#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF16	27237	mdanderson.org	37	1	3397126	3397126	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:3397126G>T	ENST00000378378.4	+	15	2510	c.2105G>T	c.(2104-2106)cGt>cTt	p.R702L	ARHGEF16_ENST00000413250.2_Missense_Mutation_p.R406L|ARHGEF16_ENST00000378373.1_Missense_Mutation_p.R414L|ARHGEF16_ENST00000378371.2_Missense_Mutation_p.R414L	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	702					activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		AGGATGGAGCGTCTGCGGGTG	0.662																																					p.R702L													.	.			0			c.G2105T												41.0	37.0	38.0					1																	3397126		2201	4294	6495	SO:0001583	missense	27237	exon15			TGGAGCGTCTGCG	D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.2105G>T	1.37:g.3397126G>T	ENSP00000367629:p.Arg702Leu		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	20	0.20	4	NM_014448	52	0.00	0	Q86TF0|Q99434	Missense_Mutation	SNP	ENST00000378378.4	37	CCDS46.2	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456653	0.84317	.	.	ENSG00000130762	ENST00000378378;ENST00000378373;ENST00000378371;ENST00000413250	T;T;T;T	0.78003	-0.95;-0.6;-0.6;-1.14	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.88980	0.6585	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90372	0.4381	10	0.87932	D	0	-38.3556	18.7336	0.91746	0.0:0.0:1.0:0.0	.	406;702	B4DJM7;Q5VV41	.;ARHGG_HUMAN	L	702;414;414;406	ENSP00000367629:R702L;ENSP00000367624:R414L;ENSP00000367622:R414L;ENSP00000408887:R406L	ENSP00000367622:R414L	R	+	2	0	ARHGEF16	3386986	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	8.786000	0.91826	2.437000	0.82529	0.462000	0.41574	CGT			0.662	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001515.1		NM_014448	
CASZ1	54897	mdanderson.org	37	1	10699273	10699273	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:10699273G>T	ENST00000377022.3	-	21	5323	c.5006C>A	c.(5005-5007)gCa>gAa	p.A1669E	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1669	Ala-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CTCCCCAGCTgcggcggcggc	0.806																																					p.A1669E													.	.			0			c.C5006A												2.0	2.0	2.0					1																	10699273		1245	2649	3894	SO:0001583	missense	54897	exon21			CCAGCTGCGGCGG	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.5006C>A	1.37:g.10699273G>T	ENSP00000366221:p.Ala1669Glu		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_001079843	0		0	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.937674	0.34189	.	.	ENSG00000130940	ENST00000377022	.	.	.	0.826	0.826	0.18829	.	1.332390	0.06449	U	0.727344	T	0.24509	0.0594	N	0.14661	0.345	0.09310	N	0.999993	B	0.06786	0.001	B	0.01281	0.0	T	0.21484	-1.0244	9	0.33940	T	0.23	-0.8002	5.49	0.16771	0.0:0.0:1.0:0.0	.	1669	Q86V15	CASZ1_HUMAN	E	1669	.	ENSP00000366221:A1669E	A	-	2	0	CASZ1	10621860	0.001000	0.12720	0.043000	0.18650	0.177000	0.22998	0.000000	0.12993	0.891000	0.36235	0.000000	0.15137	GCA			0.806	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005673.2		NM_017766	
KIAA2013	90231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11982843	11982843	+	Missense_Mutation	SNP	A	A	C			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:11982843A>C	ENST00000376572.3	-	2	1922	c.1737T>G	c.(1735-1737)caT>caG	p.H579Q	KIAA2013_ENST00000376576.3_Missense_Mutation_p.H579Q	NM_138346.2	NP_612355.1	Q8IYS2	K2013_HUMAN	KIAA2013	579						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGTGCTCATCATGGGCCAGGA	0.612																																					p.H579Q													.	.			0			c.T1737G												46.0	42.0	43.0					1																	11982843		2203	4300	6503	SO:0001583	missense	90231	exon2			CTCATCATGGGCC	AB095933	CCDS141.1	1p36.22	2011-02-09			ENSG00000116685	ENSG00000116685			28513	protein-coding gene	gene with protein product						12477932	Standard	NM_138346		Approved	MGC33867, RP5-1077B9.1	uc001atk.3	Q8IYS2	OTTHUMG00000002391	ENST00000376572.3:c.1737T>G	1.37:g.11982843A>C	ENSP00000365756:p.His579Gln		Somatic	195	0	0		WXS	Illumina HiSeq	.	237	0.30	72	NM_138346	374	0.32	120	Q5JXC1|Q8IVF8|Q8NDI7|Q9BSY1	Missense_Mutation	SNP	ENST00000376572.3	37	CCDS141.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.210108	0.58343	.	.	ENSG00000116685	ENST00000376572;ENST00000376576	.	.	.	5.82	0.504	0.16946	.	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	M	0.65975	2.015	0.58432	D	0.999993	D;D	0.76494	0.999;0.999	D;D	0.78314	0.984;0.991	T	0.68637	-0.5356	9	0.87932	D	0	-27.0168	9.9911	0.41872	0.5094:0.0:0.4906:0.0	.	579;579	Q8IYS2-2;Q8IYS2	.;K2013_HUMAN	Q	579	.	ENSP00000365756:H579Q	H	-	3	2	KIAA2013	11905430	0.995000	0.38212	0.999000	0.59377	0.918000	0.54935	0.315000	0.19451	0.093000	0.17368	-0.917000	0.02746	CAT			0.612	KIAA2013-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006858.1		NM_138346	
SPEN	23013	hgsc.bcm.edu	37	1	16174549	16174549	+	5'UTR	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:16174549G>T	ENST00000375759.3	+	0	191				RP11-169K16.9_ENST00000317122.1_RNA	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GCGGTCGCCGGCACGCCGCCC	0.706																																					.													.	.			0			.												19.0	18.0	18.0					1																	16174549		2123	4195	6318	SO:0001623	5_prime_UTR_variant	23013	.			TCGCCGGCACGCC		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.-14G>T	1.37:g.16174549G>T			Somatic	104	0	0		WXS	Illumina HiSeq	.	100	0.13	13	.	15	0.13	2	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	RNA	SNP	ENST00000375759.3	37	CCDS164.1																																																																																					0.706	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025993.1		NM_015001	
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:16918653C>T	ENST00000430580.2	-	6	853		c.e6+1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																																					.													.	.			0			.																																									SO:0001630	splice_region_variant	55672	.			AACTTACTGTTGT	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.34+1G>A	1.37:g.16918653C>T			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	50	0.08	4	.	1	0.00	0	Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37																																																																																						0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000106436.3		NM_017940	Intron
DNM3	26052	hgsc.bcm.edu	37	1	171810829	171810829	+	Silent	SNP	G	G	T	rs376123360		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:171810829G>T	ENST00000355305.5	+	1	190	c.33G>T	c.(31-33)ccG>ccT	p.P11P	DNM3_ENST00000367731.1_Silent_p.P11P|DNM3_ENST00000367733.2_Silent_p.P11P|DNM3_ENST00000358155.4_Silent_p.P11P|DNM3_ENST00000520906.1_Silent_p.P11P			Q9UQ16	DYN3_HUMAN	dynamin 3	11					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AGCTGATCCCGCTGGTGAACC	0.692																																					p.P11P													DNM3,caecum,carcinoma,+1,1	DNM3	1	1	0			c.G33T							G	,	1,4293		0,1,2146	23.0	32.0	29.0		33,33	-7.3	0.8	1		29	0,8538		0,0,4269	no	coding-synonymous,coding-synonymous	DNM3	NM_001136127.1,NM_015569.3	,	0,1,6415	TT,TG,GG		0.0,0.0233,0.0078	,	11/860,11/864	171810829	1,12831	2147	4269	6416	SO:0001819	synonymous_variant	26052	exon1			GATCCCGCTGGTG	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.33G>T	1.37:g.171810829G>T			Somatic	63	0	0		WXS	Illumina HiSeq	.	47	0.04	2	NM_001136127	2	0.00	0	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Silent	SNP	ENST00000355305.5	37																																																																																						0.692	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding		OTTHUMT00000084531.1		NM_015569	
FMN2	56776	mdanderson.org	37	1	240371244	240371244	+	Silent	SNP	G	G	A	rs200328010		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:240371244G>A	ENST00000319653.9	+	5	3362	c.3132G>A	c.(3130-3132)ccG>ccA	p.P1044P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1044	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TACCCCCTCCGCCCCCACTTC	0.731																																					p.P1044P													FMN2,right_upper_lobe,carcinoma,+1,1	FMN2	1	1	0			c.G3132A												3.0	4.0	3.0					1																	240371244		1296	2955	4251	SO:0001819	synonymous_variant	56776	exon5			CCCTCCGCCCCCA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3132G>A	1.37:g.240371244G>A			Somatic	76	0.0263157895	2		WXS	Illumina HiSeq	Phase_I	58	0.12	7	NM_020066	1	0.00	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			0.002		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
KIF26B	55083	mdanderson.org	37	1	245851927	245851927	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr1:245851927C>T	ENST00000407071.2	+	12	6082	c.5642C>T	c.(5641-5643)cCg>cTg	p.P1881L	KIF26B_ENST00000366518.4_Missense_Mutation_p.P1500L	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1881					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GAGCTCCCGCCGGCCATGGGG	0.731																																					p.P1881L													.	.			0			c.C5642T												6.0	7.0	7.0					1																	245851927		1941	3991	5932	SO:0001583	missense	55083	exon12			TCCCGCCGGCCAT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5642C>T	1.37:g.245851927C>T	ENSP00000385545:p.Pro1881Leu		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_018012	0		0	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790178	0.90367	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.82893	-1.66;-1.66	5.18	5.18	0.71444	.	.	.	.	.	D	0.91791	0.7403	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.974;0.983	D	0.92945	0.6375	9	0.87932	D	0	.	18.6823	0.91551	0.0:1.0:0.0:0.0	.	1500;1881	B7WPD9;Q2KJY2	.;KI26B_HUMAN	L	1881;1500;1497	ENSP00000385545:P1881L;ENSP00000355475:P1500L	ENSP00000355475:P1500L	P	+	2	0	KIF26B	243918550	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.618000	0.83043	2.409000	0.81822	0.462000	0.41574	CCG			0.731	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381037.1		XM_371354	
SKIDA1	387640	mdanderson.org	37	10	21806056	21806056	+	Silent	SNP	G	G	A			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr10:21806056G>A	ENST00000449193.2	-	4	2948	c.696C>T	c.(694-696)gcC>gcT	p.A232A	SKIDA1_ENST00000444772.3_Intron|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	232	Ala-rich.			Missing (in Ref. 2; BAD18601). {ECO:0000305}.		nucleus (GO:0005634)											cggcagcagcggcggcggcgg	0.766																																					p.A232A													.	.			0			c.C696T												1.0	1.0	1.0					10																	21806056		64	241	305	SO:0001819	synonymous_variant	387640	exon4			AGCAGCGGCGGCG	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.696C>T	10.37:g.21806056G>A			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_207371	0		0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																					0.766	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286950.2		NM_207371	
PDE3B	5140	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	14666502	14666502	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr11:14666502G>T	ENST00000282096.4	+	1	1234	c.881G>T	c.(880-882)aGg>aTg	p.R294M	PSMA1_ENST00000418988.2_5'Flank|PDE3B_ENST00000455098.2_Missense_Mutation_p.R294M|PDE3B_ENST00000534317.1_3'UTR	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	294					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CCCCGGAGGAGGTCCAGCTGC	0.522																																					p.R294M													.	PDE3B	98		0			c.G881T												52.0	57.0	56.0					11																	14666502		2200	4294	6494	SO:0001583	missense	5140	exon1			GGAGGAGGTCCAG	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.881G>T	11.37:g.14666502G>T	ENSP00000282096:p.Arg294Met		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	79	0.06	5	NM_000922	5	0.00	0	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	ENST00000282096.4	37	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	G	32	5.131129	0.94473	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.73897	-0.58;-0.79	4.83	4.83	0.62350	.	14.878900	0.00166	N	0.000000	D	0.88607	0.6482	M	0.70275	2.135	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.996;0.998	T	0.73780	-0.3875	10	0.87932	D	0	.	16.9104	0.86139	0.0:0.0:1.0:0.0	.	294;294;294	B7ZM37;Q13370;A7E2E5	.;PDE3B_HUMAN;.	M	294	ENSP00000282096:R294M;ENSP00000388644:R294M	ENSP00000282096:R294M	R	+	2	0	PDE3B	14623078	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.134000	0.94467	2.238000	0.73509	0.557000	0.71058	AGG			0.522	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000386974.1		NM_000922	
HNRNPKP3	399881	broad.mit.edu	37	11	43283606	43283606	+	RNA	DEL	A	A	-	rs377012965		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr11:43283606delA	ENST00000511537.1	-	0	1329					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		AAGCAAATGTAAAAAAAAAAA	0.388																																					.													.	.			0			.																																											0	.			AAATGTAAAAAAA			11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43283606delA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	2	0.00	0		RNA	DEL	ENST00000511537.1	37																																																																																						0.388	HNRNPKP3-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000390385.1		NR_033868	
WNT11	7481	mdanderson.org	37	11	75905750	75905750	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr11:75905750C>T	ENST00000322563.3	-	3	582	c.458G>A	c.(457-459)cGc>cAc	p.R153H	RP11-619A14.2_ENST00000527314.1_RNA	NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	153					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						TCCTCCCCAGCGGTTCCCGGG	0.667																																					p.R153H													.	.			0			c.G458A												30.0	26.0	27.0					11																	75905750		1882	3716	5598	SO:0001583	missense	7481	exon3			CCCCAGCGGTTCC	Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.458G>A	11.37:g.75905750C>T	ENSP00000325526:p.Arg153His		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_004626	1	0.00	0	B2R8Z6|Q14DE8|Q8WZ98	Missense_Mutation	SNP	ENST00000322563.3	37	CCDS8242.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539338	0.65085	.	.	ENSG00000085741	ENST00000322563;ENST00000531317;ENST00000447195	T	0.75938	-0.98	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.61850	0.2380	N	0.25245	0.725	0.80722	D	1	P	0.47545	0.897	B	0.37650	0.255	T	0.69194	-0.5209	10	0.56958	D	0.05	.	17.1651	0.86814	0.0:1.0:0.0:0.0	.	153	O96014	WNT11_HUMAN	H	153	ENSP00000325526:R153H	ENSP00000325526:R153H	R	-	2	0	WNT11	75583398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.923000	0.56469	2.287000	0.76781	0.555000	0.69702	CGC			0.667	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383083.1		NM_004626	
SYTL2	54843	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	85415906	85415906	+	Silent	SNP	G	G	T	rs374075595		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr11:85415906G>T	ENST00000528231.1	-	14	2546	c.2269C>A	c.(2269-2271)Cgg>Agg	p.R757R	SYTL2_ENST00000524452.1_Silent_p.R733R|SYTL2_ENST00000359152.5_Silent_p.R1603R|SYTL2_ENST00000354566.3_Silent_p.R1095R|SYTL2_ENST00000316356.4_Silent_p.R758R|SYTL2_ENST00000529581.1_Silent_p.R199R|SYTL2_ENST00000389960.4_Silent_p.R733R|SYTL2_ENST00000525702.1_Silent_p.R199R|SYTL2_ENST00000527523.1_Silent_p.R725R|SYTL2_ENST00000389958.3_Silent_p.R188R|SYTL2_ENST00000533892.1_Silent_p.R159R|SYTL2_ENST00000525423.1_Silent_p.R1079R	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	757					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CTCACCTTCCGCTTCAGAGGG	0.383																																					p.R1095R													.	.			0			c.C3283A												161.0	152.0	155.0					11																	85415906		2203	4299	6502	SO:0001819	synonymous_variant	54843	exon9			CCTTCCGCTTCAG	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.2269C>A	11.37:g.85415906G>T			Somatic	160	0	0		WXS	Illumina HiSeq	.	115	0.04	5	NM_206927	7	0.00	0	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	ENST00000528231.1	37	CCDS53688.1																																																																																					0.383	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000392192.1		NM_206927	
DCP1B	196513	hgsc.bcm.edu	37	12	2062350	2062350	+	Missense_Mutation	SNP	C	C	G	rs570843986	byFrequency	TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr12:2062350C>G	ENST00000280665.6	-	7	835	c.756G>C	c.(754-756)caG>caC	p.Q252H	DCP1B_ENST00000397173.4_Missense_Mutation_p.Q150H|DCP1B_ENST00000540622.1_Missense_Mutation_p.Q126H|DCP1B_ENST00000541700.1_5'UTR	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	252	Poly-Gln.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.Q252H(8)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			gctgctgctgctgGTGGAGAG	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		14619	0.002		0.0	False		,,,				2504	0.0				p.Q252H													DCP1B,bladder,carcinoma,0,13	DCP1B	0	13	8	Substitution - Missense(8)	endometrium(5)|lung(2)|large_intestine(1)	c.G756C												35.0	42.0	40.0					12																	2062350		2203	4300	6503	SO:0001583	missense	196513	exon7			CTGCTGCTGGTGG	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.756G>C	12.37:g.2062350C>G	ENSP00000280665:p.Gln252His		Somatic	26	0	0		WXS	Illumina HiSeq	.	55	0.05	3	NM_152640	128	0.01	1	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	ENST00000280665.6	37	CCDS31727.1	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361713	0.01235	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.19250	2.19;2.17;2.16	4.04	-8.09	0.01090	.	1.568620	0.03045	N	0.153823	T	0.13072	0.0317	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15694	-1.0428	10	0.17369	T	0.5	.	12.662	0.56820	0.0881:0.1213:0.7178:0.0728	.	150;252	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	H	252;150;126	ENSP00000280665:Q252H;ENSP00000380358:Q150H;ENSP00000444374:Q126H	ENSP00000280665:Q252H	Q	-	3	2	DCP1B	1932611	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.268000	0.02836	-2.090000	0.00859	-2.175000	0.00321	CAG			0.552	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398244.1		NM_152640	
DDX11	1663	mdanderson.org	37	12	31255198	31255198	+	Missense_Mutation	SNP	G	G	A	rs558229319	byFrequency	TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr12:31255198G>A	ENST00000407793.2	+	22	2475	c.2224G>A	c.(2224-2226)Gca>Aca	p.A742T	DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000542838.1_Missense_Mutation_p.A742T|DDX11_ENST00000228264.6_Missense_Mutation_p.A716T|DDX11_ENST00000350437.4_Missense_Mutation_p.A692T|DDX11_ENST00000545668.1_Missense_Mutation_p.A742T	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	742					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					ACCTAAGAGCGCACACCAGGT	0.577										Multiple Myeloma(12;0.14)			G|||	2	0.000399361	0.0015	0.0	5008	,	,		20797	0.0		0.0	False		,,,				2504	0.0				p.A742T													.	.			0			c.G2224A												71.0	79.0	77.0					12																	31255198		2203	4300	6503	SO:0001583	missense	1663	exon22			AAGAGCGCACACC	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.2224G>A	12.37:g.31255198G>A	ENSP00000384703:p.Ala742Thr		Somatic	203	0	0		WXS	Illumina HiSeq	Phase_I	375	0.04	16	NM_030653	307	0.03	9	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501187	0.44455	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	D;D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89;-2.89	3.85	2.95	0.34219	Helicase, ATP-dependent, c2 type (1);	0.239301	0.43110	N	0.000612	D	0.93074	0.7795	M	0.67397	2.05	0.80722	D	1	B;B;D;B	0.76494	0.142;0.363;0.999;0.142	B;B;P;B	0.61477	0.055;0.088;0.889;0.055	D	0.89925	0.4062	10	0.21540	T	0.41	.	9.1836	0.37156	0.1094:0.0:0.8906:0.0	.	716;742;692;742	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	T	742;742;467;716;742;692	ENSP00000443426:A742T;ENSP00000384703:A742T;ENSP00000228264:A716T;ENSP00000440402:A742T;ENSP00000309965:A692T	ENSP00000228264:A716T	A	+	1	0	DDX11	31146465	1.000000	0.71417	0.282000	0.24776	0.283000	0.27025	2.073000	0.41519	0.824000	0.34613	-0.198000	0.12761	GCA			0.577	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000399728.1		NM_030653	
KIF21A	55605	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	39735383	39735383	+	Silent	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr12:39735383C>T	ENST00000361418.5	-	14	1860	c.1845G>A	c.(1843-1845)gaG>gaA	p.E615E	KIF21A_ENST00000395670.3_Silent_p.E615E|KIF21A_ENST00000361961.3_Silent_p.E602E|KIF21A_ENST00000544797.2_Silent_p.E602E|KIF21A_ENST00000541463.2_Silent_p.E602E			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	615					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E602D(1)|p.E602E(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				cctcctcctcctcttcttcat	0.398																																					p.E615E													KIF21A,NS,carcinoma,0,2	KIF21A	0	2	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(1)|kidney(1)	c.G1845A												85.0	82.0	83.0					12																	39735383		2203	4299	6502	SO:0001819	synonymous_variant	55605	exon14			CTCCTCCTCTTCT	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1845G>A	12.37:g.39735383C>T			Somatic	136	0	0		WXS	Illumina HiSeq	.	146	0.04	6	NM_001173464	17	0.00	0	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	37	CCDS53776.1																																																																																					0.398	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403581.1		NM_017641	
TESPA1	9840	broad.mit.edu	37	12	55354957	55354957	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr12:55354957G>T	ENST00000449076.1	-	10	1694	c.1562C>A	c.(1561-1563)tCg>tAg	p.S521*	TESPA1_ENST00000531122.1_Nonsense_Mutation_p.S383*|TESPA1_ENST00000532804.1_Nonsense_Mutation_p.S383*|TESPA1_ENST00000524959.1_5'Flank|TESPA1_ENST00000524622.1_Nonsense_Mutation_p.S383*|TESPA1_ENST00000316577.8_Nonsense_Mutation_p.S521*	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	521					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											CTTACTTCACGAGTCTTTGCC	0.498																																					p.S521X													.	.			0			c.C1562A												132.0	156.0	148.0					12																	55354957		2184	4290	6474	SO:0001587	stop_gained	9840	exon10			CTTCACGAGTCTT	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1562C>A	12.37:g.55354957G>T	ENSP00000400892:p.Ser521*		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	125	0.03	4	NM_001098815	8	0.00	0	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Nonsense_Mutation	SNP	ENST00000449076.1	37	CCDS44913.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581348	0.86748	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	.	.	.	3.96	1.17	0.20885	.	1.380920	0.05103	N	0.487501	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.1551	6.581	0.22594	0.309:0.0:0.691:0.0	.	.	.	.	X	383;383;521;521;383	.	ENSP00000312679:S521X	S	-	2	0	KIAA0748	53641224	0.005000	0.15991	0.004000	0.12327	0.016000	0.09150	0.181000	0.16880	0.253000	0.21552	-0.992000	0.02543	TCG			0.498	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000383822.1		NM_001098815	
SPRYD4	283377	broad.mit.edu	37	12	56862413	56862413	+	Missense_Mutation	SNP	G	G	T	rs142431089		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr12:56862413G>T	ENST00000338146.5	+	1	113	c.38G>T	c.(37-39)cGc>cTc	p.R13L	MIP_ENST00000555551.1_Intron	NM_207344.3	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	13	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)	7						CGCTTGTGCCGCTGGGGAGCC	0.557																																					p.R13L													.	SPRYD4	13		0			c.G38T												135.0	125.0	128.0					12																	56862413		2203	4300	6503	SO:0001583	missense	283377	exon1			TGTGCCGCTGGGG	AL832247	CCDS8920.1	12q13.3	2006-03-09				ENSG00000176422			27468	protein-coding gene	gene with protein product							Standard	NM_207344		Approved	DKFZp686N0877	uc001sli.4	Q8WW59		ENST00000338146.5:c.38G>T	12.37:g.56862413G>T	ENSP00000338034:p.Arg13Leu		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	114	0.04	4	NM_207344	28	0.00	0	A8K7A5	Missense_Mutation	SNP	ENST00000338146.5	37	CCDS8920.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970329	0.53614	.	.	ENSG00000176422	ENST00000338146	T	0.63096	-0.02	5.57	0.0595	0.14332	B30.2/SPRY domain (1);	0.682102	0.15367	N	0.266062	T	0.43166	0.1235	L	0.44542	1.39	0.21719	N	0.999577	B	0.02656	0.0	B	0.04013	0.001	T	0.15378	-1.0439	10	0.25751	T	0.34	-1.0655	0.911	0.01295	0.1878:0.1494:0.3565:0.3062	.	13	Q8WW59	SPRY4_HUMAN	L	13	ENSP00000338034:R13L	ENSP00000338034:R13L	R	+	2	0	SPRYD4	55148680	0.003000	0.15002	0.393000	0.26258	0.961000	0.63080	-0.067000	0.11579	0.340000	0.23745	0.563000	0.77884	CGC			0.557	SPRYD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_207344	
LTB4R	1241	broad.mit.edu	37	14	24785074	24785074	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr14:24785074T>C	ENST00000396789.4	+	2	1942	c.217T>C	c.(217-219)Ttt>Ctt	p.F73L	LTB4R_ENST00000396782.2_Missense_Mutation_p.F73L|LTB4R_ENST00000345363.3_Missense_Mutation_p.F73L	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	73					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CACTGCTCCCTTTTTCCTTCA	0.582																																					p.F73L													.	LTB4R	18		0			c.T217C												183.0	163.0	170.0					14																	24785074		2203	4300	6503	SO:0001583	missense	1241	exon2			GCTCCCTTTTTCC	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.217T>C	14.37:g.24785074T>C	ENSP00000380008:p.Phe73Leu		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	88	0.03	3	NM_181657	9	0.00	0	Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	SNP	ENST00000396789.4	37	CCDS9626.1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.145293	0.37825	.	.	ENSG00000213903	ENST00000553481;ENST00000345363;ENST00000396789;ENST00000396782	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.89	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.238062	0.36200	U	0.002721	T	0.27629	0.0679	L	0.37466	1.105	0.37507	D	0.917019	B	0.17465	0.022	B	0.17433	0.018	T	0.12142	-1.0559	10	0.20046	T	0.44	.	11.3543	0.49607	0.0:0.0:0.1521:0.8479	.	73	Q15722	LT4R1_HUMAN	L	73	ENSP00000450457:F73L;ENSP00000307445:F73L;ENSP00000380008:F73L;ENSP00000380002:F73L	ENSP00000307445:F73L	F	+	1	0	LTB4R	23854914	0.279000	0.24239	0.998000	0.56505	0.991000	0.79684	0.623000	0.24447	1.009000	0.39289	0.533000	0.62120	TTT			0.582	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000073198.4			
MESP2	145873	broad.mit.edu;mdanderson.org	37	15	90320173	90320173	+	Silent	SNP	A	A	G	rs113636330		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr15:90320173A>G	ENST00000341735.3	+	1	585	c.585A>G	c.(583-585)ggA>ggG	p.G195G	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	195	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			aggggcaaggacaggggcaag	0.781																																					p.G195G													.	MESP2	20		0			c.A585G												3.0	5.0	4.0					15																	90320173		1538	3548	5086	SO:0001819	synonymous_variant	145873	exon1			GCAAGGACAGGGG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.585A>G	15.37:g.90320173A>G			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	37	0.11	4	NM_001039958	0		0	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																					0.781	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416421.1		XM_085261	
UBN1	29855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4903071	4903071	+	Silent	SNP	C	C	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr16:4903071C>G	ENST00000396658.4	+	1	856	c.153C>G	c.(151-153)ctC>ctG	p.L51L	UBN1_ENST00000262376.6_Silent_p.L51L|UBN1_ENST00000545171.1_Silent_p.L51L|UBN1_ENST00000590769.1_Silent_p.L51L	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	51	Sufficient for interaction with HIRA.				chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						CACTCACCCTCTTTGAACCAG	0.537																																					p.L51L													.	.			0			c.C153G												88.0	85.0	86.0					16																	4903071		2197	4300	6497	SO:0001819	synonymous_variant	29855	exon2			CACCCTCTTTGAA	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.153C>G	16.37:g.4903071C>G			Somatic	89	0	0		WXS	Illumina HiSeq	.	71	0.13	9	NM_001079514	57	0.30	17	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	ENST00000396658.4	37	CCDS10525.1																																																																																					0.537	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251719.1		NM_016936	
UBN1	29855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4927071	4927071	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr16:4927071C>G	ENST00000396658.4	+	15	3927	c.3224C>G	c.(3223-3225)aCa>aGa	p.T1075R	UBN1_ENST00000262376.6_Missense_Mutation_p.T1075R|UBN1_ENST00000545171.1_Missense_Mutation_p.T1075R|UBN1_ENST00000590769.1_Missense_Mutation_p.T1075R	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	1075					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						GCCATCGTCACAGGCCCTGCC	0.577																																					p.T1075R													.	.			0			c.C3224G												147.0	154.0	151.0					16																	4927071		2197	4300	6497	SO:0001583	missense	29855	exon16			TCGTCACAGGCCC	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.3224C>G	16.37:g.4927071C>G	ENSP00000379894:p.Thr1075Arg		Somatic	48	0	0		WXS	Illumina HiSeq	.	54	0.30	16	NM_001079514	106	0.39	41	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562516	0.86335	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.54279	1.29;0.58;1.29	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000001	T	0.71221	0.3314	L	0.60455	1.87	0.46222	D	0.998932	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.71230	-0.4654	10	0.66056	D	0.02	-15.6907	19.6982	0.96039	0.0:1.0:0.0:0.0	.	1075;1075	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	R	1075	ENSP00000262376:T1075R;ENSP00000442379:T1075R;ENSP00000379894:T1075R	ENSP00000262376:T1075R	T	+	2	0	UBN1	4867072	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	5.508000	0.67006	2.894000	0.99253	0.655000	0.94253	ACA			0.577	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251719.1		NM_016936	
TUBB8P7	197331	broad.mit.edu	37	16	90162530	90162530	+	RNA	SNP	A	A	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr16:90162530A>G	ENST00000564451.1	+	0	1883				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7																		GTGTCTGAATATCAGCAATAT	0.547																																					.													.	.			0			.																																											0	.			CTGAATATCAGCA			16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90162530A>G			Somatic	61	0.0163934426	1		WXS	Illumina HiSeq	Phase_I	46	0.09	4	.	18	0.06	1		RNA	SNP	ENST00000564451.1	37																																																																																						0.547	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000420856.1		NG_002334	
SMCR2	140768	broad.mit.edu	37	17	17579770	17579771	+	lincRNA	DEL	TG	TG	-	rs377428889|rs111841324		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr17:17579770_17579771delTG	ENST00000456090.2	-	0	114									Smith-Magenis syndrome chromosome region, candidate 2 (non-protein coding)																		AACCCAAGGCtgtgtgtgtgtg	0.495																																					.													.	.			0			.																																											0	.			CAAGGCTGTGTGT	AI821758		17p11.2	2012-10-16	2011-06-10		ENSG00000223979	ENSG00000223979		"""Long non-coding RNAs"""	17914	non-coding RNA	RNA, long non-coding			"""Smith-Magenis syndrome chromosome region, candidate 2"""			11997338	Standard			Approved				OTTHUMG00000059291		17.37:g.17579780_17579781delTG			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	0		0		RNA	DEL	ENST00000456090.2	37																																																																																						0.495	SMCR2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000131667.2			
ABCA6	23460	broad.mit.edu	37	17	67124787	67124787	+	Silent	SNP	A	A	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr17:67124787A>G	ENST00000284425.2	-	8	1266	c.1092T>C	c.(1090-1092)ccT>ccC	p.P364P		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	364					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TAAAGGCAAAAGGGCTACAAA	0.373																																					p.P364P													.	ABCA6	210		0			c.T1092C												88.0	88.0	88.0					17																	67124787		2203	4300	6503	SO:0001819	synonymous_variant	23460	exon8			GGCAAAAGGGCTA	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1092T>C	17.37:g.67124787A>G			Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	146	0.03	4	NM_080284	0		0	Q6NSH9|Q8N856|Q8WWZ6	Silent	SNP	ENST00000284425.2	37	CCDS11683.1																																																																																					0.373	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450463.1		NM_080284	
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1061799	1061799	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:1061799G>A	ENST00000263094.6	+	41	5713	c.5482G>A	c.(5482-5484)Gtg>Atg	p.V1828M	ABCA7_ENST00000433129.1_Missense_Mutation_p.V1828M|ABCA7_ENST00000435683.2_Missense_Mutation_p.V1690M	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1828	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGCTGGGTGTGAATGGAGC	0.577																																					p.V1828M													.	.			0			c.G5482A												113.0	93.0	100.0					19																	1061799		2203	4300	6503	SO:0001583	missense	10347	exon41			CTGGGTGTGAATG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5482G>A	19.37:g.1061799G>A	ENSP00000263094:p.Val1828Met		Somatic	106	0	0		WXS	Illumina HiSeq	.	127	0.24	31	NM_019112	23	0.09	2	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630712	0.67015	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.93763	-3.28;-3.28	3.57	2.47	0.30058	ATPase, AAA+ type, core (1);ABC transporter-like (1);	.	.	.	.	D	0.91771	0.7397	L	0.41906	1.305	0.42088	D	0.99128	D;P	0.56035	0.974;0.807	P;B	0.52343	0.696;0.212	D	0.91377	0.5124	9	0.66056	D	0.02	.	10.1039	0.42521	0.1073:0.0:0.8927:0.0	.	953;1828	D6W5Y0;Q8IZY2	.;ABCA7_HUMAN	M	1828	ENSP00000263094:V1828M;ENSP00000414062:V1828M	ENSP00000263094:V1828M	V	+	1	0	ABCA7	1012799	1.000000	0.71417	0.979000	0.43373	0.805000	0.45488	5.849000	0.69465	1.809000	0.52856	0.561000	0.74099	GTG			0.577	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000394993.1		NM_019112	
ABHD17A	81926	hgsc.bcm.edu	37	19	1881263	1881263	+	Silent	SNP	G	G	A			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:1881263G>A	ENST00000292577.7	-	2	736	c.303C>T	c.(301-303)tgC>tgT	p.C101C	ABHD17A_ENST00000590661.1_Silent_p.C101C|ABHD17A_ENST00000250974.9_Silent_p.C101C	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	101						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.C101C(3)									GAACATACATGCAGGAGACGC	0.662																																					p.C101C													FAM108A1,NS,carcinoma,0,2	FAM108A1	0	2	3	Substitution - coding silent(3)	lung(2)|endometrium(1)	c.C303T												35.0	39.0	38.0					19																	1881263		2202	4299	6501	SO:0001819	synonymous_variant	81926	exon2			ATACATGCAGGAG	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.303C>T	19.37:g.1881263G>A			Somatic	43	0.023255814	1		WXS	Illumina HiSeq	.	65	0.05	3	NM_031213	203	0.00	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	37	CCDS45902.1																																																																																					0.662	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415556.2		NM_031213	
EVI5L	115704	mdanderson.org	37	19	7927017	7927017	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:7927017G>T	ENST00000270530.4	+	15	1817	c.1621G>T	c.(1621-1623)Gcc>Tcc	p.A541S	EVI5L_ENST00000538904.2_Missense_Mutation_p.A552S	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	541					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						GGCCCATCTGGCCCGCGGCGG	0.746																																					p.A552S													.	.			0			c.G1654T												3.0	4.0	3.0					19																	7927017		1766	3718	5484	SO:0001583	missense	115704	exon15			CATCTGGCCCGCG	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.1621G>T	19.37:g.7927017G>T	ENSP00000270530:p.Ala541Ser		Somatic	27	0.037037037	1		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001159944	13	0.00	0	B9A6I9	Missense_Mutation	SNP	ENST00000270530.4	37	CCDS12188.1	.	.	.	.	.	.	.	.	.	.	G	4.844	0.156893	0.09236	.	.	ENSG00000142459	ENST00000270530;ENST00000538904	T;T	0.28895	1.59;1.59	4.29	3.27	0.37495	.	0.058387	0.64402	N	0.000001	T	0.10680	0.0261	N	0.03115	-0.41	0.25924	N	0.983072	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.34750	-0.9816	10	0.02654	T	1	-31.5486	9.018	0.36182	0.0:0.0:0.1985:0.8015	.	552;541	B9A6I9;Q96CN4	.;EVI5L_HUMAN	S	541;552	ENSP00000270530:A541S;ENSP00000445905:A552S	ENSP00000270530:A541S	A	+	1	0	EVI5L	7833017	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.743000	0.26231	0.709000	0.31976	-0.397000	0.06425	GCC			0.746	EVI5L-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000461347.1		NM_145245	
ZNF441	126068	mdanderson.org	37	19	11891239	11891239	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:11891239G>T	ENST00000357901.4	+	4	702	c.600G>T	c.(598-600)ttG>ttT	p.L200F	ZNF441_ENST00000454339.2_Missense_Mutation_p.L133F	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TATGTAAGTTGTGTGGAAACG	0.398																																					p.L200F													.	.			0			c.G600T												155.0	145.0	148.0					19																	11891239		2203	4300	6503	SO:0001583	missense	126068	exon4			TAAGTTGTGTGGA	AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.600G>T	19.37:g.11891239G>T	ENSP00000350576:p.Leu200Phe		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	129	0.04	5	NM_152355	1	0.00	0		Missense_Mutation	SNP	ENST00000357901.4	37	CCDS12266.2	.	.	.	.	.	.	.	.	.	.	g	8.671	0.902924	0.17760	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	T;T	0.15718	2.4;2.4	1.04	-2.08	0.07254	Zinc finger, C2H2 (1);	.	.	.	.	T	0.07279	0.0184	N	0.10760	0.04	0.09310	N	0.999999	B	0.11235	0.004	B	0.14578	0.011	T	0.29243	-1.0018	9	0.66056	D	0.02	.	3.305	0.06997	0.5753:0.0:0.2418:0.1829	.	200	Q8N8Z8	ZN441_HUMAN	F	156;200;133	ENSP00000350576:L200F;ENSP00000403738:L133F	ENSP00000350576:L200F	L	+	3	2	ZNF441	11752239	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-7.118000	0.00044	-1.548000	0.01712	-0.680000	0.03767	TTG			0.398	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335273.3		NM_152355	
MED26	9441	bcgsc.ca	37	19	16687978	16687978	+	Silent	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:16687978G>T	ENST00000263390.3	-	3	925	c.663C>A	c.(661-663)atC>atA	p.I221I	CTD-3222D19.2_ENST00000409035.1_Silent_p.I229I|CTC-429P9.4_ENST00000593962.1_5'Flank	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	221					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						CGTTGACGGGGATCTTGCCAC	0.667																																					p.I221I													.	MED26	25		0			c.C663A												47.0	52.0	50.0					19																	16687978		2203	4300	6503	SO:0001819	synonymous_variant	9441	exon3			GACGGGGATCTTG	AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.663C>A	19.37:g.16687978G>T			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_1	84	0.06	5	NM_004831	40	0.00	0	A1A4S3|Q0VGB6	Silent	SNP	ENST00000263390.3	37	CCDS12347.1																																																																																					0.667	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461178.1		NM_004831	
USHBP1	83878	mdanderson.org	37	19	17366295	17366295	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:17366295G>T	ENST00000252597.3	-	10	1764	c.1591C>A	c.(1591-1593)Ctg>Atg	p.L531M	AC010646.3_ENST00000594059.1_5'Flank|USHBP1_ENST00000431146.2_Missense_Mutation_p.L467M	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1											breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						TCCCACCGCAGCTGCTCCAGC	0.682																																					p.L531M													.	.			0			c.C1591A												44.0	47.0	46.0					19																	17366295		2203	4300	6503	SO:0001583	missense	83878	exon10			ACCGCAGCTGCTC	AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1591C>A	19.37:g.17366295G>T	ENSP00000252597:p.Leu531Met		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_031941	0		0		Missense_Mutation	SNP	ENST00000252597.3	37	CCDS12353.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.540606	0.45280	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.58797	0.38;0.31	4.92	3.89	0.44902	.	0.000000	0.56097	D	0.000027	T	0.70640	0.3247	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.71170	-0.4671	10	0.59425	D	0.04	-13.5874	9.2715	0.37675	0.1006:0.0:0.8994:0.0	.	467;531	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	M	531;467	ENSP00000252597:L531M;ENSP00000407902:L467M	ENSP00000252597:L531M	L	-	1	2	USHBP1	17227295	1.000000	0.71417	1.000000	0.80357	0.441000	0.31987	1.724000	0.38064	1.062000	0.40625	-0.140000	0.14226	CTG			0.682	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463328.1		NM_031941	
CATSPERG	57828	mdanderson.org	37	19	38827887	38827887	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:38827887G>T	ENST00000409235.3	+	2	128	c.13G>T	c.(13-15)Gcc>Tcc	p.A5S	CATSPERG_ENST00000410018.1_Missense_Mutation_p.A5S|CATSPERG_ENST00000215069.4_Intron	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	5					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						GTGCGGCCCAGCCATGTTCCC	0.637																																					p.A5S													.	.			0			c.G13T												51.0	49.0	49.0					19																	38827887		692	1591	2283	SO:0001583	missense	57828	exon2			GGCCCAGCCATGT	AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.13G>T	19.37:g.38827887G>T	ENSP00000386962:p.Ala5Ser		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_021185	1	0.00	0	A6NEG6|Q659E1	Missense_Mutation	SNP	ENST00000409235.3	37	CCDS12514.2	.	.	.	.	.	.	.	.	.	.	g	16.28	3.079633	0.55753	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	T;T;T	0.28895	1.59;1.59;1.59	3.3	1.16	0.20824	.	0.603497	0.13756	N	0.364903	T	0.18341	0.0440	N	0.24115	0.695	0.18873	N	0.999988	P;P	0.40180	0.705;0.705	B;B	0.38327	0.271;0.271	T	0.11743	-1.0575	10	0.87932	D	0	-7.1576	5.5171	0.16912	0.2608:0.0:0.7392:0.0	.	5;5	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	S	5	ENSP00000387057:A5S;ENSP00000386962:A5S;ENSP00000386950:A5S	ENSP00000311314:A5S	A	+	1	0	CATSPERG	43519727	0.005000	0.15991	0.062000	0.19696	0.066000	0.16364	0.495000	0.22483	0.429000	0.26202	-0.401000	0.06369	GCC			0.637	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000330204.1		NM_021185	
AXL	558	bcgsc.ca	37	19	41745121	41745121	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:41745121A>G	ENST00000301178.4	+	9	1377	c.1187A>G	c.(1186-1188)gAc>gGc	p.D396G	AXL_ENST00000593513.1_Missense_Mutation_p.D128G|AXL_ENST00000359092.3_Missense_Mutation_p.D396G	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	396	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						CTGCAGGGGGACGGGTCTGTG	0.617																																					p.D396G													.	AXL	126		0			c.A1187G												160.0	124.0	136.0					19																	41745121		2203	4300	6503	SO:0001583	missense	558	exon9			AGGGGGACGGGTC	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.1187A>G	19.37:g.41745121A>G	ENSP00000301178:p.Asp396Gly		Somatic	70	0.0285714286	2		WXS	Illumina HiSeq	Phase_1	72	0.06	4	NM_021913	7	0.00	0	Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	37	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	a	6.080	0.383100	0.11524	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.56941	0.43;0.43	3.79	2.76	0.32466	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.119980	0.06614	N	0.756112	T	0.35393	0.0930	N	0.14661	0.345	0.18873	N	0.999987	B;B	0.26547	0.152;0.001	B;B	0.29785	0.107;0.005	T	0.32824	-0.9892	10	0.20046	T	0.44	-0.5501	6.6768	0.23098	0.8854:0.0:0.1146:0.0	.	396;396	P30530-2;P30530	.;UFO_HUMAN	G	396	ENSP00000301178:D396G;ENSP00000351995:D396G	ENSP00000301178:D396G	D	+	2	0	AXL	46436961	0.360000	0.24964	0.183000	0.23137	0.712000	0.41017	0.709000	0.25734	0.540000	0.28808	0.317000	0.21355	GAC			0.617	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000463323.2			
CCDC97	90324	mdanderson.org	37	19	41825732	41825732	+	Silent	SNP	A	A	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:41825732A>G	ENST00000269967.3	+	3	878	c.756A>G	c.(754-756)gaA>gaG	p.E252E		NM_052848.1	NP_443080.1	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	252										biliary_tract(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	17						aggaagaggaagaggaggagg	0.607																																					p.E252E													.	.			0			c.A756G												22.0	21.0	21.0					19																	41825732		2203	4298	6501	SO:0001819	synonymous_variant	90324	exon3			AGAGGAAGAGGAG	BC011577	CCDS12578.1	19q13.2	2008-02-05							28289	protein-coding gene	gene with protein product						12477932	Standard	NM_052848		Approved	FLJ40267, MGC20255	uc002oqg.3	Q96F63		ENST00000269967.3:c.756A>G	19.37:g.41825732A>G			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_052848	69	0.00	0	Q658N6|Q96IF3	Silent	SNP	ENST00000269967.3	37	CCDS12578.1																																																																																					0.607	CCDC97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463293.1		NM_052848	
MYH14	79784	mdanderson.org	37	19	50781508	50781508	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr19:50781508G>T	ENST00000596571.1	+	27	3871	c.3871G>T	c.(3871-3873)Gca>Tca	p.A1291S	MYH14_ENST00000425460.1_Missense_Mutation_p.A1299S|MYH14_ENST00000440075.2_Missense_Mutation_p.A1332S|MYH14_ENST00000262269.8_Missense_Mutation_p.A1332S|MYH14_ENST00000376970.2_Missense_Mutation_p.A1324S|MYH14_ENST00000601313.1_Missense_Mutation_p.A1332S|MYH14_ENST00000598205.1_Missense_Mutation_p.A1299S			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1291					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGGGGAGAGGGCACGAGCGGA	0.662																																					p.A1332S													.	.			0			c.G3994T												19.0	27.0	24.0					19																	50781508		2080	4185	6265	SO:0001583	missense	79784	exon30			GAGAGGGCACGAG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.3871G>T	19.37:g.50781508G>T	ENSP00000472819:p.Ala1291Ser		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_001145809	8	0.00	0	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	3.119	-0.180960	0.06380	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	3.78	2.64	0.31445	Myosin tail (1);	.	.	.	.	T	0.55513	0.1925	N	0.05124	-0.11	0.26371	N	0.976893	B;B;B	0.25719	0.049;0.132;0.109	B;B;B	0.33254	0.064;0.16;0.099	T	0.48019	-0.9071	9	0.14656	T	0.56	.	6.1894	0.20516	0.0:0.2027:0.5884:0.2089	.	1332;1291;1299	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	S	1291;1332;1324;1299;1291;1332	ENSP00000406273:A1332S;ENSP00000366169:A1324S;ENSP00000407879:A1299S;ENSP00000262269:A1332S	ENSP00000262269:A1332S	A	+	1	0	MYH14	55473320	0.198000	0.23374	0.993000	0.49108	0.755000	0.42902	1.259000	0.32956	2.149000	0.67028	0.462000	0.41574	GCA			0.662	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000464710.2		NM_024729	
ARHGEF4	50649	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	131675018	131675018	+	5'UTR	SNP	G	G	A			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr2:131675018G>A	ENST00000326016.5	+	0	460				ARHGEF4_ENST00000409359.1_Missense_Mutation_p.G837S|ARHGEF4_ENST00000428230.2_5'UTR|ARHGEF4_ENST00000525839.1_5'UTR|ARHGEF4_ENST00000392953.3_5'UTR	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		AGGAGGCCAGGGTCCGCGCGG	0.577																																					.													.	ARHGEF4	89		0			.																																									SO:0001623	5_prime_UTR_variant	50649	.			GGCCAGGGTCCGC	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.-60G>A	2.37:g.131675018G>A			Somatic	149	0.0067114094	1		WXS	Illumina HiSeq	Phase_I	138	0.23	32	.	1	1.00	1	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	G	3.716	-0.058538	0.07317	.	.	ENSG00000136002	ENST00000409359;ENST00000438985	T;T	0.38560	1.13;1.15	4.77	-5.99	0.02213	.	.	.	.	.	T	0.15435	0.0372	.	.	.	0.09310	N	0.999998	B	0.06786	0.001	B	0.08055	0.003	T	0.29274	-1.0017	8	0.08381	T	0.77	.	4.7872	0.13230	0.114:0.1227:0.1176:0.6457	.	837	E7EV07	.	S	837;161	ENSP00000386794:G837S;ENSP00000389661:G161S	ENSP00000386794:G837S	G	+	1	0	ARHGEF4	131391488	0.068000	0.21057	0.000000	0.03702	0.004000	0.04260	0.220000	0.17660	-1.521000	0.01771	-1.362000	0.01212	GGT			0.577	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000254554.4			
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230663622	230663622	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr2:230663622C>T	ENST00000283943.5	-	22	3404	c.3226G>A	c.(3226-3228)Gct>Act	p.A1076T	TRIP12_ENST00000389044.4_Missense_Mutation_p.A1124T|TRIP12_ENST00000389045.3_Missense_Mutation_p.A806T|TRIP12_ENST00000543084.1_3'UTR	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1076					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTTGAGGCAGCCCTGGCAAGG	0.458																																					p.A1076T													.	.			0			c.G3226A												107.0	102.0	104.0					2																	230663622		2203	4300	6503	SO:0001583	missense	9320	exon22			AGGCAGCCCTGGC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3226G>A	2.37:g.230663622C>T	ENSP00000283943:p.Ala1076Thr		Somatic	121	0	0		WXS	Illumina HiSeq	.	118	0.28	33	NM_004238	85	0.32	27	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466736	0.84425	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.43688	0.94;0.94;0.94	5.76	5.76	0.90799	.	0.098210	0.64402	D	0.000001	T	0.30759	0.0775	N	0.24115	0.695	0.80722	D	1	B;P;B	0.34522	0.319;0.455;0.319	B;B;B	0.29267	0.063;0.1;0.1	T	0.05517	-1.0880	10	0.20046	T	0.44	.	19.976	0.97309	0.0:1.0:0.0:0.0	.	806;1124;1076	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	T	1076;806;1124	ENSP00000283943:A1076T;ENSP00000373697:A806T;ENSP00000373696:A1124T	ENSP00000283943:A1076T	A	-	1	0	TRIP12	230371866	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.756000	0.68757	2.713000	0.92767	0.655000	0.94253	GCT			0.458	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000331861.3		NM_004238	
STK25	10494	mdanderson.org	37	2	242437664	242437664	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr2:242437664G>T	ENST00000316586.4	-	9	1367	c.1018C>A	c.(1018-1020)Cac>Aac	p.H340N	STK25_ENST00000535007.1_Missense_Mutation_p.H246N|STK25_ENST00000401869.1_Missense_Mutation_p.H340N|STK25_ENST00000405585.1_Missense_Mutation_p.H263N|STK25_ENST00000543554.1_Missense_Mutation_p.H246N|STK25_ENST00000405883.3_Missense_Mutation_p.H263N|STK25_ENST00000403346.3_Missense_Mutation_p.H340N|STK25_ENST00000478403.1_5'UTR	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	340					establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		TGTGAACTGTGCAGGGCCGTC	0.662																																					p.H340N	NSCLC(99;1100 1566 7679 28647 48345)												.	.			0			c.C1018A												151.0	130.0	137.0					2																	242437664		2203	4300	6503	SO:0001583	missense	10494	exon9			AACTGTGCAGGGC	D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.1018C>A	2.37:g.242437664G>T	ENSP00000325748:p.His340Asn		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001271977	188	0.01	2	A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Missense_Mutation	SNP	ENST00000316586.4	37	CCDS2549.1	.	.	.	.	.	.	.	.	.	.	G	5.248	0.231222	0.09969	.	.	ENSG00000115694	ENST00000316586;ENST00000403346;ENST00000401869;ENST00000405883;ENST00000545437;ENST00000405585;ENST00000543554;ENST00000535007	T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.24	4.3	0.51218	.	0.265448	0.38005	N	0.001845	T	0.12008	0.0292	N	0.02011	-0.69	0.40204	D	0.977553	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.15780	-1.0425	10	0.16896	T	0.51	.	13.3176	0.60415	0.0:0.0:0.8424:0.1576	.	266;263;340	B4DVS7;A8K6Z3;O00506	.;.;STK25_HUMAN	N	340;340;340;263;246;263;246;246	ENSP00000325748:H340N;ENSP00000384162:H340N;ENSP00000385687:H340N;ENSP00000384444:H263N;ENSP00000385541:H263N;ENSP00000444886:H246N;ENSP00000446008:H246N	ENSP00000325748:H340N	H	-	1	0	STK25	242086337	0.990000	0.36364	0.981000	0.43875	0.480000	0.33159	2.548000	0.45794	2.619000	0.88677	0.561000	0.74099	CAC			0.662	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257265.4		NM_006374	
MICAL3	57553	bcgsc.ca	37	22	18358228	18358228	+	Intron	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr22:18358228G>T	ENST00000441493.2	-	17	2594				MICAL3_ENST00000414725.2_Intron|MICAL3_ENST00000383094.3_Intron|MICAL3_ENST00000444520.1_Intron|MICAL3_ENST00000400561.2_Intron|MICAL3_ENST00000585038.1_Silent_p.S830S|MICAL3_ENST00000207726.7_Intron|MICAL3_ENST00000429452.1_Silent_p.S830S	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3						actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGAGGGAGTCGGAGGAGGGAG	0.577																																					p.S830S													.	MICAL3	53		0			c.C2490A												24.0	31.0	29.0					22																	18358228		1560	3567	5127	SO:0001627	intron_variant	57553	exon19			GGAGTCGGAGGAG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2242-3439C>A	22.37:g.18358228G>T			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_1	43	0.09	4	NM_001136004	0		0	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1																																																																																					0.577	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447351.1			
EMID1	129080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29627121	29627121	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr22:29627121G>T	ENST00000404820.3	+	6	705	c.578G>T	c.(577-579)gGc>gTc	p.G193V	EMID1_ENST00000404755.3_Missense_Mutation_p.G193V|EMID1_ENST00000334018.6_Missense_Mutation_p.G193V|EMID1_ENST00000484039.1_3'UTR			Q96A84	EMID1_HUMAN	EMI domain containing 1	191	Collagen-like.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						GGAGATGGAGGCCTCCAGGGT	0.642																																					p.G193V													.	.			0			c.G578T												42.0	45.0	44.0					22																	29627121		2203	4300	6503	SO:0001583	missense	129080	exon6			ATGGAGGCCTCCA	AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.578G>T	22.37:g.29627121G>T	ENSP00000384452:p.Gly193Val		Somatic	207	0	0		WXS	Illumina HiSeq	.	209	0.18	37	NM_133455	8	0.38	3	B0QYK6|Q6ICG1|Q86SS7	Missense_Mutation	SNP	ENST00000404820.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.743|9.743	1.165513|1.165513	0.21538|0.21538	.|.	.|.	ENSG00000186998|ENSG00000186998	ENST00000433143|ENST00000334018;ENST00000429226;ENST00000404755;ENST00000404820;ENST00000430127	.|D;T;D;D;T	.|0.92752	.|-3.0;0.79;-3.1;-2.98;0.47	4.95|4.95	3.93|3.93	0.45458|0.45458	.|.	.|0.634319	.|0.13819	.|N	.|0.360579	D|D	0.93387|0.93387	0.7891|0.7891	H|H	0.95574|0.95574	3.69|3.69	0.44295|0.44295	D|D	0.997161|0.997161	.|B;P;B;P	.|0.35077	.|0.22;0.483;0.19;0.465	.|B;B;B;B	.|0.31101	.|0.058;0.086;0.081;0.124	D|D	0.93074|0.93074	0.6485|0.6485	5|10	.|0.87932	.|D	.|0	0.0429|0.0429	9.5733|9.5733	0.39442|0.39442	0.0993:0.0:0.9007:0.0|0.0993:0.0:0.9007:0.0	.|.	.|193;193;191;193	.|B0QYK4;B0QYK5;Q96A84;Q96A84-3	.|.;.;EMID1_HUMAN;.	S|V	39|193;193;193;193;165	.|ENSP00000335481:G193V;ENSP00000403816:G193V;ENSP00000385414:G193V;ENSP00000384452:G193V;ENSP00000399760:G165V	.|ENSP00000335481:G193V	A|G	+|+	1|2	0|0	EMID1|EMID1	27957121|27957121	0.627000|0.627000	0.27129|0.27129	0.775000|0.775000	0.31657|0.31657	0.017000|0.017000	0.09413|0.09413	0.653000|0.653000	0.24902|0.24902	1.228000|1.228000	0.43614|0.43614	0.585000|0.585000	0.79938|0.79938	GCC|GGC			0.642	EMID1-002	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000321075.1		NM_133455	
SCN5A	6331	mdanderson.org	37	3	38592963	38592963	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr3:38592963G>T	ENST00000333535.4	-	28	5049	c.4900C>A	c.(4900-4902)Ctc>Atc	p.L1634I	SCN5A_ENST00000451551.2_Missense_Mutation_p.L1580I|SCN5A_ENST00000443581.1_Missense_Mutation_p.L1633I|SCN5A_ENST00000425664.1_Missense_Mutation_p.L1616I|SCN5A_ENST00000450102.2_Missense_Mutation_p.L1580I|SCN5A_ENST00000449557.2_Missense_Mutation_p.L1580I|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000413689.1_Missense_Mutation_p.L1634I|SCN5A_ENST00000423572.2_Missense_Mutation_p.L1633I|SCN5A_ENST00000414099.2_Missense_Mutation_p.L1616I|SCN5A_ENST00000455624.2_Missense_Mutation_p.L1601I			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1634					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	ATCAGTCTGAGGATGCGGCCT	0.597																																					p.L1634I													.	.			0			c.C4900A												101.0	103.0	102.0					3																	38592963		2203	4300	6503	SO:0001583	missense	6331	exon28			GTCTGAGGATGCG	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4900C>A	3.37:g.38592963G>T	ENSP00000328968:p.Leu1634Ile		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_198056	2	0.00	0	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219021	0.79464	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.99113	-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44	4.54	4.54	0.55810	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99330	0.9765	M	0.87269	2.87	0.54753	D	0.999987	D;D;D;D;D;P	0.89917	0.999;0.999;1.0;0.998;0.999;0.847	D;D;D;D;D;P	0.80764	0.991;0.994;0.992;0.983;0.986;0.622	D	0.98897	1.0775	10	0.87932	D	0	.	17.4903	0.87701	0.0:0.0:1.0:0.0	.	1580;1601;1616;1634;1633;1634	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	I	1616;1633;1634;1580;1633;1616;1634;1601;1580;1580	ENSP00000398962:L1616I;ENSP00000398266:L1633I;ENSP00000410257:L1634I;ENSP00000388797:L1580I;ENSP00000397915:L1633I;ENSP00000416634:L1616I;ENSP00000328968:L1634I;ENSP00000399524:L1601I;ENSP00000403355:L1580I;ENSP00000413996:L1580I	ENSP00000328968:L1634I	L	-	1	0	SCN5A	38567967	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.813000	0.86123	2.353000	0.79882	0.561000	0.74099	CTC			0.597	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000377958.1		NM_198056	
ZBTB47	92999	broad.mit.edu	37	3	42700893	42700893	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr3:42700893A>G	ENST00000232974.6	+	2	1327	c.1046A>G	c.(1045-1047)gAg>gGg	p.E349G	ZBTB47_ENST00000457842.3_5'UTR|ZBTB47_ENST00000505904.1_Intron			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	349	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		gaggaggaggagggggaggag	0.667																																					p.E349G													.	ZBTB47	39		0			c.A1046G												3.0	7.0	6.0					3																	42700893		561	1419	1980	SO:0001583	missense	92999	exon2			AGGAGGAGGGGGA	AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.1046A>G	3.37:g.42700893A>G	ENSP00000232974:p.Glu349Gly		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	NM_145166	0		0	H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Missense_Mutation	SNP	ENST00000232974.6	37	CCDS46805.2	.	.	.	.	.	.	.	.	.	.	a	2.886	-0.230709	0.05983	.	.	ENSG00000114853	ENST00000232974	T	0.70749	-0.51	3.02	1.8	0.24995	.	.	.	.	.	T	0.48295	0.1492	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.23655	-1.0182	7	0.33940	T	0.23	.	5.0154	0.14333	0.8512:0.0:0.1488:0.0	.	.	.	.	G	349	ENSP00000232974:E349G	ENSP00000232974:E349G	E	+	2	0	ZBTB47	42675897	0.679000	0.27596	0.690000	0.30148	0.188000	0.23474	0.722000	0.25925	0.265000	0.21872	0.370000	0.22315	GAG			0.667	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343485.3		NM_145166	
DRD3	1814	mdanderson.org	37	3	113858539	113858539	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr3:113858539G>T	ENST00000460779.1	-	6	820	c.531C>A	c.(529-531)gaC>gaA	p.D177E	DRD3_ENST00000383673.2_Missense_Mutation_p.D177E|DRD3_ENST00000467632.1_Missense_Mutation_p.D177E|DRD3_ENST00000295881.7_Missense_Mutation_p.D177E	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	177					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	AGACAGTGGGGTCCCCTGTGG	0.507																																					p.D177E													.	.			0			c.C531A												91.0	85.0	87.0					3																	113858539		2203	4300	6503	SO:0001583	missense	1814	exon5			AGTGGGGTCCCCT		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.531C>A	3.37:g.113858539G>T	ENSP00000419402:p.Asp177Glu		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	44	0.09	4	NM_000796	0		0	A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279291	0.23307	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.12	0.836	0.18891	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.26593	0.0650	L	0.28014	0.82	0.45046	D	0.998068	B;B;B;B	0.19445	0.036;0.036;0.021;0.0	B;B;B;B	0.28553	0.091;0.091;0.038;0.003	T	0.04307	-1.0961	10	0.23891	T	0.37	.	7.79	0.29114	0.518:0.0:0.482:0.0	.	177;177;177;177	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	E	177	ENSP00000419402:D177E;ENSP00000420662:D177E;ENSP00000373169:D177E;ENSP00000295881:D177E	ENSP00000281274:D177E	D	-	3	2	DRD3	115341229	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	2.657000	0.46724	0.272000	0.22027	-0.136000	0.14681	GAC			0.507	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354699.1		NM_000796.3	
YEATS2	55689	mdanderson.org	37	3	183504021	183504021	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr3:183504021G>T	ENST00000305135.5	+	20	3040	c.2845G>T	c.(2845-2847)Gca>Tca	p.A949S		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	949					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GCTGAGAGTAGCAGGAGGGGT	0.517																																					p.A949S													.	.			0			c.G2845T												66.0	67.0	67.0					3																	183504021		2008	4177	6185	SO:0001583	missense	55689	exon20			AGAGTAGCAGGAG	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.2845G>T	3.37:g.183504021G>T	ENSP00000306983:p.Ala949Ser		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_018023	74	0.00	0	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	CCDS43175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.72|14.72	2.620655|2.620655	0.46736|0.46736	.|.	.|.	ENSG00000163872|ENSG00000163872	ENST00000421660;ENST00000305135|ENST00000432781	T|.	0.22134|.	1.97|.	5.88|5.88	4.93|4.93	0.64822|0.64822	.|.	0.149552|.	0.47455|.	D|.	0.000229|.	T|T	0.30947|0.30947	0.0781|0.0781	N|N	0.11560|0.11560	0.145|0.145	0.26925|0.26925	N|N	0.966581|0.966581	B;B|.	0.26975|.	0.165;0.021|.	B;B|.	0.30855|.	0.121;0.012|.	T|T	0.16928|0.16928	-1.0386|-1.0386	10|5	0.26408|.	T|.	0.33|.	-25.9916|-25.9916	16.0087|16.0087	0.80380|0.80380	0.0:0.0:0.8249:0.1751|0.0:0.0:0.8249:0.1751	.|.	111;949|.	Q8N5H6;Q9ULM3|.	.;YETS2_HUMAN|.	S|I	949|134	ENSP00000306983:A949S|.	ENSP00000306983:A949S|.	A|S	+|+	1|2	0|0	YEATS2|YEATS2	184986715|184986715	0.944000|0.944000	0.32072|0.32072	0.988000|0.988000	0.46212|0.46212	0.995000|0.995000	0.86356|0.86356	1.748000|1.748000	0.38308|0.38308	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	GCA|AGC			0.517	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346507.2		NM_018023	
VWA5B2	90113	mdanderson.org	37	3	183954037	183954037	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr3:183954037G>A	ENST00000426955.2	+	8	1299	c.1199G>A	c.(1198-1200)cGg>cAg	p.R400Q	EIF2B5_ENST00000444495.1_Intron|VWA5B2_ENST00000273794.5_Missense_Mutation_p.R181Q	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	411	VWFA.									breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						CCAGAGAGCCGGCCTTGCAGT	0.602																																					p.R400Q													.	.			0			c.G1199A												101.0	95.0	97.0					3																	183954037		692	1591	2283	SO:0001583	missense	90113	exon8			AGAGCCGGCCTTG		CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.1199G>A	3.37:g.183954037G>A	ENSP00000398688:p.Arg400Gln		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_138345	3	0.00	0	B9EGN7	Missense_Mutation	SNP	ENST00000426955.2	37	CCDS54686.1	.	.	.	.	.	.	.	.	.	.	g	15.38	2.815496	0.50527	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	T;T	0.21031	2.03;2.03	5.09	3.27	0.37495	von Willebrand factor, type A (1);	0.143577	0.30383	N	0.009755	T	0.27063	0.0663	L	0.31207	0.915	0.23282	N	0.997989	D;B;B	0.89917	1.0;0.393;0.419	D;B;B	0.68353	0.957;0.071;0.161	T	0.08911	-1.0699	10	0.16896	T	0.51	-8.0667	10.2329	0.43266	0.1657:0.0:0.8343:0.0	.	181;400;411	E9PF42;B9EGN7;Q8N398	.;.;VW5B2_HUMAN	Q	400;181	ENSP00000398688:R400Q;ENSP00000273794:R181Q	ENSP00000273794:R181Q	R	+	2	0	VWA5B2	185436731	0.015000	0.18098	1.000000	0.80357	0.828000	0.46876	0.734000	0.26101	1.300000	0.44818	-0.215000	0.12644	CGG			0.602	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346004.2		XM_291077	
CPZ	8532	mdanderson.org	37	4	8594640	8594640	+	Missense_Mutation	SNP	A	A	C	rs76775183		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr4:8594640A>C	ENST00000360986.4	+	1	254	c.80A>C	c.(79-81)aAc>aCc	p.N27T	CPZ_ENST00000506287.1_3'UTR|CPZ_ENST00000315782.6_Missense_Mutation_p.N27T|CPZ_ENST00000382480.2_5'UTR	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	27	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TTTGAGCGGAACCCCGCCGGT	0.716																																					p.N27T													.	.			0			c.A80C												2.0	3.0	3.0					4																	8594640		1662	3485	5147	SO:0001583	missense	8532	exon1			AGCGGAACCCCGC	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.80A>C	4.37:g.8594640A>C	ENSP00000354255:p.Asn27Thr		Somatic	17	0.4117647059	7		WXS	Illumina HiSeq	Phase_I	14	0.36	5	NM_003652	2	0.00	0	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	a	8.123	0.781472	0.16120	.	.	ENSG00000109625	ENST00000360986;ENST00000315782	T;T	0.58060	0.73;0.36	2.22	-4.3	0.03710	.	1.757890	0.03261	N	0.183244	T	0.35653	0.0939	L	0.29908	0.895	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.0	T	0.09729	-1.0661	10	0.35671	T	0.21	.	3.6279	0.08120	0.3254:0.0:0.4674:0.2072	.	27;27	Q66K79-2;Q66K79	.;CBPZ_HUMAN	T	27	ENSP00000354255:N27T;ENSP00000315074:N27T	ENSP00000315074:N27T	N	+	2	0	CPZ	8645540	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.183000	0.09712	-1.000000	0.03438	-0.429000	0.05907	AAC			0.716	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000207001.4		NM_003652	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599340	55599340	+	Missense_Mutation	SNP	T	T	A	rs121913514		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr4:55599340T>A	ENST00000288135.5	+	17	2563	c.2466T>A	c.(2464-2466)aaT>aaA	p.N822K		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	822	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> K (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N822K(34)|p.N822N(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATGATTCTAATTATGTGGTTA	0.383	N822K(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.N822K			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,+2,48	KIT	2	48	35	Substitution - Missense(34)|Substitution - coding silent(1)	soft_tissue(17)|haematopoietic_and_lymphoid_tissue(11)|skin(4)|testis(2)|genital_tract(1)	c.T2466A												149.0	151.0	151.0					4																	55599340		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TTCTAATTATGTG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2466T>A	4.37:g.55599340T>A	ENSP00000288135:p.Asn822Lys		Somatic	94	0	0		WXS	Illumina HiSeq	.	81	0.48	39	NM_000222	259	0.65	169	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707233	0.68615	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82344	-1.6;-1.6	5.47	3.01	0.34805	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000009	D	0.84284	0.5438	L	0.33293	1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	D	0.83792	0.0231	10	0.87932	D	0	.	8.7243	0.34460	0.0:0.2153:0.0:0.7847	.	818;822	P10721-2;P10721	.;KIT_HUMAN	K	822;818	ENSP00000288135:N822K;ENSP00000390987:N818K	ENSP00000288135:N822K	N	+	3	2	KIT	55294097	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.920000	0.40025	0.883000	0.36040	0.477000	0.44152	AAT			0.383	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
CDH9	1007	mdanderson.org	37	5	26890658	26890658	+	Silent	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr5:26890658C>T	ENST00000231021.4	-	8	1441	c.1269G>A	c.(1267-1269)cgG>cgA	p.R423R		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	423	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TATCAGTATGCCGATCAACAG	0.388																																					p.R423R	Melanoma(8;187 585 15745 40864 52829)												CDH9,NS,malignant_melanoma,-2,3	CDH9	-2	3	0			c.G1269A												85.0	86.0	86.0					5																	26890658		2203	4300	6503	SO:0001819	synonymous_variant	1007	exon8			AGTATGCCGATCA	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1269G>A	5.37:g.26890658C>T			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_016279	0		0	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1																																																																																					0.388	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207352.1		NM_016279	
TXNDC5	81567	hgsc.bcm.edu	37	6	7899765	7899765	+	Intron	SNP	A	A	G	rs57491386|rs369329079|rs70982116|rs566618614		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr6:7899765A>G	ENST00000379757.4	-	3	557				BLOC1S5-TXNDC5_ENST00000439343.2_Intron|TXNDC5_ENST00000473453.1_Intron|TXNDC5_ENST00000539054.1_Intron	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)						apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					aggcagggagagagggaggga	0.517																																					.	Ovarian(119;1430 1625 3928 26125 34589)												.	.			0			.												24.0	31.0	28.0					6																	7899765		2197	4299	6496	SO:0001627	intron_variant	100526836	.			AGGGAGAGAGGGA	AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.519+43T>C	6.37:g.7899765A>G			Somatic	81	0	0		WXS	Illumina HiSeq	.	60	0.18	11	.	0		0	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	RNA	SNP	ENST00000379757.4	37	CCDS4505.1																																																																																					0.517	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039792.1		NM_030810	
BTN2A3P	54718	broad.mit.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	.		9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											0	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	89	0.0112359551	1		WXS	Illumina HiSeq	Phase_I	82	0.05	4	.	1	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
FRS3	10817	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	41738715	41738715	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr6:41738715G>A	ENST00000373018.3	-	7	1372	c.1121C>T	c.(1120-1122)aCc>aTc	p.T374I	FRS3_ENST00000259748.2_Missense_Mutation_p.T374I	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	374					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCGGGTGCTGGTGGGCTTCTG	0.667																																					p.T374I													.	.			0			c.C1121T												40.0	43.0	42.0					6																	41738715		2200	4295	6495	SO:0001583	missense	10817	exon7			GTGCTGGTGGGCT	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.1121C>T	6.37:g.41738715G>A	ENSP00000362109:p.Thr374Ile		Somatic	62	0	0		WXS	Illumina HiSeq	.	61	0.10	6	NM_006653	15	0.27	4	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	37	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.674378	0.29693	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.21543	2.0;2.0	5.76	4.71	0.59529	.	0.300510	0.41001	D	0.000976	T	0.02970	0.0088	N	0.03608	-0.345	0.28769	N	0.900469	B	0.06786	0.001	B	0.06405	0.002	T	0.38520	-0.9657	10	0.14656	T	0.56	-19.3168	11.8675	0.52501	0.1506:0.0:0.8494:0.0	.	374	O43559	FRS3_HUMAN	I	374	ENSP00000362109:T374I;ENSP00000259748:T374I	ENSP00000259748:T374I	T	-	2	0	FRS3	41846693	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.800000	0.55537	2.728000	0.93425	0.655000	0.94253	ACC			0.667	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040532.2		NM_006653	
RUNX2	860	mdanderson.org	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E|RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E													RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2_ENST00000352853	0	2	0			c.C211G												6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001024630	0		0	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG			0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040755.2		NM_004348	
TRGC2	6967	broad.mit.edu	37	7	38284884	38284885	+	RNA	INS	-	-	GG	rs138091320|rs200076851|rs377514954		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr7:38284884_38284885insGG	ENST00000436911.2	-	0	330							P03986	TRGC2_HUMAN	T cell receptor gamma constant 2						immune response (GO:0006955)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)										TTATTTGTCAAGgtgtgtgtgt	0.391																																					.													.	.			0			.																																											0	.			TTGTCAAGGTGTG	M15002		7p14	2012-02-07			ENSG00000227191	ENSG00000227191		"""T cell receptors / TRG locus"""	12276	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C2"""	615450		TCRGC2		3458221	Standard	NG_001336		Approved	TRGC2(2X), TRGC2(3X)		P03986	OTTHUMG00000155215		7.37:g.38284885_38284886dupGG			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	8	0.63	5	.	0		0		RNA	INS	ENST00000436911.2	37																																																																																						0.391	TRGC2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TR_C_gene		OTTHUMT00000338821.2		NG_001336	
CCT6P1	643253	broad.mit.edu	37	7	65226641	65226641	+	RNA	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr7:65226641G>T	ENST00000442266.1	+	0	1167				SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		AGGTTCTTGCGCAGAATTCTG	0.383																																					.													.	.			0			.																																											0	.			TCTTGCGCAGAAT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65226641G>T			Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	155	0.03	4	.	15	0.00	0		RNA	SNP	ENST00000442266.1	37																																																																																						0.383	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345507.1		NR_003110	
GNAT3	346562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	80141182	80141182	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr7:80141182T>C	ENST00000398291.3	-	1	154	c.61A>G	c.(61-63)Aaa>Gaa	p.K21E	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	21					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						TGAAGCTTTTTCTCCAGTTCT	0.388																																					p.K21E													.	.			0			c.A61G												92.0	93.0	93.0					7																	80141182		2073	4207	6280	SO:0001583	missense	346562	exon1			GCTTTTTCTCCAG		CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.61A>G	7.37:g.80141182T>C	ENSP00000381339:p.Lys21Glu		Somatic	97	0	0		WXS	Illumina HiSeq	.	82	0.15	12	NM_001102386	0		0	A4D1B2|A4D1B3|B9EJG5	Missense_Mutation	SNP	ENST00000398291.3	37	CCDS47625.1	.	.	.	.	.	.	.	.	.	.	T	17.84	3.487479	0.63962	.	.	ENSG00000214415	ENST00000398291	D	0.88896	-2.44	5.17	5.17	0.71159	.	0.000000	0.85682	U	0.000000	D	0.85435	0.5696	L	0.58810	1.83	0.80722	D	1	P	0.45531	0.86	B	0.37091	0.241	D	0.85547	0.1219	9	.	.	.	.	14.2716	0.66155	0.0:0.0:0.0:1.0	.	21	A8MTJ3	GNAT3_HUMAN	E	21	ENSP00000381339:K21E	.	K	-	1	0	GNAT3	79979118	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.088000	0.71371	2.077000	0.62373	0.533000	0.62120	AAA			0.388	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339909.3		XM_294370	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82389980	82389980	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr7:82389980A>G	ENST00000333891.9	-	24	15600	c.15263T>C	c.(15262-15264)cTa>cCa	p.L5088P		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGCAGGACTTAGACTGAATCG	0.323																																					p.L5088P													.	.			0			c.T15263C												127.0	127.0	127.0					7																	82389980		1829	4071	5900	SO:0001583	missense	27445	exon24			GGACTTAGACTGA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15263T>C	7.37:g.82389980A>G	ENSP00000334319:p.Leu5088Pro		Somatic	468	0	0		WXS	Illumina HiSeq	.	398	0.17	68	NM_033026	0		0		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	13.92	2.380789	0.42207	.	.	ENSG00000186472	ENST00000333891	T	0.09911	2.93	5.25	5.25	0.73442	.	0.177562	0.23053	U	0.052464	T	0.32645	0.0836	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.04781	-1.0927	10	0.87932	D	0	.	15.1597	0.72775	1.0:0.0:0.0:0.0	.	5088	Q9Y6V0-5	.	P	5088	ENSP00000334319:L5088P	ENSP00000334319:L5088P	L	-	2	0	PCLO	82227916	0.984000	0.35163	1.000000	0.80357	0.911000	0.54048	9.339000	0.96797	1.980000	0.57719	0.477000	0.44152	CTA			0.323	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337368.5		NM_014510	
WASL	8976	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	123388725	123388725	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr7:123388725G>A	ENST00000223023.4	-	1	396	c.64C>T	c.(64-66)Ctc>Ttc	p.L22F	RP11-390E23.6_ENST00000607957.1_RNA	NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	22					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGCGGGGTGAGCAACAGGGAC	0.662																																					p.L22F													.	.			0			c.C64T												46.0	43.0	44.0					7																	123388725		2203	4300	6503	SO:0001583	missense	8976	exon1			GGGTGAGCAACAG	D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.64C>T	7.37:g.123388725G>A	ENSP00000223023:p.Leu22Phe		Somatic	38	0	0		WXS	Illumina HiSeq	.	38	0.29	11	NM_003941	95	0.35	33	A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	37	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	G	30	5.054957	0.93793	.	.	ENSG00000106299	ENST00000223023;ENST00000536685	D	0.99912	-7.96	4.78	4.78	0.61160	Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000002	D	0.99645	0.9869	N	0.08118	0	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	D	0.96289	0.9212	10	0.87932	D	0	-5.9631	16.0011	0.80292	0.0:0.0:1.0:0.0	.	22	O00401	WASL_HUMAN	F	22	ENSP00000223023:L22F	ENSP00000223023:L22F	L	-	1	0	WASL	123175961	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.509000	0.81698	2.195000	0.70347	0.460000	0.39030	CTC			0.662	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348522.1		NM_003941	
ABCB8	11194	broad.mit.edu	37	7	150725641	150725641	+	Silent	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr7:150725641C>T	ENST00000297504.6	+	1	105	c.39C>T	c.(37-39)ggC>ggT	p.G13G	ABCB8_ENST00000477092.1_Silent_p.G13G|ABCB8_ENST00000542328.1_Missense_Mutation_p.P30S|ABCB8_ENST00000498578.1_Silent_p.G13G|ABCB8_ENST00000356058.4_Silent_p.G13G|ABCB8_ENST00000358849.4_Silent_p.G13G|RP11-148K1.10_ENST00000479085.1_RNA|ABCB8_ENST00000477719.1_Silent_p.G13G			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	13					transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	TTCGGGGTGGCCCATTCCCAG	0.587											OREG0018445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G13G													.	ABCB8	65		0			c.C39T												65.0	59.0	61.0					7																	150725641		2203	4300	6503	SO:0001819	synonymous_variant	11194	exon1			GGGTGGCCCATTC	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.39C>T	7.37:g.150725641C>T			Somatic	55	0.0363636364	2	1734	WXS	Illumina HiSeq	Phase_I	66	0.33	22	NM_007188	63	0.27	17	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37		.	.	.	.	.	.	.	.	.	.	C	8.550	0.875245	0.17395	.	.	ENSG00000197150	ENST00000542328	D	0.88277	-2.36	4.99	3.2	0.36748	.	.	.	.	.	T	0.78110	0.4232	.	.	.	0.33973	D	0.647038	B	0.12013	0.005	B	0.12156	0.007	T	0.69967	-0.5001	8	0.12766	T	0.61	0.0071	7.6522	0.28354	0.0:0.8099:0.0:0.1901	.	30	G3XAP3	.	S	30	ENSP00000438776:P30S	ENSP00000438776:P30S	P	+	1	0	ABCB8	150356574	0.010000	0.17322	0.044000	0.18714	0.108000	0.19459	0.871000	0.28023	0.695000	0.31675	0.655000	0.94253	CCC			0.587	ABCB8-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000351733.2		NM_007188	
ARHGEF10	9639	mdanderson.org	37	8	1853876	1853876	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr8:1853876G>T	ENST00000398564.1	+	17	2036	c.2036G>T	c.(2035-2037)aGc>aTc	p.S679I	ARHGEF10_ENST00000518288.1_Missense_Mutation_p.S678I|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.S616I|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.S679I|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.S654I			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	679					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GCCACCGTCAGCTCACGGTAA	0.403																																					p.S654I													.	.			0			c.G1961T												129.0	115.0	120.0					8																	1853876		2203	4300	6503	SO:0001583	missense	9639	exon17			CCGTCAGCTCACG	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.2036G>T	8.37:g.1853876G>T	ENSP00000381571:p.Ser679Ile		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_014629	118	0.01	1	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	37		.	.	.	.	.	.	.	.	.	.	G	15.04	2.714138	0.48622	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27	5.25	4.36	0.52297	.	0.096556	0.64402	D	0.000002	T	0.28134	0.0694	M	0.63428	1.95	0.80722	D	1	D;D;P	0.56035	0.974;0.967;0.523	P;P;B	0.57371	0.736;0.819;0.257	T	0.04078	-1.0979	10	0.66056	D	0.02	-28.3639	4.7397	0.13007	0.1924:0.1955:0.6121:0.0	.	679;616;654	O15013;O15013-7;O15013-5	ARHGA_HUMAN;.;.	I	654;616;678;679;679;327	ENSP00000340297:S654I;ENSP00000427909:S616I;ENSP00000431012:S678I;ENSP00000381571:S679I;ENSP00000262112:S679I;ENSP00000427768:S327I	ENSP00000262112:S679I	S	+	2	0	ARHGEF10	1841283	0.996000	0.38824	0.016000	0.15963	0.295000	0.27426	2.795000	0.47861	1.175000	0.42826	0.655000	0.94253	AGC			0.403	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding					
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	77768507	77768507	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr8:77768507C>T	ENST00000521891.2	+	10	9798	c.9350C>T	c.(9349-9351)tCc>tTc	p.S3117F	ZFHX4_ENST00000050961.6_Missense_Mutation_p.S3072F|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S3091F|ZFHX4_ENST00000455469.2_Missense_Mutation_p.S3072F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3072	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GGTCCATCCTCCTTGCCGGGA	0.502										HNSCC(33;0.089)																											p.S3117F													.	.			0			c.C9350T												35.0	35.0	35.0					8																	77768507		1908	4130	6038	SO:0001583	missense	79776	exon10			CATCCTCCTTGCC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9350C>T	8.37:g.77768507C>T	ENSP00000430497:p.Ser3117Phe		Somatic	107	0	0		WXS	Illumina HiSeq	.	115	0.19	22	NM_024721	1	0.00	0	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224078	0.58668	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.54479	0.58;0.62;0.61;0.57	5.45	5.45	0.79879	.	0.000000	0.44285	U	0.000476	T	0.71745	0.3376	M	0.66939	2.045	0.58432	D	0.999999	D;D;D	0.69078	0.996;0.994;0.997	P;P;D	0.72075	0.731;0.899;0.976	T	0.70008	-0.4990	10	0.46703	T	0.11	.	19.4736	0.94973	0.0:1.0:0.0:0.0	.	3072;3072;3117	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	F	3117;3101;3072;3072;3091	ENSP00000430497:S3117F;ENSP00000399605:S3072F;ENSP00000050961:S3072F;ENSP00000430848:S3091F	ENSP00000050961:S3072F	S	+	2	0	ZFHX4	77931062	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.651000	0.83577	2.836000	0.97738	0.655000	0.94253	TCC			0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379197.2		NM_024721	
RSPO2	340419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	109094847	109094847	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr8:109094847G>C	ENST00000276659.5	-	2	640	c.20C>G	c.(19-21)tCc>tGc	p.S7C	RSPO2_ENST00000517781.1_Missense_Mutation_p.S7C|RSPO2_ENST00000517939.1_5'Flank|RSPO2_ENST00000378439.2_Missense_Mutation_p.S7C	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	7					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			GAGGGCAAAGGAGAAAAGGCG	0.612																																					p.S7C													.	.			0			c.C20G												95.0	87.0	89.0					8																	109094847		2203	4300	6503	SO:0001583	missense	340419	exon2			GCAAAGGAGAAAA	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.20C>G	8.37:g.109094847G>C	ENSP00000276659:p.Ser7Cys		Somatic	70	0	0		WXS	Illumina HiSeq	.	65	0.15	10	NM_178565	0		0	B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105853	0.77096	.	.	ENSG00000147655	ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521956;ENST00000522333	T;T;T;T;T	0.80738	-0.99;-0.99;-1.41;-1.41;-1.41	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000006	D	0.83940	0.5363	L	0.52573	1.65	0.36688	D	0.879448	D;D	0.59357	0.985;0.985	P;P	0.52909	0.601;0.713	D	0.86547	0.1832	10	0.51188	T	0.08	-2.4878	19.1489	0.93479	0.0:0.0:1.0:0.0	.	7;7	Q6UXX9;Q6UXX9-3	RSPO2_HUMAN;.	C	7	ENSP00000427937:S7C;ENSP00000367698:S7C;ENSP00000276659:S7C;ENSP00000430010:S7C;ENSP00000430973:S7C	ENSP00000276659:S7C	S	-	2	0	RSPO2	109164023	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.408000	0.90221	2.622000	0.88805	0.591000	0.81541	TCC			0.612	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380830.1		NM_178565	
SCRIB	23513	mdanderson.org	37	8	144874951	144874951	+	Silent	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr8:144874951G>T	ENST00000320476.3	-	30	4110	c.4104C>A	c.(4102-4104)ccC>ccA	p.P1368P	SCRIB_ENST00000356994.2_Silent_p.P1368P|RP11-429J17.8_ENST00000532625.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA|RP11-429J17.8_ENST00000534089.1_RNA|SCRIB_ENST00000546337.1_5'UTR|SCRIB_ENST00000377533.3_Silent_p.P1287P	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1368					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CCTCGGCCTGGGGCACGCGCA	0.711																																					p.P1368P	Pancreas(51;966 1133 10533 14576 29674)												.	.			0			c.C4104A												18.0	18.0	18.0					8																	144874951		2199	4291	6490	SO:0001819	synonymous_variant	23513	exon30			GGCCTGGGGCACG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4104C>A	8.37:g.144874951G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_182706	230	0.00	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	G	0.861	-0.735235	0.03111	.	.	ENSG00000180900	ENST00000526832	T	0.24151	1.87	4.71	-0.949	0.10376	.	.	.	.	.	T	0.19127	0.0459	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22173	-1.0224	6	0.33141	T	0.24	.	0.79	0.01056	0.4152:0.1279:0.197:0.2599	.	.	.	.	T	364	ENSP00000431519:P364T	ENSP00000431519:P364T	P	-	1	0	SCRIB	144946939	0.997000	0.39634	0.133000	0.22050	0.021000	0.10359	0.269000	0.18589	-0.187000	0.10516	0.491000	0.48974	CCA			0.711	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000382215.1		NM_015356	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu	37	8	144940608	144940608	+	Missense_Mutation	SNP	C	C	T	rs377487212	byFrequency	TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr8:144940608C>T	ENST00000525985.1	-	2	6885	c.6814G>A	c.(6814-6816)Gtc>Atc	p.V2272I				P58107	EPIPL_HUMAN	epiplakin 1	2272						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.V2272I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGGTCGATGACGAAGCCGGTG	0.716													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		65703	0.0		0.0	False		,,,				2504	0.0				p.V2272I													EPPK1,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	EPPK1	0	1	1	Substitution - Missense(1)	central_nervous_system(1)	c.G6814A							C	ILE/VAL	2,4322		0,2,2160	43.0	41.0	41.0		6814	-1.3	1.0	8		41	7,8473		0,7,4233	no	missense	EPPK1	NM_031308.1	29	0,9,6393	TT,TC,CC		0.0825,0.0463,0.0703	benign	2272/2420	144940608	9,12795	2162	4240	6402	SO:0001583	missense	83481	exon1			CGATGACGAAGCC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6814G>A	8.37:g.144940608C>T	ENSP00000436337:p.Val2272Ile		Somatic	72	0.0138888889	1		WXS	Illumina HiSeq	.	62	0.15	9	NM_031308	50	0.00	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	5.870	0.344685	0.11126	4.63E-4	8.25E-4	ENSG00000227184	ENST00000525985	T	0.63580	-0.05	4.63	-1.32	0.09201	.	.	.	.	.	T	0.23451	0.0567	N	0.00991	-1.07	0.29726	N	0.838232	B	0.24963	0.115	B	0.29598	0.104	T	0.36601	-0.9741	9	0.02654	T	1	.	4.9377	0.13948	0.0:0.4183:0.2731:0.3086	.	2272	E9PPU0	.	I	2272	ENSP00000436337:V2272I	ENSP00000436337:V2272I	V	-	1	0	EPPK1	145012596	0.000000	0.05858	0.985000	0.45067	0.968000	0.65278	-2.308000	0.01131	-0.505000	0.06568	-0.236000	0.12185	GTC			0.716	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
TTC39B	158219	mdanderson.org	37	9	15175099	15175099	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr9:15175099G>T	ENST00000512701.2	-	19	1912	c.1876C>A	c.(1876-1878)Ccg>Acg	p.P626T	TTC39B_ENST00000355694.2_Missense_Mutation_p.P560T|TTC39B_ENST00000380850.4_Missense_Mutation_p.P613T|TTC39B_ENST00000507993.1_Missense_Mutation_p.P461T|TTC39B_ENST00000297615.5_Missense_Mutation_p.P557T|TTC39B_ENST00000507285.1_Missense_Mutation_p.P461T			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	626										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						AGAGTGAACGGCACTAGGTAG	0.373																																					p.P626T													.	.			0			c.C1876A												96.0	91.0	93.0					9																	15175099		2203	4300	6503	SO:0001583	missense	158219	exon19			TGAACGGCACTAG	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.1876C>A	9.37:g.15175099G>T	ENSP00000422496:p.Pro626Thr		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_152574	11	0.00	0	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	ENST00000512701.2	37	CCDS6477.2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146388	0.77888	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.75050	-0.9;1.11;0.79;0.79;1.11;1.11	5.72	5.72	0.89469	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.88742	0.6519	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.988;0.997;0.999	D	0.89940	0.4072	10	0.87932	D	0	-15.9572	19.4919	0.95054	0.0:0.0:1.0:0.0	.	557;613;558;560;143	F5H705;E9PAQ9;A5PLN1;Q5VTQ0;Q8IXZ6	.;.;.;TT39B_HUMAN;.	T	613;557;560;626;461;461	ENSP00000370231:P613T;ENSP00000297615:P557T;ENSP00000347920:P560T;ENSP00000422496:P626T;ENSP00000426539:P461T;ENSP00000423392:P461T	ENSP00000297615:P557T	P	-	1	0	TTC39B	15165099	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.483000	0.81158	2.691000	0.91804	0.655000	0.94253	CCG			0.373	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051758.3		NM_152574	
SLC28A3	64078	mdanderson.org	37	9	86917157	86917157	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr9:86917157G>T	ENST00000376238.4	-	5	531	c.482C>A	c.(481-483)cCt>cAt	p.P161H	SLC28A3_ENST00000537648.1_Missense_Mutation_p.P92H	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	161					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	CCTTCTGCCAGGAGACAGCAT	0.453																																					p.P161H	Ovarian(106;425 1539 34835 42413 43572)												.	.			0			c.C482A												118.0	109.0	112.0					9																	86917157		2203	4300	6503	SO:0001583	missense	64078	exon5			CTGCCAGGAGACA	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.482C>A	9.37:g.86917157G>T	ENSP00000365413:p.Pro161His		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001199633	4	0.00	0	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718799	0.48622	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.02032	4.66;4.49	5.33	5.33	0.75918	.	0.053822	0.85682	D	0.000000	T	0.12944	0.0314	M	0.75777	2.31	0.44254	D	0.997101	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.982	T	0.00033	-1.2269	10	0.87932	D	0	-17.6183	17.9616	0.89087	0.0:0.0:1.0:0.0	.	92;161	B4E2S8;Q9HAS3	.;S28A3_HUMAN	H	161;92	ENSP00000365413:P161H;ENSP00000446438:P92H	ENSP00000365413:P161H	P	-	2	0	SLC28A3	86106977	1.000000	0.71417	0.902000	0.35471	0.048000	0.14542	4.676000	0.61627	2.775000	0.95449	0.655000	0.94253	CCT			0.453	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000052874.1		NM_022127	
CRB2	286204	mdanderson.org	37	9	126129537	126129537	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr9:126129537G>T	ENST00000373631.3	+	5	842	c.841G>T	c.(841-843)Gac>Tac	p.D281Y	CRB2_ENST00000373629.2_5'Flank|CRB2_ENST00000359999.3_Missense_Mutation_p.D281Y	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	281	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						GCAGCGCTCTGACCCGGCCCT	0.692																																					p.D281Y													.	.			0			c.G841T												35.0	42.0	39.0					9																	126129537		2202	4300	6502	SO:0001583	missense	286204	exon5			CGCTCTGACCCGG	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.841G>T	9.37:g.126129537G>T	ENSP00000362734:p.Asp281Tyr		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_173689	0		0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212503	0.58452	.	.	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.88277	-2.36;-2.36	5.1	1.81	0.25067	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.441144	0.19072	N	0.123471	D	0.90222	0.6943	M	0.68728	2.09	0.80722	D	1	D;D	0.64830	0.994;0.993	P;P	0.58873	0.751;0.847	D	0.87358	0.2342	10	0.56958	D	0.05	.	5.446	0.16535	0.503:0.0:0.497:0.0	.	281;281	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	Y	281	ENSP00000353092:D281Y;ENSP00000362734:D281Y	ENSP00000353092:D281Y	D	+	1	0	CRB2	125169358	0.985000	0.35326	0.434000	0.26772	0.953000	0.61014	2.394000	0.44450	0.553000	0.29044	-0.152000	0.13540	GAC			0.692	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053990.3		NM_173689	
SEC16A	9919	mdanderson.org	37	9	139336215	139336215	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr9:139336215G>T	ENST00000371706.3	-	28	6430	c.6397C>A	c.(6397-6399)Ctg>Atg	p.L2133M	SEC16A_ENST00000313050.7_Missense_Mutation_p.L2356M|SEC16A_ENST00000313084.5_Missense_Mutation_p.L384M|SEC16A_ENST00000431893.2_Missense_Mutation_p.L2153M|SEC16A_ENST00000467838.1_5'UTR|SEC16A_ENST00000290037.6_Missense_Mutation_p.L2158M|INPP5E_ENST00000371712.3_5'Flank			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	2178	Required for interaction with SEC23A.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GCCTAGTTCAGCACCAGGTGC	0.627																																					p.L2356M													.	.			0			c.C7066A												68.0	82.0	77.0					9																	139336215		2118	4228	6346	SO:0001583	missense	9919	exon32			AGTTCAGCACCAG	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.6397C>A	9.37:g.139336215G>T	ENSP00000360771:p.Leu2133Met		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_014866	78	0.00	0	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.95|15.95	2.983006|2.983006	0.53827|0.53827	.|.	.|.	ENSG00000148396|ENSG00000148396	ENST00000433860|ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000313084;ENST00000537660;ENST00000290037;ENST00000431893;ENST00000404925;ENST00000398348	.|T;T;T;T;T;T	.|0.53423	.|1.57;0.62;1.17;1.49;1.55;1.52	5.5|5.5	-7.51|-7.51	0.01346|0.01346	.|.	.|0.330438	.|0.26979	.|N	.|0.021522	T|T	0.59115|0.59115	0.2170|0.2170	M|M	0.63843|0.63843	1.955|1.955	0.52501|0.52501	D|D	0.99995|0.99995	.|D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D;D	.|0.91635	.|0.999;0.998;0.999;0.999;0.998;0.997;0.999;0.999;0.999	T|T	0.71258|0.71258	-0.4646|-0.4646	5|10	.|0.87932	.|D	.|0	-2.8616|-2.8616	16.1623|16.1623	0.81730|0.81730	0.7599:0.0:0.2401:0.0|0.7599:0.0:0.2401:0.0	.|.	.|196;2333;2200;2153;1726;2178;733;384;199	.|B4DY06;F1T0I1;O15027-5;O15027-4;A4QN19;O15027;C9JVR0;Q8N9G1;F6VLX6	.|.;.;.;.;.;SC16A_HUMAN;.;.;.	D|M	504|2356;750;1058;2133;384;199;2158;2153;1726;733	.|ENSP00000325827:L2356M;ENSP00000277537:L750M;ENSP00000403525:L1058M;ENSP00000360771:L2133M;ENSP00000290037:L2158M;ENSP00000387583:L2153M	.|ENSP00000277537:L750M	A|L	-|-	2|1	0|2	SEC16A|SEC16A	138456036|138456036	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	-0.793000|-0.793000	0.04589|0.04589	-1.728000|-1.728000	0.01366|0.01366	-0.389000|-0.389000	0.06534|0.06534	GCT|CTG			0.627	SEC16A-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000055077.1		XM_088459	
EHMT1	79813	mdanderson.org	37	9	140729282	140729282	+	Silent	SNP	C	C	T	rs371136319		TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chr9:140729282C>T	ENST00000460843.1	+	27	3801	c.3774C>T	c.(3772-3774)tgC>tgT	p.C1258C		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1258					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GCTGCCGCTGCGGCTCCCCCA	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		10529	0.001		0.0	False		,,,				2504	0.0				p.C1258C													.	.			0			c.C3774T							C		0,4406		0,0,2203	32.0	30.0	30.0		3774	-4.7	0.9	9		30	1,8593		0,1,4296	no	coding-synonymous	EHMT1	NM_024757.4		0,1,6499	TT,TC,CC		0.0116,0.0,0.0077		1258/1299	140729282	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	79813	exon27			CCGCTGCGGCTCC	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3774C>T	9.37:g.140729282C>T			Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_024757	83	0.00	0	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	ENST00000460843.1	37	CCDS7050.2																																																																																					0.672	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055371.2		NM_024757	
DCX	1641	hgsc.bcm.edu	37	X	110653901	110653901	+	Intron	SNP	T	T	C			TCGA-YU-A912-01A-11D-A435-10	TCGA-YU-A912-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	468cbb8a-c062-4b63-8e48-644496a795e2	047fbeb8-426a-4b89-9920-743bf10f3b2a	g.chrX:110653901T>C	ENST00000338081.3	-	1	393				DCX_ENST00000371993.2_Intron|DCX_ENST00000356915.2_Intron|DCX_ENST00000488120.1_Intron|DCX_ENST00000356220.3_Intron|DCX_ENST00000496551.1_Intron	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin						axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						GAGTAAGAGATAGAGAGGGAG	0.512																																					.													.	.			0			.																																									SO:0001627	intron_variant	100873756	.			AAGAGATAGAGAG	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.221+80A>G	X.37:g.110653901T>C			Somatic	66	0	0		WXS	Illumina HiSeq	.	62	0.10	6	.	0		0	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	RNA	SNP	ENST00000338081.3	37	CCDS14556.1																																																																																					0.512	DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000357058.1		NM_178153	
