#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TP73	7161	mdanderson.org	37	1	3607508	3607508	+	Intron	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:3607508G>T	ENST00000378295.4	+	3	341				TP73_ENST00000354437.4_Intron|TP73_ENST00000604479.1_Intron|TP73_ENST00000357733.3_Intron|TP73_ENST00000346387.4_Intron|TP73_ENST00000378285.1_Splice_Site_p.T13T|TP73_ENST00000378288.4_Splice_Site_p.T13T|TP73_ENST00000604074.1_Intron|TP73_ENST00000603362.1_Intron|TP73_ENST00000378280.1_Splice_Site_p.T13T	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73						activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		ACCTCGCCACGGTAGGTGTGA	0.632																																					p.T13T													TP73_ENST00000378288,NS,carcinoma,0,1	TP73_ENST00000378288	0	1	0			c.G39T												23.0	22.0	22.0					1																	3607508		1555	3566	5121	SO:0001627	intron_variant	7161	exon1			CGCCACGGTAGGT	AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.186+7764G>T	1.37:g.3607508G>T			Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_001204190	0		0	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Silent	SNP	ENST00000378295.4	37	CCDS49.1																																																																																					0.632	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001468.4		NM_005427	
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:16918653C>T	ENST00000430580.2	-	6	853		c.e6+1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																																					.													.	.			0			.																																									SO:0001630	splice_region_variant	55672	.			AACTTACTGTTGT	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.34+1G>A	1.37:g.16918653C>T			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	.	0		0	Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37																																																																																						0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000106436.3		NM_017940	Intron
HSPG2	3339	mdanderson.org	37	1	22200901	22200901	+	Silent	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:22200901G>T	ENST00000374695.3	-	28	3733	c.3654C>A	c.(3652-3654)ggC>ggA	p.G1218G		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1218	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGACGCACTGGCCGGCAGCAG	0.657																																					p.G1218G													.	.			0			c.C3654A												24.0	26.0	25.0					1																	22200901		2203	4298	6501	SO:0001819	synonymous_variant	3339	exon28			GCACTGGCCGGCA	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3654C>A	1.37:g.22200901G>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_005529	74	0.00	0	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	10.46	1.355886	0.24598	.	.	ENSG00000142798	ENST00000427897	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	T	0.70360	0.3215	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69355	-0.5167	4	.	.	.	.	14.1574	0.65426	0.0:0.0:1.0:0.0	.	.	.	.	T	73	.	.	P	-	1	0	HSPG2	22073488	1.000000	0.71417	1.000000	0.80357	0.313000	0.28021	5.239000	0.65371	2.394000	0.81467	0.407000	0.27541	CCA			0.657	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007598.1		NM_005529	
HTR1D	3352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	23520342	23520342	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:23520342G>A	ENST00000374619.1	-	1	880	c.371C>T	c.(370-372)gCc>gTc	p.A124V	HTR1D_ENST00000314113.3_Missense_Mutation_p.A124V	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	124					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	CAGGATGGAGGCTGTGCAGCA	0.552																																					p.A124V													.	.			0			c.C371T												149.0	124.0	132.0					1																	23520342		2203	4300	6503	SO:0001583	missense	3352	exon1			ATGGAGGCTGTGC	M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.371C>T	1.37:g.23520342G>A	ENSP00000363748:p.Ala124Val		Somatic	117	0	0		WXS	Illumina HiSeq	.	84	0.45	38	NM_000864	42	0.45	19		Missense_Mutation	SNP	ENST00000374619.1	37	CCDS231.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947363	0.92593	.	.	ENSG00000179546	ENST00000314113;ENST00000374619	T;T	0.75704	-0.96;-0.96	5.6	5.6	0.85130	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89185	0.6643	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90801	0.4694	10	0.72032	D	0.01	.	18.5989	0.91240	0.0:0.0:1.0:0.0	.	124	P28221	5HT1D_HUMAN	V	124	ENSP00000313661:A124V;ENSP00000363748:A124V	ENSP00000313661:A124V	A	-	2	0	HTR1D	23392929	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	9.869000	0.99810	2.648000	0.89879	0.655000	0.94253	GCC			0.552	HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008924.1		NM_000864	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	27057901	27057901	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:27057901C>T	ENST00000324856.7	+	3	1980	c.1609C>T	c.(1609-1611)Cag>Tag	p.Q537*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q154*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q537*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	537					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ATACCCCTCCCAGCAGTCGAC	0.637			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q537X				Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.			0			c.C1609T												234.0	232.0	233.0					1																	27057901		2203	4300	6503	SO:0001587	stop_gained	8289	exon3			CCCTCCCAGCAGT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1609C>T	1.37:g.27057901C>T	ENSP00000320485:p.Gln537*		Somatic	133	0	0		WXS	Illumina HiSeq	.	106	0.52	55	NM_006015	156	0.28	44	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	34	5.377963	0.95945	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.44	5.44	0.79542	.	0.062472	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-6.4954	17.6161	0.88068	0.0:1.0:0.0:0.0	.	.	.	.	X	537;537;154	.	ENSP00000320485:Q537X	Q	+	1	0	ARID1A	26930488	0.996000	0.38824	1.000000	0.80357	0.940000	0.58332	3.543000	0.53633	2.824000	0.97209	0.655000	0.94253	CAG			0.637	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000011437.2		NM_139135	
EPHA10	284656	mdanderson.org	37	1	38227303	38227303	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:38227303G>T	ENST00000373048.4	-	3	623	c.624C>A	c.(622-624)taC>taA	p.Y208*	EPHA10_ENST00000427468.2_Nonsense_Mutation_p.Y208*|EPHA10_ENST00000319637.6_Nonsense_Mutation_p.Y208*	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	208	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGCACTGCTTGTAGTAGACGC	0.692																																					p.Y208X													.	.			0			c.C624A												22.0	26.0	25.0					1																	38227303		2200	4296	6496	SO:0001587	stop_gained	284656	exon3			CTGCTTGTAGTAG	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.624C>A	1.37:g.38227303G>T	ENSP00000362139:p.Tyr208*		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_173641	0		0	A4FU89|J3KPB5|Q6NW42	Nonsense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855803	0.91355	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	.	.	.	4.52	2.53	0.30540	.	0.000000	0.37761	N	0.001958	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5512	0.33453	0.2047:0.0:0.7953:0.0	.	.	.	.	X	208	.	ENSP00000316395:Y208X	Y	-	3	2	EPHA10	37999890	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.396000	0.66297	0.533000	0.28675	0.637000	0.83480	TAC			0.692	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000012497.2		NM_173641	
STRIP1	85369	hgsc.bcm.edu	37	1	110584439	110584439	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:110584439T>C	ENST00000369795.3	+	8	863	c.841T>C	c.(841-843)Ttt>Ctt	p.F281L	STRIP1_ENST00000369796.1_Missense_Mutation_p.F186L	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	281					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CGCCCCTCACTTTCCCATGAA	0.522																																					p.F281L													.	.			0			c.T841C												209.0	193.0	198.0					1																	110584439		2203	4300	6503	SO:0001583	missense	85369	exon8			CCTCACTTTCCCA	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.841T>C	1.37:g.110584439T>C	ENSP00000358810:p.Phe281Leu		Somatic	156	0	0		WXS	Illumina HiSeq	.	96	0.04	4	NM_033088	69	0.00	0	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Missense_Mutation	SNP	ENST00000369795.3	37	CCDS30798.1	.	.	.	.	.	.	.	.	.	.	T	31	5.058831	0.93846	.	.	ENSG00000143093	ENST00000369796;ENST00000369795	T;T	0.52295	0.67;0.74	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.46249	0.1383	M	0.81802	2.56	0.80722	D	1	B;P	0.35481	0.163;0.504	B;B	0.40782	0.137;0.34	T	0.50550	-0.8815	10	0.40728	T	0.16	-22.5007	16.158	0.81680	0.0:0.0:0.0:1.0	.	186;281	Q5VSL9-2;Q5VSL9	.;FA40A_HUMAN	L	186;281	ENSP00000358811:F186L;ENSP00000358810:F281L	ENSP00000358810:F281L	F	+	1	0	FAM40A	110385962	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.643000	0.83403	2.206000	0.71126	0.533000	0.62120	TTT			0.522	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032213.1		NM_033088	
GATAD2B	57459	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	153784507	153784507	+	Silent	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:153784507C>T	ENST00000368655.4	-	9	1764	c.1521G>A	c.(1519-1521)acG>acA	p.T507T		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	507					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T507T(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCTGCCGAAGCGTATGATGTC	0.443																																					p.T507T													GATAD2B,colon,carcinoma,0,1	GATAD2B	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G1521A												123.0	117.0	119.0					1																	153784507		2203	4300	6503	SO:0001819	synonymous_variant	57459	exon9			CCGAAGCGTATGA	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.1521G>A	1.37:g.153784507C>T			Somatic	65	0	0		WXS	Illumina HiSeq	.	70	0.09	6	NM_020699	53	0.06	3	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Silent	SNP	ENST00000368655.4	37	CCDS1054.1																																																																																					0.443	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090305.1		NM_020699	
SPTA1	6708	broad.mit.edu	37	1	158605702	158605702	+	Splice_Site	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr1:158605702C>T	ENST00000368147.4	-	38	5613		c.e38+1			NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ATCCCACTCACCGGGCCTTGG	0.537																																					.													.	SPTA1	720		0			c.5432+1G>A												73.0	76.0	75.0					1																	158605702		1924	4141	6065	SO:0001630	splice_region_variant	6708	exon39			CACTCACCGGGCC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5432+1G>A	1.37:g.158605702C>T			Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	123	0.07	9	NM_003126	0		0	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Splice_Site	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.875870	0.91664	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4695	0.90767	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTA1	156872326	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.106000	0.77039	2.941000	0.99782	0.655000	0.94253	.			0.537	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051851.3		NM_003126	Intron
LARP4B	23185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	859126	859126	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr10:859126T>A	ENST00000316157.3	-	17	1997	c.1957A>T	c.(1957-1959)Att>Ttt	p.I653F	LARP4B_ENST00000469487.1_5'Flank	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	653					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CTCTGACAAATCTCTGCGTAG	0.463																																					p.I653F													.	.			0			c.A1957T												86.0	85.0	85.0					10																	859126		2203	4300	6503	SO:0001583	missense	23185	exon18			GACAAATCTCTGC	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1957A>T	10.37:g.859126T>A	ENSP00000326128:p.Ile653Phe		Somatic	140	0	0		WXS	Illumina HiSeq	.	145	0.44	64	NM_015155	228	0.59	134	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	37	CCDS31131.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.197147|5.197147	0.94960|0.94960	.|.	.|.	ENSG00000107929|ENSG00000107929	ENST00000448368|ENST00000316157	.|T	.|0.38401	.|1.14	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.50973|0.50973	0.1647|0.1647	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.76575	.|0.988	T|T	0.52719|0.52719	-0.8538|-0.8538	5|10	.|0.87932	.|D	.|0	.|.	16.6288|16.6288	0.85011|0.85011	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|653	.|Q92615	.|LAR4B_HUMAN	V|F	253|653	.|ENSP00000326128:I653F	.|ENSP00000326128:I653F	D|I	-|-	2|1	0|0	LARP4B|LARP4B	849126|849126	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	6.792000|6.792000	0.75125|0.75125	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	GAT|ATT			0.463	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046395.2		NM_015155	
SKIDA1	387640	broad.mit.edu	37	10	21805483	21805483	+	Silent	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr10:21805483C>T	ENST00000449193.2	-	4	3521	c.1269G>A	c.(1267-1269)gaG>gaA	p.E423E	SKIDA1_ENST00000444772.3_Silent_p.E344E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	342						nucleus (GO:0005634)											cctcctcttcctcctcctcct	0.627																																					p.E423E													.	.			0			c.G1269A												5.0	6.0	6.0					10																	21805483		2007	4123	6130	SO:0001819	synonymous_variant	387640	exon4			CTCTTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1269G>A	10.37:g.21805483C>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	40	0.10	4	NM_207371	32	0.00	0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																					0.627	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286950.2		NM_207371	
HERC4	26091	mdanderson.org	37	10	69699401	69699401	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr10:69699401G>T	ENST00000395198.3	-	22	2786	c.2539C>A	c.(2539-2541)Cag>Aag	p.Q847K	HERC4_ENST00000277817.6_Missense_Mutation_p.Q737K|HERC4_ENST00000412272.2_Intron|HERC4_ENST00000373700.4_Missense_Mutation_p.Q839K|HERC4_ENST00000395187.2_3'UTR	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	847	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						TCCAGTAACTGTTGCATGCTT	0.284																																					p.Q847K													.	.			0			c.C2539A												118.0	114.0	115.0					10																	69699401		2202	4298	6500	SO:0001583	missense	26091	exon22			GTAACTGTTGCAT	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2539C>A	10.37:g.69699401G>T	ENSP00000378624:p.Gln847Lys		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	109	0.05	5	NM_022079	45	0.00	0	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.806798	0.50421	.	.	ENSG00000148634	ENST00000277817;ENST00000395198;ENST00000373700	T;T;T	0.56941	0.43;0.43;0.43	5.37	5.37	0.77165	HECT (4);	0.112392	0.64402	D	0.000011	T	0.48624	0.1510	L	0.31804	0.96	0.80722	D	1	B;B;B;B	0.32467	0.321;0.372;0.321;0.372	B;B;B;B	0.39771	0.205;0.309;0.138;0.216	T	0.36383	-0.9750	10	0.22109	T	0.4	.	19.0918	0.93229	0.0:0.0:1.0:0.0	.	737;697;839;847	Q5GLZ8-6;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;HERC4_HUMAN	K	737;847;839	ENSP00000277817:Q737K;ENSP00000378624:Q847K;ENSP00000362804:Q839K	ENSP00000277817:Q737K	Q	-	1	0	HERC4	69369407	1.000000	0.71417	0.235000	0.24058	0.968000	0.65278	4.451000	0.60047	2.506000	0.84524	0.591000	0.81541	CAG			0.284	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359262.1		NM_015601	
CDHR5	53841	broad.mit.edu	37	11	617401	617402	+	Frame_Shift_Ins	INS	-	-	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:617401_617402insC	ENST00000358353.3	-	16	2809_2810	c.2487_2488insG	c.(2485-2490)gggaggfs	p.R830fs	IRF7_ENST00000525445.1_5'Flank|IRF7_ENST00000397562.3_5'Flank|IRF7_ENST00000348655.6_5'Flank|CDHR5_ENST00000397542.2_Frame_Shift_Ins_p.R830fs|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397566.1_5'Flank|IRF7_ENST00000397574.2_5'Flank|CDHR5_ENST00000349570.7_Frame_Shift_Ins_p.R636fs|IRF7_ENST00000397570.1_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	830					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						CCCCCACCCCTCCCCGCGCCCT	0.693																																					p.R830fs													.	CDHR5	77		0			c.2488_2489insG																																									SO:0001589	frameshift_variant	53841	exon15			CACCCCTCCCCGC	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.2488dupG	11.37:g.617405_617405dupC	ENSP00000351118:p.Arg830fs		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	83	0.07	6	NM_021924	9	0.00	0	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Frame_Shift_Ins	INS	ENST00000358353.3	37	CCDS7707.1																																																																																					0.693	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255023.2		NM_021924	
MUC2	4583	mdanderson.org	37	11	1092971	1092971	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:1092971C>T	ENST00000441003.2	+	30	4817	c.4790C>T	c.(4789-4791)aCa>aTa	p.T1597I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaaccccaacacccaccggc	0.632																																					p.T1597I													MUC2_ENST00000441003,NS,carcinoma,0,1	MUC2_ENST00000441003	0	1	0			c.C4790T												47.0	82.0	70.0					11																	1092971		1782	3233	5015	SO:0001583	missense	4583	exon30			CCCCAACACCCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4790C>T	11.37:g.1092971C>T	ENSP00000415183:p.Thr1597Ile		Somatic	34	0.0588235294	2		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.395	-0.338980	0.05243	.	.	ENSG00000198788	ENST00000441003	T	0.14640	2.49	1.75	0.762	0.18454	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.41520	-0.9504	8	0.22109	T	0.4	.	4.3366	0.11089	0.0:0.6142:0.0:0.3858	.	1597	E7EUV1	.	I	1597	ENSP00000415183:T1597I	ENSP00000415183:T1597I	T	+	2	0	MUC2	1082971	0.029000	0.19370	0.001000	0.08648	0.134000	0.20937	1.107000	0.31110	0.104000	0.17725	0.121000	0.15741	ACA			0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
DCHS1	8642	broad.mit.edu	37	11	6662633	6662633	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:6662633C>T	ENST00000299441.3	-	2	623	c.212G>A	c.(211-213)gGc>gAc	p.G71D		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	71	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCTGCCGTGCCTGCCGGAAG	0.632																																					p.G71D													.	DCHS1	277		0			c.G212A												29.0	28.0	29.0					11																	6662633		2201	4296	6497	SO:0001583	missense	8642	exon2			GCCGTGCCTGCCG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.212G>A	11.37:g.6662633C>T	ENSP00000299441:p.Gly71Asp		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_003737	14	0.00	0	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501178	0.26861	.	.	ENSG00000166341	ENST00000299441	T	0.49139	0.79	5.41	4.3	0.51218	Cadherin (3);Cadherin-like (1);	0.140000	0.32884	N	0.005527	T	0.62036	0.2395	L	0.55743	1.74	0.49389	D	0.999783	D	0.89917	1.0	D	0.87578	0.998	T	0.62637	-0.6812	10	0.54805	T	0.06	.	12.923	0.58243	0.0:0.8633:0.0:0.1367	.	71	Q96JQ0	PCD16_HUMAN	D	71	ENSP00000299441:G71D	ENSP00000299441:G71D	G	-	2	0	DCHS1	6619209	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.949000	0.56668	2.536000	0.85505	0.643000	0.83706	GGC			0.632	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257258.1		NM_003737	
TPH1	7166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18057536	18057536	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:18057536G>T	ENST00000250018.2	-	2	833	c.271C>A	c.(271-273)Cta>Ata	p.L91I	TPH1_ENST00000341556.2_Missense_Mutation_p.L91I	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	91	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.			NL -> TP (in Ref. 2; AAA67050). {ECO:0000305}.	aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	TTATCTGGTAGATTCACAGAG	0.328																																					p.L91I													TPH1,NS,carcinoma,+2,1	TPH1	2	1	0			c.C271A												80.0	80.0	80.0					11																	18057536		2200	4293	6493	SO:0001583	missense	7166	exon2			CTGGTAGATTCAC	X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.271C>A	11.37:g.18057536G>T	ENSP00000250018:p.Leu91Ile		Somatic	115	0	0		WXS	Illumina HiSeq	.	94	0.30	28	NM_004179	2	0.50	1	D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	ENST00000250018.2	37	CCDS7829.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967678	0.34754	.	.	ENSG00000129167	ENST00000250018;ENST00000341556;ENST00000528338	D;D;D	0.99722	-6.14;-6.15;-6.53	5.51	1.28	0.21552	.	0.316417	0.39210	N	0.001437	D	0.96926	0.8996	N	0.08118	0	0.09310	N	0.999997	B	0.02656	0.0	B	0.08055	0.003	D	0.95302	0.8404	10	0.21014	T	0.42	-8.0E-4	7.1395	0.25548	0.1384:0.0:0.607:0.2546	.	91	P17752	TPH1_HUMAN	I	91;91;101	ENSP00000250018:L91I;ENSP00000343550:L91I;ENSP00000436081:L101I	ENSP00000250018:L91I	L	-	1	2	TPH1	18014112	1.000000	0.71417	0.966000	0.40874	0.973000	0.67179	2.909000	0.48758	0.309000	0.22966	0.655000	0.94253	CTA			0.328	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389696.1		NM_004179	
TPH1	7166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18057614	18057614	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:18057614C>G	ENST00000250018.2	-	2	755	c.193G>C	c.(193-195)Gac>Cac	p.D65H	TPH1_ENST00000341556.2_Missense_Mutation_p.D65H	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	65	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	ATGTCACAGTCAACAAAAATC	0.343																																					p.D65H													.	.			0			c.G193C												114.0	108.0	110.0					11																	18057614		2200	4293	6493	SO:0001583	missense	7166	exon2			CACAGTCAACAAA	X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.193G>C	11.37:g.18057614C>G	ENSP00000250018:p.Asp65His		Somatic	134	0	0		WXS	Illumina HiSeq	.	123	0.26	32	NM_004179	1	0.00	0	D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	ENST00000250018.2	37	CCDS7829.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756961	0.89843	.	.	ENSG00000129167	ENST00000250018;ENST00000341556;ENST00000528338	D;D;D	0.98968	-5.28;-5.28;-5.28	5.51	5.51	0.81932	Amino acid-binding ACT (1);	0.000000	0.85682	D	0.000000	D	0.99278	0.9748	H	0.97390	3.995	0.80722	D	1	B	0.26147	0.143	B	0.41946	0.371	D	0.98962	1.0798	10	0.54805	T	0.06	-24.1041	19.7758	0.96391	0.0:1.0:0.0:0.0	.	65	P17752	TPH1_HUMAN	H	65;65;75	ENSP00000250018:D65H;ENSP00000343550:D65H;ENSP00000436081:D75H	ENSP00000250018:D65H	D	-	1	0	TPH1	18014190	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.741000	0.84997	2.752000	0.94435	0.655000	0.94253	GAC			0.343	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389696.1		NM_004179	
SLC43A1	8501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57281542	57281542	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:57281542T>A	ENST00000278426.3	-	2	398	c.43A>T	c.(43-45)Atg>Ttg	p.M15L	SLC43A1_ENST00000528450.1_Missense_Mutation_p.M15L	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GTGCAGGCCATCCACCAGCGC	0.637																																					p.M15L													.	.			0			c.A43T												29.0	27.0	28.0					11																	57281542		2198	4296	6494	SO:0001583	missense	8501	exon2			AGGCCATCCACCA	AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.43A>T	11.37:g.57281542T>A	ENSP00000278426:p.Met15Leu		Somatic	45	0	0		WXS	Illumina HiSeq	.	33	0.39	13	NM_001198810	13	0.23	3		Missense_Mutation	SNP	ENST00000278426.3	37	CCDS7958.1	.	.	.	.	.	.	.	.	.	.	T	17.60	3.429892	0.62844	.	.	ENSG00000149150	ENST00000278426;ENST00000528450;ENST00000533066;ENST00000533263	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.36	5.36	0.76844	Major facilitator superfamily domain, general substrate transporter (1);	0.077674	0.85682	D	0.000000	T	0.29126	0.0724	L	0.48260	1.515	0.49798	D	0.999821	B	0.16166	0.016	B	0.16722	0.016	T	0.11717	-1.0576	10	0.02654	T	1	-32.8948	14.3357	0.66589	0.0:0.0:0.0:1.0	.	15	O75387	LAT3_HUMAN	L	15	ENSP00000278426:M15L;ENSP00000435673:M15L;ENSP00000435647:M15L;ENSP00000435486:M15L	ENSP00000278426:M15L	M	-	1	0	SLC43A1	57038118	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.829000	0.69316	2.039000	0.60335	0.528000	0.53228	ATG			0.637	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392541.1		NM_003627	
SYVN1	84447	mdanderson.org	37	11	64897841	64897841	+	Silent	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:64897841G>T	ENST00000377190.3	-	12	1210	c.1116C>A	c.(1114-1116)ggC>ggA	p.G372G	SYVN1_ENST00000294256.8_Silent_p.G372G|SYVN1_ENST00000526060.1_Silent_p.G372G|SYVN1_ENST00000307289.6_Silent_p.G321G|SYVN1_ENST00000526121.1_5'Flank	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	372	Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GAGGCAGGAGGCCCTGGGGGA	0.637																																					p.G372G													.	.			0			c.C1116A												32.0	33.0	32.0					11																	64897841		2196	4296	6492	SO:0001819	synonymous_variant	84447	exon12			CAGGAGGCCCTGG	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1116C>A	11.37:g.64897841G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_032431	65	0.00	0	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Silent	SNP	ENST00000377190.3	37	CCDS31605.1																																																																																					0.637	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000385274.1		NM_032431	
DPP3	10072	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	66260275	66260275	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:66260275G>A	ENST00000360510.2	+	10	1142	c.1077G>A	c.(1075-1077)tgG>tgA	p.W359*	DPP3_ENST00000453114.1_Nonsense_Mutation_p.W359*|DPP3_ENST00000532677.1_Nonsense_Mutation_p.W378*|DPP3_ENST00000533799.1_3'UTR|DPP3_ENST00000541961.1_Nonsense_Mutation_p.W359*|DPP3_ENST00000530165.1_Nonsense_Mutation_p.W329*|DPP3_ENST00000531863.1_Nonsense_Mutation_p.W379*			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	359					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						AGCTGCCCTGGCCCCCAACCT	0.602																																					p.W359X													.	DPP3	61		0			c.G1077A												89.0	87.0	87.0					11																	66260275		2200	4295	6495	SO:0001587	stop_gained	10072	exon10			GCCCTGGCCCCCA	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1077G>A	11.37:g.66260275G>A	ENSP00000353701:p.Trp359*		Somatic	110	0.0090909091	1		WXS	Illumina HiSeq	Phase_I	107	0.76	81	NM_130443	84	0.19	16	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Nonsense_Mutation	SNP	ENST00000360510.2	37	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	G	35	5.547048	0.96488	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807	.	.	.	5.41	4.49	0.54785	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2503	0.60048	0.0:0.0:0.8399:0.1601	.	.	.	.	X	379;378;359;359;359;329;257	.	ENSP00000353701:W359X	W	+	3	0	DPP3	66016851	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.175000	0.77632	1.263000	0.44181	-0.181000	0.13052	TGG			0.602	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393424.2			
CCDC87	55231	mdanderson.org	37	11	66358257	66358257	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:66358257G>T	ENST00000333861.3	-	1	2297	c.2230C>A	c.(2230-2232)Caa>Aaa	p.Q744K	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	744					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TTGGAAGCTTGTCCCTCAAAC	0.557																																					p.Q744K													.	.			0			c.C2230A												113.0	121.0	119.0					11																	66358257		2200	4295	6495	SO:0001583	missense	55231	exon1			AAGCTTGTCCCTC	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.2230C>A	11.37:g.66358257G>T	ENSP00000328487:p.Gln744Lys		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_018219	4	0.00	0	Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	37	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	G	8.736	0.917836	0.17982	.	.	ENSG00000182791	ENST00000333861	T	0.24538	1.85	5.07	4.12	0.48240	.	0.533887	0.15773	N	0.245348	T	0.23572	0.0570	L	0.60455	1.87	0.09310	N	0.999991	P	0.38300	0.626	B	0.33846	0.171	T	0.13388	-1.0511	10	0.40728	T	0.16	-0.4269	10.5814	0.45257	0.0:0.2111:0.7889:0.0	.	744	Q9NVE4	CCD87_HUMAN	K	744	ENSP00000328487:Q744K	ENSP00000328487:Q744K	Q	-	1	0	CCDC87	66114833	0.082000	0.21442	0.255000	0.24374	0.300000	0.27592	1.394000	0.34509	2.639000	0.89480	0.561000	0.74099	CAA			0.557	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393825.1		NM_018219	
TSKU	25987	mdanderson.org	37	11	76506691	76506691	+	Missense_Mutation	SNP	G	G	T	rs202220235		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:76506691G>T	ENST00000527881.1	+	2	1057	c.31G>T	c.(31-33)Gtg>Ttg	p.V11L	TSKU_ENST00000333090.4_Missense_Mutation_p.V11L			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	11					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					GCTGCTGGCCGTGAGTGGGGC	0.617																																					p.V11L													.	.			0			c.G31T												35.0	40.0	39.0					11																	76506691		2200	4291	6491	SO:0001583	missense	25987	exon2			CTGGCCGTGAGTG	AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.31G>T	11.37:g.76506691G>T	ENSP00000434847:p.Val11Leu		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_015516	235	0.00	0	B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Missense_Mutation	SNP	ENST00000527881.1	37	CCDS8246.1	.	.	.	.	.	.	.	.	.	.	G	4.876	0.162887	0.09287	.	.	ENSG00000182704	ENST00000533752;ENST00000333090;ENST00000439807;ENST00000525167;ENST00000527881	T;T;T	0.50277	0.75;1.59;1.59	5.14	-1.92	0.07618	.	1.197050	0.05863	N	0.623343	T	0.19725	0.0474	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12553	-1.0543	10	0.30078	T	0.28	-0.9982	1.5851	0.02642	0.2245:0.2821:0.3334:0.16	.	11	Q8WUA8	TSK_HUMAN	L	11	ENSP00000435133:V11L;ENSP00000332668:V11L;ENSP00000434847:V11L	ENSP00000332668:V11L	V	+	1	0	TSKU	76184339	0.000000	0.05858	0.012000	0.15200	0.480000	0.33159	-1.616000	0.02053	-0.049000	0.13379	-0.137000	0.14449	GTG			0.617	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382871.1		NM_015516	
ROBO3	64221	mdanderson.org	37	11	124745971	124745971	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr11:124745971C>T	ENST00000397801.1	+	16	2735	c.2543C>T	c.(2542-2544)gCc>gTc	p.A848V	ROBO3_ENST00000543966.1_5'Flank|ROBO3_ENST00000538940.1_Missense_Mutation_p.A826V	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	848	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GTCGCGGCGGCCACCAGCGCA	0.682											OREG0021467	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A848V													.	.			0			c.C2543T												17.0	19.0	18.0					11																	124745971		1947	4138	6085	SO:0001583	missense	64221	exon16			CGGCGGCCACCAG	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.2543C>T	11.37:g.124745971C>T	ENSP00000380903:p.Ala848Val		Somatic	58	0	0	1536	WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_022370	11	0.00	0		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218079	0.58560	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.48522	0.81;0.81	5.09	4.18	0.49190	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.41001	D	0.000962	T	0.29620	0.0739	N	0.10760	0.04	0.80722	D	1	B	0.24963	0.115	B	0.37091	0.241	T	0.08391	-1.0724	10	0.17832	T	0.49	.	8.8332	0.35096	0.0:0.7688:0.1503:0.0809	.	848	Q96MS0	ROBO3_HUMAN	V	848;826	ENSP00000380903:A848V;ENSP00000441797:A826V	ENSP00000380903:A848V	A	+	2	0	ROBO3	124251181	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	1.976000	0.40579	1.127000	0.42034	0.563000	0.77884	GCC			0.682	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387091.1		XM_370663	
GPR162	27239	broad.mit.edu	37	12	6933730	6933730	+	Silent	SNP	T	T	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr12:6933730T>G	ENST00000311268.3	+	2	1453	c.666T>G	c.(664-666)ggT>ggG	p.G222G	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						TGGGGGGTGGTGGGGGGACCA	0.677																																					p.G222G													.	GPR162	55		0			c.T666G												25.0	31.0	29.0					12																	6933730		2202	4298	6500	SO:0001819	synonymous_variant	27239	exon2			GGGTGGTGGGGGG	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.666T>G	12.37:g.6933730T>G			Somatic	63	0.0952380952	6		WXS	Illumina HiSeq	Phase_I	83	0.16	13	NM_019858	2	0.00	0	Q16664|Q59EH5|Q66K56	Silent	SNP	ENST00000311268.3	37	CCDS8563.1																																																																																					0.677	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399478.1		NM_019858	
EIF4B	1975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53410339	53410339	+	Silent	SNP	C	C	G	rs373400973		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr12:53410339C>G	ENST00000262056.9	+	2	422	c.96C>G	c.(94-96)acC>acG	p.T32T	RP11-983P16.4_ENST00000549388.1_RNA|RP11-983P16.2_ENST00000435621.3_RNA|EIF4B_ENST00000551527.1_3'UTR|EIF4B_ENST00000420463.3_Silent_p.T32T|EIF4B_ENST00000416762.3_Silent_p.T32T|RP11-983P16.4_ENST00000552905.1_RNA	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	32					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						GAGGAAGCACCTATGTTTCCA	0.423																																					p.T32T													.	.			0			c.C96G							C		0,3688		0,0,1844	122.0	117.0	119.0		96	3.8	1.0	12		119	1,8173		0,1,4086	no	coding-synonymous	EIF4B	NM_001417.4		0,1,5930	GG,GC,CC		0.0122,0.0,0.0084		32/612	53410339	1,11861	1844	4087	5931	SO:0001819	synonymous_variant	1975	exon2			AAGCACCTATGTT	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.96C>G	12.37:g.53410339C>G			Somatic	60	0	0		WXS	Illumina HiSeq	.	75	0.23	17	NM_001417	410	0.30	124	Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Silent	SNP	ENST00000262056.9	37	CCDS41788.1																																																																																					0.423	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000404852.2		NM_001417	
PA2G4	5036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56505268	56505268	+	Silent	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr12:56505268C>T	ENST00000303305.6	+	12	1493	c.1074C>T	c.(1072-1074)ctC>ctT	p.L358L	RP11-603J24.17_ENST00000548595.1_RNA|PA2G4_ENST00000552766.1_Intron	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	358	Necessary for nucleolar localization.				cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			AGGCCCTCCTCCAGAGTTCTG	0.403																																					p.L358L													.	.			0			c.C1074T												104.0	108.0	107.0					12																	56505268		2201	4299	6500	SO:0001819	synonymous_variant	5036	exon12			CCTCCTCCAGAGT	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.1074C>T	12.37:g.56505268C>T			Somatic	226	0	0		WXS	Illumina HiSeq	.	214	0.30	64	NM_006191	664	0.30	196	O43846|Q9UM59	Silent	SNP	ENST00000303305.6	37	CCDS8902.1																																																																																					0.403	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407767.1		NM_006191	
SYCP3	50511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	102125386	102125386	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr12:102125386C>T	ENST00000392927.3	-	7	643	c.512G>A	c.(511-513)aGa>aAa	p.R171K	SYCP3_ENST00000266743.2_Missense_Mutation_p.R171K|SYCP3_ENST00000392924.1_Missense_Mutation_p.R171K	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	171	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TGTTTTCAATCTCTGGCTCTG	0.279																																					p.R171K													.	.			0			c.G512A												59.0	59.0	59.0					12																	102125386		2201	4270	6471	SO:0001583	missense	50511	exon7			TTCAATCTCTGGC	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.512G>A	12.37:g.102125386C>T	ENSP00000376658:p.Arg171Lys		Somatic	74	0	0		WXS	Illumina HiSeq	.	55	0.29	16	NM_001177949	0		0		Missense_Mutation	SNP	ENST00000392927.3	37	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.622527	0.46840	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	4.56	3.64	0.41730	.	0.106561	0.64402	D	0.000005	T	0.47728	0.1461	L	0.55103	1.725	0.33847	D	0.632106	P	0.35575	0.51	B	0.36030	0.216	T	0.58736	-0.7584	9	0.22109	T	0.4	-7.0642	14.7446	0.69480	0.0:0.8543:0.1457:0.0	.	171	Q8IZU3	SYCP3_HUMAN	K	171	.	ENSP00000266743:R171K	R	-	2	0	SYCP3	100649517	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.258000	0.51507	1.210000	0.43336	0.305000	0.20034	AGA			0.279	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316478.2		NM_153694	
FRY	10129	mdanderson.org	37	13	32776178	32776178	+	Splice_Site	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr13:32776178G>T	ENST00000380250.3	+	30	4342		c.e30+1			NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GCTCATGCAGGCACGTATCAT	0.378																																					.													.	.			0			c.3846+1G>T												118.0	104.0	108.0					13																	32776178		1895	4114	6009	SO:0001630	splice_region_variant	10129	exon30			ATGCAGGCACGTA	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.3846+1G>T	13.37:g.32776178G>T			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_023037	0		0	Q9Y3N6	Splice_Site	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221466	0.79464	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9928	0.97374	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRY	31674178	1.000000	0.71417	0.996000	0.52242	0.674000	0.39518	9.759000	0.98931	2.745000	0.94114	0.650000	0.86243	.			0.378	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044405.1		NM_023037	Intron
TFDP1	7027	mdanderson.org	37	13	114294482	114294482	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr13:114294482G>C	ENST00000375370.5	+	12	1345	c.1133G>C	c.(1132-1134)gGg>gCg	p.G378A	TFDP1_ENST00000544902.1_Missense_Mutation_p.G349A|TFDP1_ENST00000538138.1_Missense_Mutation_p.G279A	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	378					anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			AGCTCCAATGGGTCTCAGTAC	0.632										TSP Lung(29;0.18)																											p.G378A													.	.			0			c.G1133C												92.0	87.0	89.0					13																	114294482		2203	4300	6503	SO:0001583	missense	7027	exon12			CCAATGGGTCTCA	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.1133G>C	13.37:g.114294482G>C	ENSP00000364519:p.Gly378Ala		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_007111	388	0.00	0	B4DLQ9|Q5JSB4|Q8IZL5	Missense_Mutation	SNP	ENST00000375370.5	37	CCDS9538.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.754516	0.31046	.	.	ENSG00000198176	ENST00000538138;ENST00000375370;ENST00000544902	T;T;T	0.46063	0.99;2.04;0.88	3.95	3.95	0.45737	.	0.158159	0.56097	N	0.000028	T	0.25717	0.0626	N	0.19112	0.55	0.25676	N	0.985841	B;B;B	0.25441	0.126;0.003;0.005	B;B;B	0.22386	0.039;0.004;0.007	T	0.10337	-1.0634	10	0.05959	T	0.93	.	16.3301	0.83006	0.0:0.0:1.0:0.0	.	349;279;378	F5H452;B4DLQ9;Q14186	.;.;TFDP1_HUMAN	A	279;378;349	ENSP00000443878:G279A;ENSP00000364519:G378A;ENSP00000438450:G349A	ENSP00000364519:G378A	G	+	2	0	TFDP1	113342483	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.414000	0.66405	1.910000	0.55303	0.491000	0.48974	GGG			0.632	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045918.3		NM_007111	
HECTD1	25831	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	31576895	31576897	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr14:31576895_31576897delCTC	ENST00000399332.1	-	37	6982_6984	c.6494_6496delGAG	c.(6493-6498)ggagaa>gaa	p.G2165del	HECTD1_ENST00000553700.1_In_Frame_Del_p.G2165del	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2165	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GTTCCTTCTTCTCCTAAAAATTC	0.345																																					p.2165_2166del													.	HECTD1	159		0			c.6495_6497del																																									SO:0001651	inframe_deletion	25831	exon37			CTTCTTCTCCTAA	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6494_6496delGAG	14.37:g.31576895_31576897delCTC	ENSP00000382269:p.Gly2165del		Somatic	120	0	0		WXS	Illumina HiSeq	.	78	0.22	17	NM_015382	103	0.00	0	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	In_Frame_Del	DEL	ENST00000399332.1	37	CCDS41939.1																																																																																					0.345	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000409942.1			
SIX4	51804	mdanderson.org	37	14	61190366	61190366	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr14:61190366G>T	ENST00000216513.4	-	1	486	c.427C>A	c.(427-429)Cgt>Agt	p.R143S		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	143					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		TCGTTGCCACGTAGCAGGTCG	0.687																																					p.R143S													.	.			0			c.C427A												9.0	9.0	9.0					14																	61190366		2179	4268	6447	SO:0001583	missense	51804	exon1			TGCCACGTAGCAG	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.427C>A	14.37:g.61190366G>T	ENSP00000216513:p.Arg143Ser		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_017420	0		0	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	37	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213624	0.79352	.	.	ENSG00000100625	ENST00000216513;ENST00000556952	D	0.91180	-2.8	3.48	3.48	0.39840	.	0.393903	0.29940	N	0.010817	D	0.82783	0.5112	N	0.12920	0.275	0.80722	D	1	B;P	0.34815	0.047;0.47	B;B	0.34242	0.135;0.178	D	0.84516	0.0625	10	0.56958	D	0.05	.	15.1462	0.72653	0.0:0.0:1.0:0.0	.	135;143	G3V2N2;Q9UIU6	.;SIX4_HUMAN	S	143;135	ENSP00000216513:R143S	ENSP00000216513:R143S	R	-	1	0	SIX4	60260119	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.500000	0.81588	1.769000	0.52152	0.650000	0.86243	CGT			0.687	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000072397.2			
C14orf159	80017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	91642295	91642295	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr14:91642295G>A	ENST00000523771.1	+	7	1213	c.610G>A	c.(610-612)Gag>Aag	p.E204K	C14orf159_ENST00000522322.1_Missense_Mutation_p.E204K|C14orf159_ENST00000428926.2_Missense_Mutation_p.E204K|C14orf159_ENST00000521077.2_Missense_Mutation_p.E209K|C14orf159_ENST00000520328.1_Missense_Mutation_p.E192K|C14orf159_ENST00000523816.1_Missense_Mutation_p.E204K|C14orf159_ENST00000412671.2_Missense_Mutation_p.E209K|C14orf159_ENST00000518868.1_Missense_Mutation_p.E209K|C14orf159_ENST00000256324.10_Missense_Mutation_p.E209K|C14orf159_ENST00000525393.2_Missense_Mutation_p.E80K			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	204						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		GGGAATCAAAGAGCTTTCCAA	0.502																																					p.E209K													.	.			0			c.G625A												107.0	100.0	103.0					14																	91642295		2203	4300	6503	SO:0001583	missense	80017	exon7			ATCAAAGAGCTTT	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.610G>A	14.37:g.91642295G>A	ENSP00000429655:p.Glu204Lys		Somatic	119	0	0		WXS	Illumina HiSeq	.	96	0.14	13	NM_001102368	18	0.06	1	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Missense_Mutation	SNP	ENST00000523771.1	37	CCDS32141.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.100546	0.37048	.	.	ENSG00000133943	ENST00000520328;ENST00000256324;ENST00000521077;ENST00000518868;ENST00000523816;ENST00000517518;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	T;T;T;T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.06	4.16	0.48862	.	0.175523	0.48767	D	0.000172	T	0.28134	0.0694	N	0.24115	0.695	0.09310	N	1	P;B;P;B;P;P	0.38677	0.642;0.129;0.642;0.358;0.589;0.589	B;B;B;B;B;B	0.37508	0.252;0.084;0.252;0.116;0.163;0.163	T	0.16748	-1.0392	10	0.66056	D	0.02	.	8.6546	0.34055	0.0827:0.1537:0.7636:0.0	.	204;80;209;192;209;209	Q7Z3D6;Q8NB88;B3KVU6;Q7Z3D6-5;Q7Z3D6-2;Q7Z3D6-3	CN159_HUMAN;.;.;.;.;.	K	192;209;209;209;204;209;80;204;204;204;209	ENSP00000429453:E192K;ENSP00000256324:E209K;ENSP00000430137:E209K;ENSP00000428263:E209K;ENSP00000428974:E204K;ENSP00000428652:E209K;ENSP00000435459:E80K;ENSP00000404343:E204K;ENSP00000427953:E204K;ENSP00000429655:E204K;ENSP00000404196:E209K	ENSP00000256324:E209K	E	+	1	0	C14orf159	90712048	0.712000	0.27916	0.025000	0.17156	0.845000	0.48019	1.735000	0.38176	1.231000	0.43661	0.561000	0.74099	GAG			0.502	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381273.1		NM_024952	
DICER1	23405	mdanderson.org	37	14	95579466	95579466	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr14:95579466T>C	ENST00000526495.1	-	14	2294	c.2003A>G	c.(2002-2004)tAt>tGt	p.Y668C	DICER1_ENST00000343455.3_Missense_Mutation_p.Y668C|DICER1_ENST00000393063.1_Missense_Mutation_p.Y668C|DICER1_ENST00000541352.1_Missense_Mutation_p.Y668C|DICER1_ENST00000527414.1_Missense_Mutation_p.Y668C			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	668	Dicer dsRNA-binding fold. {ECO:0000255|PROSITE-ProRule:PRU00657}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AATTGGCAGATAAAGAGTTGA	0.373			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.Y668C			yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	.			0			c.A2003G												111.0	111.0	111.0					14																	95579466		2203	4300	6503	SO:0001583	missense	23405	exon12	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	GGCAGATAAAGAG	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.2003A>G	14.37:g.95579466T>C	ENSP00000437256:p.Tyr668Cys		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	93	0.04	4	NM_001271282	79	0.04	3	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.807112	0.70797	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.72	5.03	5.03	0.67393	Dicer double-stranded RNA-binding fold (2);	0.063724	0.64402	D	0.000003	T	0.65739	0.2720	L	0.58101	1.795	0.58432	D	0.999995	D	0.76494	0.999	P	0.62813	0.907	T	0.65565	-0.6137	10	0.39692	T	0.17	-15.0597	14.7903	0.69837	0.0:0.0:0.0:1.0	.	668	Q9UPY3	DICER_HUMAN	C	668	ENSP00000343745:Y668C;ENSP00000437256:Y668C;ENSP00000376783:Y668C;ENSP00000435681:Y668C;ENSP00000444719:Y668C	ENSP00000343745:Y668C	Y	-	2	0	DICER1	94649219	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	4.228000	0.58619	1.901000	0.55032	0.455000	0.32223	TAT			0.373	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000387997.1			
AK7	122481	broad.mit.edu;mdanderson.org	37	14	96858506	96858506	+	Silent	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr14:96858506G>A	ENST00000267584.4	+	1	59	c.15G>A	c.(13-15)gaG>gaA	p.E5E	AK7_ENST00000555570.1_Silent_p.E5E	NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	5	Poly-Glu.				axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		CTGAAGAAGAGGAAACTGCTG	0.612																																					p.E5E													.	AK7	69		0			c.G15A												66.0	71.0	69.0					14																	96858506		2203	4300	6503	SO:0001819	synonymous_variant	122481	exon1			AGAAGAGGAAACT	AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.15G>A	14.37:g.96858506G>A			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	55	0.09	5	NM_152327	11	0.09	1	Q8IYP6	Silent	SNP	ENST00000267584.4	37	CCDS9945.1																																																																																					0.612	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413340.1			
SPTBN5	51332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42156128	42156128	+	Missense_Mutation	SNP	C	C	T	rs563656968		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr15:42156128C>T	ENST00000320955.6	-	40	7240	c.7013G>A	c.(7012-7014)cGg>cAg	p.R2338Q	MIR4310_ENST00000582950.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2338					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTGGCTTCGCCGCTGGCAGAT	0.602													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17491	0.0		0.0	False		,,,				2504	0.0				p.R2303Q													.	.			0			c.G6908A												114.0	117.0	116.0					15																	42156128		2021	4179	6200	SO:0001583	missense	51332	exon40			CTTCGCCGCTGGC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.7013G>A	15.37:g.42156128C>T	ENSP00000317790:p.Arg2338Gln		Somatic	54	0	0		WXS	Illumina HiSeq	.	39	0.15	6	NM_016642	10	0.20	2		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	.	34	5.292157	0.95546	.	.	ENSG00000137877	ENST00000320955	T	0.54675	0.56	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000002	T	0.70527	0.3234	M	0.66939	2.045	0.33380	D	0.574695	D	0.89917	1.0	D	0.91635	0.999	T	0.79699	-0.1694	10	0.72032	D	0.01	.	15.3493	0.74370	0.0:1.0:0.0:0.0	.	2338	Q9NRC6	SPTN5_HUMAN	Q	2338	ENSP00000317790:R2338Q	ENSP00000317790:R2338Q	R	-	2	0	SPTBN5	39943420	0.997000	0.39634	0.945000	0.38365	0.994000	0.84299	1.616000	0.36933	2.362000	0.80069	0.561000	0.74099	CGG			0.602	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000420237.1		NM_016642	
HERC1	8925	broad.mit.edu;mdanderson.org	37	15	64019909	64019909	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr15:64019909G>T	ENST00000443617.2	-	17	3370	c.3283C>A	c.(3283-3285)Ctt>Att	p.L1095I		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1095					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AGTCTATTAAGGCAATCAAGA	0.453																																					p.L1095I													.	HERC1	624		0			c.C3283A												58.0	56.0	57.0					15																	64019909		1900	4148	6048	SO:0001583	missense	8925	exon17			TATTAAGGCAATC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.3283C>A	15.37:g.64019909G>T	ENSP00000390158:p.Leu1095Ile		Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	138	0.04	5	NM_003922	5	0.00	0	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957584	0.92726	.	.	ENSG00000103657	ENST00000443617	T	0.69306	-0.39	5.39	5.39	0.77823	.	0.000000	0.64402	U	0.000004	T	0.58004	0.2092	L	0.29908	0.895	0.58432	D	0.999996	P	0.46987	0.888	B	0.39465	0.3	T	0.65179	-0.6231	10	0.66056	D	0.02	.	19.151	0.93488	0.0:0.0:1.0:0.0	.	1095	Q15751	HERC1_HUMAN	I	1095	ENSP00000390158:L1095I	ENSP00000390158:L1095I	L	-	1	0	HERC1	61806962	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.696000	0.68287	2.528000	0.85240	0.655000	0.94253	CTT			0.453	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418523.1		NM_003922	
STRA6	64220	mdanderson.org	37	15	74488353	74488353	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr15:74488353G>T	ENST00000323940.5	-	5	647	c.402C>A	c.(400-402)agC>agA	p.S134R	STRA6_ENST00000449139.2_Missense_Mutation_p.S134R|STRA6_ENST00000423167.2_Missense_Mutation_p.S125R|STRA6_ENST00000535552.1_Missense_Mutation_p.S171R|STRA6_ENST00000432245.2_Missense_Mutation_p.S134R|STRA6_ENST00000563965.1_Missense_Mutation_p.S173R|STRA6_ENST00000574278.1_Missense_Mutation_p.S149R|STRA6_ENST00000395105.4_Missense_Mutation_p.S134R|STRA6_ENST00000574439.1_5'UTR|STRA6_ENST00000416286.3_Missense_Mutation_p.S134R	NM_001142617.1|NM_001142618.1|NM_001142619.1	NP_001136089.1|NP_001136090.1|NP_001136091.1	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid 6	134					adrenal gland development (GO:0030325)|alveolar primary septum development (GO:0061143)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|cognition (GO:0050890)|developmental growth (GO:0048589)|diaphragm development (GO:0060539)|digestive tract morphogenesis (GO:0048546)|ductus arteriosus closure (GO:0097070)|ear development (GO:0043583)|embryonic camera-type eye formation (GO:0060900)|embryonic digestive tract development (GO:0048566)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|feeding behavior (GO:0007631)|female genitalia development (GO:0030540)|head development (GO:0060322)|head morphogenesis (GO:0060323)|heart development (GO:0007507)|kidney development (GO:0001822)|learning (GO:0007612)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung vasculature development (GO:0060426)|neuromuscular process (GO:0050905)|nose morphogenesis (GO:0043585)|paramesonephric duct development (GO:0061205)|phototransduction, visible light (GO:0007603)|positive regulation of behavior (GO:0048520)|positive regulation of JAK-STAT cascade (GO:0046427)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol transport (GO:0034633)|smooth muscle tissue development (GO:0048745)|uterus morphogenesis (GO:0061038)|ventricular septum development (GO:0003281)|vitamin A import (GO:0071939)|vocal learning (GO:0042297)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	receptor activity (GO:0004872)|vitamin transporter activity (GO:0051183)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|stomach(2)	26						GGGTACCTTGGCTGGGTGCTG	0.597																																					p.S173R													.	.			0			c.C519A												58.0	49.0	52.0					15																	74488353		2198	4297	6495	SO:0001583	missense	64220	exon5			ACCTTGGCTGGGT	AF352728	CCDS10261.1, CCDS45301.1, CCDS45302.1, CCDS55973.1, CCDS55974.1, CCDS58387.1	15q24.1	2014-07-14	2012-12-07		ENSG00000137868	ENSG00000137868			30650	protein-coding gene	gene with protein product	"""retinol binding protein 4 receptor"""	610745	"""stimulated by retinoic acid gene 6 homolog (mouse)"", ""stimulated by retinoic acid 6 homolog (mouse)"""			17255476, 17273977	Standard	NM_022369		Approved	FLJ12541	uc002axj.3	Q9BX79	OTTHUMG00000138998	ENST00000323940.5:c.402C>A	15.37:g.74488353G>T	ENSP00000326085:p.Ser134Arg		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001199042	23	0.00	0	A8K7F1|B7Z5M9|B7Z862|D3DW54|F5GYI8|I3L1G8|Q6PJF8|Q71RB9|Q7L9G1|Q7Z3U9|Q8TB21|Q9BX78|Q9H9U8	Missense_Mutation	SNP	ENST00000323940.5	37	CCDS10261.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659594	0.29515	.	.	ENSG00000137868	ENST00000395105;ENST00000323940;ENST00000416286;ENST00000449139;ENST00000423167;ENST00000535552;ENST00000536129;ENST00000432245	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	5.24	-0.298	0.12814	.	0.790012	0.12560	N	0.458278	T	0.78451	0.4285	L	0.43152	1.355	0.09310	N	1	B;B;D;B;B;B	0.57257	0.27;0.27;0.979;0.064;0.064;0.27	B;B;P;B;B;B	0.58454	0.062;0.089;0.839;0.062;0.062;0.089	T	0.65323	-0.6196	10	0.37606	T	0.19	-6.789	3.6983	0.08372	0.4603:0.0:0.366:0.1737	.	171;172;134;125;134;173	F5GYI8;B7Z5G7;Q9BX79-2;Q9BX79-3;Q9BX79;Q9BX79-4	.;.;.;.;STRA6_HUMAN;.	R	134;134;66;173;125;171;24;134	ENSP00000378537:S134R;ENSP00000326085:S134R;ENSP00000413012:S125R;ENSP00000440238:S171R;ENSP00000407176:S134R	ENSP00000326085:S134R	S	-	3	2	STRA6	72275406	0.000000	0.05858	0.009000	0.14445	0.052000	0.14988	-0.101000	0.10973	0.281000	0.22233	0.655000	0.94253	AGC			0.597	STRA6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000272891.1			
CACNA1H	8912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1254228	1254228	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr16:1254228G>A	ENST00000348261.5	+	10	2469	c.2221G>A	c.(2221-2223)Gac>Aac	p.D741N	CACNA1H_ENST00000358590.4_Missense_Mutation_p.D741N|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000565831.1_Missense_Mutation_p.D741N	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	741					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TGACCGCTGGGACCCCACGCG	0.716																																					p.D741N													.	.			0			c.G2221A												17.0	23.0	21.0					16																	1254228		2146	4231	6377	SO:0001583	missense	8912	exon10			CGCTGGGACCCCA	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.2221G>A	16.37:g.1254228G>A	ENSP00000334198:p.Asp741Asn		Somatic	100	0	0		WXS	Illumina HiSeq	.	80	0.30	24	NM_021098	2	0.50	1	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757811	0.49468	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96913	-4.17;-4.12	4.21	4.21	0.49690	.	0.656042	0.14524	N	0.314264	D	0.97551	0.9198	M	0.67700	2.07	0.25071	N	0.990997	D;D	0.89917	1.0;0.994	D;P	0.71870	0.975;0.779	D	0.93215	0.6603	10	0.51188	T	0.08	.	15.7211	0.77710	0.0:0.0:1.0:0.0	.	741;741	O95180-2;O95180	.;CAC1H_HUMAN	N	741	ENSP00000334198:D741N;ENSP00000351401:D741N	ENSP00000334198:D741N	D	+	1	0	CACNA1H	1194229	1.000000	0.71417	0.167000	0.22817	0.007000	0.05969	3.930000	0.56522	2.193000	0.70182	0.561000	0.74099	GAC			0.716	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000421601.1		NM_001005407	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	3900553	3900554	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr16:3900553_3900554delAA	ENST00000262367.5	-	2	1351_1352	c.542_543delTT	c.(541-543)tttfs	p.F181fs	CREBBP_ENST00000382070.3_Frame_Shift_Del_p.F181fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	181					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGGTCTGGTTAAAGTTAGCATT	0.525			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.181_182del				Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546		0			c.543_544del																																									SO:0001589	frameshift_variant	1387	exon2			CTGGTTAAAGTTA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.542_543delTT	16.37:g.3900553_3900554delAA	ENSP00000262367:p.Phe181fs		Somatic	82	0	0		WXS	Illumina HiSeq	.	62	0.27	17	NM_001079846	76	0.00	0	D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Del	DEL	ENST00000262367.5	37	CCDS10509.1																																																																																					0.525	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251591.2		NM_004380	
CDR2	1039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	22376333	22376333	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr16:22376333G>A	ENST00000268383.2	-	2	389	c.82C>T	c.(82-84)Ctt>Ttt	p.L28F	CDR2_ENST00000569045.1_5'UTR|RP11-21M24.3_ENST00000566764.1_RNA	NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	28						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		GCAAGTTGAAGATCTAGCACA	0.378																																					p.L28F													.	.			0			c.C82T												105.0	87.0	93.0					16																	22376333		2197	4300	6497	SO:0001583	missense	1039	exon2			GTTGAAGATCTAG	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.82C>T	16.37:g.22376333G>A	ENSP00000268383:p.Leu28Phe		Somatic	84	0	0		WXS	Illumina HiSeq	.	83	0.43	36	NM_001802	48	0.54	26	A8K8A8|Q13977	Missense_Mutation	SNP	ENST00000268383.2	37	CCDS32404.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594128	0.86953	.	.	ENSG00000140743	ENST00000268383	T	0.36157	1.27	5.91	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.60495	0.2273	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63932	-0.6525	10	0.72032	D	0.01	-11.9522	10.6749	0.45781	0.1415:0.0:0.8585:0.0	.	28	Q01850	CDR2_HUMAN	F	28	ENSP00000268383:L28F	ENSP00000268383:L28F	L	-	1	0	CDR2	22283834	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.149000	0.64863	2.804000	0.96469	0.462000	0.41574	CTT			0.378	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430081.1			
IGHV3OR16-9	28307	broad.mit.edu	37	16	32077601	32077601	+	RNA	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr16:32077601G>A	ENST00000354689.6	+	0	216				RP11-1166P10.6_ENST00000566806.1_RNA					immunoglobulin heavy variable 3/OR16-9 (non-functional)																		CCATCTCCAGGGACAACGCCA	0.502																																					.													.	.			0			.																																											0	.			CTCCAGGGACAAC	Z29606		16p11.2	2013-12-06	2008-09-11		ENSG00000270472	ENSG00000270472		"""Immunoglobulins / IGH orphons"""	5644	other	immunoglobulin gene			"""immunoglobulin heavy variable 3/OR16-9"""				Standard			Approved	IGHV3/OR16-9			OTTHUMG00000184753		16.37:g.32077601G>A			Somatic	272	0.0036764706	1		WXS	Illumina HiSeq	Phase_I	191	0.04	8	.	0		0		RNA	SNP	ENST00000354689.6	37																																																																																						0.502	IGHV3OR16-9-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000432530.2			
HERPUD1	9709	mdanderson.org	37	16	56973165	56973165	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr16:56973165C>A	ENST00000439977.2	+	5	645	c.448C>A	c.(448-450)Cag>Aag	p.Q150K	HERPUD1_ENST00000570273.1_3'UTR|HERPUD1_ENST00000379792.2_Missense_Mutation_p.Q125K|RP11-325K4.2_ENST00000570210.1_RNA|HERPUD1_ENST00000300302.5_Missense_Mutation_p.Q149K|RP11-325K4.3_ENST00000565861.1_RNA|HERPUD1_ENST00000344114.4_Intron	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	150					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of protein binding (GO:0032092)|regulation of protein ubiquitination (GO:0031396)|response to unfolded protein (GO:0006986)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	11						AGCTGCCCAGCAGGCATTCCA	0.423			T	ERG	prostate																																p.Q150K				Dom	yes		16	16q12.2-q13	9709	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1"""		E	.	.			0			c.C448A												124.0	134.0	131.0					16																	56973165		2198	4300	6498	SO:0001583	missense	9709	exon5			GCCCAGCAGGCAT	AB034989	CCDS10771.1, CCDS45492.1	16q13	2008-05-14			ENSG00000051108	ENSG00000051108			13744	protein-coding gene	gene with protein product		608070				10922362, 10708769	Standard	NM_001010989		Approved	KIAA0025, Mif1, HERP, SUP	uc002eke.2	Q15011	OTTHUMG00000133276	ENST00000439977.2:c.448C>A	16.37:g.56973165C>A	ENSP00000409555:p.Gln150Lys		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_014685	93	0.00	0	E9PGD1|O60644|Q6IAN8|Q96D92	Missense_Mutation	SNP	ENST00000439977.2	37	CCDS10771.1	.	.	.	.	.	.	.	.	.	.	C	4.871	0.161893	0.09287	.	.	ENSG00000051108	ENST00000439977;ENST00000379792;ENST00000300302	T;T	0.31769	1.85;1.48	5.98	5.98	0.97165	.	0.729507	0.14356	N	0.324752	T	0.29158	0.0725	L	0.47716	1.5	0.42326	D	0.992279	B;B;B;B	0.25235	0.023;0.121;0.009;0.005	B;B;B;B	0.17979	0.006;0.02;0.008;0.004	T	0.03068	-1.1076	10	0.29301	T	0.29	-17.0674	14.2973	0.66321	0.1484:0.8516:0.0:0.0	.	150;125;149;150	A4UAE9;E9PGD1;Q15011-2;Q15011	.;.;.;HERP1_HUMAN	K	149;125;150	ENSP00000409555:Q149K;ENSP00000369118:Q125K	ENSP00000300302:Q150K	Q	+	1	0	HERPUD1	55530666	0.140000	0.22579	1.000000	0.80357	0.996000	0.88848	1.680000	0.37607	2.838000	0.97847	0.591000	0.81541	CAG			0.423	HERPUD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257056.5			
NEURL4	84461	mdanderson.org	37	17	7224486	7224486	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:7224486G>T	ENST00000399464.2	-	20	3320	c.3305C>A	c.(3304-3306)tCa>tAa	p.S1102*	RP11-542C16.2_ENST00000575474.1_5'Flank|NEURL4_ENST00000570460.1_Nonsense_Mutation_p.S1078*|NEURL4_ENST00000315614.7_Nonsense_Mutation_p.S1100*|NEURL4_ENST00000574120.1_5'Flank	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	1102						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCGGTGTCTGAACTGGGGGA	0.607																																					p.S1102X													.	.			0			c.C3305A												62.0	66.0	64.0					17																	7224486		2182	4278	6460	SO:0001587	stop_gained	84461	exon20			GTGTCTGAACTGG		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.3305C>A	17.37:g.7224486G>T	ENSP00000382390:p.Ser1102*		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_032442	143	0.00	0	Q6GPI8|Q96IU9|Q9H0B0	Nonsense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	G	40	8.345824	0.98769	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	.	.	.	4.73	2.74	0.32292	.	0.168292	0.41097	D	0.000951	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.5802	9.9022	0.41355	0.17:0.0:0.83:0.0	.	.	.	.	X	1100;1102	.	ENSP00000319826:S1100X	S	-	2	0	NEURL4	7165210	0.998000	0.40836	0.629000	0.29254	0.946000	0.59487	2.704000	0.47118	0.606000	0.29965	0.563000	0.77884	TCA			0.607	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255434.2		NM_032442	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		Somatic	281	0.0640569395	18		RNA-Seq	Illumina HiSeq		268	0.04	11	NM_145301	120	0.33	40	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
TRIM16	10626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	15532122	15532122	+	Missense_Mutation	SNP	A	A	T	rs543438903		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:15532122A>T	ENST00000578237.1	-	11	2357	c.1502T>A	c.(1501-1503)tTc>tAc	p.F501Y	TRIM16_ENST00000336708.7_Missense_Mutation_p.F501Y|RP11-385D13.1_ENST00000455584.2_Intron|TRIM16_ENST00000577886.1_Missense_Mutation_p.F285Y|TRIM16_ENST00000579219.1_3'UTR|TRIM16_ENST00000416464.2_Missense_Mutation_p.F371Y			O95361	TRI16_HUMAN	tripartite motif containing 16	501	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		CCCTCCCGGGAAGTCGATATA	0.527																																					p.F501Y													.	.			0			c.T1502A												72.0	73.0	73.0					17																	15532122		2203	4300	6503	SO:0001583	missense	10626	exon9			CCCGGGAAGTCGA	AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.1502T>A	17.37:g.15532122A>T	ENSP00000463188:p.Phe501Tyr		Somatic	169	0	0		WXS	Illumina HiSeq	.	166	0.30	49	NM_006470	35	0.31	11	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	ENST00000578237.1	37	CCDS11171.1	.	.	.	.	.	.	.	.	.	.	.	2.301	-0.360271	0.05103	.	.	ENSG00000221926	ENST00000336708;ENST00000416464	T;T	0.56776	0.44;0.44	4.72	3.5	0.40072	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.15478	0.0373	N	0.00408	-1.53	0.33075	D	0.535858	B;B	0.20368	0.044;0.042	B;B	0.22601	0.03;0.04	T	0.33548	-0.9864	9	0.05959	T	0.93	.	6.9073	0.24315	0.6468:0.0:0.0:0.3532	.	371;501	B3KP96;O95361	.;TRI16_HUMAN	Y	501;371	ENSP00000338989:F501Y;ENSP00000399918:F371Y	ENSP00000338989:F501Y	F	-	2	0	TRIM16	15472847	1.000000	0.71417	0.963000	0.40424	0.228000	0.25075	5.983000	0.70540	1.894000	0.54839	0.528000	0.53228	TTC			0.527	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130700.2		NM_006470	
TBC1D3	729873	bcgsc.ca	37	17	36352419	36352420	+	Intron	INS	-	-	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:36352419_36352420insC	ENST00000537432.1	-	4	427				RP11-1407O15.2_ENST00000312412.4_Intron|RP11-1407O15.2_ENST00000544906.1_Intron			Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTTTTTTTTTTACCTTATCCCC	0.342																																					.													.	.			0			.																																									SO:0001627	intron_variant	729873	.			TTTTTTTACCTTA		CCDS45658.1	17q12	2014-09-16			ENSG00000274611	ENSG00000274419			19031	protein-coding gene	gene with protein product	"""prostate cancer gene 17"""	607741				12604796, 12359748, 16863688	Standard	NM_001123391		Approved	TBC1D3A, DKFZp434P2235, PRC17	uc002hoo.2	Q8IZP1	OTTHUMG00000188487	ENST00000537432.1:c.61+1->G	17.37:g.36352419_36352420insC			Somatic	309	0	0		WXS	Illumina HiSeq	Phase_1	260	0.10	25	.	4	0.25	1	A6NGX2|A8K007|Q6DCB4|Q9H0B9|Q9UDD4	Splice_Site	INS	ENST00000537432.1	37	CCDS45658.1																																																																																					0.342	TBC1D3-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_001123391	
KRT9	3857	broad.mit.edu	37	17	39728194	39728194	+	Silent	SNP	A	A	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:39728194A>C	ENST00000246662.4	-	1	116	c.51T>G	c.(49-51)ggT>ggG	p.G17G	KRT9_ENST00000588431.1_Intron	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	17	Head.|Poly-Gly.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				CGCCCCCGCCACCCCCGCCGC	0.642																																					p.G17G													.	KRT9	78		0			c.T51G																																									SO:0001819	synonymous_variant	3857	exon1			CCCGCCACCCCCG		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.51T>G	17.37:g.39728194A>C			Somatic	41	0.1463414634	6		WXS	Illumina HiSeq	Phase_I	29	0.52	15	NM_000226	0		0	O00109|Q0IJ47|Q14665	Silent	SNP	ENST00000246662.4	37	CCDS32654.1																																																																																					0.642	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257707.1		NM_000226	
PPM1D	8493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	58740737	58740737	+	Nonsense_Mutation	SNP	A	A	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:58740737A>T	ENST00000305921.3	+	6	1874	c.1642A>T	c.(1642-1644)Aag>Tag	p.K548*	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	548					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			CCCCCTGATGAAGAAGCATAG	0.463											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.K548X													.	.			0			c.A1642T												77.0	73.0	75.0					17																	58740737		2203	4300	6503	SO:0001587	stop_gained	8493	exon6			CTGATGAAGAAGC	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1642A>T	17.37:g.58740737A>T	ENSP00000306682:p.Lys548*		Somatic	109	0	0	1033	WXS	Illumina HiSeq	.	84	0.31	26	NM_003620	44	0.36	16	Q53XP4|Q6P991|Q8IVR6	Nonsense_Mutation	SNP	ENST00000305921.3	37	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	A	40	8.113692	0.98659	.	.	ENSG00000170836	ENST00000305921	.	.	.	6.08	6.08	0.98989	.	0.120334	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3048	16.6512	0.85203	1.0:0.0:0.0:0.0	.	.	.	.	X	548	.	ENSP00000306682:K548X	K	+	1	0	PPM1D	56095519	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.400000	0.73252	2.333000	0.79357	0.482000	0.46254	AAG			0.463	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449474.1		NM_003620	
DDX42	11325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	61898885	61898886	+	IGR	DEL	TG	TG	-			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:61898885_61898886delTG	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Frame_Shift_Del_p.Q572fs	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						AGGGGGTGTCTGTGGCAGCTGC	0.574																																					p.572_572del													.	FTSJ3	63		0			c.1715_1716del																																									SO:0001628	intergenic_variant	117246	exon16			GGTGTCTGTGGCA	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61898887_61898888delTG			Somatic	75	0	0		WXS	Illumina HiSeq	.	64	0.00	0	NM_017647	128	0.00	0	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Frame_Shift_Del	DEL	ENST00000578681.1	37	CCDS32704.1																																																																																					0.574	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444368.1		NM_007372	
QRICH2	84074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74288014	74288014	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr17:74288014C>T	ENST00000262765.5	-	4	2475	c.2296G>A	c.(2296-2298)Gta>Ata	p.V766I		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	766										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CCAGGTTGTACCAGGCCATGT	0.537																																					p.V766I													.	.			0			c.G2296A												187.0	177.0	181.0					17																	74288014		2203	4300	6503	SO:0001583	missense	84074	exon4			GTTGTACCAGGCC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.2296G>A	17.37:g.74288014C>T	ENSP00000262765:p.Val766Ile		Somatic	102	0	0		WXS	Illumina HiSeq	.	117	0.11	13	NM_032134	5	0.00	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.550690	0.27739	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.08458	3.09	4.8	3.82	0.43975	.	.	.	.	.	T	0.10294	0.0252	L	0.55103	1.725	0.09310	N	1	P;B	0.46784	0.884;0.4	B;B	0.42738	0.396;0.121	T	0.16897	-1.0387	9	0.19590	T	0.45	-5.9867	10.7472	0.46187	0.1903:0.8097:0.0:0.0	.	766;766	B5MD94;Q9H0J4	.;QRIC2_HUMAN	I	766	ENSP00000262765:V766I	ENSP00000262765:V766I	V	-	1	0	QRICH2	71799609	0.000000	0.05858	0.061000	0.19648	0.496000	0.33645	0.438000	0.21559	1.127000	0.42034	0.448000	0.29417	GTA			0.537	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395140.1		NM_032134	
EMILIN2	84034	mdanderson.org	37	18	2913083	2913083	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr18:2913083A>G	ENST00000254528.3	+	8	3002	c.2843A>G	c.(2842-2844)tAt>tGt	p.Y948C	EMILIN2_ENST00000308080.5_3'UTR	NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	948	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		ACGGCTCCTTATGATGGGCGC	0.617																																					p.Y948C													.	.			0			c.A2843G												48.0	50.0	50.0					18																	2913083		2203	4300	6503	SO:0001583	missense	84034	exon8			CTCCTTATGATGG	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.2843A>G	18.37:g.2913083A>G	ENSP00000254528:p.Tyr948Cys		Somatic	52	0.0192307692	1		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_032048	56	0.02	1	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	A	10.79	1.449419	0.26074	.	.	ENSG00000132205	ENST00000254528;ENST00000308080	T	0.04654	3.58	5.38	4.15	0.48705	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.598323	0.15953	N	0.236645	T	0.12860	0.0312	L	0.43152	1.355	0.09310	N	1	D	0.76494	0.999	D	0.68192	0.956	T	0.09952	-1.0651	10	0.44086	T	0.13	-11.169	10.1007	0.42502	0.5565:0.0:0.0:0.4435	.	948	Q9BXX0	EMIL2_HUMAN	C	948;225	ENSP00000254528:Y948C	ENSP00000254528:Y948C	Y	+	2	0	EMILIN2	2903083	0.050000	0.20438	0.011000	0.14972	0.012000	0.07955	1.289000	0.33307	0.844000	0.35094	0.533000	0.62120	TAT			0.617	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250337.2		NM_032048	
PRSS57	400668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	686926	686926	+	Splice_Site	SNP	G	G	A	rs372538839		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:686926G>A	ENST00000329267.7	-	4	673	c.644C>T	c.(643-645)tCg>tTg	p.S215L		NM_214710.3	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine, 57	215	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|lung(5)	6						GGATCTTACCGAGCAGAAGCC	0.622																																					p.S215L													.	.			0			c.C644T												56.0	57.0	56.0					19																	686926		2203	4300	6503	SO:0001630	splice_region_variant	400668	exon4			CTTACCGAGCAGA	AY358594	CCDS12041.1	19p13.3	2012-03-26	2011-03-07	2011-03-07		ENSG00000185198		"""Serine peptidases / Serine peptidases"""	31397	protein-coding gene	gene with protein product			"""protease, serine-like 1"""	PRSSL1		12975309	Standard	NM_214710		Approved	UNQ782	uc002lpl.1	Q6UWY2		ENST00000329267.7:c.645+1C>T	19.37:g.686926G>A			Somatic	130	0	0		WXS	Illumina HiSeq	.	72	0.36	26	NM_214710	0		0	B2RNW8	Missense_Mutation	SNP	ENST00000329267.7	37	CCDS12041.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802675	0.70682	.	.	ENSG00000185198	ENST00000329267	D	0.88818	-2.43	4.91	3.8	0.43715	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.451111	0.16600	N	0.207397	D	0.87939	0.6304	L	0.40543	1.245	0.80722	D	1	D;D	0.61697	0.979;0.99	P;P	0.51055	0.657;0.657	D	0.87570	0.2477	10	0.46703	T	0.11	.	13.731	0.62787	0.0:0.1552:0.8448:0.0	.	214;215	B7ZMF6;Q6UWY2	.;PRS57_HUMAN	L	215	ENSP00000327386:S215L	ENSP00000327386:S215L	S	-	2	0	PRSS57	637926	0.610000	0.26983	1.000000	0.80357	0.647000	0.38526	2.287000	0.43505	2.265000	0.75225	0.462000	0.41574	TCG			0.622	PRSS57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452480.2		NM_214710	Missense_Mutation
MUC16	94025	mdanderson.org	37	19	9024140	9024140	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:9024140G>T	ENST00000397910.4	-	18	37335	c.37132C>A	c.(37132-37134)Ccc>Acc	p.P12378T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12380					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTACTTGTGGGGCTGGAGAGG	0.438																																					p.P12378T													.	.			0			c.C37132A												79.0	75.0	76.0					19																	9024140		1902	4120	6022	SO:0001583	missense	94025	exon18			TTGTGGGGCTGGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37132C>A	19.37:g.9024140G>T	ENSP00000381008:p.Pro12378Thr		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_024690	0		0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	7.719	0.696807	0.15106	.	.	ENSG00000181143	ENST00000397910	T	0.02103	4.45	1.54	-2.2	0.06994	.	.	.	.	.	T	0.02767	0.0083	M	0.69823	2.125	.	.	.	P	0.47962	0.903	B	0.37508	0.252	T	0.26780	-1.0093	8	0.87932	D	0	.	5.0401	0.14454	0.4831:0.0:0.5169:0.0	.	12378	B5ME49	.	T	12378	ENSP00000381008:P12378T	ENSP00000381008:P12378T	P	-	1	0	MUC16	8885140	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-1.753000	0.01818	-0.542000	0.06249	0.196000	0.17591	CCC			0.438	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402806.1		NM_024690	
C19orf66	55337	mdanderson.org	37	19	10200662	10200662	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:10200662G>T	ENST00000253110.11	+	5	621	c.323G>T	c.(322-324)cGg>cTg	p.R108L	CTD-2240E14.4_ENST00000589622.1_RNA|C19orf66_ENST00000591813.1_Missense_Mutation_p.R108L|C19orf66_ENST00000397881.3_Missense_Mutation_p.R57L	NM_018381.2	NP_060851.2	Q9NUL5	CS066_HUMAN	chromosome 19 open reading frame 66	108										large_intestine(3)|skin(1)	4						GCTGTGGACCGGCAGTTTGCC	0.607																																					p.R108L													.	.			0			c.G323T												48.0	49.0	49.0					19																	10200662		2169	4264	6433	SO:0001583	missense	55337	exon5			TGGACCGGCAGTT		CCDS45957.1	19p13.2	2012-10-26			ENSG00000130813	ENSG00000130813			25649	protein-coding gene	gene with protein product						12477932	Standard	NM_018381		Approved	FLJ11286	uc002mmu.4	Q9NUL5		ENST00000253110.11:c.323G>T	19.37:g.10200662G>T	ENSP00000253110:p.Arg108Leu		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_018381	11	0.00	0	A8MQT9|Q4G188|Q8IYH6|Q8N8V1	Missense_Mutation	SNP	ENST00000253110.11	37	CCDS45957.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121655	0.56613	.	.	ENSG00000130813	ENST00000253110;ENST00000397881	.	.	.	4.3	4.3	0.51218	.	0.432330	0.16698	N	0.203268	T	0.39009	0.1062	N	0.24115	0.695	0.41141	D	0.98595	P;P;P	0.47841	0.901;0.772;0.772	B;B;B	0.39465	0.3;0.26;0.26	T	0.45086	-0.9285	9	0.56958	D	0.05	-22.0365	13.8014	0.63202	0.0:0.0:1.0:0.0	.	57;108;108	Q9NUL5-2;Q9NUL5-4;Q9NUL5	.;.;CS066_HUMAN	L	108;57	.	ENSP00000253110:R108L	R	+	2	0	C19orf66	10061662	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.299000	0.59073	2.236000	0.73375	0.561000	0.74099	CGG			0.607	C19orf66-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000451129.1		NM_018381	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000252455.2_Silent_p.E322E|PRKCSH_ENST00000587327.1_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000412601.1_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E													PRKCSH,caecum,carcinoma,0,1	PRKCSH	0	1	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A												27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	19.37:g.11558370G>A			Somatic	52	0	0		WXS	Illumina HiSeq	.	45	0.09	4	NM_001001329	132	0.00	0	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																					0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000458817.1			
KCTD15	79047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34292141	34292141	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:34292141C>A	ENST00000430256.3	+	3	544	c.136C>A	c.(136-138)Ccc>Acc	p.P46T	KCTD15_ENST00000284006.6_Missense_Mutation_p.P46T|KCTD15_ENST00000588881.1_Missense_Mutation_p.P46T|KCTD15_ENST00000589786.1_Missense_Mutation_p.P46T			Q96SI1	KCD15_HUMAN	potassium channel tetramerization domain containing 15	46					multicellular organismal development (GO:0007275)|protein homooligomerization (GO:0051260)					endometrium(1)|lung(2)|pancreas(1)|urinary_tract(1)	5	Esophageal squamous(110;0.162)					CCAGGGCATCCCCCTGCCAGC	0.612																																					p.P46T	Melanoma(36;646 1094 5145 14504 45302)|GBM(25;193 541 1518 14388 52178)												.	.			0			c.C136A												81.0	75.0	77.0					19																	34292141		2203	4300	6503	SO:0001583	missense	79047	exon4			GGCATCCCCCTGC	AK025590	CCDS12434.1, CCDS46039.1	19q13.12	2013-06-20	2013-06-20			ENSG00000153885			23297	protein-coding gene	gene with protein product		615240	"""potassium channel tetramerisation domain containing 15"""			12477932	Standard	NM_024076		Approved	MGC25497	uc002nuw.4	Q96SI1		ENST00000430256.3:c.136C>A	19.37:g.34292141C>A	ENSP00000394390:p.Pro46Thr		Somatic	65	0	0		WXS	Illumina HiSeq	.	46	0.28	13	NM_001129995	166	0.32	53	A8K600|Q9BVI6	Missense_Mutation	SNP	ENST00000430256.3	37	CCDS46039.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410974	0.83340	.	.	ENSG00000153885	ENST00000430256;ENST00000284006;ENST00000422820	T;T	0.78924	0.56;-1.22	5.46	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.81019	0.4736	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.79212	-0.1896	10	0.33940	T	0.23	.	13.0598	0.59000	0.0:0.9226:0.0:0.0774	.	46;46	Q96SI1;Q96SI1-2	KCD15_HUMAN;.	T	46;46;49	ENSP00000394390:P46T;ENSP00000284006:P46T	ENSP00000284006:P46T	P	+	1	0	KCTD15	38983981	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	7.440000	0.80464	1.304000	0.44892	0.655000	0.94253	CCC			0.612	KCTD15-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451462.2		NM_024076	
LRFN3	79414	broad.mit.edu;mdanderson.org	37	19	36435792	36435792	+	Silent	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:36435792C>T	ENST00000588831.1	+	4	2812	c.1758C>T	c.(1756-1758)acC>acT	p.T586T	AF038458.3_ENST00000592518.1_lincRNA|LRFN3_ENST00000246529.3_Silent_p.T586T			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	586					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCTCCCAGACCAAcggcgccc	0.721																																					p.T586T													.	LRFN3	43		0			c.C1758T												19.0	16.0	17.0					19																	36435792		2202	4297	6499	SO:0001819	synonymous_variant	79414	exon3			CCAGACCAACGGC	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.1758C>T	19.37:g.36435792C>T			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	11	0.36	4	NM_024509	14	0.29	4	Q6UY10	Silent	SNP	ENST00000588831.1	37	CCDS12483.1																																																																																					0.721	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457403.2		NM_024509	
STRN4	29888	mdanderson.org	37	19	47232034	47232034	+	Splice_Site	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:47232034G>T	ENST00000263280.6	-	7	929	c.880C>A	c.(880-882)Ctc>Atc	p.L294I	STRN4_ENST00000594357.2_5'Flank|STRN4_ENST00000539396.1_Splice_Site_p.L175I|CTB-174O21.2_ENST00000600716.1_RNA|STRN4_ENST00000391910.3_Splice_Site_p.L294I	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	294						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		TTGGATGGGAGCTGGCACATG	0.567											OREG0025579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L294I													.	.			0			c.C880A												74.0	72.0	73.0					19																	47232034		2203	4300	6503	SO:0001630	splice_region_variant	29888	exon7			ATGGGAGCTGGCA	AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.880-1C>A	19.37:g.47232034G>T			Somatic	60	0	0	945	WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_001039877	452	0.00	0	A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Missense_Mutation	SNP	ENST00000263280.6	37	CCDS12690.1	.	.	.	.	.	.	.	.	.	.	G	5.384	0.256160	0.10185	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396;ENST00000435164	T;T;T	0.62639	0.01;0.01;0.11	4.19	3.08	0.35506	.	0.168583	0.39909	N	0.001228	T	0.31451	0.0797	N	0.02539	-0.55	0.35028	D	0.758507	B;B	0.18310	0.015;0.027	B;B	0.18871	0.023;0.006	T	0.34453	-0.9828	10	0.22109	T	0.4	-19.9399	8.7277	0.34480	0.1244:0.0:0.8756:0.0	.	294;294	F8VYA6;Q9NRL3	.;STRN4_HUMAN	I	294;294;175;175	ENSP00000375777:L294I;ENSP00000263280:L294I;ENSP00000440901:L175I	ENSP00000263280:L294I	L	-	1	0	STRN4	51923874	1.000000	0.71417	0.999000	0.59377	0.749000	0.42624	4.689000	0.61723	2.174000	0.68829	0.462000	0.41574	CTC			0.567	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000466607.2			Missense_Mutation
FUZ	80199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50312451	50312451	+	Missense_Mutation	SNP	G	G	T	rs376948728		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:50312451G>T	ENST00000313777.4	-	7	918	c.755C>A	c.(754-756)cCg>cAg	p.P252Q	FUZ_ENST00000533418.1_Missense_Mutation_p.P202Q|AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000534008.1_5'Flank|FUZ_ENST00000445575.2_Missense_Mutation_p.P252Q|FUZ_ENST00000528094.1_Missense_Mutation_p.P216Q	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	252	Leu-rich.				cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		GGGTGGGCTCGGCCCGCAGAG	0.677																																					p.P252Q													.	.			0			c.C755A												18.0	17.0	17.0					19																	50312451		2030	3994	6024	SO:0001583	missense	80199	exon7			GGGCTCGGCCCGC	BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.755C>A	19.37:g.50312451G>T	ENSP00000313309:p.Pro252Gln		Somatic	115	0	0		WXS	Illumina HiSeq	.	67	0.27	18	NM_025129	83	0.37	31	B2RD86|B5MDH0|Q6PJY0|Q9H613	Missense_Mutation	SNP	ENST00000313777.4	37	CCDS12781.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230499	0.79688	.	.	ENSG00000010361	ENST00000528094;ENST00000533418;ENST00000529634;ENST00000313777;ENST00000377092;ENST00000445575;ENST00000529004	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	4.46	4.46	0.54185	.	0.058843	0.64402	D	0.000002	T	0.50565	0.1623	M	0.75777	2.31	0.51233	D	0.999916	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.55509	-0.8130	10	0.87932	D	0	-18.307	14.1275	0.65230	0.0:0.0:1.0:0.0	.	216;252	Q9BT04-3;Q9BT04	.;FUZZY_HUMAN	Q	216;202;252;252;152;252;202	ENSP00000435177:P216Q;ENSP00000431731:P202Q;ENSP00000313309:P252Q;ENSP00000408018:P252Q	ENSP00000313309:P252Q	P	-	2	0	FUZ	55004263	1.000000	0.71417	0.974000	0.42286	0.552000	0.35366	4.544000	0.60691	2.305000	0.77605	0.462000	0.41574	CCG			0.677	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393986.1		NM_025129	
SYT3	84258	mdanderson.org	37	19	51135704	51135704	+	Silent	SNP	T	T	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr19:51135704T>A	ENST00000338916.4	-	2	1146	c.513A>T	c.(511-513)gcA>gcT	p.A171A	SYT3_ENST00000600079.1_Silent_p.A171A|SYT3_ENST00000593901.1_Silent_p.A171A|SYT3_ENST00000544769.1_Silent_p.A171A	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	171					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CTGCTGCTGCTGCAGCCTCTG	0.647																																					p.A171A													.	.			0			c.A513T												25.0	26.0	26.0					19																	51135704		2195	4282	6477	SO:0001819	synonymous_variant	84258	exon2			TGCTGCTGCAGCC	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.513A>T	19.37:g.51135704T>A			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_032298	0		0	Q8N5Z1|Q8N640	Silent	SNP	ENST00000338916.4	37	CCDS12798.1																																																																																					0.647	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464910.1		NM_032298	
C2orf16	84226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27800712	27800712	+	Missense_Mutation	SNP	A	A	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:27800712A>T	ENST00000408964.2	+	1	1324	c.1273A>T	c.(1273-1275)Agt>Tgt	p.S425C		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	425						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GAAGCAAACAAGTCAAGTTAT	0.438																																					p.S425C													C2orf16_ENST00000408964,colon,carcinoma,0,2	C2orf16_ENST00000408964	0	2	0			c.A1273T												78.0	77.0	77.0					2																	27800712		1904	4108	6012	SO:0001583	missense	84226	exon1			CAAACAAGTCAAG	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.1273A>T	2.37:g.27800712A>T	ENSP00000386190:p.Ser425Cys		Somatic	100	0	0		WXS	Illumina HiSeq	.	107	0.28	30	NM_032266	1	0.00	0	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.697495	0.48307	.	.	ENSG00000221843	ENST00000408964	T	0.05786	3.39	3.16	-5.27	0.02763	.	.	.	.	.	T	0.03136	0.0092	N	0.19112	0.55	0.09310	N	1	B	0.24368	0.102	B	0.21546	0.035	T	0.42531	-0.9446	9	0.48119	T	0.1	.	1.1214	0.01725	0.4542:0.1505:0.2465:0.1489	.	425	Q68DN1	CB016_HUMAN	C	425	ENSP00000386190:S425C	ENSP00000386190:S425C	S	+	1	0	C2orf16	27654216	0.000000	0.05858	0.001000	0.08648	0.276000	0.26787	-1.627000	0.02033	-1.174000	0.02754	0.460000	0.39030	AGT			0.438	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353292.1		NM_032266	
C2orf81	388963	hgsc.bcm.edu;mdanderson.org	37	2	74642265	74642265	+	Missense_Mutation	SNP	A	A	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:74642265A>C	ENST00000517883.1	-	1	1445	c.754T>G	c.(754-756)Tcc>Gcc	p.S252A	C2orf81_ENST00000290390.5_Missense_Mutation_p.S320A			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	313										endometrium(3)|kidney(1)	4						TGCTGGCAGGACGCGGAGGGG	0.721																																					p.S320A													C2orf81,colon,carcinoma,0,1	C2orf81	0	1	0			c.T958G												4.0	8.0	6.0					2																	74642265		638	1532	2170	SO:0001583	missense	388963	exon4			GGCAGGACGCGGA	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.754T>G	2.37:g.74642265A>C	ENSP00000431103:p.Ser252Ala		Somatic	79	0.0126582278	1		WXS	Illumina HiSeq	.	69	0.06	4	NM_001145054	4	0.00	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	a	12.67	2.008342	0.35415	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	5.0	-4.83	0.03161	.	2.205130	0.02226	N	0.064447	T	0.21674	0.0522	L	0.36672	1.1	0.09310	N	1	B	0.28291	0.206	B	0.28011	0.085	T	0.07966	-1.0745	9	0.12430	T	0.62	0.3431	1.4608	0.02395	0.3364:0.2747:0.268:0.1209	.	320	G3XAA6	.	A	252;320	.	ENSP00000290390:S320A	S	-	1	0	C2orf81	74495773	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.495000	0.06443	-0.580000	0.05944	0.454000	0.30748	TCC			0.721	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000377683.1		NM_001145054	
HTRA2	27429	broad.mit.edu	37	2	74757160	74757160	+	Silent	SNP	T	T	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:74757160T>G	ENST00000258080.3	+	1	657	c.27T>G	c.(25-27)ggT>ggG	p.G9G	HTRA2_ENST00000352222.3_Silent_p.G9G|HTRA2_ENST00000467961.1_Intron|AUP1_ENST00000377526.3_5'Flank	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	9					adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						CGGGGCGGGGTGCAGGCTGGA	0.716																																					p.G9G													.	HTRA2	22		0			c.T27G												16.0	22.0	20.0					2																	74757160		1818	3808	5626	SO:0001819	synonymous_variant	27429	exon1			GCGGGGTGCAGGC		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.27T>G	2.37:g.74757160T>G			Somatic	40	0.2	8		WXS	Illumina HiSeq	Phase_I	58	0.36	21	NM_013247	3	0.00	0	Q9HBZ4|Q9P0Y3|Q9P0Y4	Silent	SNP	ENST00000258080.3	37	CCDS1951.1																																																																																					0.716	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252219.2		NM_013247	
Unknown	0	bcgsc.ca	37	2	91795573	91795573	+	IGR	SNP	G	G	A	rs77931968	byFrequency	TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:91795573G>A								RP11-575H3.1 (26653 upstream) : AC027612.6 (9612 downstream)																							GGCCAACGGCGTCCTCAATGA	0.517																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AACGGCGTCCTCA																													2.37:g.91795573G>A			Somatic	109	0.0091743119	1		WXS	Illumina HiSeq	Phase_1	153	0.07	11	.	0		0		RNA	SNP		37																																																																																					0	0.517										
RGPD4	285190	ucsc.edu	37	2	108487826	108487826	+	Silent	SNP	C	C	T	rs2556258	byFrequency	TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:108487826C>T	ENST00000408999.3	+	20	3443	c.3366C>T	c.(3364-3366)ccC>ccT	p.P1122P	RGPD4_ENST00000354986.4_Silent_p.P1122P	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1122	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						ACCTGAAGCCCCTGTCTGGAT	0.438													N|||	1974	0.394169	0.4145	0.3199	5008	,	,		10220	0.1458		0.5437	False		,,,				2504	0.5215				p.P1122P													.	RGPD4	112		0			c.C3366T												7.0	6.0	6.0					2																	108487826		280	760	1040	SO:0001819	synonymous_variant	285190	exon20			GAAGCCCCTGTCT	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3366C>T	2.37:g.108487826C>T			Somatic	19	0.1052631579	2		WXS	Illumina HiSeq		18	0.61	11	NM_182588	4	0.00	0	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																					0.438	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330096.2		XM_496581	
UBXN4	23190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	136528187	136528187	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:136528187T>A	ENST00000272638.9	+	8	1015	c.704T>A	c.(703-705)aTg>aAg	p.M235K	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	235					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						GGAAAAGAAATGTTGGATTAT	0.328																																					p.M235K													.	.			0			c.T704A												72.0	66.0	68.0					2																	136528187		1804	4067	5871	SO:0001583	missense	23190	exon8			AAGAAATGTTGGA	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.704T>A	2.37:g.136528187T>A	ENSP00000272638:p.Met235Lys		Somatic	349	0	0		WXS	Illumina HiSeq	.	361	0.25	91	NM_014607	203	0.26	53	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	ENST00000272638.9	37	CCDS42761.1	.	.	.	.	.	.	.	.	.	.	T	18.81	3.703882	0.68501	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.17691	2.26	5.54	5.54	0.83059	.	0.545156	0.23314	N	0.049528	T	0.25717	0.0626	M	0.86268	2.805	0.58432	D	0.999993	B	0.32245	0.361	B	0.35470	0.203	T	0.18903	-1.0322	10	0.06236	T	0.91	.	15.668	0.77247	0.0:0.0:0.0:1.0	.	235	Q92575	UBXN4_HUMAN	K	235;217	ENSP00000272638:M235K	ENSP00000272638:M235K	M	+	2	0	UBXN4	136244657	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.679000	0.61649	2.106000	0.64143	0.477000	0.44152	ATG			0.328	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331696.1		NM_014607	
ACVR2A	92	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	148657362	148657362	+	Silent	SNP	C	C	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:148657362C>G	ENST00000241416.7	+	4	1059	c.423C>G	c.(421-423)ctC>ctG	p.L141L	AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000535787.1_Silent_p.L33L|ACVR2A_ENST00000404590.1_Silent_p.L141L	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	141					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		ACATCCTGCTCTATTCCTTGG	0.433																																					p.L141L													.	.			0			c.C423G												295.0	282.0	287.0					2																	148657362		2203	4300	6503	SO:0001819	synonymous_variant	92	exon4			CCTGCTCTATTCC		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.423C>G	2.37:g.148657362C>G			Somatic	251	0	0		WXS	Illumina HiSeq	.	230	0.30	68	NM_001616	34	0.35	12	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Silent	SNP	ENST00000241416.7	37	CCDS33301.1																																																																																					0.433	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319051.1		NM_001616	
ASNSD1	54529	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	190535267	190535267	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr2:190535267C>T	ENST00000260952.4	+	6	2160	c.1747C>T	c.(1747-1749)Ctt>Ttt	p.L583F	ASNSD1_ENST00000607062.1_Missense_Mutation_p.L102F	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	583	Asparagine synthetase.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			TGAAAAATTACTTTTACGCCT	0.413																																					p.L583F													.	ASNSD1	63		0			c.C1747T												84.0	84.0	84.0					2																	190535267		2203	4300	6503	SO:0001583	missense	54529	exon6			AAATTACTTTTAC	AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.1747C>T	2.37:g.190535267C>T	ENSP00000260952:p.Leu583Phe		Somatic	270	0.0037037037	1		WXS	Illumina HiSeq	Phase_I	253	0.21	53	NM_019048	179	0.17	30	D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	ENST00000260952.4	37	CCDS2300.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.480930	0.44044	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	T;T	0.51071	0.72;0.72	5.88	-3.83	0.04269	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.275265	0.41396	D	0.000886	T	0.67720	0.2923	M	0.88512	2.96	0.42030	D	0.991027	P	0.50066	0.931	P	0.56916	0.809	T	0.79864	-0.1623	10	0.72032	D	0.01	-10.2585	21.3049	0.99951	0.2529:0.7471:0.0:0.0	.	583	Q9NWL6	ASND1_HUMAN	F	583	ENSP00000260952:L583F;ENSP00000406790:L583F	ENSP00000260952:L583F	L	+	1	0	ASNSD1	190243512	0.656000	0.27385	0.105000	0.21289	0.274000	0.26718	0.607000	0.24209	-0.455000	0.07054	-0.410000	0.06199	CTT			0.413	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255919.3		NM_019048	
CRNKL1	51340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	20033204	20033204	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr20:20033204G>A	ENST00000377340.2	-	2	297	c.266C>T	c.(265-267)aCg>aTg	p.T89M	CRNKL1_ENST00000536226.1_5'Flank|C20orf26_ENST00000377306.1_5'UTR|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000245957.5_5'UTR|C20orf26_ENST00000389656.3_5'UTR|CRNKL1_ENST00000377327.4_Missense_Mutation_p.T77M	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	89					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						GCGGCAGCGCGTGGAGTGCGG	0.667																																					p.T89M													.	.			0			c.C266T												48.0	43.0	45.0					20																	20033204		2203	4298	6501	SO:0001583	missense	51340	exon2			CAGCGCGTGGAGT	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.266C>T	20.37:g.20033204G>A	ENSP00000366557:p.Thr89Met		Somatic	63	0	0		WXS	Illumina HiSeq	.	56	0.36	20	NM_016652	0		0	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	ENST00000377340.2	37	CCDS33446.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873977	0.33069	.	.	ENSG00000101343	ENST00000377327;ENST00000377340	T;T	0.29655	1.56;1.56	4.43	-0.265	0.12946	.	4.303840	0.00644	N	0.000523	T	0.14184	0.0343	N	0.08118	0	0.21782	N	0.999549	P;B	0.34892	0.474;0.244	B;B	0.25140	0.058;0.015	T	0.17930	-1.0353	10	0.87932	D	0	1.1774	2.7007	0.05148	0.0946:0.156:0.2943:0.4551	.	77;89	Q5JY65;Q9BZJ0	.;CRNL1_HUMAN	M	77;89	ENSP00000366544:T77M;ENSP00000366557:T89M	ENSP00000366544:T77M	T	-	2	0	CRNKL1	19981204	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.885000	0.04161	0.184000	0.20083	0.561000	0.74099	ACG			0.667	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000127787.1			
ZFP64	55734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	50769116	50769116	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr20:50769116G>A	ENST00000216923.4	-	6	1964	c.1615C>T	c.(1615-1617)Cgg>Tgg	p.R539W	ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.R537W|ZFP64_ENST00000346617.4_Missense_Mutation_p.R485W|ZFP64_ENST00000477786.1_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						ATCTGCAGCCGGCTGTTCCCT	0.687																																					p.R539W													.	.			0			c.C1615T												26.0	31.0	29.0					20																	50769116		2202	4300	6502	SO:0001583	missense	55734	exon6			GCAGCCGGCTGTT	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1615C>T	20.37:g.50769116G>A	ENSP00000216923:p.Arg539Trp		Somatic	14	0	0		WXS	Illumina HiSeq	.	21	0.33	7	NM_018197	58	0.38	22	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821662	0.50633	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083	T;T;T	0.08102	3.13;3.18;3.13	5.46	5.46	0.80206	.	0.000000	0.53938	D	0.000041	T	0.14141	0.0342	L	0.29908	0.895	0.42176	D	0.991666	D;D;D	0.69078	0.997;0.995;0.995	P;P;P	0.52710	0.707;0.513;0.513	T	0.02339	-1.1174	10	0.38643	T	0.18	-27.7216	19.3237	0.94253	0.0:0.0:1.0:0.0	.	485;537;539	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	W	539;485;537;381	ENSP00000216923:R539W;ENSP00000344615:R485W;ENSP00000360570:R537W	ENSP00000216923:R539W	R	-	1	2	ZFP64	50202523	1.000000	0.71417	0.991000	0.47740	0.015000	0.08874	2.947000	0.49058	2.563000	0.86464	0.650000	0.86243	CGG			0.687	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000079744.1		NM_018197	
BAGE2	85319	bcgsc.ca	37	21	11058295	11058295	+	RNA	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr21:11058295G>A	ENST00000470054.1	-	0	352							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTGATAGTGGCTCCAAAGTG	0.408																																					p.P49S													.	.			0			c.C145T												132.0	98.0	109.0					21																	11058295		692	1591	2283			85319	exon3			ATAGTGGCTCCAA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058295G>A			Somatic	271	0.0110701107	3		WXS	Illumina HiSeq	Phase_1	219	0.05	10	NM_182482	0		0	A8K925|Q08ER0	RNA	SNP	ENST00000470054.1	37																																																																																						0.408	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
SYNJ1	8867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34050984	34050984	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr21:34050984C>T	ENST00000322229.7	-	11	1480	c.1481G>A	c.(1480-1482)cGa>cAa	p.R494Q	SYNJ1_ENST00000357345.3_Missense_Mutation_p.R494Q|SYNJ1_ENST00000382491.3_Missense_Mutation_p.R497Q|SYNJ1_ENST00000382499.2_Missense_Mutation_p.R533Q|SYNJ1_ENST00000433931.2_Missense_Mutation_p.R533Q			O43426	SYNJ1_HUMAN	synaptojanin 1	494					cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						TAAAAGTGCTCGAGCTTTGTC	0.348																																					p.R533Q													SYNJ1,rectum,carcinoma,-1,1	SYNJ1	-1	1	0			c.G1598A												87.0	82.0	84.0					21																	34050984		2203	4300	6503	SO:0001583	missense	8867	exon12			AGTGCTCGAGCTT	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.1481G>A	21.37:g.34050984C>T	ENSP00000322234:p.Arg494Gln		Somatic	184	0	0		WXS	Illumina HiSeq	.	171	0.20	34	NM_203446	10	0.20	2	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	36	5.779301	0.96929	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236	T;T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8;1.8	5.99	5.99	0.97316	.	0.058295	0.64402	D	0.000002	T	0.58495	0.2126	M	0.83223	2.63	0.80722	D	1	D;D;D;D;D	0.89917	0.997;0.999;1.0;0.997;1.0	P;P;D;P;D	0.97110	0.823;0.848;1.0;0.848;0.996	T	0.60378	-0.7275	10	0.72032	D	0.01	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	497;533;494;494;494	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	Q	497;494;533;533;494;497	ENSP00000371931:R497Q;ENSP00000349903:R494Q;ENSP00000371939:R533Q;ENSP00000409667:R533Q;ENSP00000322234:R494Q;ENSP00000413649:R497Q	ENSP00000322234:R494Q	R	-	2	0	SYNJ1	32972855	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.840000	0.97914	0.655000	0.94253	CGA			0.348	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding					
YWHAH	7533	mdanderson.org	37	22	32352743	32352743	+	Silent	SNP	C	C	T	rs377641891		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr22:32352743C>T	ENST00000248975.5	+	2	978	c.705C>T	c.(703-705)agC>agT	p.S235S	YWHAH_ENST00000397492.1_3'UTR|YWHAH_ENST00000471374.1_3'UTR	NM_003405.3	NP_003396.1	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta	235					apoptotic process (GO:0006915)|glucocorticoid catabolic process (GO:0006713)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular protein transport (GO:0006886)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane depolarization during action potential (GO:0086010)|membrane organization (GO:0061024)|negative regulation of dendrite morphogenesis (GO:0050774)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of sodium ion transport (GO:0002028)|regulation of synaptic plasticity (GO:0048167)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|glucocorticoid receptor binding (GO:0035259)|insulin-like growth factor receptor binding (GO:0005159)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|large_intestine(1)|upper_aerodigestive_tract(1)	4						TCTGGACGAGCGACCAGCAGG	0.542																																					p.S235S	Ovarian(98;460 2060 9263 44007)												.	.			0			c.C705T							C		0,4406		0,0,2203	38.0	33.0	34.0		705	0.3	1.0	22		34	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	YWHAH	NM_003405.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		235/247	32352743	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7533	exon2			GACGAGCGACCAG	X78138	CCDS13901.1	22q12.1-q13.1	2013-12-03	2013-12-03		ENSG00000128245	ENSG00000128245			12853	protein-coding gene	gene with protein product	"""14-3-3 eta"""	113508	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide"""	YWHA1			Standard	NM_003405		Approved		uc003alz.3	Q04917	OTTHUMG00000030833	ENST00000248975.5:c.705C>T	22.37:g.32352743C>T			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_003405	542	0.00	0		Silent	SNP	ENST00000248975.5	37	CCDS13901.1																																																																																					0.542	YWHAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075721.2		NM_003405	
MEI1	150365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42126573	42126573	+	Missense_Mutation	SNP	C	C	T	rs374534859		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr22:42126573C>T	ENST00000401548.3	+	9	1068	c.1028C>T	c.(1027-1029)tCc>tTc	p.S343F	MEI1_ENST00000540833.1_Missense_Mutation_p.S83F|MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000400107.1_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTCGTCTGGTCCAGCTGTAAC	0.463																																					p.S343F													.	.			0			c.C1028T							C	PHE/SER	0,3888		0,0,1944	190.0	170.0	176.0		1028	4.9	1.0	22		176	1,8301		0,1,4150	no	missense	MEI1	NM_152513.3	155	0,1,6094	TT,TC,CC		0.012,0.0,0.0082	possibly-damaging	343/1275	42126573	1,12189	1944	4151	6095	SO:0001583	missense	150365	exon9			TCTGGTCCAGCTG	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.1028C>T	22.37:g.42126573C>T	ENSP00000384115:p.Ser343Phe		Somatic	129	0.007751938	1		WXS	Illumina HiSeq	.	95	0.92	87	NM_152513	0		0		Missense_Mutation	SNP	ENST00000401548.3	37	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630995	0.67015	0.0	1.2E-4	ENSG00000167077	ENST00000401548;ENST00000540833	T;T	0.17528	2.27;2.27	5.9	4.88	0.63580	Armadillo-like helical (1);Armadillo-type fold (1);	0.133732	0.51477	N	0.000084	T	0.39462	0.1079	M	0.61703	1.905	0.80722	D	1	D;B	0.89917	1.0;0.058	D;B	0.91635	0.999;0.043	T	0.19031	-1.0318	10	0.54805	T	0.06	.	14.8792	0.70519	0.0:0.9305:0.0:0.0694	.	343;343	Q5TIA1;Q5TIA1-4	MEI1_HUMAN;.	F	343;83	ENSP00000384115:S343F;ENSP00000444225:S83F	ENSP00000384115:S343F	S	+	2	0	MEI1	40456519	0.998000	0.40836	0.999000	0.59377	0.633000	0.38033	4.110000	0.57831	1.499000	0.48617	0.563000	0.77884	TCC			0.463	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000074937.3		NM_152513	
TUBGCP6	85378	mdanderson.org	37	22	50659727	50659727	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr22:50659727G>T	ENST00000248846.5	-	16	3165	c.3061C>A	c.(3061-3063)Ccc>Acc	p.P1021T	TUBGCP6_ENST00000491449.1_5'UTR|TUBGCP6_ENST00000439308.2_Missense_Mutation_p.P1021T			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1021					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CGCTCTGTGGGCTGGCTGCTC	0.657																																					p.P1021T													.	.			0			c.C3061A												35.0	39.0	38.0					22																	50659727		2203	4300	6503	SO:0001583	missense	85378	exon16			CTGTGGGCTGGCT	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3061C>A	22.37:g.50659727G>T	ENSP00000248846:p.Pro1021Thr		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	46	0.11	5	NM_020461	53	0.00	0	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379521	0.24944	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.15017	2.98;2.46	4.2	-3.96	0.04106	.	5.192270	0.00520	N	0.000184	T	0.13286	0.0322	L	0.39898	1.24	0.09310	N	1	B;B;B	0.19445	0.013;0.036;0.019	B;B;B	0.19666	0.025;0.026;0.018	T	0.29822	-0.9999	10	0.66056	D	0.02	.	1.7951	0.03059	0.1695:0.3846:0.156:0.2898	.	1013;1021;1021	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	T	1021	ENSP00000248846:P1021T;ENSP00000397387:P1021T	ENSP00000248846:P1021T	P	-	1	0	TUBGCP6	49001854	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.051000	0.11885	-0.702000	0.05056	-0.882000	0.02950	CCC			0.657	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075004.3		NM_020461	
FANCD2	2177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10132048	10132048	+	Silent	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr3:10132048C>T	ENST00000419585.1	+	37	3917	c.3756C>T	c.(3754-3756)ggC>ggT	p.G1252G	FANCD2_ENST00000383807.1_Silent_p.G1252G|FANCD2_ENST00000383806.1_Intron|FANCD2_ENST00000287647.3_Silent_p.G1252G|FANCD2OS_ENST00000524279.1_Intron|FANCD2OS_ENST00000436517.1_Intron			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	1252					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TTGAGCCTGGCACAGCAGCAG	0.408			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.G1252G			yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	.			0			c.C3756T												72.0	62.0	65.0					3																	10132048		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon37	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GCCTGGCACAGCA	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.3756C>T	3.37:g.10132048C>T			Somatic	56	0	0		WXS	Illumina HiSeq	.	52	0.52	27	NM_001018115	151	0.74	111	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																					0.408	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339873.1			
PARP15	165631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122296590	122296590	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr3:122296590G>C	ENST00000464300.2	+	1	142	c.76G>C	c.(76-78)Gtt>Ctt	p.V26L	PARP15_ENST00000483793.1_Missense_Mutation_p.V26L	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	26					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		TATGCACGGAGTTGCAGGTGT	0.687																																					p.V26L													.	.			0			c.G76C												43.0	44.0	44.0					3																	122296590		692	1591	2283	SO:0001583	missense	165631	exon1			CACGGAGTTGCAG	AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.76G>C	3.37:g.122296590G>C	ENSP00000417214:p.Val26Leu		Somatic	113	0	0		WXS	Illumina HiSeq	.	124	0.65	81	NM_001113523	1	0.00	0	J3KR47|Q8N1K3	Missense_Mutation	SNP	ENST00000464300.2	37	CCDS46893.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.481830	0.26598	.	.	ENSG00000173200	ENST00000464300;ENST00000483793	T;T	0.16897	2.68;2.31	2.77	0.77	0.18497	.	.	.	.	.	T	0.08980	0.0222	N	0.14661	0.345	0.18873	N	0.999988	B;B	0.14438	0.01;0.01	B;B	0.11329	0.006;0.003	T	0.35151	-0.9800	9	0.33141	T	0.24	.	6.2995	0.21105	0.0:0.2049:0.5844:0.2107	.	26;4	C9J7L3;Q460N3	.;PAR15_HUMAN	L	26	ENSP00000417214:V26L;ENSP00000417785:V26L	ENSP00000417214:V26L	V	+	1	0	PARP15	123779280	0.798000	0.28890	0.001000	0.08648	0.002000	0.02628	1.562000	0.36353	0.174000	0.19809	0.561000	0.74099	GTT			0.687	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355964.2		NM_152615	
EFCC1	79825	broad.mit.edu	37	3	128721009	128721011	+	In_Frame_Del	DEL	CGC	CGC	-	rs531145864	byFrequency	TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	CGC	CGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr3:128721009_128721011delCGC	ENST00000480450.1	+	1	538_540	c.538_540delCGC	c.(538-540)cgcdel	p.R184del	KIAA1257_ENST00000510149.1_Intron|EFCC1_ENST00000436022.2_5'UTR			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	184	Poly-Arg.						calcium ion binding (GO:0005509)										GCGCCGTccgcgccgccgccgcc	0.754																																					p.180_180del													.	.			0			c.538_540del									15,1277		5,5,636						1.8	0.9			3	26,2792		4,18,1387	no	coding	CCDC48	NM_024768.2		9,23,2023	A1A1,A1R,RR		0.9226,1.161,0.9976				41,4069				SO:0001651	inframe_deletion	79825	exon1			CGTCCGCGCCGCC	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.538_540delCGC	3.37:g.128721018_128721020delCGC	ENSP00000420075:p.Arg184del		Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_024768	0		0	A8MYE2	In_Frame_Del	DEL	ENST00000480450.1	37	CCDS3054.2																																																																																					0.754	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000352832.1		NM_024768	
TTC14	151613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	180320071	180320071	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr3:180320071C>G	ENST00000296015.4	+	1	154	c.22C>G	c.(22-24)Cag>Gag	p.Q8E	TTC14_ENST00000412756.2_Missense_Mutation_p.Q8E|RP11-496B10.3_ENST00000472596.1_lincRNA|TTC14_ENST00000382584.4_Missense_Mutation_p.Q8E	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	8							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CCTTTTGCGGCAGTCGCTAAA	0.617																																					p.Q8E													.	.			0			c.C22G												60.0	59.0	59.0					3																	180320071		2203	4300	6503	SO:0001583	missense	151613	exon1			TTGCGGCAGTCGC	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.22C>G	3.37:g.180320071C>G	ENSP00000296015:p.Gln8Glu		Somatic	45	0	0		WXS	Illumina HiSeq	.	56	0.29	16	NM_001042601	28	0.36	10	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829863	0.71258	.	.	ENSG00000163728	ENST00000296015;ENST00000491380;ENST00000412756;ENST00000382584	T;T	0.58506	0.33;0.33	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.73393	0.3581	M	0.64997	1.995	0.46849	D	0.999228	D;D;P	0.61697	0.99;0.99;0.956	P;D;D	0.72982	0.848;0.979;0.931	T	0.75825	-0.3181	10	0.87932	D	0	-9.853	16.4418	0.83903	0.0:1.0:0.0:0.0	.	8;8;8	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	E	8	ENSP00000296015:Q8E;ENSP00000372027:Q8E	ENSP00000296015:Q8E	Q	+	1	0	TTC14	181802765	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	4.197000	0.58413	2.640000	0.89533	0.591000	0.81541	CAG			0.617	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349786.1		NM_133462	
TP63	8626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	189586470	189586470	+	Nonsense_Mutation	SNP	C	C	A	rs147148566		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr3:189586470C>A	ENST00000264731.3	+	8	1183	c.1094C>A	c.(1093-1095)tCg>tAg	p.S365*	TP63_ENST00000456148.1_Nonsense_Mutation_p.S271*|TP63_ENST00000440651.2_Nonsense_Mutation_p.S365*|TP63_ENST00000382063.4_Nonsense_Mutation_p.S280*|TP63_ENST00000392460.3_Nonsense_Mutation_p.S365*|TP63_ENST00000392461.3_Nonsense_Mutation_p.S271*|TP63_ENST00000418709.2_Nonsense_Mutation_p.S365*|TP63_ENST00000354600.5_Nonsense_Mutation_p.S271*|TP63_ENST00000437221.1_Nonsense_Mutation_p.S271*|TP63_ENST00000392463.2_Nonsense_Mutation_p.S271*|TP63_ENST00000320472.5_Nonsense_Mutation_p.S365*|TP63_ENST00000449992.1_Nonsense_Mutation_p.S186*	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	365	Interaction with HIPK2.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)	p.S365L(3)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CAGCAAGTTTCGGACAGTACA	0.537										HNSCC(45;0.13)																											p.S365X													TP63_ENST00000418709,mucosal,malignant_melanoma,0,6	TP63_ENST00000418709	0	6	3	Substitution - Missense(3)	skin(2)|kidney(1)	c.C1094A												129.0	122.0	124.0					3																	189586470		2203	4300	6503	SO:0001587	stop_gained	8626	exon8			AAGTTTCGGACAG	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1094C>A	3.37:g.189586470C>A	ENSP00000264731:p.Ser365*		Somatic	112	0	0		WXS	Illumina HiSeq	.	131	0.37	48	NM_001114979	0		0	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Nonsense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	C	36	5.608202	0.96626	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	.	.	.	6.03	6.03	0.97812	.	0.057185	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.2957	19.5548	0.95338	0.0:1.0:0.0:0.0	.	.	.	.	X	365;365;365;365;365;280;271;271;271;271;186;271	.	.	S	+	2	0	TP63	191069164	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	3.593000	0.54001	2.854000	0.98071	0.655000	0.94253	TCG			0.537	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000343865.1		NM_003722	
LINC00969	440993	broad.mit.edu;ucsc.edu	37	3	195400728	195400728	+	lincRNA	SNP	A	A	G	rs12107841	byFrequency	TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr3:195400728A>G	ENST00000445430.1	+	0	1324									long intergenic non-protein coding RNA 969																		GATTGTGCCCAGCCTGTACGC	0.587																																					.													.	.			0			.																																											0	.			GTGCCCAGCCTGT	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195400728A>G			Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	103	0.11	11	.	26	0.00	0		RNA	SNP	ENST00000445430.1	37																																																																																						0.587	LINC00969-038	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000341951.1			
NFXL1	152518	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47901125	47901125	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr4:47901125G>A	ENST00000507489.1	-	7	1015	c.839C>T	c.(838-840)cCt>cTt	p.P280L	NFXL1_ENST00000381538.3_Missense_Mutation_p.P280L|NFXL1_ENST00000329043.3_Missense_Mutation_p.P280L	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	280						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CTTTGGACAAGGAGGGCAGGG	0.368																																					p.P280L													.	NFXL1	79		0			c.C839T												70.0	65.0	67.0					4																	47901125		2203	4300	6503	SO:0001583	missense	152518	exon7			GGACAAGGAGGGC	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.839C>T	4.37:g.47901125G>A	ENSP00000422037:p.Pro280Leu		Somatic	132	0.0151515152	2		WXS	Illumina HiSeq	Phase_I	76	0.42	32	NM_152995	33	0.58	19	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068315	0.76301	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	D;D;D	0.82803	-1.65;-1.65;-1.65	4.85	4.85	0.62838	Zinc finger, NF-X1-type (1);	0.000000	0.85682	D	0.000000	D	0.93207	0.7836	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94992	0.8135	10	0.87932	D	0	-8.7826	17.9625	0.89090	0.0:0.0:1.0:0.0	.	280	Q6ZNB6	NFXL1_HUMAN	L	280	ENSP00000370949:P280L;ENSP00000422037:P280L;ENSP00000333113:P280L	ENSP00000333113:P280L	P	-	2	0	NFXL1	47595882	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	9.468000	0.97676	2.215000	0.71742	0.655000	0.94253	CCT			0.368	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361636.1		NM_152995	
CNGA1	1259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47939764	47939764	+	Missense_Mutation	SNP	A	A	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr4:47939764A>C	ENST00000514170.1	-	11	1066	c.747T>G	c.(745-747)gaT>gaG	p.D249E	CNGA1_ENST00000402813.3_Missense_Mutation_p.D318E|CNGA1_ENST00000544810.1_Missense_Mutation_p.D249E|CNGA1_ENST00000420489.2_Missense_Mutation_p.D249E|CNGA1_ENST00000358519.4_Missense_Mutation_p.D249E			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	249					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						GTGACAGAACATCAAGTTTAA	0.318																																					p.D318E													.	.			0			c.T954G												110.0	112.0	112.0					4																	47939764		1812	4077	5889	SO:0001583	missense	1259	exon10			CAGAACATCAAGT	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.747T>G	4.37:g.47939764A>C	ENSP00000426862:p.Asp249Glu		Somatic	184	0	0		WXS	Illumina HiSeq	.	109	0.39	42	NM_001142564	1	0.00	0	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	ENST00000514170.1	37	CCDS43226.1	.	.	.	.	.	.	.	.	.	.	A	12.60	1.985517	0.35036	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.99270	-5.66;-5.66;-5.66;-5.66;-5.66	5.33	1.56	0.23342	Ion transport (1);	0.046946	0.85682	D	0.000000	D	0.99510	0.9825	H	0.97611	4.04	0.44194	D	0.997019	D;D	0.65815	0.995;0.995	D;D	0.70487	0.969;0.969	D	0.99153	1.0859	10	0.87932	D	0	.	8.9009	0.35495	0.7844:0.0:0.2156:0.0	.	249;249	Q4W5E3;P29973	.;CNGA1_HUMAN	E	318;249;249;249;249	ENSP00000384264:D318E;ENSP00000426862:D249E;ENSP00000443401:D249E;ENSP00000351320:D249E;ENSP00000389881:D249E	ENSP00000351320:D249E	D	-	3	2	CNGA1	47634521	0.972000	0.33761	0.975000	0.42487	0.188000	0.23474	1.394000	0.34509	0.329000	0.23460	0.529000	0.55759	GAT			0.318	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000372070.2		NM_000087	
GPM6A	2823	hgsc.bcm.edu	37	4	176923708	176923708	+	5'Flank	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr4:176923708C>T	ENST00000280187.7	-	0	0				GPM6A_ENST00000506894.1_5'UTR	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A						neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		GTCTCCTCCCCAGAGGCCCCC	0.577																																					p.G12R													.	.			0			c.G34A																																									SO:0001631	upstream_gene_variant	2823	exon1			CCTCCCCAGAGGC		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674			4.37:g.176923708C>T	Exception_encountered		Somatic	16	0	0		WXS	Illumina HiSeq	.	19	0.53	10	NM_001261447	0		0	B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	ENST00000280187.7	37	CCDS3824.1																																																																																					0.577	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362163.1			
HSD17B4	3295	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	118809607	118809607	+	Silent	SNP	T	T	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr5:118809607T>C	ENST00000256216.6	+	3	250	c.117T>C	c.(115-117)aaT>aaC	p.N39N	HSD17B4_ENST00000504811.1_Silent_p.N64N|HSD17B4_ENST00000513628.1_5'Flank|HSD17B4_ENST00000515320.1_Silent_p.N21N|HSD17B4_ENST00000414835.2_5'UTR|HSD17B4_ENST00000509514.1_5'Flank|HSD17B4_ENST00000510025.1_Silent_p.N15N	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	39	(3R)-hydroxyacyl-CoA dehydrogenase.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		TTACAGTGAATGATTTGGGAG	0.378																																					p.N64N	Colon(35;490 801 34689 41394 43344)												.	HSD17B4	63		0			c.T192C												118.0	120.0	119.0					5																	118809607		2202	4300	6502	SO:0001819	synonymous_variant	3295	exon4			AGTGAATGATTTG		CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.117T>C	5.37:g.118809607T>C			Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	80	0.41	33	NM_001199291	169	0.51	86	B4DNV1|B4DVS5|E9PB82|F5HE57	Silent	SNP	ENST00000256216.6	37	CCDS4126.1																																																																																					0.378	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250863.3		NM_000414	
PCDHB6	56130	mdanderson.org	37	5	140531342	140531342	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr5:140531342G>T	ENST00000231136.1	+	1	1504	c.1504G>T	c.(1504-1506)Gtc>Ttc	p.V502F	PCDHB6_ENST00000543635.1_Missense_Mutation_p.V366F	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	502	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCTTCCCTGGTCTCCATCAA	0.667																																					p.V502F													.	.			0			c.G1504T												77.0	83.0	81.0					5																	140531342		2201	4297	6498	SO:0001583	missense	56130	exon1			TCCCTGGTCTCCA	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1504G>T	5.37:g.140531342G>T	ENSP00000231136:p.Val502Phe		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_018939	8	0.00	0	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775469	0.31411	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.21191	2.02;2.02	4.07	2.88	0.33553	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.16128	0.0388	N	0.01800	-0.715	0.23430	N	0.997694	D	0.67145	0.996	D	0.70716	0.97	T	0.10451	-1.0629	9	0.87932	D	0	.	3.528	0.07766	0.1289:0.1539:0.56:0.1571	.	502	Q9Y5E3	PCDB6_HUMAN	F	366;502;287	ENSP00000438466:V366F;ENSP00000231136:V502F	ENSP00000231136:V502F	V	+	1	0	PCDHB6	140511526	0.000000	0.05858	0.791000	0.31998	0.474000	0.32979	-0.884000	0.04166	1.986000	0.57962	0.556000	0.70494	GTC			0.667	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251818.2		NM_018939	
Unknown	0	bcgsc.ca	37	5	153873611	153873611	+	IGR	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr5:153873611C>T								CTB-158E9.1 (8122 upstream) : MIR3141 (101960 downstream)																							CCAGAAGAAACAAAGAGGAGT	0.428																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AAGAAACAAAGAG																													5.37:g.153873611C>T			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_1	66	0.38	25	.	0		0		RNA	SNP		37																																																																																					0	0.428										
SQSTM1	8878	mdanderson.org	37	5	179251214	179251214	+	Silent	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr5:179251214G>T	ENST00000389805.4	+	4	742	c.564G>T	c.(562-564)gtG>gtT	p.V188V	SQSTM1_ENST00000402874.3_Silent_p.V104V|SQSTM1_ENST00000376929.3_Silent_p.V104V|SQSTM1_ENST00000360718.5_Silent_p.V104V|SQSTM1_ENST00000510187.1_Silent_p.V188V	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	188	Interaction with GABRR3. {ECO:0000250}.|LIM protein-binding (LB).				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCGGAAGGTGAAACACGGAC	0.672																																					p.V188V													.	.			0			c.G564T												48.0	54.0	52.0					5																	179251214		2203	4300	6503	SO:0001819	synonymous_variant	8878	exon4			GAAGGTGAAACAC	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.564G>T	5.37:g.179251214G>T			Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	48	0.08	4	NM_003900	355	0.00	0	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Silent	SNP	ENST00000389805.4	37	CCDS34317.1																																																																																					0.672	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319344.1			
RNF130	55819	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	5	179442323	179442323	+	Intron	SNP	T	T	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr5:179442323T>C	ENST00000261947.4	-	3	841				RNF130_ENST00000521389.1_Intron|MIR340_ENST00000362125.1_RNA|RNF130_ENST00000522208.2_Intron	NM_001280801.1	NP_001267730.1			ring finger protein 130											breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTATGGCTATAAAGTAACTG	0.378																																					.	GBM(24;432 554 38471 39699 51728)												.	.			0			.												99.0	90.0	93.0					5																	179442323		1568	3582	5150	SO:0001627	intron_variant	442908	.			TGGCTATAAAGTA	AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.443-2012A>G	5.37:g.179442323T>C			Somatic	289	0	0		WXS	Illumina HiSeq	.	142	0.43	61	.	0		0		RNA	SNP	ENST00000261947.4	37																																																																																						0.378	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000374205.1		NM_018434	
FOXQ1	94234	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	1313345	1313345	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr6:1313345G>A	ENST00000296839.2	+	1	671	c.406G>A	c.(406-408)Gcg>Acg	p.A136T		NM_033260.3	NP_150285.3	Q9C009	FOXQ1_HUMAN	forkhead box Q1	136					hair follicle morphogenesis (GO:0031069)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|urinary_tract(1)	2	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)		CCGCGACTCGGCGGGCGGGCG	0.682																																					p.A136T													.	.			0			c.G406A												26.0	29.0	28.0					6																	1313345		2149	4209	6358	SO:0001583	missense	94234	exon1			GACTCGGCGGGCG	AF153341	CCDS4471.1	6p25	2008-02-05			ENSG00000164379	ENSG00000164379		"""Forkhead boxes"""	20951	protein-coding gene	gene with protein product		612788				11747606, 12011061	Standard	NM_033260		Approved	HFH1	uc003mtl.4	Q9C009	OTTHUMG00000016160	ENST00000296839.2:c.406G>A	6.37:g.1313345G>A	ENSP00000296839:p.Ala136Thr		Somatic	55	0	0		WXS	Illumina HiSeq	.	49	0.37	18	NM_033260	55	0.35	19	Q9NS06	Missense_Mutation	SNP	ENST00000296839.2	37	CCDS4471.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737827	0.69304	.	.	ENSG00000164379	ENST00000296839	D	0.95447	-3.71	3.87	0.868	0.19090	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.416111	0.23194	U	0.050862	D	0.89431	0.6713	N	0.16862	0.45	0.33192	D	0.551034	D	0.58620	0.983	P	0.57846	0.828	D	0.86589	0.1859	10	0.56958	D	0.05	.	7.3274	0.26563	0.0962:0.3253:0.5785:0.0	.	136	Q9C009	FOXQ1_HUMAN	T	136	ENSP00000296839:A136T	ENSP00000296839:A136T	A	+	1	0	FOXQ1	1258345	0.000000	0.05858	0.231000	0.23993	0.762000	0.43233	-0.112000	0.10791	0.125000	0.18397	0.184000	0.17185	GCG			0.682	FOXQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043410.1		NM_033260	
SKIV2L	6499	mdanderson.org	37	6	31931201	31931201	+	Missense_Mutation	SNP	G	G	T	rs144001502		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr6:31931201G>T	ENST00000375394.2	+	14	1528	c.1415G>T	c.(1414-1416)cGt>cTt	p.R472L	SKIV2L_ENST00000544581.1_Missense_Mutation_p.R279L	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	472	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CGGCTGAAGCGTCGTCAGATC	0.577																																					p.R472L													.	.			0			c.G1415T												66.0	65.0	65.0					6																	31931201		2203	4300	6503	SO:0001583	missense	6499	exon14			TGAAGCGTCGTCA		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1415G>T	6.37:g.31931201G>T	ENSP00000364543:p.Arg472Leu		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_006929	138	0.00	0	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760419	0.69763	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.51071	0.84;0.72	5.3	5.3	0.74995	DEAD-like helicase (2);	0.063081	0.64402	D	0.000008	T	0.39384	0.1076	M	0.87900	2.915	0.35398	D	0.791304	P	0.50943	0.94	B	0.37780	0.258	T	0.59658	-0.7413	10	0.72032	D	0.01	-11.1345	11.3663	0.49673	0.0835:0.0:0.9165:0.0	.	472	Q15477	SKIV2_HUMAN	L	472;314;279	ENSP00000364543:R472L;ENSP00000442645:R279L	ENSP00000364543:R472L	R	+	2	0	SKIV2L	32039180	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.402000	0.59722	2.757000	0.94681	0.650000	0.86243	CGT			0.577	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076264.3			
TAB2	23118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	149699839	149699839	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr6:149699839A>G	ENST00000367456.1	+	4	1365	c.788A>G	c.(787-789)aAt>aGt	p.N263S	TAB2_ENST00000286332.5_Missense_Mutation_p.N263S|TAB2_ENST00000536230.1_Missense_Mutation_p.N231S|TAB2_ENST00000392282.1_Missense_Mutation_p.N263S|TAB2_ENST00000538427.1_Missense_Mutation_p.N263S			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	263					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						CCTGCATCTAATCCTCTGTCA	0.483																																					p.N263S													.	.			0			c.A788G												180.0	164.0	169.0					6																	149699839		2203	4300	6503	SO:0001583	missense	23118	exon5			CATCTAATCCTCT	AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.788A>G	6.37:g.149699839A>G	ENSP00000356426:p.Asn263Ser		Somatic	127	0	0		WXS	Illumina HiSeq	.	84	0.18	15	NM_015093	113	0.29	33	B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Missense_Mutation	SNP	ENST00000367456.1	37	CCDS5214.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.147225	0.00029	.	.	ENSG00000055208	ENST00000536230;ENST00000392282;ENST00000538427;ENST00000367456;ENST00000286332	T;T;T;T;T	0.70282	-0.44;-0.47;-0.45;-0.45;-0.45	6.16	-3.52	0.04682	.	0.678516	0.16363	N	0.217691	T	0.10680	0.0261	N	0.01352	-0.895	0.19775	N	0.99996	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43032	-0.9416	10	0.02654	T	1	-1.4554	8.1073	0.30894	0.4141:0.2007:0.3853:0.0	.	231;263	B4DIR9;Q9NYJ8	.;TAB2_HUMAN	S	231;263;263;263;263	ENSP00000443206:N231S;ENSP00000376106:N263S;ENSP00000445752:N263S;ENSP00000356426:N263S;ENSP00000286332:N263S	ENSP00000286332:N263S	N	+	2	0	TAB2	149741532	0.977000	0.34250	0.198000	0.23420	0.004000	0.04260	0.224000	0.17738	-0.579000	0.05952	-0.323000	0.08544	AAT			0.483	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042633.3			
RAET1K	646024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	150322744	150322744	+	RNA	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr6:150322744C>T	ENST00000533735.1	-	0	132					NR_024045.1				retinoic acid early transcript 1K pseudogene																		AACTTCACACCATCGTGGTTC	0.458																																					.													.	.			0			.																																											646024	.			TCACACCATCGTG	AF425244		6q25.1	2012-01-10			ENSG00000218358	ENSG00000218358			16797	pseudogene	pseudogene						11827464	Standard	NR_024045		Approved		uc003qnq.3		OTTHUMG00000015815		6.37:g.150322744C>T			Somatic	231	0	0		WXS	Illumina HiSeq	.	109	0.26	28	.	4	0.00	0		RNA	SNP	ENST00000533735.1	37																																																																																						0.458	RAET1K-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000390882.1			
CCT6P3	643180	broad.mit.edu	37	7	64528813	64528814	+	RNA	INS	-	-	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:64528813_64528814insT	ENST00000426828.1	+	0	621				SNORA15_ENST00000384334.1_RNA|SNORA22_ENST00000384614.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		CTTTCTGTAACTTTTTTTTTTT	0.317																																					.													.	.			0			.																																											0	.			CTGTAACTTTTTT			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64528824_64528824dupT			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	13	0.31	4	.	1	0.00	0		RNA	INS	ENST00000426828.1	37																																																																																						0.317	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
AGFG2	3268	mdanderson.org	37	7	100137130	100137130	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:100137130G>T	ENST00000300176.4	+	1	283	c.161G>T	c.(160-162)gGg>gTg	p.G54V	AGFG2_ENST00000262935.4_Missense_Mutation_p.G54V	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	54	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCCAGCGCGGGGTCACCTAC	0.721																																					p.G54V													.	.			0			c.G161T												14.0	12.0	13.0					7																	100137130		2169	4246	6415	SO:0001583	missense	3268	exon1			AGCGCGGGGTCAC	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.161G>T	7.37:g.100137130G>T	ENSP00000300176:p.Gly54Val		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_006076	83	0.00	0	O75429|Q96AB9|Q96GL4	Missense_Mutation	SNP	ENST00000300176.4	37	CCDS5697.1	.	.	.	.	.	.	.	.	.	.	G	33	5.259542	0.95368	.	.	ENSG00000106351	ENST00000300176;ENST00000262935	T;T	0.47528	0.84;0.84	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.76414	0.3984	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.82542	-0.0405	10	0.87932	D	0	-10.1059	15.0468	0.71833	0.0:0.0:1.0:0.0	.	54;54	O95081-2;O95081	.;AGFG2_HUMAN	V	54	ENSP00000300176:G54V;ENSP00000262935:G54V	ENSP00000262935:G54V	G	+	2	0	AGFG2	99975066	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.874000	0.92363	2.624000	0.88883	0.456000	0.33151	GGG			0.721	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342769.1		NM_006076	
C7orf55-LUC7L2	100996928	broad.mit.edu	37	7	139060888	139060888	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:139060888G>T	ENST00000354926.4	+	2	496	c.142G>T	c.(142-144)Gtc>Ttc	p.V48F	C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.V45F|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.V47F|LUC7L2_ENST00000541515.3_Missense_Mutation_p.V114F	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		TCCTCATGATGTCCTTTCTGG	0.343																																					p.V114F													.	.			0			c.G340T												157.0	148.0	151.0					7																	139060888		1921	4140	6061	SO:0001583	missense	0	exon3			CATGATGTCCTTT		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.142G>T	7.37:g.139060888G>T	ENSP00000347005:p.Val48Phe		Somatic	148	0.0067567568	1		WXS	Illumina HiSeq	Phase_I	130	0.03	4	NM_001244584	168	0.00	0		Missense_Mutation	SNP	ENST00000354926.4	37	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796606	0.70567	.	.	ENSG00000146963	ENST00000448820;ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.45668	0.89;1.49;0.89;0.89	5.98	5.98	0.97165	.	0.055120	0.64402	D	0.000001	T	0.55210	0.1906	L	0.42245	1.32	0.37821	D	0.928394	D;D;D;D	0.63046	0.992;0.971;0.989;0.971	D;P;D;P	0.67900	0.954;0.901;0.923;0.857	T	0.62751	-0.6788	9	0.87932	D	0	-8.3111	13.6246	0.62157	0.0707:0.0:0.9293:0.0	.	114;45;47;48	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	F	45;45;114;48;48;47	ENSP00000441604:V45F;ENSP00000440222:V114F;ENSP00000347005:V48F;ENSP00000263545:V47F	ENSP00000263545:V47F	V	+	1	0	LUC7L2	138711428	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.450000	0.80656	2.834000	0.97654	0.655000	0.94253	GTC			0.343	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323618.2			
C7orf55-LUC7L2	100996928	mdanderson.org	37	7	139086888	139086888	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:139086888G>T	ENST00000354926.4	+	4	615	c.261G>T	c.(259-261)atG>atT	p.M87I	C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.M84I|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.M86I|LUC7L2_ENST00000541515.3_Missense_Mutation_p.M153I	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		TGTAGGCCATGGATCATCTGC	0.338																																					p.M153I													.	.			0			c.G459T												75.0	66.0	69.0					7																	139086888		1838	4086	5924	SO:0001583	missense	100996928	exon5			GGCCATGGATCAT		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.261G>T	7.37:g.139086888G>T	ENSP00000347005:p.Met87Ile		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001244584	213	0.00	0		Missense_Mutation	SNP	ENST00000354926.4	37	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349961	0.82132	.	.	ENSG00000146963	ENST00000448820;ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.45276	1.63;1.63;1.63;0.9	5.69	5.69	0.88448	.	0.117720	0.85682	D	0.000000	T	0.48077	0.1480	L	0.60845	1.875	0.46356	D	0.999007	P;P;P;P	0.39311	0.467;0.467;0.616;0.667	B;B;B;B	0.41412	0.356;0.356;0.242;0.356	T	0.49960	-0.8883	9	0.45353	T	0.12	-13.1285	19.809	0.96540	0.0:0.0:1.0:0.0	.	153;84;86;87	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	I	84;84;153;87;87;86	ENSP00000441604:M84I;ENSP00000440222:M153I;ENSP00000347005:M87I;ENSP00000263545:M86I	ENSP00000263545:M86I	M	+	3	0	LUC7L2	138737428	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.866000	0.56040	2.676000	0.91093	0.561000	0.74099	ATG			0.338	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323618.2			
PRSS3P2	154754	hgsc.bcm.edu	37	7	142479004	142479004	+	RNA	SNP	A	A	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:142479004A>C	ENST00000603901.1	+	0	40					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										CATCTGGCATATCTCCTTCCC	0.498																																					.													.	.			0			.																																											154754	.			TGGCATATCTCCT			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142479004A>C			Somatic	20	0	0		WXS	Illumina HiSeq	.	23	0.26	6	.	0		0		RNA	SNP	ENST00000603901.1	37																																																																																						0.498	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000470000.1		NR_001296	
PRSS3P2	154754	hgsc.bcm.edu	37	7	142479016	142479016	+	RNA	SNP	T	T	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:142479016T>C	ENST00000603901.1	+	0	40					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										CTCCTTCCCATCCTCCTTGGG	0.488																																					.													.	.			0			.																																											154754	.			TTCCCATCCTCCT			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142479016T>C			Somatic	17	0	0		WXS	Illumina HiSeq	.	18	0.33	6	.	0		0		RNA	SNP	ENST00000603901.1	37																																																																																						0.488	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000470000.1		NR_001296	
PRSS3P2	154754	hgsc.bcm.edu	37	7	142479029	142479029	+	RNA	SNP	C	C	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:142479029C>G	ENST00000603901.1	+	0	40					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										TCCTTGGGCTCTCTTTAAGCC	0.483																																					.													.	.			0			.																																											154754	.			TGGGCTCTCTTTA			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142479029C>G			Somatic	12	0	0		WXS	Illumina HiSeq	.	18	0.28	5	.	0		0		RNA	SNP	ENST00000603901.1	37																																																																																						0.483	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000470000.1		NR_001296	
GPR124	25960	mdanderson.org	37	8	37687462	37687462	+	Silent	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr8:37687462G>T	ENST00000412232.2	+	6	661	c.648G>T	c.(646-648)acG>acT	p.T216T	GPR124_ENST00000315215.7_Silent_p.T216T	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	216	LRRCT.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CGGAACACACGCTCTGTGCTT	0.662																																					p.T216T													.	.			0			c.G648T												42.0	37.0	38.0					8																	37687462		2202	4300	6502	SO:0001819	synonymous_variant	25960	exon6			ACACACGCTCTGT	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.648G>T	8.37:g.37687462G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_032777	34	0.00	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2																																																																																					0.662	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343331.2			
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu	37	8	77767796	77767797	+	In_Frame_Ins	INS	-	-	CGACCA	rs16939379	byFrequency	TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr8:77767796_77767797insCGACCA	ENST00000521891.2	+	10	9087_9088	c.8639_8640insCGACCA	c.(8638-8643)ggcgac>ggCGACCAcgac	p.2883_2884insHD	ZFHX4_ENST00000455469.2_In_Frame_Ins_p.2838_2839insHD|ZFHX4_ENST00000518282.1_In_Frame_Ins_p.2857_2858insHD|ZFHX4_ENST00000050961.6_In_Frame_Ins_p.2838_2839insHD	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2838					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GACAAAGATGGCGACCACGACC	0.52										HNSCC(33;0.089)																											p.G2880delinsGDH													.	ZFHX4	878		0			c.8639_8640insCGACCA																																									SO:0001652	inframe_insertion	79776	exon10			AAGATGGCGACCA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8646_8651dupCGACCA	8.37:g.77767797_77767802dupCGACCA	ENSP00000430497:p.His2882_Asp2883dup		Somatic	95	0	0		WXS	Illumina HiSeq	.	65	0.23	15	NM_024721	0		0	G3V138|Q18PS0|Q6ZN20	In_Frame_Ins	INS	ENST00000521891.2	37	CCDS47878.2																																																																																					0.520	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379197.2		NM_024721	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113308062	113308062	+	Splice_Site	SNP	G	G	T	rs199825870		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr8:113308062G>T	ENST00000297405.5	-	54	8858	c.8614C>A	c.(8614-8616)Cct>Act	p.P2872T	CSMD3_ENST00000343508.3_Splice_Site_p.P2832T|CSMD3_ENST00000352409.3_Splice_Site_p.P2802T|CSMD3_ENST00000455883.2_Splice_Site_p.P2703T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2872	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GCTTACTTACGCACACAGGAT	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.P2872T													.	.			0			c.C8614A												106.0	88.0	94.0					8																	113308062		2203	4300	6503	SO:0001630	splice_region_variant	114788	exon54			ACTTACGCACACA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8614+1C>A	8.37:g.113308062G>T			Somatic	146	0	0		WXS	Illumina HiSeq	.	82	0.35	29	NM_198123	2	1.00	2	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175892	0.78564	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	5.31	4.43	0.53597	Complement control module (1);Sushi/SCR/CCP (1);	0.075513	0.53938	D	0.000053	T	0.59851	0.2224	M	0.92970	3.365	0.58432	D	0.999992	P;P;D	0.89917	0.93;0.812;1.0	P;B;D	0.97110	0.768;0.436;1.0	T	0.70930	-0.4738	9	.	.	.	.	13.8879	0.63719	0.0734:0.0:0.9266:0.0	.	2703;2872;2832	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	T	2832;2872;2142;2703;2802	ENSP00000345799:P2832T;ENSP00000297405:P2872T;ENSP00000341558:P2142T;ENSP00000412263:P2703T;ENSP00000343124:P2802T	.	P	-	1	0	CSMD3	113377238	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.059000	0.57470	1.242000	0.43836	0.655000	0.94253	CCT			0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347141.1		NM_052900	Missense_Mutation
MAFA	389692	broad.mit.edu	37	8	144511954	144511956	+	In_Frame_Del	DEL	TGG	TGG	-	rs552049497|rs141816879		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr8:144511954_144511956delTGG	ENST00000333480.2	-	1	620_622	c.621_623delCCA	c.(619-624)caccat>cat	p.207_208HH>H	MAFA_ENST00000528185.1_5'UTR	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	207	His-rich.				insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H208delH(3)		breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggt	0.744										HNSCC(29;0.082)																											p.207_208del													.	MAFA	9		3	Deletion - In frame(3)	upper_aerodigestive_tract(2)|breast(1)	c.621_623del																																									SO:0001651	inframe_deletion	389692	exon1			CCGCCATGGTGGT	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.621_623delCCA	8.37:g.144511963_144511965delTGG	ENSP00000328364:p.His208del		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.67	4	NM_201589	0		0		In_Frame_Del	DEL	ENST00000333480.2	37	CCDS34955.1																																																																																					0.744	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381511.2		NM_201589	
EEF1D	1936	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	144663434	144663434	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr8:144663434G>C	ENST00000529272.1	-	4	654	c.254C>G	c.(253-255)gCc>gGc	p.A85G	EEF1D_ENST00000317198.6_Missense_Mutation_p.A85G|EEF1D_ENST00000528610.1_Missense_Mutation_p.A61G|EEF1D_ENST00000526838.1_Intron|NAPRT1_ENST00000426292.3_5'Flank|NAPRT1_ENST00000449291.2_5'Flank|EEF1D_ENST00000395119.3_Missense_Mutation_p.A85G|EEF1D_ENST00000423316.2_Missense_Mutation_p.A451G|EEF1D_ENST00000532741.1_Missense_Mutation_p.A501G|NAPRT1_ENST00000276844.7_5'Flank|RP11-661A12.7_ENST00000529247.1_RNA|EEF1D_ENST00000442189.2_Missense_Mutation_p.A451G|EEF1D_ENST00000419152.2_Missense_Mutation_p.A85G|EEF1D_ENST00000524624.1_Missense_Mutation_p.A61G|NAPRT1_ENST00000435154.3_5'Flank|EEF1D_ENST00000531621.1_Intron|EEF1D_ENST00000532400.1_Intron			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	85	Leucine-zipper.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TTCCAGACTGGCAATCCGGAC	0.692																																					p.A451G													.	EEF1D	48		0			c.C1352G												33.0	31.0	31.0					8																	144663434		2203	4296	6499	SO:0001583	missense	1936	exon6			AGACTGGCAATCC	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.254C>G	8.37:g.144663434G>C	ENSP00000434872:p.Ala85Gly		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	40	0.30	12	NM_001130053	959	0.42	406	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	ENST00000529272.1	37	CCDS6405.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548461	0.65311	.	.	ENSG00000104529	ENST00000419152;ENST00000532741;ENST00000442189;ENST00000528610;ENST00000395119;ENST00000529272;ENST00000423316;ENST00000356793;ENST00000317198;ENST00000337369;ENST00000524624;ENST00000534380;ENST00000534377;ENST00000533204;ENST00000530191;ENST00000531218;ENST00000533494;ENST00000530445;ENST00000533749	.	.	.	4.64	4.64	0.57946	.	0.310460	0.34460	N	0.003956	T	0.54240	0.1846	M	0.65975	2.015	0.30636	N	0.75695	P;P;B;P;P	0.44429	0.835;0.735;0.266;0.749;0.783	B;B;B;B;P	0.45829	0.343;0.363;0.092;0.334;0.494	T	0.62746	-0.6789	9	0.52906	T	0.07	.	16.8522	0.85996	0.0:0.0:1.0:0.0	.	451;379;85;501;451	D3DWK1;F8W934;P29692;E9PRY8;P29692-2	.;.;EF1D_HUMAN;.;.	G	85;501;451;61;85;85;451;379;85;451;61;85;61;85;85;85;85;85;101	.	ENSP00000317399:A85G	A	-	2	0	EEF1D	144734577	1.000000	0.71417	0.976000	0.42696	0.468000	0.32798	3.808000	0.55598	2.296000	0.77279	0.542000	0.68232	GCC			0.692	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000382592.2		NM_032378	
PLEC	5339	broad.mit.edu	37	8	144999684	144999684	+	Frame_Shift_Del	DEL	A	A	-	rs35916068	byFrequency	TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr8:144999684delA	ENST00000322810.4	-	31	4993	c.4824delT	c.(4822-4824)gctfs	p.A1608fs	PLEC_ENST00000356346.3_Frame_Shift_Del_p.A1457fs|PLEC_ENST00000354589.3_Frame_Shift_Del_p.A1471fs|PLEC_ENST00000527096.1_Frame_Shift_Del_p.A1494fs|PLEC_ENST00000436759.2_Frame_Shift_Del_p.A1498fs|PLEC_ENST00000398774.2_Frame_Shift_Del_p.A1439fs|PLEC_ENST00000357649.2_Frame_Shift_Del_p.A1475fs|PLEC_ENST00000345136.3_Frame_Shift_Del_p.A1471fs|PLEC_ENST00000354958.2_Frame_Shift_Del_p.A1449fs	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1608	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTCCCCCTCAGCCCCGCCAC	0.726																																					p.A1608fs													.	PLEC	1144		0			c.4824delT												9.0	9.0	9.0					8																	144999684		1846	3738	5584	SO:0001589	frameshift_variant	5339	exon31			CCCCTCAGCCCCG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4824delT	8.37:g.144999684delA	ENSP00000323856:p.Ala1608fs		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_201380	43	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Frame_Shift_Del	DEL	ENST00000322810.4	37	CCDS43772.1																																																																																					0.726	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
ZNF16	7564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	146156383	146156383	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr8:146156383C>T	ENST00000276816.4	-	4	1976	c.1790G>A	c.(1789-1791)gGg>gAg	p.G597E	ZNF16_ENST00000394909.2_Missense_Mutation_p.G597E	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	597					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GGGTTTTTCCCCAGTATGAAC	0.488																																					p.G597E													.	.			0			c.G1790A												102.0	93.0	96.0					8																	146156383		2203	4300	6503	SO:0001583	missense	7564	exon3			TTTTCCCCAGTAT	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1790G>A	8.37:g.146156383C>T	ENSP00000276816:p.Gly597Glu		Somatic	90	0	0		WXS	Illumina HiSeq	.	60	0.48	29	NM_006958	25	0.60	15	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.197222	0.58126	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	T;T	0.25749	1.78;1.78	4.0	4.0	0.46444	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41673	0.1169	L	0.37561	1.115	0.31681	N	0.643165	D	0.89917	1.0	D	0.97110	1.0	T	0.48234	-0.9053	9	0.66056	D	0.02	.	15.0179	0.71600	0.0:1.0:0.0:0.0	.	597	P17020	ZNF16_HUMAN	E	597	ENSP00000276816:G597E;ENSP00000378369:G597E	ENSP00000276816:G597E	G	-	2	0	ZNF16	146127187	0.869000	0.29996	0.998000	0.56505	0.905000	0.53344	3.250000	0.51445	2.058000	0.61347	0.462000	0.41574	GGG			0.488	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000382978.1		NM_006958	
TLR4	7099	broad.mit.edu	37	9	120475855	120475855	+	Silent	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr9:120475855C>T	ENST00000355622.6	+	3	1550	c.1449C>T	c.(1447-1449)ttC>ttT	p.F483F	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Silent_p.F443F	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	483					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GCAATTCTTTCCAGGAAAACT	0.438																																					p.F483F													TLR4,NS,carcinoma,0,1	TLR4	220	1	0			c.C1449T												84.0	84.0	84.0					9																	120475855		2203	4300	6503	SO:0001819	synonymous_variant	7099	exon3			TTCTTTCCAGGAA	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1449C>T	9.37:g.120475855C>T			Somatic	155	0.0451612903	7		WXS	Illumina HiSeq	Phase_I	101	0.07	7	NM_138554	5	0.00	0	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Silent	SNP	ENST00000355622.6	37	CCDS6818.1																																																																																					0.438	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055549.3		NM_138554	
PIP5KL1	138429	mdanderson.org	37	9	130692122	130692122	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr9:130692122A>G	ENST00000388747.4	-	2	117	c.73T>C	c.(73-75)Tcc>Ccc	p.S25P	PIP5KL1_ENST00000300432.3_5'Flank|PIP5KL1_ENST00000490773.1_5'Flank	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	25						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						CGCCGGCTGGAGGTGACTGCT	0.637																																					p.S25P													.	.			0			c.T73C												7.0	10.0	9.0					9																	130692122		1482	3381	4863	SO:0001583	missense	138429	exon2			GGCTGGAGGTGAC	BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.73T>C	9.37:g.130692122A>G	ENSP00000373399:p.Ser25Pro		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_001135219	0		0	Q8IVS3	Missense_Mutation	SNP	ENST00000388747.4	37	CCDS48030.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.598403	0.28445	.	.	ENSG00000167103	ENST00000388747	T	0.48522	0.81	4.99	2.57	0.30868	.	0.465773	0.17214	N	0.182615	T	0.29652	0.0740	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17992	-1.0351	10	0.49607	T	0.09	-17.9914	5.3717	0.16142	0.7299:0.1769:0.0932:0.0	.	25	Q5T9C9	PI5L1_HUMAN	P	25	ENSP00000373399:S25P	ENSP00000373399:S25P	S	-	1	0	PIP5KL1	129731943	0.000000	0.05858	0.008000	0.14137	0.145000	0.21501	0.290000	0.18975	0.305000	0.22832	0.459000	0.35465	TCC			0.637	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054289.2		NM_173492	
C9orf173	441476	hgsc.bcm.edu	37	9	140145760	140145760	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr9:140145760G>T	ENST00000412566.1	+	1	31	c.22G>T	c.(22-24)Gca>Tca	p.A8S	C9orf173_ENST00000388931.3_Missense_Mutation_p.A8S			Q8N7X2	CI173_HUMAN	chromosome 9 open reading frame 173	8										kidney(1)|large_intestine(1)|lung(5)|pancreas(1)	8						TGACCAGAAGGCAGTGAAATT	0.542																																					p.A8S													.	.			0			c.G22T												120.0	133.0	129.0					9																	140145760		1955	4141	6096	SO:0001583	missense	441476	exon1			CAGAAGGCAGTGA		CCDS48065.1, CCDS59156.1, CCDS75940.1, CCDS75941.1	9q34.3	2009-10-02			ENSG00000197768	ENSG00000197768			37285	protein-coding gene	gene with protein product							Standard	NM_001256699		Approved	FLJ40246	uc004cmk.2	Q8N7X2		ENST00000412566.1:c.22G>T	9.37:g.140145760G>T	ENSP00000391218:p.Ala8Ser		Somatic	128	0	0		WXS	Illumina HiSeq	.	98	0.04	4	NM_001256701	23	0.00	0	A2RU24|B7ZM72|B7ZM76|Q8NEA3	Missense_Mutation	SNP	ENST00000412566.1	37	CCDS48065.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066932	0.76301	.	.	ENSG00000197768	ENST00000388931;ENST00000412566	T;T	0.59083	0.29;0.4	4.41	3.49	0.39957	.	0.000000	0.33515	N	0.004835	T	0.57460	0.2055	L	0.48642	1.525	0.30602	N	0.760379	B;D;D;P	0.60160	0.192;0.987;0.987;0.93	B;P;P;P	0.50405	0.078;0.64;0.64;0.489	T	0.63225	-0.6685	10	0.87932	D	0	-10.7761	11.2392	0.48960	0.0:0.0:0.8155:0.1845	.	8;8;8;8	B7ZM74;Q8N7X2-3;Q8N7X2-2;Q8N7X2-4	.;.;.;.	S	8	ENSP00000373583:A8S;ENSP00000391218:A8S	ENSP00000373583:A8S	A	+	1	0	C9orf173	139265581	0.977000	0.34250	0.990000	0.47175	0.867000	0.49689	0.923000	0.28757	1.031000	0.39867	0.555000	0.69702	GCA			0.542	C9orf173-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001004353	
MT-ND6	4541	broad.mit.edu;bcgsc.ca	37	M	14600	14600	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chrM:14600G>A	ENST00000361681.2	-	1	73	c.74C>T	c.(73-75)cCt>cTt	p.P25L	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	25					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CCCCATAAATAGGAGAAGGCT	0.393																																					p.P25L													.	.			0			c.C74T																																									SO:0001583	missense	4541	exon1			TAAATAGGAGAAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.74C>T	M.37:g.14600G>A	ENSP00000354665:p.Pro25Leu		Somatic	169	0.0059171598	1		WXS	Illumina HiSeq	Phase_I	120	0.06	7	ENST00000361681	0		0	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	37																																																																																						0.393	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024037	
POLA1	5422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	24751914	24751914	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chrX:24751914A>G	ENST00000379059.3	+	17	1811	c.1796A>G	c.(1795-1797)aAa>aGa	p.K599R	POLA1_ENST00000493342.1_3'UTR|POLA1_ENST00000379068.3_Missense_Mutation_p.K605R	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	599					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TATGCTTTCAAAGAAGTCATT	0.348																																					p.K599R													.	.			0			c.A1796G												50.0	48.0	49.0					X																	24751914		2202	4298	6500	SO:0001583	missense	5422	exon17			CTTTCAAAGAAGT		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1796A>G	X.37:g.24751914A>G	ENSP00000368349:p.Lys599Arg		Somatic	475	0.0021052632	1		WXS	Illumina HiSeq	.	527	0.46	242	NM_016937	21	0.81	17	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	A	5.402	0.259362	0.10239	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.41400	1.0;1.0	4.81	-1.1	0.09872	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.442345	0.26939	N	0.021732	T	0.25938	0.0632	L	0.46157	1.445	0.46478	D	0.999066	B	0.11235	0.004	B	0.16722	0.016	T	0.06661	-1.0814	10	0.21014	T	0.42	2.9926	2.0435	0.03555	0.522:0.1338:0.0813:0.2629	.	599	P09884	DPOLA_HUMAN	R	605;599	ENSP00000368358:K605R;ENSP00000368349:K599R	ENSP00000368349:K599R	K	+	2	0	POLA1	24661835	1.000000	0.71417	0.002000	0.10522	0.456000	0.32438	3.795000	0.55499	-0.386000	0.07821	0.345000	0.21793	AAA			0.348	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056111.1		NM_016937	
TAF9B	51616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	77393365	77393365	+	Missense_Mutation	SNP	C	C	T	rs372088655		TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chrX:77393365C>T	ENST00000341864.5	-	4	380	c.286G>A	c.(286-288)Gca>Aca	p.A96T		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	96					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						TTCTGCCTTGCGATATCCAGT	0.343																																					p.A96T													.	.			0			c.G286A							C	THR/ALA	1,3834		0,0,1,1632,570	89.0	78.0	82.0		286	4.3	1.0	X		82	0,6723		0,0,0,2427,1869	no	missense	TAF9B	NM_015975.4	58	0,0,1,4059,2439	TT,TC,T,CC,C		0.0,0.0261,0.0095	possibly-damaging	96/252	77393365	1,10557	2203	4296	6499	SO:0001583	missense	51616	exon4			GCCTTGCGATATC	AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.286G>A	X.37:g.77393365C>T	ENSP00000339917:p.Ala96Thr		Somatic	295	0	0		WXS	Illumina HiSeq	.	314	0.44	138	NM_015975	149	0.26	39	B2RUZ9|Q9Y2S3	Missense_Mutation	SNP	ENST00000341864.5	37	CCDS35340.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314409	0.81358	2.61E-4	0.0	ENSG00000187325	ENST00000341864	T	0.61859	0.07	4.32	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.70911	0.3278	L	0.59912	1.85	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.74272	-0.3719	10	0.72032	D	0.01	-7.2943	13.2635	0.60120	0.0:1.0:0.0:0.0	.	96	Q9HBM6	TAF9B_HUMAN	T	96	ENSP00000339917:A96T	ENSP00000339917:A96T	A	-	1	0	TAF9B	77280021	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.051000	0.76627	1.986000	0.57962	0.600000	0.82982	GCA			0.343	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057308.1		NM_015975	
RP11-308D16.4	0	broad.mit.edu	37	X	136058330	136058330	+	RNA	DEL	T	T	-			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chrX:136058330delT	ENST00000424306.1	+	0	2052																											AAAAAGGGGATTTTTTTTGGC	0.323																																					.													.	.			0			.																																											0	.			AGGGGATTTTTTT																													X.37:g.136058330delT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000424306.1	37																																																																																						0.323	RP11-308D16.4-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000058514.2			
KRBA1	84626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149430318	149430318	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94I-01A-11D-A435-10	TCGA-YU-A94I-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f459a1b-ea13-4396-89b1-50daa8059835	713aeca6-9e16-4d10-8691-0227db471977	g.chr7:149430318C>T	ENST00000485033.2	+	15	2092	c.2092C>T	c.(2092-2094)Ccc>Tcc	p.P698S	KRBA1_ENST00000255992.10_Missense_Mutation_p.P758S|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.P698S			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	759	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GAGGCTGCTCCCCCAGGGCCC	0.642																																					.													.	.			0			.												79.0	88.0	85.0					7																	149430318		1942	4120	6062	SO:0001583	missense	84626	.			CTGCTCCCCCAGG	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.2092C>T	7.37:g.149430318C>T	ENSP00000420112:p.Pro698Ser		Somatic	96	0	0		WXS	Illumina HiSeq	.	82	0.38	31	.	28	0.18	5	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.	.	.	.	.	.	.	.	.	.	C	9.530	1.110597	0.20714	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.26660	1.72;1.73;1.73	4.44	0.725	0.18242	.	0.643714	0.12991	N	0.422444	T	0.13543	0.0328	.	.	.	0.09310	N	1	B;B	0.25312	0.123;0.123	B;B	0.23574	0.032;0.047	T	0.27773	-1.0064	9	0.27785	T	0.31	-2.5346	3.8849	0.09094	0.393:0.452:0.0:0.155	.	698;759	E7ENE9;A5PL33	.;KRBA1_HUMAN	S	758;698;698	ENSP00000255992:P758S;ENSP00000317165:P698S;ENSP00000420112:P698S	ENSP00000255992:P758S	P	+	1	0	KRBA1	149061251	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-0.177000	0.09796	-0.091000	0.12440	0.563000	0.77884	CCC			0.642	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000349841.3		NM_032534	
