00000300589:L210F	ENSP00000300589:L210F	L	+	3	2	NOD2	49299356	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.649000	0.05384	0.150000	0.19136	-0.142000	0.14014	TTG			0.488	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256876.2		NM_022162	
RRAD	6236	mdanderson.org	37	16	66958768	66958768	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr16:66958768G>T	ENST00000299759.6	-	2	565	c.315C>A	c.(313-315)agC>agA	p.S105R	RRAD_ENST00000420652.1_Missense_Mutation_p.S105R			P55042	RAD_HUMAN	Ras-related associated with diabetes	105					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GCGCCAGGGCGCTCTTGCCCA	0.701																																					p.S105R													.	.			0			c.C315A												14.0	16.0	15.0					16																	66958768		2194	4296	6490	SO:0001583	missense	6236	exon2			CAGGGCGCTCTTG	L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.315C>A	16.37:g.66958768G>T	ENSP00000299759:p.Ser105Arg		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_004165	140	0.00	0	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212335	0.79240	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	D;D	0.86497	-2.13;-2.13	4.24	1.19	0.21007	Small GTP-binding protein domain (1);	0.229124	0.45126	D	0.000393	D	0.94627	0.8268	H	0.98646	4.29	0.58432	D	0.999999	D	0.76494	0.999	D	0.64042	0.921	D	0.92554	0.6052	10	0.87932	D	0	.	7.9392	0.29948	0.3233:0.0:0.6767:0.0	.	105	P55042	RAD_HUMAN	R	105	ENSP00000388744:S105R;ENSP00000299759:S105R	ENSP00000299759:S105R	S	-	3	2	RRAD	65516269	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.151000	0.50670	0.102000	0.17638	0.655000	0.94253	AGC			0.701	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268830.1		NM_004165	
CCDC43	124808	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	42759494	42759494	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr17:42759494G>C	ENST00000315286.8	-	3	313	c.305C>G	c.(304-306)gCc>gGc	p.A102G	CCDC43_ENST00000457422.2_Missense_Mutation_p.A102G|C17orf104_ENST00000588805.1_Intron|CCDC43_ENST00000588210.1_Missense_Mutation_p.A102G	NM_144609.2	NP_653210.2	Q96MW1	CCD43_HUMAN	coiled-coil domain containing 43	102										lung(2)	2		Prostate(33;0.0322)				GGTGGCAATGGCCTGTACTTC	0.493																																					p.A102G													.	.			0			c.C305G												140.0	130.0	134.0					17																	42759494		2031	4202	6233	SO:0001583	missense	124808	exon3			GCAATGGCCTGTA	AK056357	CCDS45704.1, CCDS45705.1	17q21.31	2005-12-16							26472	protein-coding gene	gene with protein product						12477932	Standard	NM_001099225		Approved	FLJ31795	uc002ihc.2	Q96MW1		ENST00000315286.8:c.305C>G	17.37:g.42759494G>C	ENSP00000323782:p.Ala102Gly		Somatic	157	0	0		WXS	Illumina HiSeq	.	172	0.05	8	NM_001099225	55	0.02	1	C9JVK9	Missense_Mutation	SNP	ENST00000315286.8	37	CCDS45704.1	.	.	.	.	.	.	.	.	.	.	G	31	5.092579	0.94149	.	.	ENSG00000180329	ENST00000315286;ENST00000457422	.	.	.	6.06	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.74876	0.3774	M	0.81497	2.545	0.80722	D	1	D;P	0.59767	0.986;0.933	P;P	0.55713	0.782;0.542	T	0.75986	-0.3124	9	0.45353	T	0.12	-8.7765	15.4476	0.75243	0.068:0.0:0.932:0.0	.	102;102	Q96MW1-2;Q96MW1	.;CCD43_HUMAN	G	102	.	ENSP00000323782:A102G	A	-	2	0	CCDC43	40115020	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.074000	0.76791	2.871000	0.98454	0.655000	0.94253	GCC			0.493	CCDC43-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000457812.1		NM_144609	
HEXIM1	10614	broad.mit.edu	37	17	43229643	43229644	+	IGR	INS	-	-	C	rs71136074|rs146564091|rs13341389	byFrequency	TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr17:43229643_43229644insC	ENST00000332499.2	+	0	4785				AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CCtttttctttatttttttttt	0.455																																					.													.	HEXIM1	25		0			.																																									SO:0001628	intergenic_variant	0	.			TTTCTTTATTTTT	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992			17.37:g.43229643_43229644insC			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0	B2R8Y5	RNA	INS	ENST00000332499.2	37	CCDS11495.1																																																																																					0.455	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449821.2		NM_006460	
LOC101927755	101927755	bcgsc.ca	37	17	58066651	58066651	+	lincRNA	SNP	C	C	T	rs376360537		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr17:58066651C>T	ENST00000586209.1	+	0	158																											ACTGGTAAAGCTGTTTAAGAG	0.333																																					.													.	.			0			.																																											653645	.			GTAAAGCTGTTTA																													17.37:g.58066651C>T			Somatic	409	0.0171149144	7		WXS	Illumina HiSeq	Phase_1	433	0.06	25	.	1	1.00	1		RNA	SNP	ENST00000586209.1	37																																																																																						0.333	RP11-178C3.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000449162.1			
ZFR2	23217	mdanderson.org	37	19	3831689	3831689	+	Silent	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:3831689G>T	ENST00000262961.4	-	4	577	c.567C>A	c.(565-567)ccC>ccA	p.P189P	ZFR2_ENST00000591965.1_5'UTR	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	189	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GGTTGTAGGAGGGCGGGGGGT	0.637																																					p.P189P													.	.			0			c.C567A												18.0	21.0	20.0					19																	3831689		2100	4213	6313	SO:0001819	synonymous_variant	23217	exon4			GTAGGAGGGCGGG	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.567C>A	19.37:g.3831689G>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_015174	0		0		Silent	SNP	ENST00000262961.4	37	CCDS45921.1																																																																																					0.637	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453648.2		NM_015174	
PRR22	163154	mdanderson.org	37	19	5783886	5783886	+	Silent	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:5783886G>T	ENST00000419421.2	-	3	476	c.372C>A	c.(370-372)gcC>gcA	p.A124A		NM_001134316.1	NP_001127788.1	Q8IZ63	PRR22_HUMAN	proline rich 22	124	Pro-rich.									endometrium(2)|large_intestine(1)|prostate(1)|urinary_tract(1)	5						GCAGCCCCGGGGCCTTGAGGT	0.706																																					p.A124A													.	.			0			c.C372A												4.0	5.0	5.0					19																	5783886		1986	4024	6010	SO:0001819	synonymous_variant	163154	exon3			CCCCGGGGCCTTG	BC023278	CCDS45933.1	19p13.3	2012-12-20			ENSG00000212123	ENSG00000212123			28354	protein-coding gene	gene with protein product						12477932	Standard	NM_001134316		Approved	MGC24975	uc010xiv.1	Q8IZ63	OTTHUMG00000180553	ENST00000419421.2:c.372C>A	19.37:g.5783886G>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001134316	35	0.00	0	E9PB31	Silent	SNP	ENST00000419421.2	37	CCDS45933.1																																																																																					0.706	PRR22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368523.1		NM_153359	
PRKCSH	5589	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	11558391	11558391	+	Silent	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:11558391G>A	ENST00000589838.1	+	10	987	c.987G>A	c.(985-987)gaG>gaA	p.E329E	PRKCSH_ENST00000252455.2_Silent_p.E329E|PRKCSH_ENST00000591462.1_Silent_p.E329E|PRKCSH_ENST00000587327.1_Silent_p.E329E|PRKCSH_ENST00000412601.1_Silent_p.E329E|PRKCSH_ENST00000592741.1_Silent_p.E329E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	329	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E329E(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						ctgaagaagaggaggaggagg	0.632																																					p.E329E													PRKCSH,NS,carcinoma,0,1	PRKCSH	0	1	1	Substitution - coding silent(1)	prostate(1)	c.G987A												23.0	23.0	23.0					19																	11558391		2201	4298	6499	SO:0001819	synonymous_variant	5589	exon11			AGAAGAGGAGGAG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.987G>A	19.37:g.11558391G>A			Somatic	67	0	0		WXS	Illumina HiSeq	.	77	0.06	5	NM_001001329	101	0.03	3	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																					0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000458817.1			
CCDC105	126402	mdanderson.org	37	19	15132449	15132449	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:15132449G>T	ENST00000292574.3	+	5	1145	c.1063G>T	c.(1063-1065)Gga>Tga	p.G355*		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	355						extracellular vesicular exosome (GO:0070062)		p.G355K(1)|p.G355R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						TATGACGTTAGGACTGATGAG	0.587																																					p.G355X													CCDC105,NS,carcinoma,0,2	CCDC105	0	2	2	Substitution - Missense(2)	lung(2)	c.G1063T												81.0	80.0	80.0					19																	15132449		2203	4300	6503	SO:0001587	stop_gained	126402	exon5			ACGTTAGGACTGA	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1063G>T	19.37:g.15132449G>T	ENSP00000292574:p.Gly355*		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_173482	0		0	Q8N7T5|Q8NDL5	Nonsense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206895	0.58343	.	.	ENSG00000160994	ENST00000292574	.	.	.	3.91	3.91	0.45181	.	0.110416	0.36703	N	0.002455	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-17.8949	11.3526	0.49596	0.0:0.0:1.0:0.0	.	.	.	.	X	355	.	ENSP00000292574:G355X	G	+	1	0	CCDC105	14993449	0.996000	0.38824	0.158000	0.22627	0.082000	0.17680	3.984000	0.56923	2.033000	0.60031	0.549000	0.68633	GGA			0.587	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466293.1		NM_173482	
IFI30	10437	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	18288094	18288094	+	Missense_Mutation	SNP	G	G	A	rs533404165	byFrequency	TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:18288094G>A	ENST00000407280.3	+	5	803	c.628G>A	c.(628-630)Gtc>Atc	p.V210I	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	210					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						CTGGGTCACCGTCAATGGGGT	0.572													G|||	5	0.000998403	0.0	0.0	5008	,	,		17592	0.0		0.0	False		,,,				2504	0.0051				p.V210I													.	IFI30	12		0			c.G628A												45.0	45.0	45.0					19																	18288094		2143	4255	6398	SO:0001583	missense	10437	exon5			GTCACCGTCAATG	J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.628G>A	19.37:g.18288094G>A	ENSP00000384886:p.Val210Ile		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	113	0.05	6	NM_006332	1685	0.00	0	Q76MF9|Q8NEI4|Q8WU77|Q9UL08	Missense_Mutation	SNP	ENST00000407280.3	37	CCDS46015.1	.	.	.	.	.	.	.	.	.	.	G	3.142	-0.176014	0.06380	.	.	ENSG00000216490	ENST00000407280	T	0.30448	1.53	5.1	1.64	0.23874	.	.	.	.	.	T	0.15046	0.0363	N	0.21448	0.665	0.27418	N	0.954381	B	0.15930	0.015	B	0.08055	0.003	T	0.31861	-0.9928	9	0.07175	T	0.84	-31.0579	5.245	0.15493	0.2967:0.1482:0.555:0.0	.	210	P13284	GILT_HUMAN	I	210	ENSP00000384886:V210I	ENSP00000384886:V210I	V	+	1	0	IFI30	18149094	0.818000	0.29161	0.985000	0.45067	0.015000	0.08874	0.696000	0.25541	1.170000	0.42753	-0.226000	0.12346	GTC			0.572	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466396.3		NM_006332	
ZNF573	126231	hgsc.bcm.edu	37	19	38260728	38260728	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:38260728G>T	ENST00000590414.2	-	3	233	c.212C>A	c.(211-213)tCc>tAc	p.S71Y	ZNF573_ENST00000585724.1_Missense_Mutation_p.P27T|ZNF573_ENST00000392138.1_Intron|ZNF573_ENST00000339503.4_5'UTR|ZNF573_ENST00000536220.1_5'UTR|ZNF573_ENST00000357309.3_5'UTR			Q86YE8	ZN573_HUMAN	zinc finger protein 573	71	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TTTAGAAATGGAATGTCCTCC	0.373																																					p.S71Y													.	.			0			c.C212A																																									SO:0001583	missense	126231	exon4			GAAATGGAATGTC	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.212C>A	19.37:g.38260728G>T	ENSP00000465020:p.Ser71Tyr		Somatic	111	0	0		WXS	Illumina HiSeq	.	98	0.04	4	NM_001172690	0		0	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Missense_Mutation	SNP	ENST00000590414.2	37	CCDS59381.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744900	0.49151	.	.	ENSG00000189144	ENST00000378445	T	0.00724	5.78	2.13	2.13	0.27403	Krueppel-associated box (3);	.	.	.	.	T	0.01940	0.0061	L	0.50919	1.6	0.80722	D	1	D	0.58970	0.984	P	0.62435	0.902	T	0.69057	-0.5246	9	0.35671	T	0.21	.	7.8045	0.29193	0.0:0.0:1.0:0.0	.	51	Q86YE8	ZN573_HUMAN	Y	15	ENSP00000367706:S15Y	ENSP00000367706:S15Y	S	-	2	0	ZNF573	42952568	0.002000	0.14202	0.987000	0.45799	0.986000	0.74619	0.670000	0.25157	1.502000	0.48669	0.555000	0.69702	TCC			0.373	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459773.2		NM_152360	
OPA3	80207	mdanderson.org	37	19	46087973	46087973	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:46087973C>T	ENST00000263275.4	-	1	104	c.50G>A	c.(49-51)cGg>cAg	p.R17Q	OPA3_ENST00000544371.1_Intron|OPA3_ENST00000323060.3_Missense_Mutation_p.R17Q	NM_025136.3	NP_079412.1	Q9H6K4	OPA3_HUMAN	optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)	17					growth (GO:0040007)|mitochondrion morphogenesis (GO:0070584)|neuromuscular process (GO:0050905)|regulation of lipid metabolic process (GO:0019216)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	mitochondrion (GO:0005739)				cervix(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		GCTGACCTGCCGGATGCCCAA	0.627																																					p.R17Q													.	.			0			c.G50A												63.0	62.0	62.0					19																	46087973		2203	4300	6503	SO:0001583	missense	80207	exon1			ACCTGCCGGATGC	AK025840	CCDS12668.1, CCDS33052.1	19q13.2-q13.3	2014-01-28				ENSG00000125741			8142	protein-coding gene	gene with protein product		606580				9097959, 11668429	Standard	NM_001017989		Approved	FLJ22187, MGA3	uc002pcj.4	Q9H6K4		ENST00000263275.4:c.50G>A	19.37:g.46087973C>T	ENSP00000263275:p.Arg17Gln		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001017989	23	0.00	0	Q6P384|Q8N784	Missense_Mutation	SNP	ENST00000263275.4	37	CCDS12668.1	.	.	.	.	.	.	.	.	.	.	C	37	6.496440	0.97616	.	.	ENSG00000125741	ENST00000323060;ENST00000263275	D;D	0.87179	-2.22;-2.22	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.95204	0.8445	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.95676	0.8728	10	0.87932	D	0	6.0E-4	17.8364	0.88699	0.0:1.0:0.0:0.0	.	17;17	Q9H6K4;Q9H6K4-2	OPA3_HUMAN;.	Q	17	ENSP00000319817:R17Q;ENSP00000263275:R17Q	ENSP00000263275:R17Q	R	-	2	0	OPA3	50779813	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.031000	0.76491	2.884000	0.98904	0.655000	0.94253	CGG			0.627	OPA3-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000459601.1			
HSD17B14	51171	mdanderson.org	37	19	49318335	49318335	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:49318335C>T	ENST00000263278.4	-	6	699	c.433G>A	c.(433-435)Gca>Aca	p.A145T	HSD17B14_ENST00000599157.1_Missense_Mutation_p.A121T	NM_016246.2	NP_057330.2	Q9BPX1	DHB14_HUMAN	hydroxysteroid (17-beta) dehydrogenase 14	145					steroid catabolic process (GO:0006706)	cytosol (GO:0005829)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			large_intestine(3)|lung(1)|skin(1)	5		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		TGGCCGATTGCCCCCACCAGG	0.602																																					p.A145T													.	.			0			c.G433A												110.0	86.0	94.0					19																	49318335		2203	4300	6503	SO:0001583	missense	51171	exon6			CGATTGCCCCCAC	AF126781	CCDS12736.1	19q13.33	2011-09-14	2006-11-22	2006-11-22		ENSG00000087076		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	23238	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 3"", ""short chain dehydrogenase/reductase family 47C, member 1"""	612832	"""dehydrogenase/reductase (SDR family) member 10"""	DHRS10		10800688, 17067289, 19027726	Standard	XM_005258969		Approved	retSDR3, SDR47C1	uc002pkv.1	Q9BPX1		ENST00000263278.4:c.433G>A	19.37:g.49318335C>T	ENSP00000263278:p.Ala145Thr		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_016246	30	0.00	0	Q9UKU3	Missense_Mutation	SNP	ENST00000263278.4	37	CCDS12736.1	.	.	.	.	.	.	.	.	.	.	C	6.366	0.435721	0.12104	.	.	ENSG00000087076	ENST00000263278	D	0.87256	-2.23	4.07	4.07	0.47477	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.335067	0.27961	N	0.017151	T	0.73361	0.3577	N	0.11870	0.19	0.34930	D	0.749263	B	0.14805	0.011	B	0.08055	0.003	T	0.73607	-0.3929	10	0.41790	T	0.15	.	7.9272	0.29880	0.0:0.889:0.0:0.111	.	145	Q9BPX1	DHB14_HUMAN	T	145	ENSP00000263278:A145T	ENSP00000263278:A145T	A	-	1	0	HSD17B14	54010147	0.583000	0.26757	0.819000	0.32651	0.503000	0.33858	0.845000	0.27668	2.279000	0.76181	0.558000	0.71614	GCA			0.602	HSD17B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466212.1		NM_016246	
SYT3	84258	hgsc.bcm.edu;broad.mit.edu	37	19	51128793	51128793	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:51128793G>T	ENST00000338916.4	-	6	2064	c.1431C>A	c.(1429-1431)agC>agA	p.S477R	SYT3_ENST00000593901.1_Missense_Mutation_p.S477R|SYT3_ENST00000544769.1_Missense_Mutation_p.S477R|SYT3_ENST00000600079.1_Missense_Mutation_p.S477R	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	477	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GCCGCCCCTCGCTGATCAGGG	0.602																																					p.S477R													.	.			0			c.C1431A												48.0	44.0	45.0					19																	51128793		2203	4300	6503	SO:0001583	missense	84258	exon6			CCCCTCGCTGATC	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1431C>A	19.37:g.51128793G>T	ENSP00000340914:p.Ser477Arg		Somatic	81	0	0		WXS	Illumina HiSeq	.	97	0.04	4	NM_032298	8	0.00	0	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936581	0.34189	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.72394	-0.65;-0.65	3.38	-0.304	0.12788	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.258169	0.29892	U	0.010928	T	0.53674	0.1811	L	0.43646	1.37	0.31239	N	0.695448	B	0.32731	0.382	B	0.27715	0.082	T	0.56709	-0.7934	10	0.72032	D	0.01	.	5.7288	0.18028	0.215:0.1653:0.6197:0.0	.	477	Q9BQG1	SYT3_HUMAN	R	477	ENSP00000340914:S477R;ENSP00000438883:S477R	ENSP00000340914:S477R	S	-	3	2	SYT3	55820605	0.003000	0.15002	1.000000	0.80357	0.845000	0.48019	-0.956000	0.03865	0.557000	0.29117	0.478000	0.44815	AGC			0.602	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464910.1		NM_032298	
ZNF551	90233	broad.mit.edu	37	19	58198322	58198322	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr19:58198322G>A	ENST00000282296.5	+	3	864	c.679G>A	c.(679-681)Gaa>Aaa	p.E227K	ZNF551_ENST00000356715.4_Missense_Mutation_p.E211K|ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000594684.1_Intron|AC003006.7_ENST00000599221.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CAAGTGGGGTGAATACAGAAA	0.448																																					p.E227K													.	ZNF551	65		0			c.G679A												74.0	76.0	75.0					19																	58198322		2203	4300	6503	SO:0001583	missense	90233	exon3			TGGGGTGAATACA	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.679G>A	19.37:g.58198322G>A	ENSP00000282296:p.Glu227Lys		Somatic	57	0.0701754386	4		WXS	Illumina HiSeq	Phase_I	44	0.11	5	NM_138347	10	0.00	0	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	37	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	G	9.307	1.054645	0.19907	.	.	ENSG00000204519	ENST00000356715;ENST00000282296;ENST00000359821	.	.	.	2.27	-4.12	0.03916	.	.	.	.	.	T	0.29458	0.0734	L	0.45698	1.435	0.09310	N	1	B	0.27971	0.196	B	0.25140	0.058	T	0.33059	-0.9883	8	0.59425	D	0.04	.	5.2585	0.15559	0.2275:0.3073:0.4652:0.0	.	227	Q7Z340	ZN551_HUMAN	K	227;211;121	.	ENSP00000282296:E211K	E	+	1	0	ZNF551	62890134	.	.	0.000000	0.03702	0.003000	0.03518	.	.	-0.520000	0.06435	-0.291000	0.09656	GAA			0.448	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000466803.2		NM_138347	
EVA1A	84141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	75720472	75720472	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr2:75720472C>A	ENST00000233712.1	-	4	786	c.349G>T	c.(349-351)Gag>Tag	p.E117*	EVA1A_ENST00000410113.1_Nonsense_Mutation_p.E117*|EVA1A_ENST00000410010.1_Nonsense_Mutation_p.E105*|EVA1A_ENST00000490746.1_Intron|EVA1A_ENST00000393913.3_Nonsense_Mutation_p.E117*|EVA1A_ENST00000410071.1_Nonsense_Mutation_p.E117*	NM_032181.2	NP_115557.1	Q9H8M9	EVA1A_HUMAN	eva-1 homolog A (C. elegans)	117					apoptotic process (GO:0006915)|autophagy (GO:0006914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)											CGCTCCAGCTCCTCCGCAGAG	0.632																																					p.E117X													.	.			0			c.G349T												44.0	47.0	46.0					2																	75720472		2203	4300	6503	SO:0001587	stop_gained	84141	exon4			CCAGCTCCTCCGC	BC016157	CCDS1959.1	2p12	2012-11-05	2012-11-05	2012-11-05	ENSG00000115363	ENSG00000115363			25816	protein-coding gene	gene with protein product			"""transmembrane protein 166"", ""family with sequence similarity 176, member A"""	TMEM166, FAM176A		12477932	Standard	NM_001135032		Approved	FLJ13391	uc002sni.2	Q9H8M9	OTTHUMG00000129991	ENST00000233712.1:c.349G>T	2.37:g.75720472C>A	ENSP00000233712:p.Glu117*		Somatic	170	0	0		WXS	Illumina HiSeq	.	154	0.22	34	NM_032181	5	0.20	1	D6W5J3|Q9HC41	Nonsense_Mutation	SNP	ENST00000233712.1	37	CCDS1959.1	.	.	.	.	.	.	.	.	.	.	C	40	8.087733	0.98648	.	.	ENSG00000115363	ENST00000393913;ENST00000233712;ENST00000410113;ENST00000410010;ENST00000410071;ENST00000432649	.	.	.	5.05	5.05	0.67936	.	0.089559	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	0.5233	16.7196	0.85407	0.0:1.0:0.0:0.0	.	.	.	.	X	117;117;117;105;117;117	.	ENSP00000233712:E117X	E	-	1	0	FAM176A	75573980	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.729000	0.84864	2.722000	0.93159	0.655000	0.94253	GAG			0.632	EVA1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328707.1		NM_032181	
CCNT2	905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	135694499	135694499	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr2:135694499G>C	ENST00000264157.5	+	3	359	c.329G>C	c.(328-330)tGt>tCt	p.C110S	CCNT2_ENST00000295238.6_Missense_Mutation_p.C110S|CCNT2_ENST00000537343.1_5'UTR	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	110					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		GCACATGCTTGTCTTCATCCT	0.338																																					p.C110S													.	.			0			c.G329C												138.0	138.0	138.0					2																	135694499		2203	4300	6503	SO:0001583	missense	905	exon3			ATGCTTGTCTTCA	AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.329G>C	2.37:g.135694499G>C	ENSP00000264157:p.Cys110Ser		Somatic	90	0	0		WXS	Illumina HiSeq	.	112	0.09	10	NM_058241	26	0.27	7	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	37	CCDS2174.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622199	0.87460	.	.	ENSG00000082258	ENST00000295238;ENST00000264157	T;T	0.40225	1.04;1.04	5.39	5.39	0.77823	Cyclin, N-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.46367	0.1389	L	0.56396	1.775	0.80722	D	1	P;P	0.39696	0.563;0.683	B;B	0.39503	0.301;0.213	T	0.50825	-0.8782	10	0.66056	D	0.02	.	19.5203	0.95182	0.0:0.0:1.0:0.0	.	110;110	O60583;O60583-2	CCNT2_HUMAN;.	S	110	ENSP00000295238:C110S;ENSP00000264157:C110S	ENSP00000264157:C110S	C	+	2	0	CCNT2	135410969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.678000	0.91216	0.655000	0.94253	TGT			0.338	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254629.1		NM_058241	
LCT	3938	broad.mit.edu	37	2	136575423	136575423	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr2:136575423C>T	ENST00000264162.2	-	6	1205	c.1195G>A	c.(1195-1197)Gga>Aga	p.G399R	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	399	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCCCAGCCTCCTTCCACGTTA	0.622																																					p.G399R													.	LCT	309		0			c.G1195A												62.0	68.0	66.0					2																	136575423		2203	4300	6503	SO:0001583	missense	3938	exon6			AGCCTCCTTCCAC	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1195G>A	2.37:g.136575423C>T	ENSP00000264162:p.Gly399Arg		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	72	0.04	3	NM_002299	0		0	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566167	0.86439	.	.	ENSG00000115850	ENST00000264162	T	0.70516	-0.49	5.25	5.25	0.73442	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.90055	0.6894	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.92750	0.6215	10	0.87932	D	0	-19.7411	19.3941	0.94598	0.0:1.0:0.0:0.0	.	399	P09848	LPH_HUMAN	R	399	ENSP00000264162:G399R	ENSP00000264162:G399R	G	-	1	0	LCT	136291893	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	7.609000	0.82925	2.885000	0.99019	0.655000	0.94253	GGA			0.622	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254657.1		NM_002299	
SIGLEC1	6614	mdanderson.org	37	20	3673619	3673619	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr20:3673619G>T	ENST00000344754.4	-	14	3667	c.3668C>A	c.(3667-3669)aCc>aAc	p.T1223N	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.T1223N	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1223	Ig-like C2-type 12.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CAGGCGCAGGGTGTTGGGGAC	0.697																																					p.T1223N													.	.			0			c.C3668A												24.0	28.0	26.0					20																	3673619		2199	4291	6490	SO:0001583	missense	6614	exon14			CGCAGGGTGTTGG	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3668C>A	20.37:g.3673619G>T	ENSP00000341141:p.Thr1223Asn		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_023068	36	0.00	0	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	CCDS13060.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.16|15.16	2.750576|2.750576	0.49257|0.49257	.|.	.|.	ENSG00000088827|ENSG00000088827	ENST00000419548|ENST00000344754;ENST00000202578	.|T;T	.|0.73789	.|-0.78;-0.78	4.98|4.98	4.04|4.04	0.47022|0.47022	.|Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.41001	.|D	.|0.000965	T|T	0.80319|0.80319	0.4601|0.4601	L|L	0.56280|0.56280	1.765|1.765	0.31241|0.31241	N|N	0.69523|0.69523	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.984;0.998	T|T	0.77907|0.77907	-0.2412|-0.2412	5|10	.|0.33940	.|T	.|0.23	.|.	9.1314|9.1314	0.36848|0.36848	0.0988:0.0:0.9012:0.0|0.0988:0.0:0.9012:0.0	.|.	.|1223;1223	.|Q9BZZ2;Q9BZZ2-3	.|SN_HUMAN;.	Q|N	36|1223	.|ENSP00000341141:T1223N;ENSP00000202578:T1223N	.|ENSP00000202578:T1223N	H|T	-|-	3|2	2|0	SIGLEC1|SIGLEC1	3621619|3621619	0.416000|0.416000	0.25424|0.25424	1.000000|1.000000	0.80357|0.80357	0.782000|0.782000	0.44232|0.44232	1.616000|1.616000	0.36933|0.36933	1.338000|1.338000	0.45544|0.45544	-0.136000|-0.136000	0.14681|0.14681	CAC|ACC			0.697	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077761.2		NM_023068	
MMP11	4320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24124604	24124604	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr22:24124604C>A	ENST00000215743.3	+	7	1319	c.1267C>A	c.(1267-1269)Ccc>Acc	p.P423T	AP000349.1_ENST00000598975.1_Missense_Mutation_p.A204S	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	423					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	CAGTCCCGTGCCCCGCAGGGC	0.637																																					p.P423T													.	.			0			c.C1267A												44.0	37.0	39.0					22																	24124604		2203	4300	6503	SO:0001583	missense	4320	exon7			CCCGTGCCCCGCA		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.1267C>A	22.37:g.24124604C>A	ENSP00000215743:p.Pro423Thr		Somatic	86	0	0		WXS	Illumina HiSeq	.	81	0.17	14	NM_005940	94	0.22	21	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	37	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.600639	0.46423	.	.	ENSG00000099953	ENST00000215743	T	0.05786	3.39	4.93	4.93	0.64822	Hemopexin/matrixin (2);	0.051162	0.85682	D	0.000000	T	0.32912	0.0845	H	0.96633	3.855	0.45183	D	0.998199	D	0.71674	0.998	D	0.72982	0.979	T	0.30534	-0.9975	10	0.87932	D	0	.	7.101	0.25338	0.0:0.8186:0.0:0.1814	.	423	P24347	MMP11_HUMAN	T	423	ENSP00000215743:P423T	ENSP00000215743:P423T	P	+	1	0	MMP11	22454604	1.000000	0.71417	1.000000	0.80357	0.400000	0.30750	4.202000	0.58446	2.761000	0.94854	0.585000	0.79938	CCC			0.637	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319891.2		NM_005940	
SH3BP1	23616	mdanderson.org	37	22	38038946	38038946	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr22:38038946G>A	ENST00000357436.4	+	5	642	c.329G>A	c.(328-330)cGc>cAc	p.R110H	SH3BP1_ENST00000495174.1_3'UTR|Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000336738.5_Missense_Mutation_p.R110H|SH3BP1_ENST00000442465.2_Missense_Mutation_p.R110H|SH3BP1_ENST00000599616.1_Missense_Mutation_p.R46H	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	110	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CAGCTGGCCCGCATCCTGGCC	0.637											OREG0026546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R110H													.	.			0			c.G329A												66.0	58.0	61.0					22																	38038946		2203	4300	6503	SO:0001583	missense	23616	exon5			TGGCCCGCATCCT		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.329G>A	22.37:g.38038946G>A	ENSP00000350018:p.Arg110His		Somatic	49	0	0	875	WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_018957	82	0.01	1	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771751	0.49680	.	.	ENSG00000100092	ENST00000357436;ENST00000336738;ENST00000442465;ENST00000397014	T;T;T	0.62364	0.03;0.03;0.03	4.51	4.51	0.55191	BAR (2);	0.307267	0.23222	N	0.050551	T	0.64125	0.2570	L	0.34521	1.04	0.09310	N	0.999999	B;D;D;D;D	0.71674	0.121;0.998;0.998;0.998;0.998	B;P;P;P;P	0.61201	0.064;0.885;0.841;0.883;0.885	T	0.55379	-0.8150	10	0.51188	T	0.08	.	9.5579	0.39351	0.1059:0.0:0.8941:0.0	.	110;24;46;110;24	F5GZA8;E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;.;3BP1_HUMAN;.	H	110;110;110;24	ENSP00000350018:R110H;ENSP00000337213:R110H;ENSP00000395126:R110H	ENSP00000337213:R110H	R	+	2	0	SH3BP1	36368892	0.001000	0.12720	1.000000	0.80357	0.997000	0.91878	0.955000	0.29188	2.338000	0.79540	0.491000	0.48974	CGC			0.637	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075884.4		NM_018957	
CELSR1	9620	mdanderson.org	37	22	46931226	46931226	+	Silent	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr22:46931226G>A	ENST00000262738.3	-	1	1841	c.1842C>T	c.(1840-1842)ggC>ggT	p.G614G	CELSR1_ENST00000497509.1_5'Flank|CELSR1_ENST00000395964.1_Silent_p.G614G	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	614	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CAGCGCTGCCGCCCCCCAGAA	0.657																																					p.G614G													.	.			0			c.C1842T												24.0	26.0	25.0					22																	46931226		2203	4296	6499	SO:0001819	synonymous_variant	9620	exon1			GCTGCCGCCCCCC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1842C>T	22.37:g.46931226G>A			Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	22	0.14	3	NM_014246	5	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	CCDS14076.1																																																																																					0.657	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
GRAMD4	23151	broad.mit.edu;mdanderson.org	37	22	47022780	47022780	+	Silent	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr22:47022780G>T	ENST00000406902.1	+	2	297	c.84G>T	c.(82-84)tcG>tcT	p.S28S	GRAMD4_ENST00000361034.3_Silent_p.S28S|GRAMD4_ENST00000490378.1_3'UTR			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	28					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CAAATGCCTCGGACACCGAAT	0.582																																					p.S28S													GRAMD4,colon,carcinoma,+1,1	GRAMD4	53	1	0			c.G84T												152.0	122.0	132.0					22																	47022780		2203	4300	6503	SO:0001819	synonymous_variant	23151	exon1			TGCCTCGGACACC		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.84G>T	22.37:g.47022780G>T			Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	77	0.05	4	NM_015124	10	0.00	0	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Silent	SNP	ENST00000406902.1	37	CCDS33672.1																																																																																					0.582	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317969.1		NM_015124	
NT5DC2	64943	mdanderson.org	37	3	52558490	52558490	+	Missense_Mutation	SNP	C	C	T	rs200568224		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr3:52558490C>T	ENST00000307076.4	-	14	1959	c.1559G>A	c.(1558-1560)cGc>cAc	p.R520H	NT5DC2_ENST00000422318.2_Missense_Mutation_p.R557H|STAB1_ENST00000321725.6_3'UTR|NT5DC2_ENST00000307092.4_Missense_Mutation_p.R461H|NT5DC2_ENST00000459839.1_Missense_Mutation_p.R532H	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	520							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		GTGCCCTCAGCGGATGTGGGC	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19169	0.0		0.0	False		,,,				2504	0.0				p.R557H													NT5DC2,NS,carcinoma,-1,1	NT5DC2	-1	1	0			c.G1670A												82.0	92.0	89.0					3																	52558490		2203	4299	6502	SO:0001583	missense	64943	exon14			CCTCAGCGGATGT	AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.1559G>A	3.37:g.52558490C>T	ENSP00000302468:p.Arg520His		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001134231	430	0.00	0	C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	ENST00000307076.4	37	CCDS2858.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721767	0.89298	.	.	ENSG00000168268	ENST00000307092;ENST00000463947;ENST00000307076;ENST00000422318;ENST00000459839	T;T;T;T	0.27402	1.79;1.73;1.67;1.75	5.76	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	L	0.57536	1.79	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.66847	0.947;0.912;0.935	T	0.54173	-0.8333	10	0.87932	D	0	.	14.7716	0.69684	0.0:0.9308:0.0:0.0692	.	532;520;557	C9JTZ6;Q9H857;E9PAL9	.;NT5D2_HUMAN;.	H	461;194;520;557;532	ENSP00000306017:R461H;ENSP00000302468:R520H;ENSP00000406933:R557H;ENSP00000419547:R532H	ENSP00000302468:R520H	R	-	2	0	NT5DC2	52533530	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	4.596000	0.61055	1.457000	0.47850	-0.136000	0.14681	CGC			0.622	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000351509.1		NM_022908	
ADCY5	111	mdanderson.org	37	3	123071367	123071367	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr3:123071367G>T	ENST00000462833.1	-	2	2408	c.1196C>A	c.(1195-1197)cCg>cAg	p.P399Q	ADCY5_ENST00000309879.5_Missense_Mutation_p.P49Q|ADCY5_ENST00000470367.1_5'UTR|ADCY5_ENST00000491190.1_Missense_Mutation_p.P32Q	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	399					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GACCTCAGCCGGATAGTGGGT	0.597																																					p.P399Q													.	.			0			c.C1196A												73.0	73.0	73.0					3																	123071367		2203	4300	6503	SO:0001583	missense	111	exon2			TCAGCCGGATAGT	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1196C>A	3.37:g.123071367G>T	ENSP00000419361:p.Pro399Gln		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_183357	3	0.00	0	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890212	0.91889	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;T;T	0.81078	-1.04;-1.45;-1.42	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000001	D	0.88254	0.6387	M	0.79805	2.47	0.80722	D	1	P;D	0.59767	0.914;0.986	B;P	0.56960	0.247;0.81	D	0.89136	0.3513	10	0.52906	T	0.07	.	18.4045	0.90529	0.0:0.0:1.0:0.0	.	399;32	O95622;B3KWA8	ADCY5_HUMAN;.	Q	399;32;49	ENSP00000419361:P399Q;ENSP00000418537:P32Q;ENSP00000308685:P49Q	ENSP00000308685:P49Q	P	-	2	0	ADCY5	124554057	1.000000	0.71417	0.955000	0.39395	0.762000	0.43233	7.748000	0.85085	2.571000	0.86741	0.561000	0.74099	CCG			0.597	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355889.4		XM_171048	
ERICH6	131831	mdanderson.org	37	3	150421527	150421527	+	Silent	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr3:150421527C>T	ENST00000295910.6	-	1	211	c.159G>A	c.(157-159)gaG>gaA	p.E53E	RP11-103G8.2_ENST00000471093.1_RNA|RP11-103G8.2_ENST00000475393.1_RNA|FAM194A_ENST00000491361.1_Intron	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ccaccacctcctcctcctcct	0.602																																					p.E53E													.	.			0			c.G159A																																									SO:0001819	synonymous_variant	131831	exon1			CACCTCCTCCTCC																												ENST00000295910.6:c.159G>A	3.37:g.150421527C>T			Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	133	0.07	9	NM_152394	0		0		Silent	SNP	ENST00000295910.6	37	CCDS3151.2																																																																																					0.602	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257666.1			
CPN2	1370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	194062671	194062671	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr3:194062671G>T	ENST00000323830.3	-	2	850	c.761C>A	c.(760-762)aCg>aAg	p.T254K	CPN2_ENST00000429275.1_Missense_Mutation_p.T254K	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	254					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)	p.T254K(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		CGGCAGGTGCGTGATGGCGTT	0.597																																					p.T254K													CPN2,NS,carcinoma,0,1	CPN2	0	1	1	Substitution - Missense(1)	lung(1)	c.C761A												47.0	49.0	48.0					3																	194062671		2203	4300	6503	SO:0001583	missense	1370	exon2			AGGTGCGTGATGG	J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.761C>A	3.37:g.194062671G>T	ENSP00000319464:p.Thr254Lys		Somatic	126	0	0		WXS	Illumina HiSeq	.	158	0.11	18	NM_001080513	3	0.00	0	B2RPE7|Q86SU4|Q8N5V4	Missense_Mutation	SNP	ENST00000323830.3	37	CCDS33920.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.445029	0.00178	.	.	ENSG00000178772	ENST00000323830;ENST00000429275	T;T	0.10763	2.84;2.84	5.05	-1.03	0.10102	.	2.956720	0.01430	N	0.014703	T	0.08846	0.0219	L	0.45228	1.405	0.09310	N	1	B	0.15473	0.013	B	0.17098	0.017	T	0.26815	-1.0092	10	0.09084	T	0.74	.	3.2569	0.06835	0.125:0.3226:0.3917:0.1607	.	254	P22792	CPN2_HUMAN	K	254	ENSP00000319464:T254K;ENSP00000402232:T254K	ENSP00000319464:T254K	T	-	2	0	CPN2	195544366	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.200000	0.17257	-0.092000	0.12417	-0.311000	0.09066	ACG			0.597	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342856.2		NM_001080513	
DOK7	285489	mdanderson.org	37	4	3494873	3494873	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr4:3494873C>A	ENST00000340083.5	+	7	1225	c.1160C>A	c.(1159-1161)aCc>aAc	p.T387N	DOK7_ENST00000389653.2_Missense_Mutation_p.T387N|DOK7_ENST00000512714.1_3'UTR|DOK7_ENST00000507039.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	387					neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		AGCCTGTGCACCTGCCTGCCC	0.692																																					p.T387N													.	.			0			c.C1160A												11.0	12.0	11.0					4																	3494873		2180	4282	6462	SO:0001583	missense	285489	exon7			TGTGCACCTGCCT	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.1160C>A	4.37:g.3494873C>A	ENSP00000344432:p.Thr387Asn		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_173660	1	0.00	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	.	.	.	.	.	.	.	.	.	.	c	10.72	1.429009	0.25726	.	.	ENSG00000175920	ENST00000389653;ENST00000340083	T;T	0.70164	-0.46;-0.36	3.77	2.93	0.34026	.	0.282688	0.32147	N	0.006507	T	0.54143	0.1840	L	0.32530	0.975	0.24048	N	0.996052	B;P;B	0.42409	0.256;0.779;0.072	B;B;B	0.41036	0.062;0.346;0.026	T	0.45991	-0.9223	10	0.39692	T	0.17	-23.9499	10.5809	0.45255	0.0:0.9048:0.0:0.0952	.	387;249;387	Q18PE1-3;Q18PE1-2;Q18PE1	.;.;DOK7_HUMAN	N	387	ENSP00000374304:T387N;ENSP00000344432:T387N	ENSP00000344432:T387N	T	+	2	0	DOK7	3464671	0.155000	0.22806	0.367000	0.25926	0.079000	0.17450	0.794000	0.26958	0.818000	0.34468	-0.263000	0.10527	ACC			0.692	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000313538.1		NM_173660	
OTUD4	54726	bcgsc.ca	37	4	146059006	146059006	+	Missense_Mutation	SNP	G	G	A	rs558808115		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr4:146059006G>A	ENST00000447906.2	-	21	3108	c.2921C>T	c.(2920-2922)aCt>aTt	p.T974I	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Missense_Mutation_p.T909I			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	974					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AACAGGCACAGTTTCTCTCTC	0.463																																					p.T909I													OTUD4,NS,carcinoma,0,5	OTUD4	120	5	0			c.C2726T												128.0	133.0	131.0					4																	146059006		2203	4300	6503	SO:0001583	missense	54726	exon21			GGCACAGTTTCTC		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2921C>T	4.37:g.146059006G>A	ENSP00000395487:p.Thr974Ile		Somatic	186	0.0161290323	3		WXS	Illumina HiSeq	Phase_1	116	0.06	7	NM_001102653	48	0.00	0	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37		.	.	.	.	.	.	.	.	.	.	G	13.28	2.191504	0.38707	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.34275	1.37;1.37	6.17	5.33	0.75918	.	1.059000	0.07258	N	0.867023	T	0.32793	0.0841	N	0.24115	0.695	0.80722	D	1	B;B	0.13145	0.007;0.004	B;B	0.14023	0.01;0.004	T	0.02275	-1.1184	10	0.59425	D	0.04	-0.3286	15.5098	0.75772	0.0658:0.0:0.9342:0.0	.	974;973	G3V0I6;Q01804	.;OTUD4_HUMAN	I	909;974	ENSP00000409279:T909I;ENSP00000395487:T974I	ENSP00000395487:T974I	T	-	2	0	OTUD4	146278456	0.027000	0.19231	0.108000	0.21378	0.880000	0.50808	2.210000	0.42816	1.621000	0.50320	0.655000	0.94253	ACT			0.463	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000365117.2		NM_017493	
BRD8	10902	mdanderson.org	37	5	137513290	137513290	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr5:137513290G>T	ENST00000254900.5	-	2	457	c.86C>A	c.(85-87)tCt>tAt	p.S29Y	KIF20A_ENST00000394894.3_5'Flank|KIF20A_ENST00000508792.1_5'Flank|BRD8_ENST00000411594.2_Missense_Mutation_p.S29Y|BRD8_ENST00000455658.2_Silent_p.I11I|BRD8_ENST00000230901.5_Missense_Mutation_p.S29Y|BRD8_ENST00000402931.1_Missense_Mutation_p.S29Y	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	29					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CATGACAGAAGATGCTAAACA	0.428																																					p.S29Y													.	.			0			c.C86A												125.0	115.0	118.0					5																	137513290		2203	4300	6503	SO:0001583	missense	10902	exon2			ACAGAAGATGCTA	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.86C>A	5.37:g.137513290G>T	ENSP00000254900:p.Ser29Tyr		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_139199	68	0.00	0	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.424515|5.424515	0.96111|0.96111	.|.	.|.	ENSG00000112983|ENSG00000112983	ENST00000441656|ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000430331	.|T;T;T;T;T;T;T	.|0.30182	.|1.54;1.54;1.54;1.54;1.54;1.54;1.54	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.052912	.|0.85682	.|D	.|0.000000	T|T	0.56441|0.56441	0.1985|0.1985	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.997;0.997;0.999	.|D;D;D	.|0.83275	.|0.994;0.994;0.996	T|T	0.54490|0.54490	-0.8286|-0.8286	5|10	.|0.87932	.|D	.|0	-11.4378|-11.4378	19.5352|19.5352	0.95251|0.95251	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|29;29;29	.|Q9H0E9-4;Q9H0E9-2;Q9H0E9	.|.;.;BRD8_HUMAN	I|Y	23|29;24;24;29;29;29;29	.|ENSP00000254900:S29Y;ENSP00000398067:S24Y;ENSP00000398873:S24Y;ENSP00000230901:S29Y;ENSP00000384845:S29Y;ENSP00000394330:S29Y;ENSP00000407414:S29Y	.|ENSP00000230901:S29Y	L|S	-|-	1|2	0|0	BRD8|BRD8	137541189|137541189	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	9.662000|9.662000	0.98603|0.98603	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	CTT|TCT			0.428	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251282.3		NM_006696	
TNXB	7148	hgsc.bcm.edu	37	6	32024600	32024600	+	Missense_Mutation	SNP	T	T	C	rs369180703		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr6:32024600T>C	ENST00000375244.3	-	23	8107	c.7906A>G	c.(7906-7908)Atg>Gtg	p.M2636V	TNXB_ENST00000375247.2_Missense_Mutation_p.M2636V			P22105	TENX_HUMAN	tenascin XB	2696	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCATCTGTCATGGTCAGCTCC	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		14585	0.001		0.0	False		,,,				2504	0.0				p.M2636V													TNXB_ENST00000375247,NS,carcinoma,0,2	TNXB_ENST00000375247	0	2	0			c.A7906G												93.0	108.0	103.0					6																	32024600		1332	2580	3912	SO:0001583	missense	7148	exon23			CTGTCATGGTCAG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.7906A>G	6.37:g.32024600T>C	ENSP00000364393:p.Met2636Val		Somatic	133	0.015037594	2		WXS	Illumina HiSeq	.	120	0.04	5	NM_019105	22	0.00	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	0.016	-1.525769	0.00959	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.50277	0.75;0.75	4.09	4.09	0.47781	.	0.000000	0.44902	N	0.000410	T	0.01287	0.0042	N	0.00002	-3.62	0.20821	N	0.999849	B	0.02656	0.0	B	0.01281	0.0	T	0.44267	-0.9339	10	0.02654	T	1	.	9.2792	0.37718	0.0:0.8947:0.0:0.1053	.	2636	P22105-3	.	V	2636	ENSP00000364393:M2636V;ENSP00000364396:M2636V	ENSP00000364393:M2636V	M	-	1	0	TNXB	32132578	0.967000	0.33354	0.740000	0.30986	0.312000	0.27988	2.493000	0.45320	0.726000	0.32339	-0.665000	0.03846	ATG			0.622	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000268927.2		NM_019105	
ETV7	51513	mdanderson.org	37	6	36343801	36343801	+	Missense_Mutation	SNP	C	C	T	rs145194281	byFrequency	TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr6:36343801C>T	ENST00000340181.4	-	3	395	c.154G>A	c.(154-156)Gca>Aca	p.A52T	ETV7_ENST00000373737.4_Missense_Mutation_p.A52T|ETV7_ENST00000339796.5_Missense_Mutation_p.A52T|ETV7_ENST00000373738.1_Intron|ETV7_ENST00000538992.1_Intron	NM_001207037.1|NM_001207040.1|NM_016135.3	NP_001193966.1|NP_001193969.1|NP_057219.1	Q9Y603	ETV7_HUMAN	ets variant 7	52	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(4)	10						CTCCACAGTGCGGGCTGGATG	0.632													C|||	2	0.000399361	0.0	0.0	5008	,	,		18610	0.001		0.0	False		,,,				2504	0.001				p.A52T													ETV7,caecum,carcinoma,0,1	ETV7	0	1	0			c.G154A							C	,,,,,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	60.0	50.0	53.0		,,,,,154,154,154	0.2	0.8	6	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	no	intron,utr-5,intron,utr-5,intron,missense,missense,missense	ETV7	NM_001207036.1,NM_001207037.1,NM_001207039.1,NM_001207040.1,NM_001207041.1,NM_016135.3,NM_001207038.1,NM_001207035.1	,,,,,58,58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,benign,benign,benign	,,,,,52/342,52/265,52/318	36343801	1,13005	2203	4300	6503	SO:0001583	missense	51513	exon3			ACAGTGCGGGCTG	AF116508	CCDS4819.1, CCDS56422.1, CCDS56423.1, CCDS56424.1, CCDS56425.1, CCDS75440.1, CCDS75441.1	6p21	2008-09-12	2008-09-12		ENSG00000010030	ENSG00000010030			18160	protein-coding gene	gene with protein product	"""TEL2 oncogene"""	605255	"""ets variant gene 7 (TEL2 oncogene)"""			10828014, 11108721	Standard	NM_016135		Approved	TEL2, TEL-2	uc003omb.3	Q9Y603	OTTHUMG00000014594	ENST00000340181.4:c.154G>A	6.37:g.36343801C>T	ENSP00000341843:p.Ala52Thr		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_016135	4	0.00	0	B3KVC2|B4DVB6|B4E1G4|Q5R3L3|Q5R3L4|Q9NZ65|Q9NZ66|Q9NZ68|Q9NZR8|Q9UNJ7|Q9Y5K4|Q9Y604	Missense_Mutation	SNP	ENST00000340181.4	37	CCDS4819.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	4.749	0.139218	0.09083	0.0	1.16E-4	ENSG00000010030	ENST00000339796;ENST00000340181;ENST00000373737	T;T;T	0.28895	1.59;1.59;1.59	3.63	0.148	0.14843	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.218446	0.40385	N	0.001114	T	0.04182	0.0116	N	0.16656	0.425	0.47778	D	0.999515	B;B;B	0.15719	0.003;0.011;0.014	B;B;B	0.18263	0.001;0.006;0.021	T	0.32745	-0.9895	10	0.07175	T	0.84	.	4.9295	0.13910	0.25:0.5209:0.0:0.2291	.	52;52;52	Q9Y603-7;Q9Y603;Q9Y603-5	.;ETV7_HUMAN;.	T	52	ENSP00000342260:A52T;ENSP00000341843:A52T;ENSP00000362842:A52T	ENSP00000342260:A52T	A	-	1	0	ETV7	36451779	0.961000	0.32948	0.806000	0.32338	0.105000	0.19272	2.493000	0.45320	0.099000	0.17552	-0.998000	0.02512	GCA			0.632	ETV7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040341.1		NM_016135	
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	111714087	111714087	+	Silent	SNP	T	T	C			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr6:111714087T>C	ENST00000358835.3	-	6	1108	c.654A>G	c.(652-654)gaA>gaG	p.E218E	REV3L_ENST00000435970.1_Silent_p.E140E|REV3L_ENST00000368805.1_Silent_p.E218E|REV3L_ENST00000368802.3_Silent_p.E218E			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	218					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ACCTTGGTATTTCATCTTGTT	0.313								DNA polymerases (catalytic subunits)																													p.E218E													.	.			0			c.A654G												67.0	68.0	68.0					6																	111714087		2203	4298	6501	SO:0001819	synonymous_variant	5980	exon5			TGGTATTTCATCT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.654A>G	6.37:g.111714087T>C			Somatic	174	0	0		WXS	Illumina HiSeq	.	140	0.27	38	NM_002912	1	0.00	0	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																					0.313	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043695.1		NM_002912	
TXLNB	167838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	139569008	139569008	+	Silent	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr6:139569008G>A	ENST00000358430.3	-	8	1348	c.1116C>T	c.(1114-1116)agC>agT	p.S372S	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	372						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		TAGTTAGTGTGCTCTGGAATT	0.378																																					p.S372S													.	.			0			c.C1116T												159.0	157.0	158.0					6																	139569008		2203	4300	6503	SO:0001819	synonymous_variant	167838	exon8			TAGTGTGCTCTGG		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1116C>T	6.37:g.139569008G>A			Somatic	197	0	0		WXS	Illumina HiSeq	.	143	0.22	31	NM_153235	0		0	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Silent	SNP	ENST00000358430.3	37	CCDS34545.1																																																																																					0.378	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042458.1		NM_153235	
UTRN	7402	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	144780096	144780096	+	Silent	SNP	C	C	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr6:144780096C>T	ENST00000367545.3	+	19	2475	c.2475C>T	c.(2473-2475)tcC>tcT	p.S825S		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	825	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AACACACTTCCATTTCTGAAT	0.443																																					p.S825S													.	UTRN	327		0			c.C2475T												56.0	57.0	57.0					6																	144780096		2203	4300	6503	SO:0001819	synonymous_variant	7402	exon19			CACTTCCATTTCT	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2475C>T	6.37:g.144780096C>T			Somatic	133	0.015037594	2		WXS	Illumina HiSeq	Phase_I	114	0.30	34	NM_007124	3	0.00	0	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	ENST00000367545.3	37	CCDS34547.1																																																																																					0.443	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042551.1			
SYNE1	23345	broad.mit.edu;mdanderson.org	37	6	152631005	152631005	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr6:152631005G>A	ENST00000367255.5	-	90	17768	c.17167C>T	c.(17167-17169)Cag>Tag	p.Q5723*	SYNE1_ENST00000341594.5_Nonsense_Mutation_p.Q5335*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.Q5652*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.Q5723*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.Q5652*|SYNE1_ENST00000356820.4_Nonsense_Mutation_p.Q247*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5723					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCGGTGTGCTGCAGCCGGCTG	0.582										HNSCC(10;0.0054)																											p.Q5723X													.	SYNE1	3227		0			c.C17167T												61.0	58.0	59.0					6																	152631005		2203	4300	6503	SO:0001587	stop_gained	23345	exon90			TGTGCTGCAGCCG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.17167C>T	6.37:g.152631005G>A	ENSP00000356224:p.Gln5723*		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	46	0.09	4	NM_182961	3	0.00	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	41	8.762490	0.98943	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	.	.	.	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	20.6282	0.99521	0.0:0.0:1.0:0.0	.	.	.	.	X	5723;5652;5723;5652;5335;247	.	ENSP00000265368:Q5723X	Q	-	1	0	SYNE1	152672698	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.726000	0.98782	2.871000	0.98454	0.655000	0.94253	CAG			0.582	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000334755.2		NM_182961	
GRB10	2887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50671755	50671755	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr7:50671755T>A	ENST00000401949.1	-	17	1953	c.1484A>T	c.(1483-1485)cAc>cTc	p.H495L	GRB10_ENST00000406641.1_Missense_Mutation_p.H437L|GRB10_ENST00000398810.2_Missense_Mutation_p.H437L|GRB10_ENST00000407526.1_Missense_Mutation_p.H437L|GRB10_ENST00000402497.1_Missense_Mutation_p.H437L|GRB10_ENST00000439599.1_Missense_Mutation_p.H489L|GRB10_ENST00000357271.5_Missense_Mutation_p.H449L|GRB10_ENST00000335866.3_Missense_Mutation_p.H437L|GRB10_ENST00000403097.1_Missense_Mutation_p.H489L|GRB10_ENST00000398812.2_Missense_Mutation_p.H495L|GRB10_ENST00000402578.1_Missense_Mutation_p.H437L			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	495	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					GATCCTCCCGTGAAACCAGTG	0.542									Russell-Silver syndrome																												p.H495L													.	.			0			c.A1484T												168.0	169.0	168.0					7																	50671755		1974	4163	6137	SO:0001583	missense	2887	exon14	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	CTCCCGTGAAACC		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.1484A>T	7.37:g.50671755T>A	ENSP00000385770:p.His495Leu		Somatic	85	0	0		WXS	Illumina HiSeq	.	77	0.10	8	NM_005311	55	0.27	15	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Missense_Mutation	SNP	ENST00000401949.1	37	CCDS43582.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.485077	0.84854	.	.	ENSG00000106070	ENST00000398812;ENST00000439599;ENST00000335866;ENST00000398810;ENST00000402578;ENST00000403097;ENST00000406641;ENST00000357271;ENST00000407526;ENST00000401949;ENST00000398791;ENST00000402497	T;T;T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.36	4.17	0.49024	SH2 motif (5);	0.089996	0.85682	N	0.000000	T	0.73241	0.3562	M	0.91140	3.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78026	-0.2365	10	0.87932	D	0	-32.6638	12.0141	0.53303	0.0:0.0:0.1448:0.8551	.	489;449;495	Q13322-4;Q13322-2;Q13322	.;.;GRB10_HUMAN	L	495;489;437;437;437;489;437;449;437;495;27;437	ENSP00000381793:H495L;ENSP00000406716:H489L;ENSP00000338543:H437L;ENSP00000381790:H437L;ENSP00000385189:H437L;ENSP00000385544:H489L;ENSP00000385366:H437L;ENSP00000349818:H449L;ENSP00000385046:H437L;ENSP00000385770:H495L;ENSP00000385748:H437L	ENSP00000338543:H437L	H	-	2	0	GRB10	50639249	1.000000	0.71417	0.429000	0.26710	0.971000	0.66376	7.677000	0.84024	0.815000	0.34398	0.533000	0.62120	CAC			0.542	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319157.1			
DPY19L2P2	349152	broad.mit.edu	37	7	102883442	102883442	+	RNA	SNP	A	A	G			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr7:102883442A>G	ENST00000312132.4	-	0	2667							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										AAACCTCTCCATGGTTGAAAA	0.299																																					.													.	.			0			.																																											0	.			CTCTCCATGGTTG	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102883442A>G			Somatic	305	0	0		WXS	Illumina HiSeq	Phase_I	349	0.01	5	.	0		0	Q8N9V4|Q8ND62	RNA	SNP	ENST00000312132.4	37																																																																																						0.299	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000347877.1		NM_182634	
LINC00529	83647	broad.mit.edu	37	8	11114186	11114186	+	lincRNA	DEL	A	A	-			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr8:11114186delA	ENST00000443854.1	-	0	77									long intergenic non-protein coding RNA 529																		AACAAGCCTTAAAAAAAAAAG	0.418																																					.													.	.			0			.																																											0	.			AGCCTTAAAAAAA	AJ301561		8p23-p22	2012-10-12	2011-12-08	2011-12-08	ENSG00000236827	ENSG00000236827		"""Long non-coding RNAs"""	15544	non-coding RNA	RNA, long non-coding			"""chromosome 8 open reading frame 8"""	C8orf8		11896452	Standard			Approved				OTTHUMG00000165427		8.37:g.11114186delA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000443854.1	37																																																																																						0.418	LINC00529-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000383957.1			
PHF20L1	51105	broad.mit.edu	37	8	133826909	133826909	+	Frame_Shift_Del	DEL	A	A	-			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr8:133826909delA	ENST00000395386.2	+	10	1257	c.958delA	c.(958-960)aaafs	p.K321fs	PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000395390.2_Frame_Shift_Del_p.K296fs	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	321							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TCAAAGTCAGAAAAAAAATGA	0.348																																					p.K320fs													.	PHF20L1	129		0			c.958delA												68.0	73.0	71.0					8																	133826909		2203	4300	6503	SO:0001589	frameshift_variant	51105	exon10			AGTCAGAAAAAAA	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.958delA	8.37:g.133826909delA	ENSP00000378784:p.Lys321fs		Somatic	230	0	0		WXS	Illumina HiSeq	Phase_I	243	0.03	7	NM_016018	29	0.00	0	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Frame_Shift_Del	DEL	ENST00000395386.2	37	CCDS6367.2																																																																																					0.348	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000308949.3		NM_016018	
PSIP1	11168	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	15472670	15472672	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr9:15472670_15472672delCTG	ENST00000380733.4	-	10	1278_1280	c.935_937delCAG	c.(934-939)gcagat>gat	p.A312del	PSIP1_ENST00000380716.4_In_Frame_Del_p.A312del|PSIP1_ENST00000380738.4_In_Frame_Del_p.A312del|PSIP1_ENST00000380715.1_In_Frame_Del_p.A312del|PSIP1_ENST00000397519.2_In_Frame_Del_p.A312del			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	312					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CGTTTTCGATCTGCTGCTTCTTT	0.369																																					p.312_313del													.	PSIP1	93		0			c.936_938del																																									SO:0001651	inframe_deletion	11168	exon10			TTCGATCTGCTGC	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.935_937delCAG	9.37:g.15472673_15472675delCTG	ENSP00000370109:p.Ala312del		Somatic	170	0	0		WXS	Illumina HiSeq	.	201	0.21	43	NM_001128217	403	0.00	0	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	In_Frame_Del	DEL	ENST00000380733.4	37	CCDS6479.1																																																																																					0.369	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055445.1		NM_033222	
AQP7	364	mdanderson.org	37	9	33385287	33385287	+	3'UTR	SNP	T	T	C	rs74557595		TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chr9:33385287T>C	ENST00000537089.1	-	0	1145				AQP7_ENST00000377425.4_Intron			O14520	AQP7_HUMAN	aquaporin 7						excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TTCTCCCCATTGCTGCAGGCA	0.612																																					p.N249D													.	.			0			c.A745G												59.0	62.0	61.0					9																	33385287		2202	4298	6500	SO:0001624	3_prime_UTR_variant	364	exon8			CCCCATTGCTGCA	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.*329A>G	9.37:g.33385287T>C			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_001170	2	0.00	0	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	c	9.798	1.179797	0.21787	.	.	ENSG00000165269	ENST00000379507;ENST00000297988;ENST00000439678	T;T;T	0.11063	2.81;2.81;2.81	4.27	3.35	0.38373	Aquaporin-like (2);	.	.	.	.	T	0.07683	0.0193	.	.	.	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.35301	-0.9794	8	0.39692	T	0.17	-1.4238	6.1852	0.20493	0.0:0.7595:0.0:0.2405	.	249	O14520	AQP7_HUMAN	D	248;249;157	ENSP00000368821:N248D;ENSP00000297988:N249D;ENSP00000410138:N157D	ENSP00000297988:N249D	N	-	1	0	AQP7	33375287	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.126000	0.15769	0.443000	0.26582	-0.251000	0.11542	AAT			0.612	AQP7-202	KNOWN	basic	protein_coding	protein_coding				NM_001170	
MT-ND1	4535	hgsc.bcm.edu	37	M	1024	1024	+	5'Flank	SNP	G	G	A			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chrM:1024G>A	ENST00000361390.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAAATAGACTACGAAAGTGGC	0.403																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			GACTACGAAAGTG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1024G>A	Exception_encountered		Somatic	126	0	0		WXS	Illumina HiSeq	.	33	0.82	27	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.403	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
SYTL4	94121	mdanderson.org	37	X	99956557	99956557	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Y-01A-11D-A435-10	TCGA-YU-A90Y-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	32056480-ba82-46ee-bed1-c4ec50b3614c	68dac3a8-75ad-4877-bccf-f8e831ed8b21	g.chrX:99956557G>T	ENST00000372989.1	-	5	554	c.223C>A	c.(223-225)Ccc>Acc	p.P75T	SYTL4_ENST00000263033.5_Missense_Mutation_p.P75T|SYTL4_ENST00000276141.6_Missense_Mutation_p.P75T|SYTL4_ENST00000372981.1_Missense_Mutation_p.P75T|SYTL4_ENST00000454200.2_Missense_Mutation_p.P75T|SYTL4_ENST00000455616.1_Missense_Mutation_p.P75T	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	75	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTGGTTTTGGGACTCAAACGG	0.557																																					p.P75T													.	.			0			c.C223A												93.0	81.0	85.0					X																	99956557		2203	4300	6503	SO:0001583	missense	94121	exon4			TTTTGGGACTCAA		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.223C>A	X.37:g.99956557G>T	ENSP00000362080:p.Pro75Thr		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001129896	1	0.00	0	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936329	0.34189	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	T;T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88	5.25	3.43	0.39272	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.286234	0.40144	N	0.001175	T	0.65749	0.2721	L	0.29908	0.895	0.19300	N	0.999971	P;B	0.41232	0.743;0.148	P;B	0.45232	0.474;0.075	T	0.56432	-0.7980	9	.	.	.	-9.9427	10.8334	0.46673	0.1631:0.0:0.8369:0.0	.	75;75	Q96C24-2;Q96C24	.;SYTL4_HUMAN	T	75	ENSP00000362080:P75T;ENSP00000390252:P75T;ENSP00000403556:P75T;ENSP00000276141:P75T;ENSP00000263033:P75T;ENSP00000362072:P75T	.	P	-	1	0	SYTL4	99843213	1.000000	0.71417	0.569000	0.28460	0.893000	0.52053	2.351000	0.44071	1.089000	0.41292	0.600000	0.82982	CCC			0.557	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000057488.1		NM_080737	
