#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	hgsc.bcm.edu	37	1	1269674	1269674	+	Missense_Mutation	SNP	G	G	T	rs147583678		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:1269674G>T	ENST00000339381.5	+	6	2421	c.2389G>T	c.(2389-2391)Gcc>Tcc	p.A797S		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	797					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GCAGATGGGCGCCCTCCTGCT	0.637																																					p.A797S													.	.			0			c.G2389T												34.0	28.0	30.0					1																	1269674		2199	4297	6496	SO:0001583	missense	83756	exon6			ATGGGCGCCCTCC	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.2389G>T	1.37:g.1269674G>T	ENSP00000344411:p.Ala797Ser		Somatic	91	0	0		WXS	Illumina HiSeq	.	69	0.06	4	NM_152228	0		0	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	37	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.546117	0.27652	.	.	ENSG00000169962	ENST00000339381	D	0.89485	-2.52	4.59	0.66	0.17868	GPCR, family 3, C-terminal (2);	0.893166	0.09793	N	0.755105	D	0.85089	0.5617	L	0.37561	1.115	0.09310	N	0.999997	P	0.45827	0.867	P	0.46172	0.506	T	0.73757	-0.3882	10	0.49607	T	0.09	.	8.494	0.33117	0.42:0.0:0.58:0.0	.	797	Q7RTX0	TS1R3_HUMAN	S	797	ENSP00000344411:A797S	ENSP00000344411:A797S	A	+	1	0	TAS1R3	1259537	0.858000	0.29795	0.258000	0.24420	0.052000	0.14988	1.483000	0.35497	-0.015000	0.14150	0.456000	0.33151	GCC			0.637	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008493.1			
PLCH2	9651	mdanderson.org	37	1	2418772	2418772	+	Silent	SNP	C	C	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:2418772C>T	ENST00000419816.2	+	7	1345	c.1071C>T	c.(1069-1071)gaC>gaT	p.D357D	PLCH2_ENST00000449969.1_Silent_p.D330D|PLCH2_ENST00000378488.3_Silent_p.D357D|PLCH2_ENST00000378486.3_Silent_p.D357D|PLCH2_ENST00000288766.5_Intron			O75038	PLCH2_HUMAN	phospholipase C, eta 2	357	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CACGGGTGGACATGTATGCTT	0.632																																					p.D357D													.	.			0			c.C1071T												64.0	66.0	65.0					1																	2418772		2184	4278	6462	SO:0001819	synonymous_variant	9651	exon7			GGTGGACATGTAT	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.1071C>T	1.37:g.2418772C>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_014638	0		0	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	ENST00000419816.2	37																																																																																						0.632	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000467514.1		NM_014638	
KAZN	23254	hgsc.bcm.edu	37	1	15439098	15439098	+	Intron	SNP	C	C	T	rs114844404		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:15439098C>T	ENST00000376030.2	+	14	2457					NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein						keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CTTTTTTTCTCCTCCCGGGAG	0.587																																					.													.	.			0			.																																									SO:0001627	intron_variant	200197	.			TTTTCTCCTCCCG	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.2163+61C>T	1.37:g.15439098C>T			Somatic	57	0	0		WXS	Illumina HiSeq	.	60	0.30	18	.	0		0	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	RNA	SNP	ENST00000376030.2	37	CCDS152.2																																																																																					0.587	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005690.2		NM_001017999	
BSND	7809	mdanderson.org	37	1	55470729	55470729	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:55470729G>A	ENST00000371265.4	+	2	466	c.212G>A	c.(211-213)gGc>gAc	p.G71D		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	71					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						GACTTTCAAGGCATCCTCTCC	0.607																																					p.G71D	Ovarian(191;1657 2078 22894 42033 48899)												.	.			0			c.G212A												110.0	91.0	97.0					1																	55470729		2203	4300	6503	SO:0001583	missense	7809	exon2			TTCAAGGCATCCT	AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.212G>A	1.37:g.55470729G>A	ENSP00000360312:p.Gly71Asp		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_057176	0		0	Q6NT28	Missense_Mutation	SNP	ENST00000371265.4	37	CCDS602.1	.	.	.	.	.	.	.	.	.	.	G	9.587	1.125007	0.20959	.	.	ENSG00000162399	ENST00000371265	T	0.64438	-0.1	4.08	1.98	0.26296	.	0.127757	0.31685	N	0.007225	T	0.51787	0.1695	M	0.68317	2.08	0.27544	N	0.95069	B	0.23540	0.087	B	0.25759	0.063	T	0.33343	-0.9872	10	0.16420	T	0.52	-19.0983	5.3911	0.16244	0.1166:0.2036:0.6798:0.0	.	71	Q8WZ55	BSND_HUMAN	D	71	ENSP00000360312:G71D	ENSP00000360312:G71D	G	+	2	0	BSND	55243317	1.000000	0.71417	0.868000	0.34077	0.537000	0.34900	1.250000	0.32850	0.820000	0.34516	0.297000	0.19635	GGC			0.607	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022213.4		NM_057176	
GBP3	2635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	89477486	89477486	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:89477486C>T	ENST00000370481.4	-	7	1313	c.1093G>A	c.(1093-1095)Gtc>Atc	p.V365I		NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	416					axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		TTCATATAGACTTCAGTGGCC	0.478																																					p.V365I													.	.			0			c.G1093A												61.0	48.0	53.0					1																	89477486		2189	3938	6127	SO:0001583	missense	2635	exon7			TATAGACTTCAGT	BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.1093G>A	1.37:g.89477486C>T	ENSP00000359512:p.Val365Ile		Somatic	218	0	0		WXS	Illumina HiSeq	.	280	0.28	79	NM_018284	2	0.00	0	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000370481.4	37	CCDS717.2	.	.	.	.	.	.	.	.	.	.	C	1.239	-0.621870	0.03636	.	.	ENSG00000117226	ENST00000370482;ENST00000370481;ENST00000235878	T	0.02787	4.16	3.84	-7.69	0.01263	Guanylate-binding protein, C-terminal (3);	1.064250	0.07188	N	0.855266	T	0.00552	0.0018	L	0.28274	0.84	0.09310	N	1	B;B	0.16166	0.016;0.006	B;B	0.23419	0.046;0.029	T	0.44620	-0.9316	10	0.21014	T	0.42	.	6.5913	0.22647	0.0873:0.2217:0.0868:0.6042	.	231;365	F6X827;Q9H0R5	.;GBP3_HUMAN	I	333;365;365	ENSP00000359512:V365I	ENSP00000235878:V365I	V	-	1	0	GBP3	89250074	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.460000	0.00999	-3.279000	0.00197	-0.507000	0.04495	GTC			0.478	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313541.3		NM_018284	
DBT	1629	mdanderson.org	37	1	100680387	100680387	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:100680387G>T	ENST00000370132.4	-	7	938	c.925C>A	c.(925-927)Cct>Act	p.P309T	DBT_ENST00000370131.3_Missense_Mutation_p.P309T	NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	309					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		AAGAAGAAAGGCATAAAGGAG	0.358																																					p.P309T													.	.			0			c.C925A												74.0	72.0	73.0					1																	100680387		2203	4300	6503	SO:0001583	missense	1629	exon7			AGAAAGGCATAAA	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.925C>A	1.37:g.100680387G>T	ENSP00000359151:p.Pro309Thr		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001918	10	0.00	0	B2R811|Q5VVL8	Missense_Mutation	SNP	ENST00000370132.4	37	CCDS767.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507873	0.85282	.	.	ENSG00000137992	ENST00000543138;ENST00000370132;ENST00000370131	T;T	0.41758	0.99;0.99	5.54	5.54	0.83059	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.69646	0.3134	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.958;1.0	T	0.76889	-0.2792	10	0.87932	D	0	-13.7976	19.4948	0.95067	0.0:0.0:1.0:0.0	.	128;309	F5H1F9;P11182	.;ODB2_HUMAN	T	128;309;309	ENSP00000359151:P309T;ENSP00000359150:P309T	ENSP00000359150:P309T	P	-	1	0	DBT	100452975	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.476000	0.97823	2.615000	0.88500	0.655000	0.94253	CCT			0.358	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030101.2		NM_001918	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	152283719	152283719	+	Missense_Mutation	SNP	T	T	G			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:152283719T>G	ENST00000368799.1	-	3	3678	c.3643A>C	c.(3643-3645)Agt>Cgt	p.S1215R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1215	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTTGCACTTCTGGATCCT	0.552									Ichthyosis																												p.S1215R													FLG,NS,carcinoma,0,2	FLG	0	2	0			c.A3643C												355.0	350.0	351.0					1																	152283719		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TTGCACTTCTGGA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3643A>C	1.37:g.152283719T>G	ENSP00000357789:p.Ser1215Arg		Somatic	83	0	0		WXS	Illumina HiSeq	.	94	0.07	7	NM_002016	2	0.00	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	2.866	-0.235137	0.05983	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	0.835	-0.724	0.11177	.	.	.	.	.	T	0.00784	0.0026	M	0.73962	2.25	0.09310	N	1	P	0.39520	0.676	B	0.39706	0.307	T	0.43442	-0.9391	9	0.15952	T	0.53	.	3.4165	0.07377	0.0:0.6402:0.0:0.3598	.	1215	P20930	FILA_HUMAN	R	1215	ENSP00000357789:S1215R	ENSP00000357789:S1215R	S	-	1	0	FLG	150550343	.	.	0.002000	0.10522	0.123000	0.20343	.	.	-0.179000	0.10654	0.156000	0.16432	AGT			0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033742.1		NM_002016	
ZC3H11A	9877	broad.mit.edu	37	1	203821424	203821424	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr1:203821424T>C	ENST00000545588.1	+	17	6157	c.2330T>C	c.(2329-2331)aTa>aCa	p.I777T	ZC3H11A_ENST00000367212.3_Missense_Mutation_p.I777T|ZC3H11A_ENST00000332127.4_Missense_Mutation_p.I777T|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.I777T|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.I777T	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	777					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAGAAACTAATATGGGAGATT	0.473																																					p.I777T													.	ZC3H11A	71		0			c.T2330C												55.0	56.0	56.0					1																	203821424		2203	4300	6503	SO:0001583	missense	9877	exon20			AACTAATATGGGA		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.2330T>C	1.37:g.203821424T>C	ENSP00000438527:p.Ile777Thr		Somatic	176	0.0056818182	1		WXS	Illumina HiSeq	Phase_I	265	0.02	4	NM_014827	106	0.00	0	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.650267	0.29336	.	.	ENSG00000058673	ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.61540	0.2355	M	0.77103	2.36	0.50467	D	0.999873	B	0.18461	0.028	B	0.24269	0.052	T	0.60454	-0.7260	10	0.46703	T	0.11	-25.6355	14.9374	0.70967	0.0:0.0:0.0:1.0	.	777	O75152	ZC11A_HUMAN	T	777;723;777;777;777;777	ENSP00000356183:I777T;ENSP00000356181:I777T;ENSP00000333253:I777T;ENSP00000438527:I777T;ENSP00000356179:I777T	ENSP00000333253:I777T	I	+	2	0	ZC3H11A	202088047	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	6.379000	0.73154	2.171000	0.68590	0.528000	0.53228	ATA			0.473	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087471.3		NM_014827	
RASSF4	83937	hgsc.bcm.edu	37	10	45486407	45486407	+	Silent	SNP	T	T	C	rs142266476		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr10:45486407T>C	ENST00000340258.5	+	9	810	c.697T>C	c.(697-699)Tta>Cta	p.L233L	RASSF4_ENST00000334940.6_Silent_p.L242L|RASSF4_ENST00000472561.1_3'UTR|RASSF4_ENST00000374417.2_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						GCGGACAAAATTAAAAGACTG	0.463																																					p.L233L													RASSF4,NS,carcinoma,-2,1	RASSF4	-2	1	0			c.T697C							T		0,4406		0,0,2203	76.0	87.0	83.0		697	0.0	1.0	10	dbSNP_134	83	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RASSF4	NM_032023.3		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		233/322	45486407	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	83937	exon9			ACAAAATTAAAAG	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.697T>C	10.37:g.45486407T>C			Somatic	50	0	0		WXS	Illumina HiSeq	.	34	0.06	2	NM_032023	36	0.00	0	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000340258.5	37	CCDS7208.1																																																																																			0		0.463	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047745.2		NM_032023	
ZSWIM8	23053	mdanderson.org	37	10	75550887	75550887	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr10:75550887G>T	ENST00000605216.1	+	8	1313	c.1096G>T	c.(1096-1098)Gcc>Tcc	p.A366S	ZSWIM8_ENST00000604729.1_Missense_Mutation_p.A366S|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.A366S|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.A366S|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.A366S	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	366							zinc ion binding (GO:0008270)										CAGCAATGCTGCCCCCTTGTT	0.592																																					p.A366S													.	.			0			c.G1096T												52.0	60.0	57.0					10																	75550887		2093	4216	6309	SO:0001583	missense	23053	exon8			AATGCTGCCCCCT	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.1096G>T	10.37:g.75550887G>T	ENSP00000474748:p.Ala366Ser		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_015037	27	0.00	0	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.46|17.46	3.394076|3.394076	0.62066|0.62066	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000433366	T|.	0.73575|.	-0.76|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.000000|.	0.56097|.	U|.	0.000023|.	T|T	0.57184|0.57184	0.2036|0.2036	N|N	0.25332|0.25332	0.735|0.735	0.80722|0.80722	D|D	1|1	D;D;D|.	0.67145|.	0.996;0.996;0.996|.	D;D;D|.	0.77557|.	0.986;0.99;0.986|.	T|T	0.49899|0.49899	-0.8890|-0.8890	10|5	0.54805|.	T|.	0.06|.	-4.4829|-4.4829	19.2662|19.2662	0.93985|0.93985	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	366;366;366|.	A7E2V4;A7E2V4-5;A7E2V4-4|.	K0913_HUMAN;.;.|.	S|F	366|88	ENSP00000381693:A366S|.	ENSP00000381693:A366S|.	A|C	+|+	1|2	0|0	KIAA0913|KIAA0913	75220893|75220893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.157000|9.157000	0.94714|0.94714	2.789000|2.789000	0.95967|0.95967	0.591000|0.591000	0.81541|0.81541	GCC|TGC			0.592	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000468545.1		NM_001242487	
PI4K2A	55361	mdanderson.org	37	10	99400832	99400832	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr10:99400832G>C	ENST00000370631.3	+	1	390	c.333G>C	c.(331-333)gaG>gaC	p.E111D	PI4K2A_ENST00000555577.1_Intron|PI4K2A_ENST00000370649.3_Intron	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	111					basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		CTGAGTTCGAGGCGGTGGTGC	0.706																																					p.E111D													.	.			0			c.G333C												12.0	14.0	13.0					10																	99400832		1970	4008	5978	SO:0001583	missense	55361	exon1			GTTCGAGGCGGTG	AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.333G>C	10.37:g.99400832G>C	ENSP00000359665:p.Glu111Asp		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_018425	4	0.00	0	D3DR59|Q9NSG8	Missense_Mutation	SNP	ENST00000370631.3	37	CCDS7469.1	.	.	.	.	.	.	.	.	.	.	G	3.147	-0.175017	0.06421	.	.	ENSG00000155252	ENST00000370631	.	.	.	3.53	2.56	0.30785	.	0.192698	0.43416	D	0.000580	T	0.29783	0.0744	N	0.14661	0.345	0.80722	D	1	B	0.13594	0.008	B	0.17098	0.017	T	0.07673	-1.0760	9	0.19590	T	0.45	-14.2655	7.8861	0.29651	0.0:0.2317:0.6285:0.1398	.	111	Q9BTU6	P4K2A_HUMAN	D	111	.	ENSP00000359665:E111D	E	+	3	2	PI4K2A	99390822	0.495000	0.26051	0.887000	0.34795	0.171000	0.22731	0.781000	0.26774	1.808000	0.52836	0.313000	0.20887	GAG			0.706	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049735.1		NM_018425	
ANO5	203859	mdanderson.org	37	11	22272376	22272376	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr11:22272376C>T	ENST00000324559.8	+	11	1420	c.1103C>T	c.(1102-1104)aCg>aTg	p.T368M		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	368					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTAAATAGTACGTGTTTGGCT	0.368																																					p.T368M													.	.			0			c.C1103T												270.0	227.0	242.0					11																	22272376		2203	4300	6503	SO:0001583	missense	203859	exon11			ATAGTACGTGTTT	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1103C>T	11.37:g.22272376C>T	ENSP00000315371:p.Thr368Met		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_213599	1	0.00	0		Missense_Mutation	SNP	ENST00000324559.8	37	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545927	0.65198	.	.	ENSG00000171714	ENST00000324559	T	0.73047	-0.71	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.86209	0.5878	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.86889	0.2047	10	0.51188	T	0.08	.	19.3645	0.94456	0.0:1.0:0.0:0.0	.	368	Q75V66	ANO5_HUMAN	M	368	ENSP00000315371:T368M	ENSP00000315371:T368M	T	+	2	0	ANO5	22228952	1.000000	0.71417	0.104000	0.21259	0.499000	0.33736	7.340000	0.79292	2.565000	0.86533	0.557000	0.71058	ACG			0.368	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387615.1		NM_213599	
TMEM109	79073	mdanderson.org	37	11	60689301	60689301	+	Silent	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr11:60689301G>T	ENST00000227525.3	+	4	799	c.396G>T	c.(394-396)ctG>ctT	p.L132L	RP11-881M11.4_ENST00000543907.1_RNA|TMEM109_ENST00000536171.1_Silent_p.L132L|TMEM132A_ENST00000453848.2_5'Flank|TMEM132A_ENST00000005286.4_5'Flank	NM_024092.2	NP_076997.1	Q9BVC6	TM109_HUMAN	transmembrane protein 109	132					cellular response to gamma radiation (GO:0071480)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell death (GO:0060548)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8						AGACCTTCCTGCTGTGGGGAG	0.632																																					p.L132L													.	.			0			c.G396T												104.0	108.0	106.0					11																	60689301		2203	4299	6502	SO:0001819	synonymous_variant	79073	exon4			CTTCCTGCTGTGG		CCDS7996.1	11q12.2	2005-12-22				ENSG00000110108			28771	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_024092		Approved	MGC5508	uc001nqg.3	Q9BVC6		ENST00000227525.3:c.396G>T	11.37:g.60689301G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_024092	45	0.00	0		Silent	SNP	ENST00000227525.3	37	CCDS7996.1																																																																																					0.632	TMEM109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396343.1		NM_024092	
SART1	9092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65744158	65744158	+	Missense_Mutation	SNP	A	A	C	rs542380135		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr11:65744158A>C	ENST00000312397.5	+	14	1870	c.1778A>C	c.(1777-1779)aAc>aCc	p.N593T		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	593					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CGCTCAGCCAACGGTGGCTCC	0.672																																					p.N593T													.	.			0			c.A1778C												31.0	29.0	30.0					11																	65744158		2201	4296	6497	SO:0001583	missense	9092	exon14			CAGCCAACGGTGG	AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.1778A>C	11.37:g.65744158A>C	ENSP00000310448:p.Asn593Thr		Somatic	48	0	0		WXS	Illumina HiSeq	.	82	0.62	51	NM_005146	387	0.66	257	A6NDN1|Q53GB5	Missense_Mutation	SNP	ENST00000312397.5	37	CCDS31611.1	.	.	.	.	.	.	.	.	.	.	A	2.822	-0.244684	0.05906	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.24151	1.87	4.0	2.87	0.33458	.	0.597033	0.16279	N	0.221443	T	0.20618	0.0496	L	0.40543	1.245	0.40897	D	0.984121	B	0.25441	0.126	B	0.26094	0.066	T	0.06320	-1.0833	10	0.87932	D	0	-29.1503	7.4032	0.26975	0.893:0.0:0.107:0.0	.	593	O43290	SNUT1_HUMAN	T	593;435	ENSP00000310448:N593T	ENSP00000310448:N593T	N	+	2	0	SART1	65500734	0.275000	0.24201	0.553000	0.28255	0.032000	0.12392	0.866000	0.27954	0.597000	0.29811	0.402000	0.26972	AAC			0.672	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391409.1			
GPC5	2262	mdanderson.org	37	13	92101090	92101090	+	Missense_Mutation	SNP	C	C	T	rs559277707		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr13:92101090C>T	ENST00000377067.3	+	2	611	c.239C>T	c.(238-240)gCg>gTg	p.A80V		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	80					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TATCAGATTGCGGCTCGCCAG	0.433													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18864	0.0		0.0	False		,,,				2504	0.0				p.A80V													.	.			0			c.C239T												143.0	133.0	136.0					13																	92101090		2203	4300	6503	SO:0001583	missense	2262	exon2			AGATTGCGGCTCG	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.239C>T	13.37:g.92101090C>T	ENSP00000366267:p.Ala80Val		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_004466	0		0	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	C	8.422	0.846542	0.16963	.	.	ENSG00000179399	ENST00000377067	T	0.50813	0.73	5.5	2.87	0.33458	.	0.053771	0.64402	N	0.000001	T	0.33265	0.0857	L	0.36672	1.1	0.31381	N	0.678985	B	0.21606	0.058	B	0.24394	0.053	T	0.30880	-0.9963	10	0.17832	T	0.49	.	8.2657	0.31813	0.0:0.6973:0.0:0.3027	.	80	P78333	GPC5_HUMAN	V	80	ENSP00000366267:A80V	ENSP00000366267:A80V	A	+	2	0	GPC5	90899091	0.598000	0.26882	0.007000	0.13788	0.136000	0.21042	1.171000	0.31896	0.301000	0.22738	0.467000	0.42956	GCG			0.433	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045454.1		NM_004466	
F7	2155	mdanderson.org	37	13	113772845	113772845	+	Silent	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr13:113772845G>T	ENST00000375581.3	+	9	959	c.924G>T	c.(922-924)ctG>ctT	p.L308L	F7_ENST00000346342.3_Silent_p.L286L|F7_ENST00000541084.1_Silent_p.L239L	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	308	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	TGCTCCGCCTGCACCAGCCCG	0.662																																					p.L308L													.	.			0			c.G924T												85.0	65.0	72.0					13																	113772845		2202	4300	6502	SO:0001819	synonymous_variant	2155	exon9			CCGCCTGCACCAG		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.924G>T	13.37:g.113772845G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_000131	28	0.00	0	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Silent	SNP	ENST00000375581.3	37	CCDS9528.1																																																																																					0.662	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000045838.4		NM_000131	
PSMB5	5693	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	23504076	23504076	+	Silent	SNP	G	G	A			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr14:23504076G>A	ENST00000361611.6	-	1	278	c.15C>T	c.(13-15)agC>agT	p.S5S	PSMB5_ENST00000493471.2_Silent_p.S5S|PSMB5_ENST00000460922.2_Silent_p.S5S|AL132780.1_ENST00000385031.1_RNA|PSMB5_ENST00000425762.2_Intron	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	5				LAS -> HEG (in Ref. 6; BC004146). {ECO:0000305}.|LASV -> IRGR (in Ref. 8; BAA06097). {ECO:0000305}.	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.S5R(2)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	TCTCCAACACGCTGGCAAGCG	0.572																																					p.S5S													PSMB5_ENST00000493471,NS,carcinoma,0,2	PSMB5_ENST00000493471	0	2	2	Substitution - Missense(2)	kidney(2)	c.C15T												37.0	36.0	36.0					14																	23504076		2203	4300	6503	SO:0001819	synonymous_variant	5693	exon1			CAACACGCTGGCA	D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.15C>T	14.37:g.23504076G>A			Somatic	70	0	0		WXS	Illumina HiSeq	.	67	0.09	6	NM_001144932	222	0.06	13	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Silent	SNP	ENST00000361611.6	37	CCDS9584.1																																																																																					0.572	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071695.4		NM_002797	
NFATC4	4776	mdanderson.org	37	14	24841809	24841809	+	Splice_Site	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr14:24841809G>T	ENST00000250373.4	+	3	1500	c.1359G>T	c.(1357-1359)aaG>aaT	p.K453N	NFATC4_ENST00000556279.1_Splice_Site_p.K485N|NFATC4_ENST00000555802.1_5'Flank|NFATC4_ENST00000539237.2_Splice_Site_p.K485N|NFATC4_ENST00000554050.1_Splice_Site_p.K453N|NFATC4_ENST00000555393.1_5'Flank|NFATC4_ENST00000554591.1_Splice_Site_p.K516N|NFATC4_ENST00000554473.1_5'Flank|NFATC4_ENST00000556759.1_5'Flank|NFATC4_ENST00000555453.1_Splice_Site_p.K441N|NFATC4_ENST00000422617.3_Splice_Site_p.K441N|NFATC4_ENST00000555167.1_5'Flank|NFATC4_ENST00000553708.1_Splice_Site_p.K453N|NFATC4_ENST00000424781.2_Splice_Site_p.K466N|NFATC4_ENST00000553879.1_Splice_Site_p.K383N|NFATC4_ENST00000557767.1_5'Flank|NFATC4_ENST00000555590.1_Splice_Site_p.K466N|NFATC4_ENST00000413692.2_Splice_Site_p.K516N|NFATC4_ENST00000553469.1_Splice_Site_p.K485N|NFATC4_ENST00000554966.1_Splice_Site_p.K466N|NFATC4_ENST00000557451.1_Splice_Site_p.K383N|NFATC4_ENST00000554344.1_Splice_Site_p.K383N|NFATC4_ENST00000556169.1_Splice_Site_p.K441N|NFATC4_ENST00000554661.1_Splice_Site_p.K383N	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	453	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CCGTAGTCAAGGTAAAGGACA	0.592																																					p.K516N													.	.			0			c.G1548T												39.0	34.0	36.0					14																	24841809		2203	4300	6503	SO:0001630	splice_region_variant	4776	exon4			AGTCAAGGTAAAG	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1359+1G>T	14.37:g.24841809G>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_001198967	11	0.00	0	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	37	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126902	0.77549	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.01	5.01	0.66863	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.67951	0.2948	M	0.70275	2.135	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.996;0.997;0.994;0.997;0.994;0.994;0.999;0.999;0.999;0.999;0.994;0.994;0.999;0.994;0.997	T	0.71318	-0.4629	10	0.87932	D	0	-10.5245	15.8646	0.79055	0.0:0.0:1.0:0.0	.	441;441;485;485;466;466;466;516;516;441;383;485;430;516;453	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-12;Q14934-5;B4DU09;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	N	516;516;466;466;466;485;485;485;453;453;453;383;383;383;441;383;441;441	ENSP00000388910:K516N;ENSP00000452039:K516N;ENSP00000451224:K466N;ENSP00000450644:K466N;ENSP00000388668:K466N;ENSP00000439350:K485N;ENSP00000452270:K485N;ENSP00000451502:K485N;ENSP00000451151:K453N;ENSP00000250373:K453N;ENSP00000450590:K453N;ENSP00000452349:K383N;ENSP00000450469:K383N;ENSP00000450733:K383N;ENSP00000451454:K441N;ENSP00000451284:K383N;ENSP00000396788:K441N;ENSP00000450686:K441N	ENSP00000250373:K453N	K	+	3	2	NFATC4	23911649	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	6.214000	0.72200	2.603000	0.88011	0.655000	0.94253	AAG			0.592	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000073206.6		NM_004554	Missense_Mutation
SYNE2	23224	mdanderson.org	37	14	64421577	64421577	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr14:64421577A>G	ENST00000344113.4	+	8	943	c.731A>G	c.(730-732)gAg>gGg	p.E244G	SYNE2_ENST00000358025.3_Missense_Mutation_p.E244G|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000341472.5_Missense_Mutation_p.E244G|SYNE2_ENST00000554584.1_Missense_Mutation_p.E244G|SYNE2_ENST00000356081.3_Missense_Mutation_p.E244G	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	244	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AATCTGAGAGAGGCCTTCAGA	0.398																																					p.E244G													.	.			0			c.A731G												126.0	109.0	114.0					14																	64421577		1842	4093	5935	SO:0001583	missense	23224	exon8			TGAGAGAGGCCTT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.731A>G	14.37:g.64421577A>G	ENSP00000341781:p.Glu244Gly		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_182914	0		0	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	13.17	2.156326	0.38021	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000341472;ENST00000356081;ENST00000554584;ENST00000261678	D;D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59;-3.59	5.19	5.19	0.71726	Calponin homology domain (5);	0.239623	0.28544	N	0.014968	D	0.97182	0.9079	M	0.85462	2.755	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.992	D;D;P	0.66847	0.947;0.913;0.813	D	0.97860	1.0280	10	0.72032	D	0.01	.	15.3513	0.74389	1.0:0.0:0.0:0.0	.	244;244;244	Q8WXH0;Q8WXH0-2;Q8WXH0-8	SYNE2_HUMAN;.;.	G	244	ENSP00000350719:E244G;ENSP00000341781:E244G;ENSP00000344528:E244G;ENSP00000348382:E244G;ENSP00000452570:E244G	ENSP00000261678:E244G	E	+	2	0	SYNE2	63491330	1.000000	0.71417	0.996000	0.52242	0.033000	0.12548	8.854000	0.92228	2.082000	0.62665	0.528000	0.53228	GAG			0.398	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276994.2		NM_182914	
TJP1	7082	mdanderson.org	37	15	29997939	29997939	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr15:29997939C>T	ENST00000346128.6	-	26	5335	c.4861G>A	c.(4861-4863)Gtg>Atg	p.V1621M	TJP1_ENST00000400011.2_Missense_Mutation_p.V1545M|TJP1_ENST00000545208.2_Missense_Mutation_p.V1541M|TJP1_ENST00000356107.6_Missense_Mutation_p.V1621M	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1621					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCCTCTTCCACAGCTGAAGGA	0.438																																					p.V1621M	Melanoma(77;681 1843 6309 6570)												.	.			0			c.G4861A												91.0	87.0	88.0					15																	29997939		1951	4151	6102	SO:0001583	missense	7082	exon26			CTTCCACAGCTGA		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.4861G>A	15.37:g.29997939C>T	ENSP00000281537:p.Val1621Met		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	70	0.06	4	NM_003257	106	0.00	0	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.328003	0.41197	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.55234	0.53;0.53	5.39	2.11	0.27256	.	0.238872	0.35151	N	0.003404	T	0.37972	0.1023	L	0.44542	1.39	0.80722	D	1	B;B;B;B	0.12013	0.001;0.005;0.002;0.001	B;B;B;B	0.12837	0.003;0.008;0.005;0.004	T	0.23904	-1.0175	10	0.51188	T	0.08	.	3.4564	0.07516	0.4874:0.3029:0.1225:0.0873	.	1614;1541;1621;1545	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	M	1621;1545;1621;1541;1541	ENSP00000281537:V1621M;ENSP00000382890:V1545M	ENSP00000281537:V1621M	V	-	1	0	TJP1	27785231	0.851000	0.29673	0.993000	0.49108	0.998000	0.95712	1.382000	0.34374	0.611000	0.30052	0.655000	0.94253	GTG			0.438	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000268237.3		NM_003257	
UACA	55075	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	70960705	70960706	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr15:70960705_70960706delTG	ENST00000322954.6	-	16	2502_2503	c.2317_2318delCA	c.(2317-2319)caafs	p.Q773fs	UACA_ENST00000560441.1_Frame_Shift_Del_p.Q758fs|UACA_ENST00000379983.2_Frame_Shift_Del_p.Q760fs|UACA_ENST00000539319.1_Frame_Shift_Del_p.Q664fs	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	773					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TGTATATTTTTGTGTTACATCT	0.317																																					p.773_773del													.	UACA	235		0			c.2318_2319del																																									SO:0001589	frameshift_variant	55075	exon16			TATTTTTGTGTTA	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.2317_2318delCA	15.37:g.70960707_70960708delTG	ENSP00000314556:p.Gln773fs		Somatic	46	0	0		WXS	Illumina HiSeq	.	66	0.53	35	NM_018003	13	0.00	0	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Frame_Shift_Del	DEL	ENST00000322954.6	37	CCDS10235.1																																																																																					0.317	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257199.2			
E4F1	1877	mdanderson.org	37	16	2279574	2279574	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr16:2279574G>T	ENST00000301727.4	+	3	361	c.313G>T	c.(313-315)Gtg>Ttg	p.V105L	E4F1_ENST00000564139.1_Missense_Mutation_p.V105L|E4F1_ENST00000565090.1_Missense_Mutation_p.V105L	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	105					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						TTGGCAGGTGGTGCCGGCAGC	0.602																																					p.V105L													.	.			0			c.G313T												101.0	114.0	110.0					16																	2279574		2198	4300	6498	SO:0001583	missense	1877	exon3			CAGGTGGTGCCGG	U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.313G>T	16.37:g.2279574G>T	ENSP00000301727:p.Val105Leu		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_004424	11	0.00	0	A8K2R4|O00146	Missense_Mutation	SNP	ENST00000301727.4	37	CCDS32370.1	.	.	.	.	.	.	.	.	.	.	G	2.505	-0.314397	0.05422	.	.	ENSG00000167967	ENST00000301727	T	0.07444	3.19	4.62	3.66	0.41972	.	0.255560	0.32287	N	0.006310	T	0.09113	0.0225	L	0.48642	1.525	0.35469	D	0.797196	B;B;B	0.09022	0.001;0.002;0.0	B;B;B	0.09377	0.004;0.003;0.001	T	0.08617	-1.0713	10	0.42905	T	0.14	-9.6934	11.9284	0.52833	0.0:0.1755:0.8245:0.0	.	101;105;105	E9PFZ8;E7EMF7;Q66K89	.;.;E4F1_HUMAN	L	105	ENSP00000301727:V105L	ENSP00000301727:V105L	V	+	1	0	E4F1	2219575	1.000000	0.71417	0.966000	0.40874	0.065000	0.16274	3.750000	0.55157	1.159000	0.42565	-0.304000	0.09214	GTG			0.602	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435225.1		NM_004424	
TNRC6A	27327	mdanderson.org	37	16	24788654	24788654	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr16:24788654G>T	ENST00000395799.3	+	5	693	c.564G>T	c.(562-564)gaG>gaT	p.E188D	TNRC6A_ENST00000315183.7_Missense_Mutation_p.E188D	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	188	Interaction with argonaute family proteins.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ATAACGGAGAGGTGCAGAACA	0.413																																					p.E188D													.	.			0			c.G564T												124.0	125.0	124.0					16																	24788654		2034	4212	6246	SO:0001583	missense	27327	exon5			CGGAGAGGTGCAG	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.564G>T	16.37:g.24788654G>T	ENSP00000379144:p.Glu188Asp		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_014494	9	0.00	0	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698285	0.30142	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.12147	2.71;2.72	5.84	4.87	0.63330	.	0.149703	0.47852	D	0.000219	T	0.09024	0.0223	L	0.34521	1.04	0.80722	D	1	P	0.47762	0.9	B	0.38985	0.287	T	0.17868	-1.0355	10	0.14252	T	0.57	-4.9344	9.8888	0.41276	0.2045:0.0:0.7955:0.0	.	188	Q8NDV7	TNR6A_HUMAN	D	188	ENSP00000326900:E188D;ENSP00000379144:E188D	ENSP00000326900:E188D	E	+	3	2	TNRC6A	24696155	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.744000	0.38268	2.758000	0.94735	0.591000	0.81541	GAG			0.413	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000214081.1		NM_020847	
GFOD2	81577	mdanderson.org	37	16	67709829	67709829	+	Silent	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr16:67709829G>T	ENST00000268797.7	-	3	732	c.387C>A	c.(385-387)gcC>gcA	p.A129A	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	129					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TGCGCACGAAGGCAGGCAGGA	0.592																																					p.A129A													.	.			0			c.C387A												104.0	83.0	90.0					16																	67709829		2198	4300	6498	SO:0001819	synonymous_variant	81577	exon3			CACGAAGGCAGGC	AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.387C>A	16.37:g.67709829G>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_030819	21	0.00	0	Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Silent	SNP	ENST00000268797.7	37	CCDS10845.1																																																																																					0.592	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268868.2		NM_030819	
ZCCHC14	23174	mdanderson.org	37	16	87451220	87451220	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr16:87451220G>T	ENST00000268616.4	-	8	1035	c.818C>A	c.(817-819)gCc>gAc	p.A273D		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	273							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GGTCCGGTAGGCCAGGGCTGA	0.672																																					p.A273D													.	.			0			c.C818A												112.0	125.0	120.0					16																	87451220		2198	4300	6498	SO:0001583	missense	23174	exon8			CGGTAGGCCAGGG	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.818C>A	16.37:g.87451220G>T	ENSP00000268616:p.Ala273Asp		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_015144	4	0.00	0	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598203	0.46318	.	.	ENSG00000140948	ENST00000268616	T	0.18960	2.18	5.77	5.77	0.91146	.	0.414096	0.26631	N	0.023312	T	0.15955	0.0384	L	0.27053	0.805	0.32054	N	0.596574	P;P	0.51933	0.949;0.93	B;B	0.42319	0.361;0.383	T	0.08126	-1.0737	10	0.52906	T	0.07	-19.3189	10.6353	0.45560	0.0696:0.133:0.7973:0.0	.	273;273	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	D	273	ENSP00000268616:A273D	ENSP00000268616:A273D	A	-	2	0	ZCCHC14	86008721	0.994000	0.37717	1.000000	0.80357	0.469000	0.32828	3.815000	0.55651	2.884000	0.98904	0.655000	0.94253	GCC			0.672	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269107.1		NM_015144	
TUBB8P7	197331	broad.mit.edu	37	16	90161723	90161723	+	RNA	SNP	T	T	C			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr16:90161723T>C	ENST00000564451.1	+	0	1076				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7																		TTCTCATTAGTAAGATCCGGG	0.572																																					.													.	.			0			.																																											0	.			CATTAGTAAGATC			16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90161723T>C			Somatic	176	0.0056818182	1		WXS	Illumina HiSeq	Phase_I	167	0.05	9	.	6	0.00	0		RNA	SNP	ENST00000564451.1	37																																																																																						0.572	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000420856.1		NG_002334	
BCAS3	54828	broad.mit.edu;mdanderson.org	37	17	59001819	59001819	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr17:59001819G>T	ENST00000390652.5	+	13	1076	c.1045G>T	c.(1045-1047)Gcc>Tcc	p.A349S	BCAS3_ENST00000589222.1_Missense_Mutation_p.A349S|BCAS3_ENST00000585744.1_Missense_Mutation_p.A120S|BCAS3_ENST00000588462.1_Missense_Mutation_p.A349S|BCAS3_ENST00000407086.3_Missense_Mutation_p.A349S|BCAS3_ENST00000588874.1_Missense_Mutation_p.A120S|BCAS3_ENST00000408905.3_Missense_Mutation_p.A349S	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CCACTTCCCTGCCCATGAGAA	0.388																																					p.A349S													.	BCAS3	90		0			c.G1045T												151.0	148.0	149.0					17																	59001819		1961	4166	6127	SO:0001583	missense	54828	exon13			TTCCCTGCCCATG	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1045G>T	17.37:g.59001819G>T	ENSP00000375067:p.Ala349Ser		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	74	0.05	4	NM_001099432	8	0.00	0		Missense_Mutation	SNP	ENST00000390652.5	37	CCDS45749.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857359	0.91433	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905;ENST00000360207;ENST00000405217	T;T;T	0.07908	3.15;3.15;3.15	5.74	5.74	0.90152	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.32615	0.0835	M	0.76727	2.345	0.58432	D	0.999994	D;D;D;D;D	0.76494	0.999;0.989;0.996;0.997;0.999	D;D;D;D;D	0.87578	0.998;0.951;0.99;0.994;0.994	T	0.01312	-1.1388	10	0.87932	D	0	.	19.9135	0.97033	0.0:0.0:1.0:0.0	.	140;154;349;349;349	B4E3M9;Q70WD9;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;BCAS3_HUMAN;.	S	349;349;349;349;141;154	ENSP00000375067:A349S;ENSP00000385323:A349S;ENSP00000386173:A349S	ENSP00000353336:A141S	A	+	1	0	BCAS3	56356601	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.090000	0.89526	2.711000	0.92665	0.591000	0.81541	GCC			0.388	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000449578.1		NM_017679	
HMG20B	10362	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	3575627	3575638	+	In_Frame_Del	DEL	GGAGAAGATCCA	GGAGAAGATCCA	-			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	GGAGAAGATCCA	GGAGAAGATCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:3575627_3575638delGGAGAAGATCCA	ENST00000333651.6	+	5	516_527	c.441_452delGGAGAAGATCCA	c.(439-453)acggagaagatccag>acg	p.EKIQ148del	MFSD12_ENST00000591878.1_5'Flank	NM_006339.2	NP_006330.2	Q9P0W2	HM20B_HUMAN	high mobility group 20B	148					blood coagulation (GO:0007596)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of protein sumoylation (GO:0033234)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATGTGCACGGAGAAGATCCAGGAGAAGAAG	0.604																																					p.147_151del													.	HMG20B	12		0			c.440_451del																																									SO:0001651	inframe_deletion	10362	exon5			GTGCACGGAGAAG	BC003505	CCDS45919.1	19p13.3	2011-07-01	2011-04-05		ENSG00000064961	ENSG00000064961		"""High mobility group / Non-canonical"""	5002	protein-coding gene	gene with protein product	"""HMG box domain containing 2"""	605535	"""high-mobility group 20B"""			10773667	Standard	NM_006339		Approved	SOXL, HMGX2, BRAF35, SMARCE1r, BRAF25, HMGXB2	uc002lya.3	Q9P0W2	OTTHUMG00000150437	ENST00000333651.6:c.441_452delGGAGAAGATCCA	19.37:g.3575627_3575638delGGAGAAGATCCA	ENSP00000328269:p.Glu148_Gln151del		Somatic	26	0	0		WXS	Illumina HiSeq	.	32	0.34	11	NM_006339	107	0.00	0	A6NMS5|D6W616|Q6IBP8|Q8NBD5|Q9HD21|Q9Y491|Q9Y4A2	In_Frame_Del	DEL	ENST00000333651.6	37	CCDS45919.1																																																																																					0.604	HMG20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318088.1		NM_006339	
SPC24	147841	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	11259855	11259855	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:11259855G>A	ENST00000592540.1	-	2	251	c.220C>T	c.(220-222)Cac>Tac	p.H74Y		NM_182513.2	NP_872319.1	Q8NBT2	SPC24_HUMAN	SPC24, NDC80 kinetochore complex component	74	Interaction with the N-terminus of SPBC25.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|Ndc80 complex (GO:0031262)|nucleolus (GO:0005730)|nucleus (GO:0005634)				autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	5						CCTCCCTGGTGCACCTGCTCC	0.602																																					p.H74Y													.	SPC24	8		0			c.C220T												20.0	23.0	22.0					19																	11259855		1968	3919	5887	SO:0001583	missense	147841	exon2			CCTGGTGCACCTG	AK075287	CCDS45974.1	19p13.2	2013-06-05	2013-06-05	2007-03-02		ENSG00000161888			26913	protein-coding gene	gene with protein product		609394	"""spindle pole body component 24 homolog (S. cerevisiae)"", ""SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	SPBC24			Standard	NM_182513		Approved	FLJ90806	uc002mql.2	Q8NBT2		ENST00000592540.1:c.220C>T	19.37:g.11259855G>A	ENSP00000465075:p.His74Tyr		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	64	0.08	5	NM_182513	27	0.04	1	B4DZZ7|C9JGC4	Missense_Mutation	SNP	ENST00000592540.1	37	CCDS45974.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.283474	0.23392	.	.	ENSG00000161888	ENST00000423327	.	.	.	4.36	2.16	0.27623	.	0.890661	0.09802	N	0.753956	T	0.34978	0.0916	L	0.51422	1.61	0.09310	N	0.999997	B	0.27192	0.171	B	0.20577	0.03	T	0.27400	-1.0075	9	0.54805	T	0.06	-1.7184	6.8768	0.24151	0.0959:0.0:0.7306:0.1736	.	74	Q8NBT2	SPC24_HUMAN	Y	74	.	ENSP00000397131:H74Y	H	-	1	0	SPC24	11120855	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	0.451000	0.21779	0.282000	0.22254	0.557000	0.71058	CAC			0.602	SPC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453059.1		NM_182513	
CPAMD8	27151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17039937	17039937	+	Silent	SNP	A	A	G			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:17039937A>G	ENST00000443236.1	-	24	3131	c.3100T>C	c.(3100-3102)Ttg>Ctg	p.L1034L		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	987						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCAGAAGACAAGGCCACACGG	0.597																																					p.L1034L													.	.			0			c.T3100C												47.0	51.0	50.0					19																	17039937		2096	4218	6314	SO:0001819	synonymous_variant	27151	exon24			AAGACAAGGCCAC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3100T>C	19.37:g.17039937A>G			Somatic	30	0	0		WXS	Illumina HiSeq	.	23	0.43	10	NM_015692	3	0.33	1	Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	CCDS42519.1																																																																																					0.597	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257531.2		NM_015692	
ZNF675	171392	broad.mit.edu	37	19	23836584	23836584	+	Missense_Mutation	SNP	G	G	T	rs200866824		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:23836584G>T	ENST00000359788.4	-	4	1319	c.1151C>A	c.(1150-1152)aCg>aAg	p.T384K	ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000596211.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	384					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CCTATGTTCCGTAAGATTTGA	0.383																																					p.T384K													.	ZNF675	88		0			c.C1151A												69.0	68.0	68.0					19																	23836584		2203	4300	6503	SO:0001583	missense	171392	exon4			TGTTCCGTAAGAT		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1151C>A	19.37:g.23836584G>T	ENSP00000352836:p.Thr384Lys		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	64	0.05	3	NM_138330	14	0.00	0	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	9.810	1.182967	0.21870	.	.	ENSG00000197372	ENST00000359788	T	0.07688	3.17	0.225	0.225	0.15325	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03871	0.0109	N	0.01493	-0.835	0.09310	N	1	D	0.53619	0.961	P	0.46208	0.507	T	0.42666	-0.9438	9	0.62326	D	0.03	.	7.9744	0.30147	1.0E-4:0.0:0.9999:0.0	.	384	Q8TD23	ZN675_HUMAN	K	384	ENSP00000352836:T384K	ENSP00000352836:T384K	T	-	2	0	ZNF675	23628424	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	-1.245000	0.02899	0.300000	0.22699	0.305000	0.20034	ACG			0.383	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466433.1		NM_138330	
PAPL	390928	mdanderson.org	37	19	39589612	39589612	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:39589612G>T	ENST00000331256.5	+	4	609	c.335G>T	c.(334-336)gGc>gTc	p.G112V	PAPL_ENST00000594229.1_Missense_Mutation_p.G112V	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		112						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)										TATCGCTGTGGCAGTGCGCAG	0.657																																					p.G112V													.	.			0			c.G335T												39.0	43.0	41.0					19																	39589612		2203	4300	6503	SO:0001583	missense	0	exon4			GCTGTGGCAGTGC																												ENST00000331256.5:c.335G>T	19.37:g.39589612G>T	ENSP00000327557:p.Gly112Val		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_001004318	0		0	B2RN68	Missense_Mutation	SNP	ENST00000331256.5	37	CCDS33018.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537814	0.85917	.	.	ENSG00000183760	ENST00000331256	D	0.88354	-2.37	5.01	5.01	0.66863	Purple acid phosphatase-like, N-terminal (1);Purple acid phosphatase, N-terminal (1);	0.062462	0.64402	D	0.000006	D	0.96137	0.8741	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97392	0.9990	10	0.87932	D	0	-32.1863	15.7812	0.78260	0.0:0.0:1.0:0.0	.	112	Q6ZNF0	PAPL_HUMAN	V	112	ENSP00000327557:G112V	ENSP00000327557:G112V	G	+	2	0	AC011443.1	44281452	1.000000	0.71417	0.997000	0.53966	0.864000	0.49448	8.861000	0.92277	2.302000	0.77476	0.563000	0.77884	GGC			0.657	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463810.1			
PPM1N	147699	mdanderson.org	37	19	46003744	46003744	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:46003744G>T	ENST00000451287.2	+	3	1088	c.1088G>T	c.(1087-1089)aGc>aTc	p.S363I	PPM1N_ENST00000456399.2_Missense_Mutation_p.S45I|PPM1N_ENST00000324688.4_3'UTR|PPM1N_ENST00000401705.1_Missense_Mutation_p.S45I|PPM1N_ENST00000401593.1_Missense_Mutation_p.S45I|PPM1N_ENST00000396735.2_Missense_Mutation_p.S45I|PPM1N_ENST00000396737.2_Missense_Mutation_p.S45I|PPM1N_ENST00000396736.2_Missense_Mutation_p.S45I	NM_001080401.1	NP_001073870.1	Q8N819	PPM1N_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)	363							magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)	9						AAGCCCCCCAGCCTGAACACA	0.577																																					p.S363I													.	.			0			c.G1088T												23.0	24.0	23.0					19																	46003744		1919	4119	6038	SO:0001583	missense	147699	exon3			CCCCCAGCCTGAA	AK097444	CCDS46115.1	19q13.32	2012-04-17			ENSG00000213889	ENSG00000213889		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26845	protein-coding gene	gene with protein product							Standard	NM_001080401		Approved	FLJ40125	uc002pce.3	Q8N819	OTTHUMG00000140397	ENST00000451287.2:c.1088G>T	19.37:g.46003744G>T	ENSP00000397050:p.Ser363Ile		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001080401	58	0.00	0	Q6P662	Missense_Mutation	SNP	ENST00000451287.2	37	CCDS46115.1	.	.	.	.	.	.	.	.	.	.	g	12.05	1.822474	0.32237	.	.	ENSG00000213889	ENST00000401705;ENST00000456399;ENST00000396737;ENST00000451287;ENST00000396734;ENST00000396735;ENST00000401593;ENST00000402807;ENST00000396736	T	0.31769	1.48	3.55	1.35	0.21983	Protein serine/threonine phosphatase 2C, C-terminal (3);	.	.	.	.	T	0.27419	0.0673	L	0.44542	1.39	0.80722	D	1	B	0.30605	0.287	B	0.39299	0.296	T	0.13045	-1.0524	9	0.72032	D	0.01	.	4.7547	0.13077	0.123:0.2241:0.6529:0.0	.	363	Q8N819	PPM1N_HUMAN	I	45;45;45;363;363;45;45;45;45	ENSP00000397050:S363I	ENSP00000379960:S363I	S	+	2	0	PPM1N	50695584	1.000000	0.71417	0.966000	0.40874	0.568000	0.35870	2.195000	0.42677	0.482000	0.27582	0.651000	0.88453	AGC			0.577	PPM1N-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000326517.2		NM_001080401	
GLTSCR1	29998	mdanderson.org	37	19	48182836	48182836	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:48182836G>T	ENST00000396720.3	+	6	603	c.409G>T	c.(409-411)Gcg>Tcg	p.A137S	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	137										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CCTGCAGCCTGCGGATGGCGG	0.726																																					p.A137S													.	.			0			c.G409T												11.0	13.0	13.0					19																	48182836		683	1586	2269	SO:0001583	missense	29998	exon6			CAGCCTGCGGATG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.409G>T	19.37:g.48182836G>T	ENSP00000379946:p.Ala137Ser		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_015711	1	0.00	0	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	37	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	G	8.699	0.909213	0.17833	.	.	ENSG00000063169	ENST00000396720	T	0.30448	1.53	4.77	4.77	0.60923	.	.	.	.	.	T	0.22589	0.0545	N	0.01576	-0.805	0.26715	N	0.970892	D	0.60575	0.988	P	0.56216	0.794	T	0.30297	-0.9983	9	0.29301	T	0.29	.	14.7072	0.69200	0.0:0.0:1.0:0.0	.	137	Q9NZM4	GSCR1_HUMAN	S	137	ENSP00000379946:A137S	ENSP00000379946:A137S	A	+	1	0	GLTSCR1	52874648	0.994000	0.37717	0.178000	0.23040	0.555000	0.35460	4.379000	0.59575	2.193000	0.70182	0.491000	0.48974	GCG			0.726	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465846.1		NM_015711	
ELSPBP1	64100	mdanderson.org	37	19	48522982	48522982	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:48522982G>T	ENST00000339841.2	+	5	540	c.362G>T	c.(361-363)gGg>gTg	p.G121V	ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	121					single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		TCAGAGTATGGGGGAAATTCT	0.453																																					p.G121V													.	.			0			c.G362T												77.0	73.0	75.0					19																	48522982		2203	4300	6503	SO:0001583	missense	64100	exon5			AGTATGGGGGAAA	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.362G>T	19.37:g.48522982G>T	ENSP00000340660:p.Gly121Val		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_022142	0		0	Q96RT0|Q9H4C8	Missense_Mutation	SNP	ENST00000339841.2	37	CCDS12708.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181285	0.38511	.	.	ENSG00000169393	ENST00000339841	T	0.09350	2.99	3.76	3.76	0.43208	Fibronectin, type II, collagen-binding (1);Kringle-like fold (1);	0.000000	0.51477	D	0.000092	T	0.22781	0.0550	M	0.89601	3.045	0.51482	D	0.999921	P	0.46859	0.885	B	0.44163	0.443	T	0.19418	-1.0306	10	0.72032	D	0.01	.	11.7957	0.52098	0.0:0.0:1.0:0.0	.	121	Q96BH3	ESPB1_HUMAN	V	121	ENSP00000340660:G121V	ENSP00000340660:G121V	G	+	2	0	ELSPBP1	53214794	1.000000	0.71417	0.693000	0.30195	0.319000	0.28217	3.422000	0.52749	2.030000	0.59900	0.561000	0.74099	GGG			0.453	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465207.1			
GRIN2D	2906	mdanderson.org	37	19	48945427	48945427	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr19:48945427C>T	ENST00000263269.3	+	12	2549	c.2461C>T	c.(2461-2463)Cgg>Tgg	p.R821W		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	821					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GATGCTGGAGCGGCTGTGGCT	0.547																																					p.R821W													.	.			0			c.C2461T												113.0	112.0	113.0					19																	48945427		2203	4300	6503	SO:0001583	missense	2906	exon12			CTGGAGCGGCTGT	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2461C>T	19.37:g.48945427C>T	ENSP00000263269:p.Arg821Trp		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_000836	1	0.00	0		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005312	0.74932	.	.	ENSG00000105464	ENST00000263269	T	0.28255	1.62	4.34	3.28	0.37604	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.43678	0.1258	L	0.45352	1.415	0.45567	D	0.99851	D	0.89917	1.0	D	0.70716	0.97	T	0.36040	-0.9764	10	0.66056	D	0.02	.	10.9139	0.47124	0.3402:0.6598:0.0:0.0	.	821	O15399	NMDE4_HUMAN	W	821	ENSP00000263269:R821W	ENSP00000263269:R821W	R	+	1	2	GRIN2D	53637239	0.037000	0.19845	1.000000	0.80357	0.966000	0.64601	0.367000	0.20382	1.169000	0.42739	0.456000	0.33151	CGG			0.547	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466121.1			
LHCGR	3973	mdanderson.org	37	2	48982764	48982764	+	Missense_Mutation	SNP	A	A	T	rs4539842		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr2:48982764A>T	ENST00000294954.7	-	1	68	c.47T>A	c.(46-48)cTg>cAg	p.L16Q	LHCGR_ENST00000401907.1_Missense_Mutation_p.L16Q|LHCGR_ENST00000405626.1_Missense_Mutation_p.L16Q|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.L16Q|LHCGR_ENST00000403273.1_Missense_Mutation_p.L16Q	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	16					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	cggctgcagcagcagcagcag	0.721																																					p.L16Q													.	.			0			c.T47A												1.0	3.0	2.0					2																	48982764		911	1841	2752	SO:0001583	missense	3973	exon1			TGCAGCAGCAGCA		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.47T>A	2.37:g.48982764A>T	ENSP00000294954:p.Leu16Gln		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_000233	0		0	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	A	16.68	3.191104	0.58017	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907	D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02	4.18	4.18	0.49190	.	1.158800	0.06471	N	0.731104	D	0.83594	0.5288	L	0.29908	0.895	0.28253	N	0.925194	D	0.55172	0.97	P	0.51453	0.67	T	0.72527	-0.4266	9	.	.	.	.	9.5009	0.39017	1.0:0.0:0.0:0.0	rs4539842	16	P22888	LSHR_HUMAN	Q	16	ENSP00000344301:L16Q;ENSP00000294954:L16Q;ENSP00000386033:L16Q;ENSP00000385847:L16Q;ENSP00000385406:L16Q	.	L	-	2	0	LHCGR	48836268	0.561000	0.26578	0.862000	0.33874	0.243000	0.25628	1.821000	0.39041	1.736000	0.51660	0.421000	0.28195	CTG			0.721	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251364.4		NM_000233.3	
SPRED2	200734	mdanderson.org	37	2	65541091	65541091	+	Silent	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr2:65541091G>T	ENST00000356388.4	-	6	990	c.801C>A	c.(799-801)ccC>ccA	p.P267P	SPRED2_ENST00000443619.2_Silent_p.P264P|SPRED2_ENST00000474228.1_5'Flank	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	267					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						AGTCCACGTAGGGGTAGTTGT	0.677																																					p.P267P													.	.			0			c.C801A												62.0	59.0	60.0					2																	65541091		2203	4300	6503	SO:0001819	synonymous_variant	200734	exon6			CACGTAGGGGTAG	AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.801C>A	2.37:g.65541091G>T			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_181784	23	0.00	0	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Silent	SNP	ENST00000356388.4	37	CCDS33211.1																																																																																					0.677	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000327632.1			
ARHGAP25	9938	mdanderson.org	37	2	69002529	69002529	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr2:69002529G>T	ENST00000295381.3	+	2	657	c.238G>T	c.(238-240)Gat>Tat	p.D80Y	ARHGAP25_ENST00000409202.3_Missense_Mutation_p.D80Y|ARHGAP25_ENST00000409030.3_Missense_Mutation_p.D73Y|ARHGAP25_ENST00000497079.1_Missense_Mutation_p.D73Y|ARHGAP25_ENST00000456116.2_3'UTR|ARHGAP25_ENST00000544262.1_Missense_Mutation_p.D54Y|ARHGAP25_ENST00000409220.1_Missense_Mutation_p.D73Y|ARHGAP25_ENST00000467265.1_Missense_Mutation_p.D80Y	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	80	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						CTACTACAAGGATGAAGAGGA	0.572																																					p.D80Y													.	.			0			c.G238T												91.0	96.0	94.0					2																	69002529		2203	4300	6503	SO:0001583	missense	9938	exon2			TACAAGGATGAAG	D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.238G>T	2.37:g.69002529G>T	ENSP00000295381:p.Asp80Tyr		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	46	0.09	4	NM_001166277	4	0.00	0	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	ENST00000295381.3	37		.	.	.	.	.	.	.	.	.	.	G	31	5.086308	0.94100	.	.	ENSG00000163219	ENST00000544262;ENST00000295381;ENST00000409202;ENST00000467265;ENST00000409030;ENST00000409220;ENST00000482106;ENST00000497079;ENST00000543533	T;T;T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46;2.46;2.46	5.58	5.58	0.84498	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.106421	0.64402	D	0.000006	T	0.48370	0.1496	M	0.84433	2.695	0.80722	D	1	D;P;D;D;D;D;P	0.89917	1.0;0.865;0.999;0.999;0.999;1.0;0.796	D;P;D;D;D;D;P	0.72338	0.977;0.784;0.969;0.969;0.969;0.97;0.748	T	0.53613	-0.8414	10	0.87932	D	0	.	18.1317	0.89604	0.0:0.0:1.0:0.0	.	80;54;80;73;73;73;80	E9PFQ7;B7Z8K7;P42331-4;G5E9G2;P42331-3;P42331-2;P42331	.;.;.;.;.;.;RHG25_HUMAN	Y	54;80;80;80;73;73;73;73;64	ENSP00000439917:D54Y;ENSP00000295381:D80Y;ENSP00000386911:D80Y;ENSP00000420583:D80Y;ENSP00000386863:D73Y;ENSP00000386241:D73Y;ENSP00000417139:D73Y	ENSP00000295381:D80Y	D	+	1	0	ARHGAP25	68856033	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.461000	0.97646	2.613000	0.88420	0.563000	0.77884	GAT			0.572	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_014882	
ANKRD30BL	554226	broad.mit.edu	37	2	132919171	132919171	+	Silent	SNP	A	A	G	rs199695856		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr2:132919171A>G	ENST00000409867.1	-	1	357	c.108T>C	c.(106-108)caT>caC	p.H36H	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	36										endometrium(1)|kidney(3)	4						TGAGATCCCCATGGTGAATCA	0.582																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			ATCCCCATGGTGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.108T>C	2.37:g.132919171A>G			Somatic	91	0.010989011	1		WXS	Illumina HiSeq	Phase_I	107	0.06	6	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
UBR3	130507	mdanderson.org	37	2	170734086	170734086	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr2:170734086G>T	ENST00000272793.5	+	4	977	c.927G>T	c.(925-927)gaG>gaT	p.E309D	UBR3_ENST00000418381.1_Missense_Mutation_p.E309D			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	309					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						CATATCCTGAGGATAAGCTTG	0.358																																					p.E309D													.	.			0			c.G927T												217.0	190.0	198.0					2																	170734086		692	1591	2283	SO:0001583	missense	130507	exon4			TCCTGAGGATAAG	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.927G>T	2.37:g.170734086G>T	ENSP00000272793:p.Glu309Asp		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_172070	1	0.00	0	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	37		.	.	.	.	.	.	.	.	.	.	G	13.15	2.151042	0.38021	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.54866	0.55;0.55	5.58	3.78	0.43462	.	.	.	.	.	T	0.57184	0.2036	L	0.44542	1.39	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.51849	-0.8653	9	0.14252	T	0.57	.	8.636	0.33948	0.2893:0.0:0.7107:0.0	.	309	Q6ZT12	UBR3_HUMAN	D	309	ENSP00000272793:E309D;ENSP00000396068:E309D	ENSP00000272793:E309D	E	+	3	2	UBR3	170442332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.510000	0.60455	0.722000	0.32252	0.591000	0.81541	GAG			0.358	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000255290.2		NM_172070	
DLX2	1746	broad.mit.edu	37	2	172967030	172967030	+	Silent	SNP	G	G	C			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr2:172967030G>C	ENST00000234198.4	-	1	598	c.237C>G	c.(235-237)ggC>ggG	p.G79G	AC104801.1_ENST00000448117.1_lincRNA|DLX2_ENST00000466293.2_Silent_p.G79G	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	79	Poly-Gly.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GCGAgcccccgccgccgccgc	0.677																																					p.G79G	GBM(188;775 2993 11256 23072)												.	DLX2	29		0			c.C237G												20.0	23.0	22.0					2																	172967030		2191	4286	6477	SO:0001819	synonymous_variant	1746	exon1			GCCCCCGCCGCCG	U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.237C>G	2.37:g.172967030G>C			Somatic	68	0.0735294118	5		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_004405	0		0	B4DMK4|B7ZA14	Silent	SNP	ENST00000234198.4	37	CCDS2248.1																																																																																					0.677	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255368.3			
AC079305.8	0	broad.mit.edu	37	2	178042377	178042378	+	RNA	INS	-	-	TA	rs13005606|rs138520040	byFrequency	TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr2:178042377_178042378insTA	ENST00000455416.1	-	0	166																											gtatatatatgtatatatatgt	0.238																																					.													.	.			0			.																																											0	.			ATATATGTATATA																													2.37:g.178042384_178042385dupTA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	11	0.55	6	.	0		0		RNA	INS	ENST00000455416.1	37																																																																																						0.238	AC079305.8-001	KNOWN	not_organism_supported|basic	antisense	antisense		OTTHUMT00000333896.1			
SCRT2	85508	mdanderson.org	37	20	644429	644429	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr20:644429G>T	ENST00000246104.6	-	2	1387	c.810C>A	c.(808-810)tgC>tgA	p.C270*	RP5-850E9.3_ENST00000488788.2_Intron	NM_033129.3	NP_149120.1	Q9NQ03	SCRT2_HUMAN	scratch family zinc finger 2	270					negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			kidney(1)|liver(1)|ovary(1)	3						CGCACTGGCGGCAGCGGTAGT	0.701																																					p.C270X													.	.			0			c.C810A												10.0	11.0	11.0					20																	644429		2166	4254	6420	SO:0001587	stop_gained	85508	exon2			CTGGCGGCAGCGG		CCDS13006.1	20p13	2013-10-09	2013-10-09		ENSG00000215397	ENSG00000215397		"""Zinc fingers, C2H2-type"""	15952	protein-coding gene	gene with protein product			"""scratch (drosophila homolog) 2, zinc finger protein"", ""scratch homolog 2, zinc finger protein (Drosophila)"""			11274425	Standard	NM_033129		Approved	ZNF898B	uc002wec.3	Q9NQ03	OTTHUMG00000130829	ENST00000246104.6:c.810C>A	20.37:g.644429G>T	ENSP00000246104:p.Cys270*		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_033129	0		0		Nonsense_Mutation	SNP	ENST00000246104.6	37	CCDS13006.1	.	.	.	.	.	.	.	.	.	.	g	42	9.772457	0.99260	.	.	ENSG00000215397	ENST00000246104	.	.	.	3.66	3.66	0.41972	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4854	14.0792	0.64909	0.0:0.0:1.0:0.0	.	.	.	.	X	270	.	ENSP00000246104:C270X	C	-	3	2	SCRT2	592429	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.208000	0.77907	1.858000	0.53909	0.457000	0.33378	TGC			0.701	SCRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253383.2		NM_033129	
GPCPD1	56261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	5528338	5528338	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr20:5528338G>T	ENST00000379019.4	-	20	2200	c.1988C>A	c.(1987-1989)gCc>gAc	p.A663D	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	663					glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						AATGCCGTTGGCATCCACATG	0.473																																					p.A663D													.	.			0			c.C1988A												162.0	143.0	149.0					20																	5528338		2203	4300	6503	SO:0001583	missense	56261	exon20			CCGTTGGCATCCA		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.1988C>A	20.37:g.5528338G>T	ENSP00000368305:p.Ala663Asp		Somatic	61	0	0		WXS	Illumina HiSeq	.	110	0.05	5	NM_019593	22	0.00	0	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	37	CCDS13090.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.76|11.76	1.734234|1.734234	0.30684|0.30684	.|.	.|.	ENSG00000125772|ENSG00000125772	ENST00000378992;ENST00000379019|ENST00000418646	T|.	0.45276|.	0.9|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.354983|.	0.26411|.	N|.	0.024530|.	T|.	0.41119|.	0.1145|.	N|N	0.24115|0.24115	0.695|0.695	0.32930|0.32930	D|D	0.517041|0.517041	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|.	0.51076|.	-0.8751|.	10|.	0.56958|.	D|.	0.05|.	-11.6215|-11.6215	13.5022|13.5022	0.61462|0.61462	0.0:0.0:0.8038:0.1961|0.0:0.0:0.8038:0.1961	.|.	663|.	Q9NPB8|.	GPCP1_HUMAN|.	D|X	280;663|254	ENSP00000368305:A663D|.	ENSP00000368277:A280D|.	A|C	-|-	2|3	0|2	GPCPD1|GPCPD1	5476338|5476338	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.590000|0.590000	0.36582|0.36582	1.957000|1.957000	0.40392|0.40392	2.393000|2.393000	0.81446|0.81446	0.555000|0.555000	0.69702|0.69702	GCC|TGC			0.473	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077869.1		NM_019593	
ARHGAP40	343578	mdanderson.org	37	20	37258290	37258290	+	Silent	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr20:37258290G>T	ENST00000373345.4	+	5	789	c.621G>T	c.(619-621)ctG>ctT	p.L207L		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	207					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						AGTGTTCCCTGCCGGTGAGGA	0.622																																					p.L259L													.	.			0			c.G777T												27.0	34.0	32.0					20																	37258290		692	1591	2283	SO:0001819	synonymous_variant	343578	exon5			TTCCCTGCCGGTG	AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.621G>T	20.37:g.37258290G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001164431	19	0.00	0		Silent	SNP	ENST00000373345.4	37		.	.	.	.	.	.	.	.	.	.	G	8.321	0.824273	0.16678	.	.	ENSG00000124143	ENST00000243967	.	.	.	4.78	3.84	0.44239	.	.	.	.	.	T	0.59514	0.2199	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56486	-0.7971	4	.	.	.	.	9.6229	0.39732	0.0983:0.0:0.9017:0.0	.	.	.	.	S	148	.	.	A	+	1	0	ARHGAP40	36691704	1.000000	0.71417	0.999000	0.59377	0.767000	0.43475	3.301000	0.51842	1.165000	0.42670	-0.131000	0.14894	GCC			0.622	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_293123	
ZNF217	7764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	52198198	52198198	+	Silent	SNP	G	G	A			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr20:52198198G>A	ENST00000371471.2	-	2	1593	c.1168C>T	c.(1168-1170)Ctg>Ttg	p.L390L	ZNF217_ENST00000302342.3_Silent_p.L390L|ZNF217_ENST00000540425.1_5'Flank			O75362	ZN217_HUMAN	zinc finger protein 217	390					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			TGCAAGACCAGCTGGTGGTAG	0.637																																					p.L390L													.	.			0			c.C1168T												72.0	73.0	73.0					20																	52198198		2203	4300	6503	SO:0001819	synonymous_variant	7764	exon1			AGACCAGCTGGTG	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1168C>T	20.37:g.52198198G>A			Somatic	76	0	0		WXS	Illumina HiSeq	.	89	0.28	25	NM_006526	10	0.10	1	E1P5Y6|Q14DB8	Silent	SNP	ENST00000371471.2	37	CCDS13443.1																																																																																					0.637	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079757.2		NM_006526	
HRH3	11255	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	60791521	60791522	+	Frame_Shift_Ins	INS	-	-	C			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr20:60791521_60791522insC	ENST00000340177.5	-	3	1162_1163	c.878_879insG	c.(877-879)ggtfs	p.G293fs	HRH3_ENST00000317393.6_Frame_Shift_Ins_p.G293fs	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	293	Poly-Gly.				brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	CCCCACCGCCACCCCCGAGGGT	0.733																																					p.G293fs													.	HRH3	25		0			c.879_880insG																																									SO:0001589	frameshift_variant	11255	exon3			ACCGCCACCCCCG	AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.879dupG	20.37:g.60791526_60791526dupC	ENSP00000342560:p.Gly293fs		Somatic	26	0	0		WXS	Illumina HiSeq	.	40	0.43	17	NM_007232	0		0	Q4QRI7|Q9GZX2|Q9H4K8	Frame_Shift_Ins	INS	ENST00000340177.5	37	CCDS13493.1																																																																																					0.733	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079994.1		NM_007232	
ZNF70	7621	broad.mit.edu	37	22	24087226	24087226	+	Silent	SNP	A	A	G			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr22:24087226A>G	ENST00000341976.3	-	2	562	c.102T>C	c.(100-102)ccT>ccC	p.P34P		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	34					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						CCTGAAGAAAAGGGTCCCCCA	0.488																																					p.P34P													.	ZNF70	49		0			c.T102C												77.0	80.0	79.0					22																	24087226		2203	4300	6503	SO:0001819	synonymous_variant	7621	exon2			AAGAAAAGGGTCC	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.102T>C	22.37:g.24087226A>G			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	230	0.02	5	NM_021916	2	0.00	0		Silent	SNP	ENST00000341976.3	37	CCDS13812.1																																																																																					0.488	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319881.1		NM_021916	
CPSF1P1	129099	bcgsc.ca	37	22	32668450	32668450	+	RNA	SNP	C	C	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr22:32668450C>T	ENST00000434942.1	+	0	1752				RP1-90G24.6_ENST00000452181.1_lincRNA																							TCAGGAACTTCATCCTGGCAG	0.572																																					.													.	.			0			.																																											129099	.			GAACTTCATCCTG																													22.37:g.32668450C>T			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_1	19	0.47	9	.	4	0.25	1		RNA	SNP	ENST00000434942.1	37																																																																																						0.572	RP1-90G24.10-001	KNOWN	basic	antisense	antisense		OTTHUMT00000315736.1			
SLC6A20	54716	mdanderson.org	37	3	45814060	45814060	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr3:45814060G>T	ENST00000358525.4	-	5	745	c.630C>A	c.(628-630)taC>taA	p.Y210*	SLC6A20_ENST00000353278.4_Intron|SLC6A20_ENST00000456124.2_Nonsense_Mutation_p.Y210*	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	210					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		CCCTGATGAGGTAGATGATGA	0.617																																					p.Y210X													.	.			0			c.C630A												91.0	96.0	94.0					3																	45814060		2103	4216	6319	SO:0001587	stop_gained	54716	exon5			GATGAGGTAGATG	AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.630C>A	3.37:g.45814060G>T	ENSP00000346298:p.Tyr210*		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_020208	0		0	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Nonsense_Mutation	SNP	ENST00000358525.4	37	CCDS43077.1	.	.	.	.	.	.	.	.	.	.	G	34	5.363930	0.95877	.	.	ENSG00000163817	ENST00000358525;ENST00000456124;ENST00000413781	.	.	.	5.33	4.25	0.50352	.	0.139591	0.49916	D	0.000121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	12.7077	0.57070	0.1392:0.0:0.8608:0.0	.	.	.	.	X	210;210;163	.	ENSP00000346298:Y210X	Y	-	3	2	SLC6A20	45789064	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	4.154000	0.58125	2.487000	0.83934	0.563000	0.77884	TAC			0.617	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257318.3		NM_020208	
RYK	6259	broad.mit.edu	37	3	133896871	133896871	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr3:133896871G>A	ENST00000427044.2	-	12	1262	c.652C>T	c.(652-654)Ccc>Tcc	p.P218S	RYK_ENST00000296084.4_Missense_Mutation_p.P408S			P34925	RYK_HUMAN	receptor-like tyrosine kinase	404					axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			lung(1)|ovary(3)	4						ATCACCATGGGCTTTTCTCCT	0.348																																					.													.	RYK	37		0			.												90.0	80.0	83.0					3																	133896871		1805	4067	5872	SO:0001583	missense	6259	.			CCATGGGCTTTTC	S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.652C>T	3.37:g.133896871G>A	ENSP00000399527:p.Pro218Ser		Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	189	0.03	6	.	193	0.07	13	Q04696	Missense_Mutation	SNP	ENST00000427044.2	37		.	.	.	.	.	.	.	.	.	.	G	29.9	5.046977	0.93740	.	.	ENSG00000163785	ENST00000296084;ENST00000427044	T;D	0.89123	0.78;-2.47	5.55	5.55	0.83447	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.050365	0.85682	N	0.000000	D	0.95037	0.8393	M	0.82323	2.585	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.994	D	0.94793	0.7964	10	0.54805	T	0.06	-4.9281	19.5071	0.95124	0.0:0.0:1.0:0.0	.	404;407	P34925;P34925-2	RYK_HUMAN;.	S	408;218	ENSP00000296084:P408S;ENSP00000399527:P218S	ENSP00000296084:P408S	P	-	1	0	RYK	135379561	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.617000	0.88574	0.557000	0.71058	CCC			0.348	RYK-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			rescued with RNA-seq	NM_001005861	
GFM1	85476	mdanderson.org	37	3	158363548	158363548	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr3:158363548G>T	ENST00000486715.1	+	2	569	c.212G>T	c.(211-213)gGc>gTc	p.G71V	GFM1_ENST00000478576.1_Missense_Mutation_p.G71V|GFM1_ENST00000264263.5_Missense_Mutation_p.G71V	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TACTACACTGGCAGAATTGCA	0.333																																					p.G71V													.	.			0			c.G212T												123.0	125.0	124.0					3																	158363548		2203	4300	6503	SO:0001583	missense	85476	exon2			ACACTGGCAGAAT	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.212G>T	3.37:g.158363548G>T	ENSP00000419038:p.Gly71Val		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_024996	12	0.00	0		Missense_Mutation	SNP	ENST00000486715.1	37	CCDS33885.1	.	.	.	.	.	.	.	.	.	.	G	31	5.081441	0.94050	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	T;T;T	0.79247	-1.25;-1.25;-1.25	5.54	5.54	0.83059	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.94860	0.8339	H	0.99967	5.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97580	1.0110	10	0.87932	D	0	-10.4926	19.5645	0.95388	0.0:0.0:1.0:0.0	.	71;71	Q96RP9;C9IZ01	EFGM_HUMAN;.	V	71	ENSP00000419038:G71V;ENSP00000418755:G71V;ENSP00000264263:G71V	ENSP00000264263:G71V	G	+	2	0	GFM1	159846242	1.000000	0.71417	0.974000	0.42286	0.991000	0.79684	9.117000	0.94347	2.599000	0.87857	0.650000	0.86243	GGC			0.333	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352271.1		NM_024996	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	126372841	126372841	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr4:126372841A>G	ENST00000394329.3	+	9	10683	c.10670A>G	c.(10669-10671)tAt>tGt	p.Y3557C	FAT4_ENST00000335110.5_Missense_Mutation_p.Y1855C	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3557	Cadherin 34. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCCACCAGTTATTTCAGTCTG	0.488																																					p.Y3557C													.	.			0			c.A10670G												117.0	119.0	118.0					4																	126372841		2203	4300	6503	SO:0001583	missense	79633	exon9			CCAGTTATTTCAG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10670A>G	4.37:g.126372841A>G	ENSP00000377862:p.Tyr3557Cys		Somatic	102	0	0		WXS	Illumina HiSeq	.	95	0.33	31	NM_024582	0		0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	A	11.78	1.740038	0.30865	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.51817	0.69;0.69	5.91	4.69	0.59074	Cadherin (4);Cadherin-like (1);	0.000000	0.31821	U	0.007003	T	0.68183	0.2973	M	0.79926	2.475	0.58432	D	0.999995	B;D;D	0.89917	0.047;1.0;1.0	B;D;D	0.87578	0.039;0.998;0.998	T	0.68961	-0.5271	10	0.42905	T	0.14	.	12.2462	0.54572	0.8725:0.0:0.0:0.1275	.	1855;3557;3557	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	C	3557;1855	ENSP00000377862:Y3557C;ENSP00000335169:Y1855C	ENSP00000335169:Y1855C	Y	+	2	0	FAT4	126592291	1.000000	0.71417	0.047000	0.18901	0.026000	0.11368	7.337000	0.79256	1.010000	0.39314	0.533000	0.62120	TAT			0.488	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256765.2		NM_024582	
RP11-43F13.1	0	broad.mit.edu	37	5	1633228	1633229	+	RNA	INS	-	-	TCTCTCTCTTTTCC	rs535578281	byFrequency	TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr5:1633228_1633229insTCTCTCTCTTTTCC	ENST00000507841.1	-	0	198																											ACAATCATCTTCACCTCAATCC	0.525														448	0.0894569	0.1785	0.0807	5008	,	,		22694	0.005		0.0994	False		,,,				2504	0.0521				.													.	.			0			.																																											0	.			TCATCTTCACCTC																													5.37:g.1633228_1633229insTCTCTCTCTTTTCC			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	26	0.23	6	.	0		0		RNA	INS	ENST00000507841.1	37																																																																																						0.525	RP11-43F13.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000365919.1			
RP11-1023L17.1	0	bcgsc.ca	37	5	34191582	34191582	+	RNA	SNP	G	G	A	rs66520650	byFrequency	TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr5:34191582G>A	ENST00000514048.1	-	0	0																											GGTCACACCCGCTGTGAAAAG	0.637																																					.													.	.			0			.																																											0	.			ACACCCGCTGTGA																													5.37:g.34191582G>A			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_1	34	0.18	6	.	0		0		RNA	SNP	ENST00000514048.1	37																																																																																						0.637	RP11-1023L17.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000367775.1			
MCC	4163	broad.mit.edu;mdanderson.org	37	5	112418571	112418571	+	Silent	SNP	T	T	G			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr5:112418571T>G	ENST00000302475.4	-	9	1763	c.1200A>C	c.(1198-1200)acA>acC	p.T400T	MCC_ENST00000515367.2_Silent_p.T337T|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000408903.3_Silent_p.T590T	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	400					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TCAGCCGTTCTGTTTCCACCT	0.468																																					p.T590T													.	MCC	234		0			c.A1770C												252.0	207.0	222.0					5																	112418571		2202	4300	6502	SO:0001819	synonymous_variant	4163	exon11			CCGTTCTGTTTCC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.1200A>C	5.37:g.112418571T>G			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	30	0.17	5	NM_001085377	13	0.08	1	D3DT05|Q6ZR04	Silent	SNP	ENST00000302475.4	37	CCDS4111.1																																																																																					0.468	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000250736.3		NM_001085377	
PRR16	51334	mdanderson.org	37	5	120021895	120021895	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr5:120021895G>T	ENST00000407149.2	+	2	615	c.406G>T	c.(406-408)Gac>Tac	p.D136Y	PRR16_ENST00000379551.2_Missense_Mutation_p.D113Y|PRR16_ENST00000505123.1_Missense_Mutation_p.D66Y|PRR16_ENST00000446965.1_Missense_Mutation_p.D66Y			Q569H4	LARGN_HUMAN	proline rich 16	136	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		GAAGTGTGAAGACCCCAAAAG	0.507																																					p.D113Y													.	.			0			c.G337T												104.0	91.0	95.0					5																	120021895		2203	4300	6503	SO:0001583	missense	51334	exon3			TGTGAAGACCCCA	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.406G>T	5.37:g.120021895G>T	ENSP00000385118:p.Asp136Tyr		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_016644	4	0.00	0	D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	37		.	.	.	.	.	.	.	.	.	.	G	18.46	3.629584	0.67015	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	5.71	5.71	0.89125	.	0.281428	0.37669	N	0.001986	T	0.62636	0.2444	L	0.48642	1.525	0.45129	D	0.998144	D;D	0.76494	0.989;0.999	P;D	0.68483	0.858;0.958	T	0.57353	-0.7826	9	.	.	.	-1.9348	18.6986	0.91611	0.0:0.0:1.0:0.0	.	136;113	Q569H4;Q569H4-3	PRR16_HUMAN;.	Y	136;113;66;66;66	ENSP00000385118:D136Y;ENSP00000368869:D113Y;ENSP00000421256:D66Y;ENSP00000423446:D66Y;ENSP00000405491:D66Y	.	D	+	1	0	PRR16	120049794	1.000000	0.71417	0.993000	0.49108	0.728000	0.41692	3.618000	0.54188	2.709000	0.92574	0.644000	0.83932	GAC			0.507	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000371059.1		NM_016644	
SIL1	64374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	138283066	138283066	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr5:138283066G>A	ENST00000394817.2	-	10	1265	c.1126C>T	c.(1126-1128)Cag>Tag	p.Q376*	SIL1_ENST00000265195.5_Nonsense_Mutation_p.Q376*|SIL1_ENST00000515008.1_5'UTR|SIL1_ENST00000509534.1_Nonsense_Mutation_p.Q383*	NM_022464.4	NP_071909.1	Q9H173	SIL1_HUMAN	SIL1 nucleotide exchange factor	376					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CACCAGCCCTGTTCCCACAGG	0.652									Marinesco-Sjgren syndrome																												p.Q376X													.	.			0			c.C1126T												60.0	49.0	52.0					5																	138283066		2203	4300	6503	SO:0001587	stop_gained	64374	exon11	Familial Cancer Database	Marinesco-Sjogren syndrome	AGCCCTGTTCCCA	AK075177	CCDS4209.1	5q31	2013-08-21	2013-08-21		ENSG00000120725	ENSG00000120725			24624	protein-coding gene	gene with protein product		608005	"""Marinesco-Sjogren syndrome"", ""SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)"""	MSS		11101517, 12356756, 16282977	Standard	XM_006714671		Approved	BAP, ULG5	uc003ldp.3	Q9H173	OTTHUMG00000129226	ENST00000394817.2:c.1126C>T	5.37:g.138283066G>A	ENSP00000378294:p.Gln376*		Somatic	149	0	0		WXS	Illumina HiSeq	.	91	0.10	9	NM_001037633	71	0.06	4	D3DQC2|Q8N2L3	Nonsense_Mutation	SNP	ENST00000394817.2	37	CCDS4209.1	.	.	.	.	.	.	.	.	.	.	G	32	5.174701	0.94807	.	.	ENSG00000120725	ENST00000394817;ENST00000265195;ENST00000509534	.	.	.	4.84	4.84	0.62591	.	0.122584	0.56097	D	0.000030	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-20.1681	16.8731	0.86044	0.0:0.0:1.0:0.0	.	.	.	.	X	376;376;383	.	ENSP00000265195:Q376X	Q	-	1	0	SIL1	138310965	1.000000	0.71417	0.999000	0.59377	0.615000	0.37417	4.577000	0.60922	2.407000	0.81776	0.462000	0.41574	CAG			0.652	SIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251319.1		NM_022464	
CMTR1	23070	mdanderson.org	37	6	37442325	37442325	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr6:37442325G>T	ENST00000373451.4	+	18	2011	c.1847G>T	c.(1846-1848)gGc>gTc	p.G616V		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	616					7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										ACATGGGATGGCCGCCAGTCA	0.527																																					p.G616V													.	.			0			c.G1847T												70.0	66.0	67.0					6																	37442325		2203	4300	6503	SO:0001583	missense	23070	exon18			GGGATGGCCGCCA	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.1847G>T	6.37:g.37442325G>T	ENSP00000362550:p.Gly616Val		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_015050	49	0.00	0	A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	ENST00000373451.4	37	CCDS4835.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993616	0.93167	.	.	ENSG00000137200	ENST00000373451;ENST00000373420	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.66915	0.2838	M	0.80616	2.505	0.80722	D	1	P	0.45474	0.859	P	0.46825	0.528	T	0.71886	-0.4457	9	0.66056	D	0.02	-23.1202	18.9492	0.92635	0.0:0.0:1.0:0.0	.	616	Q8N1G2	MTR1_HUMAN	V	616;23	.	ENSP00000362519:G23V	G	+	2	0	FTSJD2	37550303	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.623000	0.98386	2.825000	0.97269	0.655000	0.94253	GGC			0.527	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040408.1		NM_015050	
RASA4CP	401331	hgsc.bcm.edu	37	7	44069004	44069004	+	RNA	SNP	C	C	T	rs534012990	byFrequency	TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr7:44069004C>T	ENST00000446874.1	-	0	738									RAS p21 protein activator 4C, pseudogene																		CTATGGGCCTCGCGGAGGTCC	0.716													c|||	120	0.0239617	0.0862	0.0072	5008	,	,		17115	0.0		0.001	False		,,,				2504	0.0				.													.	.			0			.																																											401331	.			GGGCCTCGCGGAG			7p13	2012-07-04			ENSG00000228903	ENSG00000228903			44185	pseudogene	pseudogene							Standard	NR_024116		Approved		uc011kbk.1		OTTHUMG00000155354		7.37:g.44069004C>T			Somatic	8	0	0		WXS	Illumina HiSeq	.	17	0.53	9	.	16	0.13	2		RNA	SNP	ENST00000446874.1	37																																																																																						0.716	RASA4CP-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000339613.1		NR_024116	
INTS4L2	644619	broad.mit.edu	37	7	65150816	65150817	+	RNA	INS	-	-	C	rs376935907		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr7:65150816_65150817insC	ENST00000430126.2	+	0	757							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		TTCATCCCTCACCCCCCCCCCC	0.465																																					.													.	.			0			.																																											0	.			TCCCTCACCCCCC	BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65150827_65150827dupC			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	35	0.17	6	.	0		0		RNA	INS	ENST00000430126.2	37																																																																																						0.465	INTS4L2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345545.2		NR_027392	
NCAPG2	54892	broad.mit.edu	37	7	158478886	158478886	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr7:158478886T>C	ENST00000409423.1	-	9	987	c.815A>G	c.(814-816)aAg>aGg	p.K272R	NCAPG2_ENST00000449727.2_Missense_Mutation_p.K272R|NCAPG2_ENST00000275830.10_Missense_Mutation_p.K64R|NCAPG2_ENST00000356309.3_Missense_Mutation_p.K272R|NCAPG2_ENST00000409339.3_Missense_Mutation_p.K272R	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	272					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CCCTGAAGCCTTTTTCCAAGC	0.244																																					p.K272R													.	NCAPG2	80		0			c.A815G												32.0	32.0	32.0					7																	158478886		1779	4041	5820	SO:0001583	missense	54892	exon8			GAAGCCTTTTTCC	BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.815A>G	7.37:g.158478886T>C	ENSP00000386569:p.Lys272Arg		Somatic	221	0.0045248869	1		WXS	Illumina HiSeq	Phase_I	317	0.01	4	NM_017760	37	0.03	1	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	ENST00000409423.1	37	CCDS43686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.89|19.89	3.911524|3.911524	0.72983|0.72983	.|.	.|.	ENSG00000146918|ENSG00000146918	ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000449727|ENST00000441982	T;T;T;T;T|.	0.43294|.	0.95;0.95;0.95;0.95;0.95|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71609|0.71609	0.3360|0.3360	M|M	0.68317|0.68317	2.08|2.08	0.51482|0.51482	D|D	0.999927|0.999927	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.998;1.0|.	T|T	0.71679|0.71679	-0.4520|-0.4520	10|5	0.46703|.	T|.	0.11|.	-32.5969|-32.5969	14.001|14.001	0.64433|0.64433	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	272;64;272|.	Q86XI2-2;E7EUH9;Q86XI2|.	.;.;CNDG2_HUMAN|.	R|G	272;272;64;272;272|74	ENSP00000348657:K272R;ENSP00000386569:K272R;ENSP00000275830:K64R;ENSP00000387007:K272R;ENSP00000388326:K272R|.	ENSP00000275830:K64R|.	K|R	-|-	2|1	0|2	NCAPG2|NCAPG2	158171647|158171647	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.407000|5.407000	0.66363|0.66363	2.107000|2.107000	0.64212|0.64212	0.533000|0.533000	0.62120|0.62120	AAG|AGG			0.244	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327111.1		NM_017760	
TGS1	96764	mdanderson.org	37	8	56723593	56723593	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr8:56723593G>T	ENST00000260129.5	+	11	2774	c.2297G>T	c.(2296-2298)tGg>tTg	p.W766L		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	766	Sufficient for catalytic activity.				7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AGCCCACCTTGGGGAGGGCCA	0.428																																					p.W766L	Esophageal Squamous(34;275 823 4842 34837 48447)												.	.			0			c.G2297T												153.0	152.0	153.0					8																	56723593		2203	4300	6503	SO:0001583	missense	96764	exon11			CACCTTGGGGAGG	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.2297G>T	8.37:g.56723593G>T	ENSP00000260129:p.Trp766Leu		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_024831	48	0.00	0	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	ENST00000260129.5	37	CCDS34894.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994015	0.93167	.	.	ENSG00000137574	ENST00000260129	T	0.44881	0.91	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.74764	0.3759	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82410	-0.0471	10	0.87932	D	0	-7.1414	18.8733	0.92325	0.0:0.0:1.0:0.0	.	766	Q96RS0	TGS1_HUMAN	L	766	ENSP00000260129:W766L	ENSP00000260129:W766L	W	+	2	0	TGS1	56886147	1.000000	0.71417	0.995000	0.50966	0.896000	0.52359	9.823000	0.99369	2.450000	0.82876	0.655000	0.94253	TGG			0.428	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378152.1		NM_024831	
PLEC	5339	mdanderson.org	37	8	144996006	144996006	+	Silent	SNP	G	G	T	rs376058402		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr8:144996006G>T	ENST00000322810.4	-	32	8563	c.8394C>A	c.(8392-8394)gcC>gcA	p.A2798A	PLEC_ENST00000527096.1_Silent_p.A2684A|PLEC_ENST00000436759.2_Silent_p.A2688A|PLEC_ENST00000345136.3_Silent_p.A2661A|PLEC_ENST00000357649.2_Silent_p.A2665A|PLEC_ENST00000356346.3_Silent_p.A2647A|PLEC_ENST00000354958.2_Silent_p.A2639A|PLEC_ENST00000398774.2_Silent_p.A2629A|PLEC_ENST00000354589.3_Silent_p.A2661A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2798	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TCAGGATGCCGGCCTCCTGCA	0.697																																					p.A2798A													.	.			0			c.C8394A												14.0	17.0	16.0					8																	144996006		2120	4217	6337	SO:0001819	synonymous_variant	5339	exon32			GATGCCGGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8394C>A	8.37:g.144996006G>T			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_201380	30	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																					0.697	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
AQP7	364	mdanderson.org	37	9	33385047	33385047	+	3'UTR	SNP	G	G	A	rs78431873		TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr9:33385047G>A	ENST00000537089.1	-	0	1385				AQP7_ENST00000377425.4_3'UTR			O14520	AQP7_HUMAN	aquaporin 7						excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GGTGGGGCAGGGTGGACTGAA	0.532																																					p.P329S													.	.			0			c.C985T												141.0	149.0	146.0					9																	33385047		2203	4300	6503	SO:0001624	3_prime_UTR_variant	364	exon8			GGGCAGGGTGGAC	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.*569C>T	9.37:g.33385047G>A			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001170	16	0.00	0	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	g	5.024	0.190207	0.09547	.	.	ENSG00000165269	ENST00000379507;ENST00000297988	D;D	0.87103	-2.21;-2.21	3.12	1.14	0.20703	.	2.905240	0.00970	N	0.003231	T	0.72078	0.3416	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.62623	-0.6815	10	0.09843	T	0.71	-3.9507	3.8049	0.08773	0.1361:0.0:0.6074:0.2565	.	329	O14520	AQP7_HUMAN	S	328;329	ENSP00000368821:P328S;ENSP00000297988:P329S	ENSP00000297988:P329S	P	-	1	0	AQP7	33375047	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.147000	0.10234	0.153000	0.19213	-0.309000	0.09137	CCT			0.532	AQP7-202	KNOWN	basic	protein_coding	protein_coding				NM_001170	
FOXE1	2304	bcgsc.ca	37	9	100616400	100616400	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr9:100616400C>G	ENST00000375123.3	+	1	865	c.204C>G	c.(202-204)caC>caG	p.H68Q		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	68					anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				CCATCGCGCACGCGCCCGAGC	0.706																																					p.H68Q													.	FOXE1	19		0			c.C204G												18.0	17.0	18.0					9																	100616400		2186	4286	6472	SO:0001583	missense	2304	exon1			CGCGCACGCGCCC	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.204C>G	9.37:g.100616400C>G	ENSP00000364265:p.His68Gln		Somatic	34	0.0294117647	1		WXS	Illumina HiSeq	Phase_1	67	0.42	28	NM_004473	0		0	O75765|Q5T109|Q99526	Missense_Mutation	SNP	ENST00000375123.3	37	CCDS35078.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.552578	0.45487	.	.	ENSG00000178919	ENST00000375123	D	0.95272	-3.66	2.95	2.95	0.34219	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.070231	0.53938	D	0.000047	D	0.85758	0.5771	N	0.02539	-0.55	0.46499	D	0.999076	B	0.33238	0.403	B	0.43658	0.426	T	0.81658	-0.0833	10	0.06891	T	0.86	.	11.7148	0.51645	0.0:1.0:0.0:0.0	.	68	O00358	FOXE1_HUMAN	Q	68	ENSP00000364265:H68Q	ENSP00000364265:H68Q	H	+	3	2	FOXE1	99656221	0.985000	0.35326	1.000000	0.80357	0.996000	0.88848	0.444000	0.21661	1.680000	0.50976	0.563000	0.77884	CAC			0.706	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053341.1			
C9orf43	257169	mdanderson.org	37	9	116187328	116187328	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chr9:116187328G>T	ENST00000288462.4	+	9	1283	c.837G>T	c.(835-837)ttG>ttT	p.L279F	C9orf43_ENST00000374165.1_Missense_Mutation_p.L279F	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	279										breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						CTGAACGTTTGAAGAAATTAC	0.408																																					p.L279F													.	.			0			c.G837T												125.0	112.0	117.0					9																	116187328		2203	4300	6503	SO:0001583	missense	257169	exon9			ACGTTTGAAGAAA	BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.837G>T	9.37:g.116187328G>T	ENSP00000288462:p.Leu279Phe		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_152786	0		0		Missense_Mutation	SNP	ENST00000288462.4	37	CCDS6796.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.215571	0.58452	.	.	ENSG00000157653	ENST00000374165;ENST00000288462	T;T	0.52057	0.68;0.68	4.11	2.23	0.28157	.	0.233957	0.22117	N	0.064386	T	0.34193	0.0889	L	0.34521	1.04	0.09310	N	1	B	0.16802	0.019	B	0.18561	0.022	T	0.25222	-1.0138	10	0.45353	T	0.12	0.9291	9.2492	0.37545	0.0:0.0:0.607:0.393	.	279	Q8TAL5	CI043_HUMAN	F	279	ENSP00000363280:L279F;ENSP00000288462:L279F	ENSP00000288462:L279F	L	+	3	2	C9orf43	115227149	0.020000	0.18652	0.008000	0.14137	0.592000	0.36648	-0.002000	0.12924	0.661000	0.30985	0.557000	0.71058	TTG			0.408	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053739.1		NM_152786	
MT-ND2	4536	hgsc.bcm.edu	37	M	1586	1586	+	5'Flank	SNP	G	G	A			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chrM:1586G>A	ENST00000361453.3	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						GTGTACTGGAAAGTGCACTTG	0.443																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			TGGAAAGTGCACT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1586G>A	Exception_encountered		Somatic	26	0	0		WXS	Illumina HiSeq	.	15	0.87	13	.	0		0	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																						0.443	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024027	
MAOA	4128	mdanderson.org	37	X	43590942	43590942	+	Splice_Site	SNP	G	G	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chrX:43590942G>T	ENST00000338702.3	+	8	920	c.797G>T	c.(796-798)tGc>tTc	p.C266F	MAOA_ENST00000542639.1_Splice_Site_p.C133F	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	266					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	GTGTTTTAGTGCAAATACGTA	0.423																																					p.C266F													.	.			0			c.G797T												107.0	80.0	89.0					X																	43590942		2203	4300	6503	SO:0001630	splice_region_variant	4128	exon8			TTTAGTGCAAATA		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.796-1G>T	X.37:g.43590942G>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	61	0.07	4	NM_000240	6	0.00	0	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	37	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.512380	0.64522	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	D;D	0.92199	-2.99;-2.99	5.81	5.81	0.92471	Amine oxidase (1);	0.093465	0.64402	D	0.000001	D	0.93262	0.7853	L	0.46157	1.445	0.50632	D	0.999889	P	0.50156	0.932	P	0.56823	0.807	D	0.93788	0.7090	10	0.87932	D	0	.	14.6047	0.68469	0.0:0.1414:0.8586:0.0	.	266	P21397	AOFA_HUMAN	F	266;133	ENSP00000340684:C266F;ENSP00000440846:C133F	ENSP00000340684:C266F	C	+	2	0	MAOA	43475886	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	5.301000	0.65727	2.452000	0.82932	0.544000	0.68410	TGC			0.423	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056300.1		NM_000240	Missense_Mutation
MAGEA12	4111	hgsc.bcm.edu;ucsc.edu	37	X	151899528	151899528	+	3'UTR	SNP	C	C	T			TCGA-YU-AA4L-01A-11D-A435-10	TCGA-YU-AA4L-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5c166720-7105-4052-bcbd-b3f546b1043b	ef89d76a-cb3c-4473-888b-99ccd7d3dd3a	g.chrX:151899528C>T	ENST00000357916.4	-	0	1428				MAGEA12_ENST00000393869.3_3'UTR|MAGEA12_ENST00000393900.3_3'UTR|CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12											breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					AATGGATTTCCCAATCTGAAT	0.323																																					.													.	.			0			.																																									SO:0001624	3_prime_UTR_variant	4111	.			GATTTCCCAATCT		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.*328G>A	X.37:g.151899528C>T			Somatic	61	0	0		WXS	Illumina HiSeq	.	77	0.43	33	.	383	0.42	162	Q9NSD3	RNA	SNP	ENST00000357916.4	37	CCDS14710.1																																																																																					0.323	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058764.1		NM_005367	
