#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SLC35E2B	728661	mdanderson.org	37	1	1601537	1601537	+	Splice_Site	SNP	G	G	T	rs373497506		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr1:1601537G>T	ENST00000378662.1	-	7	1521	c.761C>A	c.(760-762)tCg>tAg	p.S254*	RP11-345P4.7_ENST00000596308.1_RNA|SLC35E2B_ENST00000234800.6_Splice_Site_p.S254*			P0CK96	S352B_HUMAN	solute carrier family 35, member E2B	254						integral component of membrane (GO:0016021)				kidney(1)|lung(1)	2						TAATACTTACGAGAACCTGTA	0.433																																					p.S254X													.	.			0			c.C761A												219.0	182.0	193.0					1																	1601537		692	1591	2283	SO:0001630	splice_region_variant	728661	exon6			ACTTACGAGAACC		CCDS44041.1	1p36.33	2013-05-22			ENSG00000189339	ENSG00000189339		"""Solute carriers"""	33941	protein-coding gene	gene with protein product							Standard	XM_006710870		Approved		uc001ahg.4	P0CK96	OTTHUMG00000078639	ENST00000378662.1:c.761+1C>A	1.37:g.1601537G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001110781	21	0.00	0	B3KWR0|O75035|Q2TAY8|Q569F8|Q5CZA4|Q9Y3J8	Nonsense_Mutation	SNP	ENST00000378662.1	37	CCDS44041.1	.	.	.	.	.	.	.	.	.	.	g	42	9.394112	0.99158	.	.	ENSG00000189339	ENST00000378662;ENST00000234800	.	.	.	5.64	5.64	0.86602	.	0.195095	0.36778	N	0.002406	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.3204	18.681	0.91546	0.0:0.0:1.0:0.0	.	.	.	.	X	254	.	.	S	-	2	0	SLC35E2B	1591400	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.954000	0.70298	2.650000	0.89964	0.585000	0.79938	TCG			0.433	SLC35E2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000171589.1			Nonsense_Mutation
KIF1B	23095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	10394661	10394661	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr1:10394661G>A	ENST00000377086.1	+	28	3210	c.3008G>A	c.(3007-3009)cGg>cAg	p.R1003Q	KIF1B_ENST00000263934.6_Missense_Mutation_p.R957Q|KIF1B_ENST00000377081.1_Missense_Mutation_p.R1003Q			O60333	KIF1B_HUMAN	kinesin family member 1B	1003					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GGTGAAGTGCGGGGATTTCTG	0.517																																					p.R957Q													.	.			0			c.G2870A												199.0	178.0	185.0					1																	10394661		2203	4300	6503	SO:0001583	missense	23095	exon26			AAGTGCGGGGATT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3008G>A	1.37:g.10394661G>A	ENSP00000366290:p.Arg1003Gln		Somatic	75	0	0		WXS	Illumina HiSeq	.	73	0.22	16	NM_015074	9	0.11	1	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	23.0	4.361542	0.82353	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.73047	-0.71;-0.71;-0.71	5.73	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.58192	0.2105	L	0.28400	0.85	0.58432	D	0.999997	P;P;P;P;P;B	0.51240	0.8;0.931;0.943;0.9;0.93;0.048	B;B;B;B;B;B	0.38755	0.229;0.174;0.229;0.281;0.194;0.005	T	0.62872	-0.6762	10	0.48119	T	0.1	.	15.0465	0.71830	0.0682:0.0:0.9318:0.0	.	989;963;1003;977;1003;957	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	Q	1003;957;1003;1003	ENSP00000263934:R957Q;ENSP00000366290:R1003Q;ENSP00000366284:R1003Q	ENSP00000263934:R957Q	R	+	2	0	KIF1B	10317248	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.994000	0.88315	1.557000	0.49525	0.655000	0.94253	CGG			0.517	KIF1B-001	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000005102.1			
CROCC	9696	broad.mit.edu	37	1	17272075	17272075	+	Missense_Mutation	SNP	G	G	A	rs2781608		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr1:17272075G>A	ENST00000375541.5	+	15	2179	c.2110G>A	c.(2110-2112)Gcc>Acc	p.A704T	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.A704T(11)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGCCGAGAAGGCCGAGGTGGC	0.657																																					p.A704T													CROCC,NS,carcinoma,0,10	CROCC	185	10	11	Substitution - Missense(11)	kidney(7)|endometrium(1)|prostate(1)|lung(1)|central_nervous_system(1)	c.G2110A												20.0	18.0	19.0					1																	17272075		2199	4291	6490	SO:0001583	missense	9696	exon15			GAGAAGGCCGAGG	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2110G>A	1.37:g.17272075G>A	ENSP00000364691:p.Ala704Thr		Somatic	73	0.0136986301	1		WXS	Illumina HiSeq	Phase_I	81	0.05	4	NM_014675	17	0.06	1		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	202	0.0924908424908425	54	0.10975609756097561	27	0.07458563535911603	41	0.07167832167832168	80	0.10554089709762533	g	7.919	0.738064	0.15574	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.10668	2.85	5.01	4.1	0.47936	.	.	.	.	.	T	0.00300	0.0009	L	0.47716	1.5	0.30387	N	0.781339	D;P;P	0.57899	0.981;0.952;0.873	P;P;B	0.52554	0.702;0.579;0.439	T	0.02477	-1.1153	9	0.16420	T	0.52	.	13.1749	0.59621	0.0795:0.0:0.9205:0.0	rs2781608;rs3871256;rs3872330	567;7;704	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	T	704;585	ENSP00000364691:A704T	ENSP00000364691:A704T	A	+	1	0	CROCC	17144662	0.999000	0.42202	0.970000	0.41538	0.013000	0.08279	2.720000	0.47252	1.448000	0.47680	-0.215000	0.12644	GCC			0.657	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006249.2		NM_014675	
CDCP2	200008	mdanderson.org	37	1	54618525	54618525	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr1:54618525G>T	ENST00000371330.1	-	1	918	c.71C>A	c.(70-72)gCc>gAc	p.A24D	RP11-446E24.4_ENST00000525949.1_Intron|RP11-446E24.4_ENST00000311841.7_3'UTR	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	24						extracellular region (GO:0005576)				kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						ACCTTCCATGGCTTGGGCCTG	0.637																																					p.A24D													.	.			0			c.C71A												79.0	82.0	81.0					1																	54618525		2203	4300	6503	SO:0001583	missense	200008	exon1			TCCATGGCTTGGG		CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.71C>A	1.37:g.54618525G>T	ENSP00000360381:p.Ala24Asp		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_201546	0		0	Q6ZWJ3	Missense_Mutation	SNP	ENST00000371330.1	37	CCDS588.2	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159857	0.57368	.	.	ENSG00000157211	ENST00000371330	T	0.29917	1.55	4.96	2.96	0.34315	.	0.312106	0.26366	N	0.024783	T	0.27384	0.0672	L	0.36672	1.1	0.31161	N	0.704337	P	0.52316	0.952	P	0.46585	0.521	T	0.19257	-1.0311	10	0.36615	T	0.2	-25.3283	10.9167	0.47139	0.0:0.3991:0.6009:0.0	.	24	Q5VXM1	CDCP2_HUMAN	D	24	ENSP00000360381:A24D	ENSP00000360381:A24D	A	-	2	0	CDCP2	54391113	0.937000	0.31787	0.998000	0.56505	0.584000	0.36387	1.487000	0.35540	1.273000	0.44346	0.650000	0.86243	GCC			0.637	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000022209.2		NM_201546	
PGBD2	267002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	249211094	249211094	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr1:249211094C>G	ENST00000329291.5	+	3	458	c.311C>G	c.(310-312)gCa>gGa	p.A104G	PGBD2_ENST00000355360.4_Intron|PGBD2_ENST00000539153.1_Missense_Mutation_p.A101G|PGBD2_ENST00000462488.1_Intron	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	104										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGGCAGAAAGCAGTTGTGAAA	0.517																																					p.A104G													.	.			0			c.C311G												58.0	61.0	60.0					1																	249211094		2203	4300	6503	SO:0001583	missense	267002	exon3			AGAAAGCAGTTGT	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.311C>G	1.37:g.249211094C>G	ENSP00000331643:p.Ala104Gly		Somatic	52	0	0		WXS	Illumina HiSeq	.	65	0.28	18	NM_170725	30	0.47	14	B3KVR8|Q6MZF8	Missense_Mutation	SNP	ENST00000329291.5	37	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	C	8.225	0.803391	0.16397	.	.	ENSG00000185220	ENST00000329291;ENST00000539153	T;T	0.12147	2.71;2.71	3.84	-0.517	0.11947	.	.	.	.	.	T	0.09202	0.0227	L	0.43152	1.355	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.39078	-0.9631	9	0.22706	T	0.39	0.0094	2.8085	0.05434	0.2022:0.4497:0.0:0.348	.	101;104	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	G	104;101	ENSP00000331643:A104G;ENSP00000439950:A101G	ENSP00000331643:A104G	A	+	2	0	PGBD2	247177717	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.423000	0.07034	0.091000	0.17302	-0.140000	0.14226	GCA			0.517	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000097318.1			
KIAA1279	26128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70760227	70760227	+	Silent	SNP	A	A	C			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr10:70760227A>C	ENST00000361983.4	+	2	576	c.474A>C	c.(472-474)gcA>gcC	p.A158A		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	158					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						TTGAAACTGCACAGGCTTACC	0.318																																					p.A158A													.	.			0			c.A474C												128.0	131.0	130.0					10																	70760227		2203	4299	6502	SO:0001819	synonymous_variant	26128	exon2			AACTGCACAGGCT	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.474A>C	10.37:g.70760227A>C			Somatic	27	0	0		WXS	Illumina HiSeq	.	33	0.33	11	NM_015634	27	0.52	14	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Silent	SNP	ENST00000361983.4	37	CCDS7284.1																																																																																					0.318	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048370.1		NM_015634	
EXOSC1	51013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	99205531	99205531	+	Silent	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr10:99205531C>T	ENST00000370902.3	-	2	136	c.105G>A	c.(103-105)tcG>tcA	p.S35S	ZDHHC16_ENST00000370854.3_5'Flank|ZDHHC16_ENST00000345745.5_5'Flank|ZDHHC16_ENST00000353979.3_5'Flank|EXOSC1_ENST00000370886.5_Silent_p.S35S|ZDHHC16_ENST00000352634.4_5'Flank|EXOSC1_ENST00000370885.4_Silent_p.S35S|EXOSC1_ENST00000471049.1_5'UTR|ZDHHC16_ENST00000370842.2_5'Flank|ZDHHC16_ENST00000393760.1_5'Flank|ZDHHC16_ENST00000370846.4_5'Flank|EXOSC1_ENST00000485122.2_Silent_p.S35S	NM_016046.3	NP_057130.1	Q9Y3B2	EXOS1_HUMAN	exosome component 1	35					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|lung(5)	7		Renal(717;0.000147)|Colorectal(252;0.00205)|Ovarian(717;0.00965)		all cancers(201;8.29e-42)|Epithelial(162;5.7e-33)|BRCA - Breast invasive adenocarcinoma(275;0.000315)|Kidney(138;0.000832)|KIRC - Kidney renal clear cell carcinoma(50;0.00269)|STAD - Stomach adenocarcinoma(243;0.202)		CGGCAAGCGACGAAAAGATGT	0.582											OREG0020413	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S35S													.	.			0			c.G105A												39.0	41.0	40.0					10																	99205531		2203	4300	6503	SO:0001819	synonymous_variant	51013	exon2			AAGCGACGAAAAG	AF151866	CCDS7459.1	10q24	2004-03-26			ENSG00000171311	ENSG00000171311			17286	protein-coding gene	gene with protein product	"""CSL4 exosomal core protein homolog (yeast)"""	606493				11812149, 11719186	Standard	XR_246092		Approved	hCsl4p, Csl4p, CSL4, Ski4p, SKI4, CGI-108, p13	uc001kni.3	Q9Y3B2	OTTHUMG00000018854	ENST00000370902.3:c.105G>A	10.37:g.99205531C>T			Somatic	50	0	0	1341	WXS	Illumina HiSeq	.	39	0.28	11	NM_016046	74	0.42	31	B2R9B3|Q5JTH3	Silent	SNP	ENST00000370902.3	37	CCDS7459.1																																																																																					0.582	EXOSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049680.1			
BRSK2	9024	mdanderson.org	37	11	1467102	1467102	+	Silent	SNP	G	G	T	rs571857054		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr11:1467102G>T	ENST00000528841.1	+	12	1575	c.1191G>T	c.(1189-1191)gcG>gcT	p.A397A	BRSK2_ENST00000531197.1_Silent_p.A397A|BRSK2_ENST00000526678.1_Silent_p.A397A|BRSK2_ENST00000308219.9_Silent_p.A397A|BRSK2_ENST00000308230.5_Silent_p.A397A|BRSK2_ENST00000528710.1_Silent_p.A337A|BRSK2_ENST00000544817.1_Silent_p.A92A|BRSK2_ENST00000382179.1_Silent_p.A443A			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	397					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CGGTGCCTGCGCGGCGGGCCA	0.721																																					p.A443A													.	.			0			c.G1329T												28.0	35.0	33.0					11																	1467102		2140	4231	6371	SO:0001819	synonymous_variant	9024	exon12			GCCTGCGCGGCGG	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1191G>T	11.37:g.1467102G>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001256630	3	0.00	0	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Silent	SNP	ENST00000528841.1	37	CCDS58107.1																																																																																					0.721	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000393033.1		NM_003957	
HARBI1	283254	mdanderson.org	37	11	46637619	46637619	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr11:46637619G>T	ENST00000326737.3	-	2	416	c.169C>A	c.(169-171)Ctt>Att	p.L57I	ATG13_ENST00000526508.1_5'Flank|ATG13_ENST00000524625.1_5'Flank|ATG13_ENST00000528494.1_5'Flank|ATG13_ENST00000529655.1_5'Flank|ATG13_ENST00000359513.4_5'Flank|ATG13_ENST00000434074.1_5'Flank|ATG13_ENST00000451945.1_5'Flank|ATG13_ENST00000312040.4_5'Flank|ATG13_ENST00000530500.1_5'Flank	NM_173811.3	NP_776172.1	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	57						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclease activity (GO:0004518)			large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)	3						GGCCTAGAAAGATTCGCCCCC	0.488																																					p.L57I													.	.			0			c.C169A												57.0	58.0	58.0					11																	46637619		2201	4299	6500	SO:0001583	missense	283254	exon2			TAGAAAGATTCGC	AK057237	CCDS7920.1	11p11.2	2008-07-10	2008-07-01	2008-07-01	ENSG00000180423	ENSG00000180423			26522	protein-coding gene	gene with protein product		615086	"""chromosome 11 open reading frame 77"""	C11orf77		15169610, 18339812	Standard	NM_173811		Approved	FLJ32675	uc001ncy.3	Q96MB7	OTTHUMG00000166537	ENST00000326737.3:c.169C>A	11.37:g.46637619G>T	ENSP00000317743:p.Leu57Ile		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_173811	7	0.00	0	D3DQP9	Missense_Mutation	SNP	ENST00000326737.3	37	CCDS7920.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682080	0.29872	.	.	ENSG00000180423	ENST00000326737;ENST00000529192	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.52948	0.1766	L	0.48260	1.515	0.80722	D	1	P	0.46327	0.876	B	0.40702	0.338	T	0.50197	-0.8856	9	0.21540	T	0.41	-14.9709	19.1143	0.93331	0.0:0.0:1.0:0.0	.	57	Q96MB7	HARB1_HUMAN	I	57	.	ENSP00000317743:L57I	L	-	1	0	HARBI1	46594195	1.000000	0.71417	0.989000	0.46669	0.116000	0.19942	7.210000	0.77924	2.534000	0.85438	0.655000	0.94253	CTT			0.488	HARBI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390291.1		NM_173811	
CKAP5	9793	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	46819368	46819368	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr11:46819368G>T	ENST00000529230.1	-	11	1371	c.1325C>A	c.(1324-1326)gCt>gAt	p.A442D	CKAP5_ENST00000415402.1_Missense_Mutation_p.A442D|CKAP5_ENST00000312055.5_Missense_Mutation_p.A442D|CKAP5_ENST00000354558.3_Missense_Mutation_p.A442D|CKAP5_ENST00000532321.1_5'Flank			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	442					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AAGTAGTGCAGCACAAAAGGG	0.418																																					p.A442D	Ovarian(4;85 273 2202 4844 13323)												.	.			0			c.C1325A												134.0	134.0	134.0					11																	46819368		2201	4299	6500	SO:0001583	missense	9793	exon11			AGTGCAGCACAAA		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1325C>A	11.37:g.46819368G>T	ENSP00000432768:p.Ala442Asp		Somatic	151	0	0		WXS	Illumina HiSeq	.	114	0.06	7	NM_001008938	31	0.10	3	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672314	0.88348	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67915	0.2944	L	0.29908	0.895	0.80722	D	1	D;D;D	0.69078	0.969;0.997;0.996	P;D;D	0.67231	0.698;0.931;0.95	T	0.60520	-0.7247	10	0.13470	T	0.59	-9.6382	19.4344	0.94785	0.0:0.0:1.0:0.0	.	442;442;442	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	D	442	ENSP00000432768:A442D;ENSP00000395302:A442D;ENSP00000310227:A442D;ENSP00000346566:A442D	ENSP00000310227:A442D	A	-	2	0	CKAP5	46775944	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.694000	0.68272	2.600000	0.87896	0.650000	0.86243	GCT			0.418	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390679.1		NM_014756	
PGR	5241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	100933354	100933354	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr11:100933354T>A	ENST00000325455.5	-	4	3489	c.2036A>T	c.(2035-2037)cAa>cTa	p.Q679L	PGR_ENST00000534013.1_Missense_Mutation_p.Q85L|PGR_ENST00000263463.5_Intron	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	679					cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CTGTATGTCTTGACCTGGTGA	0.473																																					p.Q679L	Pancreas(124;2271 2354 21954 22882)												.	.			0			c.A2036T												229.0	205.0	213.0					11																	100933354		2203	4300	6503	SO:0001583	missense	5241	exon4			ATGTCTTGACCTG	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2036A>T	11.37:g.100933354T>A	ENSP00000325120:p.Gln679Leu		Somatic	123	0	0		WXS	Illumina HiSeq	.	102	0.12	12	NM_000926	0		0	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	T	12.98	2.100419	0.37048	.	.	ENSG00000082175	ENST00000325455;ENST00000534013	T;T	0.32988	1.43;1.43	5.6	4.45	0.53987	Nuclear hormone receptor, ligand-binding (1);	0.428918	0.26532	N	0.023849	T	0.32793	0.0841	M	0.72576	2.205	0.80722	D	1	P;B	0.45531	0.86;0.239	B;B	0.40009	0.316;0.07	T	0.08868	-1.0701	10	0.27082	T	0.32	.	12.7782	0.57461	0.0:0.0:0.1371:0.8629	.	679;60	P06401;A7LQ08	PRGR_HUMAN;.	L	679;85	ENSP00000325120:Q679L;ENSP00000436561:Q85L	ENSP00000325120:Q679L	Q	-	2	0	PGR	100438564	1.000000	0.71417	0.928000	0.36995	0.110000	0.19582	3.587000	0.53957	0.923000	0.37045	-0.313000	0.08912	CAA			0.473	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394934.1			
KMT2D	8085	hgsc.bcm.edu;mdanderson.org	37	12	49427679	49427679	+	Silent	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr12:49427679C>T	ENST00000301067.7	-	39	10808	c.10809G>A	c.(10807-10809)caG>caA	p.Q3603Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3603	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3603Q(1)|p.Q3333Q(1)									gctgctgctgctgttgttgct	0.582																																					p.Q3603Q													MLL2_ENST00000301067,NS,carcinoma,0,2	MLL2_ENST00000301067	0	2	2	Substitution - coding silent(2)	endometrium(2)	c.G10809A												10.0	10.0	10.0					12																	49427679		2174	4260	6434	SO:0001819	synonymous_variant	8085	exon39			CTGCTGCTGTTGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10809G>A	12.37:g.49427679C>T			Somatic	26	0	0		WXS	Illumina HiSeq	.	31	0.10	3	NM_003482	17	0.00	0	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																					0.582	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390183.2			
ASIC1	41	mdanderson.org	37	12	50452708	50452708	+	Silent	SNP	C	C	A	rs653576	byFrequency	TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr12:50452708C>A	ENST00000447966.2	+	2	388	c.159C>A	c.(157-159)tcC>tcA	p.S53S	ASIC1_ENST00000228468.4_Silent_p.S53S	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	53					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	TCCTGGGCTCCCTGGCTGTGC	0.622																																					p.S53S													.	.			0			c.C159A												139.0	110.0	120.0					12																	50452708		2203	4300	6503	SO:0001819	synonymous_variant	41	exon2			GGGCTCCCTGGCT	U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.159C>A	12.37:g.50452708C>A			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	62	0.03	2	NM_020039	4	0.00	0	A3KN86|E5KBL7|P78349|Q96CV2	Silent	SNP	ENST00000447966.2	37	CCDS44876.1																																																																																					0.622	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406004.2		NM_020039	
CALCOCO1	57658	hgsc.bcm.edu	37	12	54115831	54115831	+	Missense_Mutation	SNP	G	G	T	rs146731373		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr12:54115831G>T	ENST00000550804.1	-	5	647	c.587C>A	c.(586-588)aCg>aAg	p.T196K	CALCOCO1_ENST00000430117.2_Missense_Mutation_p.T163K|CALCOCO1_ENST00000262059.4_Missense_Mutation_p.T196K|CALCOCO1_ENST00000548263.1_Missense_Mutation_p.T196K|CALCOCO1_ENST00000547885.1_5'Flank			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	196					intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.T196M(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						CATCAGCTCCGTGTGCTCCTG	0.607																																					p.T196K													CALCOCO1,NS,carcinoma,0,1	CALCOCO1	0	1	1	Substitution - Missense(1)	endometrium(1)	c.C587A												79.0	65.0	69.0					12																	54115831		2203	4300	6503	SO:0001583	missense	57658	exon5			AGCTCCGTGTGCT	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.587C>A	12.37:g.54115831G>T	ENSP00000449960:p.Thr196Lys		Somatic	43	0	0		WXS	Illumina HiSeq	.	45	0.04	2	NM_020898	64	0.00	0	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Missense_Mutation	SNP	ENST00000550804.1	37	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	G	1.968	-0.437163	0.04636	.	.	ENSG00000012822	ENST00000430117;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000454332	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	4.72	2.76	0.32466	.	0.587157	0.14269	N	0.330302	T	0.63651	0.2529	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.28470	0.213;0.028;0.056;0.056;0.028;0.07	B;B;B;B;B;B	0.36092	0.217;0.056;0.087;0.087;0.056;0.142	T	0.52624	-0.8551	10	0.06757	T	0.87	-3.3206	7.8395	0.29389	0.0903:0.0:0.7522:0.1576	.	189;163;196;196;163;196	B4DG60;E9PAU0;Q9P1Z2-3;Q9P1Z2-2;E7EPK7;Q9P1Z2	.;.;.;.;.;CACO1_HUMAN	K	163;196;134;196;196;189;73	ENSP00000397189:T163K;ENSP00000262059:T196K;ENSP00000447647:T196K;ENSP00000449960:T196K	ENSP00000262059:T196K	T	-	2	0	CALCOCO1	52402098	0.000000	0.05858	0.001000	0.08648	0.138000	0.21146	0.549000	0.23329	1.124000	0.41980	0.462000	0.41574	ACG			0.607	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000407233.2		NM_020898	
MMP17	4326	mdanderson.org	37	12	132326266	132326266	+	Silent	SNP	G	G	A	rs141989989	byFrequency	TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr12:132326266G>A	ENST00000360564.1	+	5	906	c.804G>A	c.(802-804)ccG>ccA	p.P268P	MMP17_ENST00000535182.1_3'UTR|MMP17_ENST00000535291.1_Silent_p.P184P	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	268					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	TCATGCGGCCGTACTACCAGG	0.642													g|||	2	0.000399361	0.0	0.0	5008	,	,		17251	0.0		0.002	False		,,,				2504	0.0				p.P268P													.	.			0			c.G804A							A		1,4405	2.1+/-5.4	0,1,2202	81.0	68.0	72.0		804	-8.3	0.1	12	dbSNP_134	72	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	MMP17	NM_016155.4		0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308		268/604	132326266	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	4326	exon5			GCGGCCGTACTAC	X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.804G>A	12.37:g.132326266G>A			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_016155	3	0.00	0	Q14850	Silent	SNP	ENST00000360564.1	37	CCDS31927.1																																																																																			0.001		0.642	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397757.1		NM_016155	
ULK1	8408	mdanderson.org	37	12	132403798	132403798	+	Silent	SNP	G	G	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr12:132403798G>A	ENST00000321867.4	+	24	2904	c.2553G>A	c.(2551-2553)ctG>ctA	p.L851L	ULK1_ENST00000540647.1_Silent_p.L96L	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	851					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GCTTCACGCTGCTGTTCGTGC	0.682																																					p.L851L													.	.			0			c.G2553A												29.0	29.0	29.0					12																	132403798		2195	4290	6485	SO:0001819	synonymous_variant	8408	exon24			CACGCTGCTGTTC	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2553G>A	12.37:g.132403798G>A			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	14	0.21	3	NM_003565	82	0.00	0	Q9UQ28	Silent	SNP	ENST00000321867.4	37	CCDS9274.1																																																																																					0.682	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397769.3			
LMO7	4008	mdanderson.org	37	13	76391409	76391409	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr13:76391409C>T	ENST00000321797.8	+	10	2081	c.1360C>T	c.(1360-1362)Cag>Tag	p.Q454*	LMO7_ENST00000341547.4_Nonsense_Mutation_p.Q405*|LMO7_ENST00000357063.3_Nonsense_Mutation_p.Q739*|LMO7_ENST00000526202.1_Nonsense_Mutation_p.Q304*|LMO7_ENST00000465261.2_Nonsense_Mutation_p.Q454*|LMO7_ENST00000377534.3_Nonsense_Mutation_p.Q739*			Q8WWI1	LMO7_HUMAN	LIM domain 7	739					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TCAGAAATGGCAGGATGTGAG	0.393																																					p.Q454X													.	.			0			c.C1360T												111.0	105.0	107.0					13																	76391409		2203	4300	6503	SO:0001587	stop_gained	4008	exon9			AAATGGCAGGATG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.1360C>T	13.37:g.76391409C>T	ENSP00000317802:p.Gln454*		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_015842	16	0.00	0	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Nonsense_Mutation	SNP	ENST00000321797.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.433160|8.433160	0.98808|0.98808	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000447038|ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261;ENST00000497947;ENST00000489941;ENST00000525373	.|.	.|.	.|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.108661	.|0.64402	.|D	.|0.000005	T|.	0.81673|.	0.4872|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	D|.	0.83396|.	0.0020|.	3|.	.|0.72032	.|D	.|0.01	-13.9689|-13.9689	19.4824|19.4824	0.95016|0.95016	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	362|405;739;739;353;454;304;454;120;120;110	.|.	.|ENSP00000317802:Q454X	A|Q	+|+	2|1	0|0	LMO7|LMO7	75289410|75289410	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.238000|7.238000	0.78173|0.78173	2.611000|2.611000	0.88343|0.88343	0.561000|0.561000	0.74099|0.74099	GCA|CAG			0.393	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000045301.3		NM_005358	
RP11-597A11.1	0	bcgsc.ca	37	14	20138135	20138135	+	RNA	SNP	C	C	T	rs77023132		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr14:20138135C>T	ENST00000548261.1	+	0	391																											ATGACAATTACTCTCCAAGCA	0.498																																					.													.	.			0			.																																											0	.			CAATTACTCTCCA																													14.37:g.20138135C>T			Somatic	36	0.2222222222	8		WXS	Illumina HiSeq	Phase_1	42	0.43	18	.	0		0		RNA	SNP	ENST00000548261.1	37																																																																																						0.498	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
APOPT1	84334	mdanderson.org	37	14	104056568	104056568	+	Missense_Mutation	SNP	C	C	T	rs529483936		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr14:104056568C>T	ENST00000409074.2	+	5	567	c.566C>T	c.(565-567)gCc>gTc	p.A189V	APOPT1_ENST00000556253.2_3'UTR|RP11-73M18.2_ENST00000472726.2_Intron|APOPT1_ENST00000477116.1_3'UTR|APOPT1_ENST00000247618.4_Missense_Mutation_p.A176V	NM_032374.3	NP_115750.2	Q96IL0	APOP1_HUMAN	apoptogenic 1, mitochondrial	189					intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)	mitochondrion (GO:0005739)											GGAAAAGTGGCCCTGGAAAGG	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		19344	0.0		0.0	False		,,,				2504	0.001				p.A189V													.	.			0			c.C566T												165.0	167.0	167.0					14																	104056568		2203	4300	6503	SO:0001583	missense	84334	exon5			AAGTGGCCCTGGA	BC007412	CCDS9983.2	14q32.33	2012-06-28	2012-06-28	2011-09-07	ENSG00000256053	ENSG00000256053			20492	protein-coding gene	gene with protein product	"""apoptogenic protein 1"""		"""chromosome 14 open reading frame 153"", ""apoptogenic 1"""	C14orf153		16782708, 18977203	Standard	NM_032374		Approved	MGC2562, APOP-1		Q96IL0	OTTHUMG00000153929	ENST00000409074.2:c.566C>T	14.37:g.104056568C>T	ENSP00000386485:p.Ala189Val		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_032374	113	0.00	0	Q53G28	Missense_Mutation	SNP	ENST00000409074.2	37	CCDS9983.2	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512088	0.27036	.	.	ENSG00000256053;ENSG00000256053;ENSG00000256500	ENST00000409074;ENST00000440963;ENST00000247618	T;T;T	0.45276	0.9;0.9;0.9	5.66	2.85	0.33270	.	0.215910	0.37715	N	0.001961	T	0.27832	0.0685	L	0.31065	0.9	0.23254	N	0.998038	B	0.19445	0.036	B	0.15870	0.014	T	0.15407	-1.0438	10	0.36615	T	0.2	.	8.2787	0.31887	0.0:0.7491:0.0:0.2509	.	189	Q96IL0	APOP1_HUMAN	V	189;101;176	ENSP00000386485:A189V;ENSP00000388067:A101V;ENSP00000247618:A176V	ENSP00000247618:A176V	A	+	2	0	C14orf153;RP11-73M18.2	103126321	0.985000	0.35326	0.518000	0.27811	0.203000	0.24098	1.723000	0.38053	0.321000	0.23259	-0.136000	0.14681	GCC			0.498	APOPT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000333060.2		NM_032374	
PACS2	23241	mdanderson.org	37	14	105859025	105859025	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr14:105859025G>T	ENST00000325438.8	+	22	2784	c.2280G>T	c.(2278-2280)agG>agT	p.R760S	PACS2_ENST00000458164.2_Missense_Mutation_p.R775S|PACS2_ENST00000551743.1_Missense_Mutation_p.R274S|PACS2_ENST00000551801.1_Intron|PACS2_ENST00000547217.1_Missense_Mutation_p.R730S|PACS2_ENST00000430725.2_Missense_Mutation_p.R685S|PACS2_ENST00000447393.1_Missense_Mutation_p.R764S			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	760					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CTGCGGACAGGAAGAGGGACG	0.642																																					p.R775S													.	.			0			c.G2325T												85.0	73.0	77.0					14																	105859025		2195	4299	6494	SO:0001583	missense	23241	exon23			GGACAGGAAGAGG	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.2280G>T	14.37:g.105859025G>T	ENSP00000321834:p.Arg760Ser		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001100913	57	0.00	0	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	CCDS32168.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.182282	0.38511	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217;ENST00000551743	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	4.0	2.06	0.26882	.	0.169367	0.51477	D	0.000100	T	0.34803	0.0910	L	0.47190	1.495	0.49299	D	0.999773	B;B;P;P	0.40660	0.343;0.294;0.629;0.726	B;B;B;B	0.42593	0.392;0.381;0.174;0.313	T	0.05209	-1.0899	10	0.29301	T	0.29	-15.642	8.2501	0.31712	0.2885:0.0:0.7115:0.0	.	764;775;760;761	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	S	685;760;775;764;730;274	ENSP00000393524:R685S;ENSP00000321834:R760S;ENSP00000399732:R775S;ENSP00000393559:R764S;ENSP00000449525:R730S;ENSP00000449254:R274S	ENSP00000321834:R760S	R	+	3	2	PACS2	104930070	1.000000	0.71417	1.000000	0.80357	0.126000	0.20510	1.571000	0.36450	0.787000	0.33731	0.462000	0.41574	AGG			0.642	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000409209.1		XM_377355	
LTK	4058	mdanderson.org	37	15	41800323	41800323	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr15:41800323G>T	ENST00000263800.6	-	9	1289	c.1193C>A	c.(1192-1194)gCt>gAt	p.A398D	LTK_ENST00000453182.2_Missense_Mutation_p.A337D|LTK_ENST00000355166.5_Missense_Mutation_p.A337D|LTK_ENST00000561619.1_Missense_Mutation_p.A80D	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	398					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CAGGCATTCAGCCAGCTGGAG	0.572										TSP Lung(18;0.14)																											p.A398D													.	.			0			c.C1193A												125.0	104.0	111.0					15																	41800323		2203	4300	6503	SO:0001583	missense	4058	exon9			CATTCAGCCAGCT	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1193C>A	15.37:g.41800323G>T	ENSP00000263800:p.Ala398Asp		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_002344	12	0.00	0	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	ENST00000263800.6	37	CCDS10077.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190903	0.58017	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;T	0.76968	-1.06;-0.83;-1.02	4.93	3.06	0.35304	.	0.482456	0.15414	U	0.263599	T	0.77651	0.4162	L	0.44542	1.39	0.09310	N	1	D;B;P;B	0.67145	0.996;0.437;0.93;0.286	P;B;P;B	0.53649	0.731;0.143;0.721;0.16	T	0.67624	-0.5623	10	0.72032	D	0.01	.	10.2367	0.43288	0.162:0.0:0.838:0.0	.	337;337;337;398	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	D	398;337;398;337	ENSP00000347293:A337D;ENSP00000263800:A398D;ENSP00000392196:A337D	ENSP00000263800:A398D	A	-	2	0	LTK	39587615	0.442000	0.25633	0.005000	0.12908	0.955000	0.61496	2.973000	0.49264	0.675000	0.31264	0.561000	0.74099	GCT			0.572	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252690.2			
SCAPER	49855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	76668615	76668615	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr15:76668615C>A	ENST00000563290.1	-	29	3838	c.3743G>T	c.(3742-3744)cGg>cTg	p.R1248L	SCAPER_ENST00000538941.2_Missense_Mutation_p.R1002L|SCAPER_ENST00000324767.7_Missense_Mutation_p.R1248L			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	1248						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GGCCATGTGCCGGAATGCAAG	0.567																																					p.R1248L													.	.			0			c.G3743T																																									SO:0001583	missense	49855	exon28			ATGTGCCGGAATG	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.3743G>T	15.37:g.76668615C>A	ENSP00000454973:p.Arg1248Leu		Somatic	70	0	0		WXS	Illumina HiSeq	.	68	0.10	7	NM_020843	23	0.13	3	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	34	5.399685	0.96030	.	.	ENSG00000140386	ENST00000324767;ENST00000538941	T;T	0.28895	1.64;1.59	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.56529	0.1991	M	0.67953	2.075	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.46952	-0.9154	10	0.36615	T	0.2	.	20.1531	0.98091	0.0:1.0:0.0:0.0	.	1002	F5H7X8	.	L	1248;1002	ENSP00000326924:R1248L;ENSP00000442190:R1002L	ENSP00000326924:R1248L	R	-	2	0	SCAPER	74455670	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.429000	0.80309	2.767000	0.95098	0.655000	0.94253	CGG			0.567	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419698.1		NM_020843	
SLC9A3R2	9351	mdanderson.org	37	16	2089944	2089944	+	IGR	SNP	G	G	T	rs367629024		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr16:2089944G>T	ENST00000424542.2	+	0	2194				NTHL1_ENST00000219066.1_Missense_Mutation_p.P307Q|NTHL1_ENST00000562951.1_5'UTR	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2						negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)	2						CTGGGCGGCCGGGCAGAGGGC	0.652																																					p.P307Q	Ovarian(69;105 1552 17724 23473)												.	.			0			c.C920A												30.0	35.0	33.0					16																	2089944		2198	4297	6495	SO:0001628	intergenic_variant	4913	exon6			GCGGCCGGGCAGA	AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956		16.37:g.2089944G>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_002528	28	0.00	0	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Missense_Mutation	SNP	ENST00000424542.2	37	CCDS45382.1	.	.	.	.	.	.	.	.	.	.	g	13.83	2.354305	0.41700	.	.	ENSG00000065057	ENST00000219066	D	0.92595	-3.07	3.92	3.92	0.45320	DNA glycosylase (1);Endonuclease III-like, iron-sulphur cluster loop motif (1);Helix-turn-helix, base-excision DNA repair, C-terminal (1);	0.109015	0.64402	D	0.000005	D	0.95843	0.8647	M	0.86953	2.85	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.68621	0.959;0.959	D	0.95943	0.8948	10	0.54805	T	0.06	-16.9426	13.2413	0.59997	0.0:0.0:1.0:0.0	.	307;307	E5KTI5;P78549	.;NTHL1_HUMAN	Q	307	ENSP00000219066:P307Q	ENSP00000219066:P307Q	P	-	2	0	NTHL1	2029945	1.000000	0.71417	0.839000	0.33178	0.105000	0.19272	6.473000	0.73572	2.029000	0.59856	0.401000	0.26515	CCG			0.652	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434448.1			
MYH11	4629	mdanderson.org	37	16	15841974	15841974	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr16:15841974C>A	ENST00000300036.5	-	17	2219	c.2110G>T	c.(2110-2112)Gtg>Ttg	p.V704L	MYH11_ENST00000452625.2_Missense_Mutation_p.V711L|MYH11_ENST00000576790.2_Missense_Mutation_p.V704L|MYH11_ENST00000396324.3_Missense_Mutation_p.V711L	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	704	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CCTTCCAGCACCCCATTGCAC	0.627			T	CBFB	AML																																p.V711L				Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	MYH11_ENST00000396324,NS,carcinoma,+1,2	MYH11_ENST00000396324	1	2	0			c.G2131T												68.0	57.0	61.0					16																	15841974		2197	4300	6497	SO:0001583	missense	4629	exon18			CCAGCACCCCATT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2110G>T	16.37:g.15841974C>A	ENSP00000300036:p.Val704Leu		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001040114	6	0.00	0	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233205	0.79688	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	4.94	4.94	0.65067	Myosin head, motor domain (2);	0.000000	0.64402	D	0.000001	T	0.68504	0.3008	L	0.58810	1.83	0.80722	D	1	P;B;B;B;B	0.42961	0.795;0.398;0.102;0.398;0.102	B;B;B;B;B	0.38616	0.277;0.277;0.277;0.277;0.277	T	0.75326	-0.3357	10	0.87932	D	0	.	17.1766	0.86843	0.0:1.0:0.0:0.0	.	711;704;711;704;711	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	L	704;704;711;711;711	ENSP00000300036:V704L;ENSP00000345136:V704L;ENSP00000379616:V711L;ENSP00000407821:V711L	ENSP00000300036:V704L	V	-	1	0	MYH11	15749475	1.000000	0.71417	0.993000	0.49108	0.955000	0.61496	7.813000	0.86123	2.285000	0.76669	0.561000	0.74099	GTG			0.627	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252192.2		NM_001040113	
QPRT	23475	mdanderson.org	37	16	29706335	29706335	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr16:29706335G>T	ENST00000395384.4	+	2	525	c.364G>T	c.(364-366)Gtg>Ttg	p.V122L	QPRT_ENST00000219771.7_Intron|QPRT_ENST00000562473.1_Intron	NM_014298.3	NP_055113.2	Q15274	NADC_HUMAN	quinolinate phosphoribosyltransferase	122					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|protein oligomerization (GO:0051259)|quinolinate catabolic process (GO:0034213)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9					Niacin(DB00627)	CGCCGCTGCAGTGGAGGCCGC	0.721																																					p.V122L													.	.			0			c.G364T												11.0	17.0	15.0					16																	29706335		2145	4225	6370	SO:0001583	missense	23475	exon2			GCTGCAGTGGAGG	D78177	CCDS10651.1	16p11.2	2008-07-31	2008-07-31		ENSG00000103485	ENSG00000103485	2.4.2.19		9755	protein-coding gene	gene with protein product	"""nicotinate-nucleotide pyrophosphorylase (carboxylating)"""	606248				9473669	Standard	NM_014298		Approved	QPRTase	uc002dto.3	Q15274	OTTHUMG00000097770	ENST00000395384.4:c.364G>T	16.37:g.29706335G>T	ENSP00000378782:p.Val122Leu		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_014298	137	0.00	0	Q53XW7|Q96G22|Q9BSG6	Missense_Mutation	SNP	ENST00000395384.4	37	CCDS10651.1	.	.	.	.	.	.	.	.	.	.	.	2.315	-0.356915	0.05138	.	.	ENSG00000103485	ENST00000449759;ENST00000395384	T	0.34667	1.35	4.51	4.51	0.55191	Quinolinate phosphoribosyl transferase, C-terminal (2);Quinolinate phosphoribosyl transferase, N-terminal (1);	0.493203	0.19428	N	0.114519	T	0.38401	0.1039	M	0.70903	2.155	0.09310	N	0.999992	B	0.33919	0.432	B	0.38562	0.276	T	0.23762	-1.0179	10	0.17832	T	0.49	-17.583	10.3831	0.44123	0.0:0.0:0.8041:0.1958	.	122	Q15274	NADC_HUMAN	L	122	ENSP00000378782:V122L	ENSP00000378782:V122L	V	+	1	0	QPRT	29613836	0.224000	0.23674	0.030000	0.17652	0.004000	0.04260	1.387000	0.34430	2.222000	0.72286	0.546000	0.68486	GTG			0.721	QPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215011.2		NM_014298	
RPGRIP1L	23322	hgsc.bcm.edu	37	16	53682980	53682980	+	Silent	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr16:53682980G>T	ENST00000379925.3	-	16	2250	c.2200C>A	c.(2200-2202)Cga>Aga	p.R734R	RPGRIP1L_ENST00000262135.4_Silent_p.R734R|RPGRIP1L_ENST00000564374.1_Silent_p.R734R|RPGRIP1L_ENST00000563746.1_Silent_p.R734R	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	734					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				ACTCTTAATCGGAACCAGTAT	0.378																																					p.R734R													.	.			0			c.C2200A												118.0	111.0	113.0					16																	53682980		2198	4300	6498	SO:0001819	synonymous_variant	23322	exon16			TTAATCGGAACCA		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2200C>A	16.37:g.53682980G>T			Somatic	114	0	0		WXS	Illumina HiSeq	.	88	0.05	4	NM_001127897	2	0.00	0	A0PJ88|Q9Y2K8	Silent	SNP	ENST00000379925.3	37	CCDS32447.1																																																																																					0.378	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000422187.1		NM_015272	
EFCAB13	124989	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	45438806	45438806	+	Missense_Mutation	SNP	G	G	A	rs377500863	byFrequency	TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr17:45438806G>A	ENST00000331493.2	+	10	1135	c.724G>A	c.(724-726)Gtg>Atg	p.V242M	EFCAB13_ENST00000517484.1_Intron	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	242						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AACTGATGACGTGTTTGCTGT	0.363													G|||	3	0.000599042	0.0015	0.0014	5008	,	,		17133	0.0		0.0	False		,,,				2504	0.0				p.V242M													.	.			0			c.G724A							G	,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	226.0	218.0	221.0		,724	-1.2	0.0	17		221	0,8600		0,0,4300	no	intron,missense	C17orf57	NM_001195192.1,NM_152347.4	,21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,possibly-damaging	,242/974	45438806	1,13005	2203	4300	6503	SO:0001583	missense	124989	exon10			GATGACGTGTTTG	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.724G>A	17.37:g.45438806G>A	ENSP00000332111:p.Val242Met		Somatic	142	0	0		WXS	Illumina HiSeq	.	151	0.05	8	NM_152347	0		0	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	G	9.659	1.143547	0.21205	2.27E-4	0.0	ENSG00000178852	ENST00000331493;ENST00000344176	T	0.41065	1.01	3.78	-1.17	0.09648	EF-hand-like domain (1);	1.143610	0.06887	N	0.803564	T	0.43787	0.1263	L	0.58101	1.795	0.09310	N	0.999999	D;P	0.54964	0.969;0.755	P;B	0.50231	0.635;0.323	T	0.34179	-0.9839	10	0.87932	D	0	-13.7074	2.7597	0.05303	0.1836:0.1316:0.5331:0.1517	.	194;242	Q8N7U2;Q8IY85	.;CQ057_HUMAN	M	242;194	ENSP00000332111:V242M	ENSP00000332111:V242M	V	+	1	0	C17orf57	42793805	0.257000	0.24022	0.003000	0.11579	0.002000	0.02628	-0.035000	0.12205	-0.608000	0.05731	-1.936000	0.00505	GTG			0.363	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000380147.4		NM_152347	
CLTC	1213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	57721790	57721790	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr17:57721790A>G	ENST00000269122.3	+	2	470	c.196A>G	c.(196-198)Att>Gtt	p.I66V	CLTC_ENST00000393043.1_Missense_Mutation_p.I66V|CLTC_ENST00000579456.1_Missense_Mutation_p.I66V	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	66	Globular terminal domain.|WD40-like repeat 1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCGAAGACCAATTTCAGCAGA	0.398			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.I66V				Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	.			0			c.A196G												88.0	80.0	83.0					17																	57721790		2203	4300	6503	SO:0001583	missense	1213	exon2			AGACCAATTTCAG	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.196A>G	17.37:g.57721790A>G	ENSP00000269122:p.Ile66Val		Somatic	106	0	0		WXS	Illumina HiSeq	.	125	0.26	33	NM_004859	99	0.22	22	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	A	16.87	3.242686	0.58995	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.61859	0.07;0.07	5.03	5.03	0.67393	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.85682	D	0.000000	T	0.65668	0.2713	M	0.87682	2.9	0.29044	N	0.884891	B;B	0.13145	0.0;0.007	B;B	0.25884	0.002;0.064	T	0.65619	-0.6124	10	0.59425	D	0.04	.	15.0351	0.71738	1.0:0.0:0.0:0.0	.	66;66	Q00610;Q00610-2	CLH1_HUMAN;.	V	66	ENSP00000269122:I66V;ENSP00000376763:I66V	ENSP00000269122:I66V	I	+	1	0	CLTC	55076572	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.283000	0.95860	2.005000	0.58758	0.533000	0.62120	ATT			0.398	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258859.1		NM_004859	
EPG5	57724	mdanderson.org	37	18	43469833	43469833	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr18:43469833G>T	ENST00000282041.5	-	28	4916	c.4882C>A	c.(4882-4884)Caa>Aaa	p.Q1628K	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1628					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GCTTCTGCTTGCAACTGCTTC	0.368																																					p.Q1628K													.	.			0			c.C4882A												142.0	132.0	135.0					18																	43469833		1888	4124	6012	SO:0001583	missense	57724	exon28			CTGCTTGCAACTG	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.4882C>A	18.37:g.43469833G>T	ENSP00000282041:p.Gln1628Lys		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_020964	8	0.00	0	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796608	0.70567	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.10668	2.85	6.01	6.01	0.97437	.	.	.	.	.	T	0.32882	0.0844	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.00115	-1.2038	9	0.52906	T	0.07	-9.8923	20.5211	0.99222	0.0:0.0:1.0:0.0	.	1628	Q9HCE0	EPG5_HUMAN	K	1628;503	ENSP00000282041:Q1628K	ENSP00000282041:Q1628K	Q	-	1	0	EPG5	41723831	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	9.448000	0.97600	2.861000	0.98227	0.650000	0.86243	CAA			0.368	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445081.1		NM_020964	
FBN3	84467	mdanderson.org	37	19	8148193	8148193	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr19:8148193C>T	ENST00000600128.1	-	57	7565	c.7151G>A	c.(7150-7152)gGc>gAc	p.G2384D	FBN3_ENST00000601739.1_Missense_Mutation_p.G2384D|FBN3_ENST00000270509.2_Missense_Mutation_p.G2384D			Q75N90	FBN3_HUMAN	fibrillin 3	2384	EGF-like 38; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GCGGAAGGAGCCAAGGCTGTT	0.597																																					p.G2384D													.	.			0			c.G7151A												168.0	120.0	136.0					19																	8148193		2203	4300	6503	SO:0001583	missense	84467	exon56			AAGGAGCCAAGGC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7151G>A	19.37:g.8148193C>T	ENSP00000470498:p.Gly2384Asp		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_032447	71	0.00	0	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190287	0.78789	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.99557	-6.16	5.13	5.13	0.70059	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.99684	0.9881	M	0.89904	3.07	0.80722	D	1	P;D	0.89917	0.833;1.0	P;D	0.97110	0.745;1.0	D	0.97859	1.0279	10	0.52906	T	0.07	.	18.5764	0.91157	0.0:1.0:0.0:0.0	.	2384;490	Q75N90;Q6ZNB8	FBN3_HUMAN;.	D	2384;490	ENSP00000270509:G2384D	ENSP00000270509:G2384D	G	-	2	0	FBN3	8054193	1.000000	0.71417	0.988000	0.46212	0.358000	0.29455	7.295000	0.78780	2.393000	0.81446	0.491000	0.48974	GGC			0.597	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461428.2		NM_032447	
ZNF799	90576	ucsc.edu	37	19	12501560	12501560	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr19:12501560T>C	ENST00000430385.3	-	4	1852	c.1652A>G	c.(1651-1653)gAa>gGa	p.E551G	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Missense_Mutation_p.E519G	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GTGAATTCTTTCATGTCGTAG	0.393																																					p.E551G													.	ZNF799	111		0			c.A1652G												93.0	96.0	95.0					19																	12501560		2202	4300	6502	SO:0001583	missense	90576	exon4			ATTCTTTCATGTC	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1652A>G	19.37:g.12501560T>C	ENSP00000411084:p.Glu551Gly		Somatic	161	0.0062111801	1		RNA-Seq	Illumina HiSeq		183	0.02	3	NM_001080821	30	0.20	6		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.811876	0.32053	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.18657	2.2;2.2	1.53	-0.919	0.10478	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20414	0.0491	M	0.62209	1.925	0.09310	N	1	B	0.17852	0.024	B	0.29353	0.101	T	0.40720	-0.9548	9	0.62326	D	0.03	.	3.0258	0.06090	0.2117:0.1463:0.0:0.642	.	551	Q96GE5	ZN799_HUMAN	G	519;551	ENSP00000415278:E519G;ENSP00000411084:E551G	ENSP00000415278:E519G	E	-	2	0	ZNF799	12362560	0.000000	0.05858	0.005000	0.12908	0.094000	0.18550	-1.204000	0.03017	-0.358000	0.08162	0.352000	0.21897	GAA			0.393	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344099.2	rescued with RNA-seq	NM_001080821	
AD000091.2	0	broad.mit.edu	37	19	15726774	15726775	+	lincRNA	DEL	CC	CC	-			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr19:15726774_15726775delCC	ENST00000589196.2	-	0	0				CYP4F8_ENST00000441682.2_RNA																							tcattcctctcctcactcactc	0.54																																					.													.	CYP4F8	64		0			.																																											11283	.			TCCTCTCCTCACT																													19.37:g.15726774_15726775delCC			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	18	0.28	5	.	0		0		RNA	DEL	ENST00000589196.2	37																																																																																						0.540	AD000091.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000460896.2			
SCAF1	58506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50148669	50148669	+	Splice_Site	SNP	G	G	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr19:50148669G>A	ENST00000360565.3	+	3	290		c.e3+1			NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)	p.?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		AATGATAAAGGTATGGCGGCT	0.577																																					.													SCAF1,NS,carcinoma,0,1	SCAF1	0	1	1	Unknown(1)	lung(1)	c.166+1G>A												70.0	69.0	69.0					19																	50148669		2203	4300	6503	SO:0001630	splice_region_variant	58506	exon3			ATAAAGGTATGGC	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.166+1G>A	19.37:g.50148669G>A			Somatic	125	0	0		WXS	Illumina HiSeq	.	163	0.19	31	NM_021228	0		0	Q7Z5V7|Q8WVA1|Q9NR59	Splice_Site	SNP	ENST00000360565.3	37	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	.	14.35	2.510262	0.44660	.	.	ENSG00000126461	ENST00000360565;ENST00000447618	.	.	.	4.07	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6149	0.51083	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCAF1	54840481	1.000000	0.71417	0.998000	0.56505	0.652000	0.38707	4.058000	0.57463	2.111000	0.64477	0.305000	0.20034	.			0.577	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465764.1		NM_021228	Intron
ZNF628	89887	mdanderson.org	37	19	55995616	55995616	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr19:55995616C>T	ENST00000598519.1	+	3	3609	c.3056C>T	c.(3055-3057)cCa>cTa	p.P1019L	NAT14_ENST00000587400.1_5'Flank|ZNF628_ENST00000391718.2_Missense_Mutation_p.P1015L|NAT14_ENST00000205194.4_5'Flank|NAT14_ENST00000591590.1_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	1019					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		CCCGGGGCTCCAGCCTCCCAG	0.701																																					p.P1019L													.	.			0			c.C3056T												5.0	6.0	5.0					19																	55995616		2050	4009	6059	SO:0001583	missense	89887	exon3			GGGCTCCAGCCTC	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.3056C>T	19.37:g.55995616C>T	ENSP00000469591:p.Pro1019Leu		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_033113	16	0.00	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	.	.	.	.	.	.	.	.	.	.	.	9.783	1.175756	0.21704	.	.	ENSG00000197483	ENST00000391718	T	0.08546	3.08	3.48	3.48	0.39840	.	0.126603	0.33515	U	0.004829	T	0.05273	0.0140	N	0.24115	0.695	0.09310	N	0.999999	P	0.39480	0.675	B	0.34242	0.178	T	0.33266	-0.9875	10	0.72032	D	0.01	-9.6118	8.314	0.32088	0.2359:0.7641:0.0:0.0	.	1015	Q5EBL2	ZN628_HUMAN	L	1015	ENSP00000375598:P1015L	ENSP00000375598:P1015L	P	+	2	0	ZNF628	60687428	0.003000	0.15002	0.004000	0.12327	0.102000	0.19082	1.441000	0.35035	1.973000	0.57446	0.478000	0.44815	CCA			0.701	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317934.2		XM_058964	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32667481	32667481	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr2:32667481G>T	ENST00000421745.2	+	19	4330	c.4196G>T	c.(4195-4197)aGt>aTt	p.S1399I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1399					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCAGGACGAAGTATAGCCCAT	0.403																																					p.S1399I	Pancreas(94;175 1509 16028 18060 45422)												.	.			0			c.G4196T												136.0	128.0	131.0					2																	32667481		2203	4300	6503	SO:0001583	missense	57448	exon19			GACGAAGTATAGC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.4196G>T	2.37:g.32667481G>T	ENSP00000393596:p.Ser1399Ile		Somatic	57	0	0		WXS	Illumina HiSeq	.	90	0.10	9	NM_016252	4	0.00	0	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	30	5.051876	0.93793	.	.	ENSG00000115760	ENST00000421745	D	0.82344	-1.6	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.90477	0.7017	M	0.73598	2.24	0.80722	D	1	D	0.61697	0.99	D	0.66497	0.944	D	0.91834	0.5478	10	0.87932	D	0	.	18.1639	0.89718	0.0:0.0:1.0:0.0	.	1399	Q9NR09	BIRC6_HUMAN	I	1399	ENSP00000393596:S1399I	ENSP00000393596:S1399I	S	+	2	0	BIRC6	32520985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.414000	0.97362	2.270000	0.75569	0.650000	0.86243	AGT			0.403	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318769.3		NM_016252	
GPR39	2863	hgsc.bcm.edu	37	2	133175021	133175021	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr2:133175021G>A	ENST00000329321.3	+	1	875	c.406G>A	c.(406-408)Gcc>Acc	p.A136T		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	136					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GCGCTACATCGCCATCTGTCA	0.602																																					p.A136T													GPR39,NS,carcinoma,0,1	GPR39	0	1	0			c.G406A												105.0	90.0	95.0					2																	133175021		2203	4300	6503	SO:0001583	missense	2863	exon1			TACATCGCCATCT	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.406G>A	2.37:g.133175021G>A	ENSP00000327417:p.Ala136Thr		Somatic	62	0	0		WXS	Illumina HiSeq	.	74	0.04	3	NM_001508	5	0.00	0	B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	37	CCDS2170.1	.	.	.	.	.	.	.	.	.	.	G	34	5.293279	0.95546	.	.	ENSG00000183840	ENST00000329321	T	0.53423	0.62	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75852	0.3906	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80863	-0.1192	10	0.87932	D	0	.	19.0852	0.93201	0.0:0.0:1.0:0.0	.	136	O43194	GPR39_HUMAN	T	136	ENSP00000327417:A136T	ENSP00000327417:A136T	A	+	1	0	GPR39	132891491	1.000000	0.71417	0.963000	0.40424	0.989000	0.77384	9.631000	0.98424	2.749000	0.94314	0.650000	0.86243	GCC			0.602	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254582.1			
FRG1B	284802	bcgsc.ca	37	20	29628233	29628233	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr20:29628233A>G	ENST00000278882.3	+	6	615	c.235A>G	c.(235-237)Atg>Gtg	p.M79V	FRG1B_ENST00000439954.2_Missense_Mutation_p.M84V|FRG1B_ENST00000358464.4_Missense_Mutation_p.M79V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	79										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTAGGGGAAAATGGCTTTGTT	0.363																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	284802	.			GGGAAAATGGCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.235A>G	20.37:g.29628233A>G	ENSP00000278882:p.Met79Val		Somatic	301	0.0099667774	3		WXS	Illumina HiSeq	Phase_1	383	0.05	18	.	78	0.00	0	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	3.138	-0.176853	0.06380	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.41065	1.01	2.08	2.08	0.27032	Actin cross-linking (1);	0.040228	0.85682	D	0.000000	T	0.23370	0.0565	.	.	.	0.41063	D	0.985397	B;B	0.17852	0.002;0.024	B;B	0.25140	0.03;0.058	T	0.04593	-1.0940	9	0.11794	T	0.64	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	84;79	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	79;84;79	ENSP00000408863:M84V	ENSP00000278882:M79V	M	+	1	0	FRG1B	28241894	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	4.813000	0.62620	1.208000	0.43306	0.347000	0.21830	ATG			0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
ZNF341	84905	mdanderson.org	37	20	32333094	32333094	+	Missense_Mutation	SNP	G	G	T	rs373744673		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr20:32333094G>T	ENST00000375200.1	+	3	693	c.328G>T	c.(328-330)Gcc>Tcc	p.A110S	ZNF341_ENST00000342427.2_Missense_Mutation_p.A110S	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	110					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CCCAACTCCTGCCAATCGCCA	0.567																																					p.A110S													.	.			0			c.G328T												33.0	35.0	35.0					20																	32333094		2203	4300	6503	SO:0001583	missense	84905	exon3			ACTCCTGCCAATC	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.328G>T	20.37:g.32333094G>T	ENSP00000364346:p.Ala110Ser		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_032819	5	0.00	0	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37		.	.	.	.	.	.	.	.	.	.	G	10.39	1.337786	0.24253	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.09723	3.18;2.95	5.58	3.62	0.41486	.	0.601770	0.17943	N	0.156795	T	0.03871	0.0109	N	0.04508	-0.205	0.43503	D	0.995758	B;B	0.20368	0.026;0.044	B;B	0.26094	0.03;0.066	T	0.30416	-0.9979	10	0.02654	T	1	-17.1402	5.2611	0.15573	0.2092:0.1625:0.6284:0.0	.	110;110	Q9BYN7;Q9BYN7-2	ZN341_HUMAN;.	S	110	ENSP00000344308:A110S;ENSP00000364346:A110S	ENSP00000344308:A110S	A	+	1	0	ZNF341	31796755	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.040000	0.30278	0.718000	0.32166	0.563000	0.77884	GCC			0.567	ZNF341-201	KNOWN	basic	protein_coding	protein_coding					
BAGE2	85319	broad.mit.edu	37	21	11058282	11058282	+	RNA	SNP	G	G	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr21:11058282G>A	ENST00000470054.1	-	0	365							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCTCTTCACAGCATTTGATAG	0.403																																					p.A53V													.	.			0			c.C158T												112.0	87.0	94.0					21																	11058282		692	1591	2283			85319	exon3			TTCACAGCATTTG	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058282G>A			Somatic	135	0.0148148148	2		WXS	Illumina HiSeq	Phase_I	185	0.03	6	NM_182482	1	0.00	0	A8K925|Q08ER0	RNA	SNP	ENST00000470054.1	37																																																																																						0.403	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
BCRP7	100133163	broad.mit.edu	37	22	18843462	18843462	+	Intron	DEL	G	G	-	rs571287382	byFrequency	TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr22:18843462delG	ENST00000412938.1	+	4	2337																											CCCAGGACAAGGGGCCAGCTC	0.627													gggg|GGGG|GGG|deletion	6	0.00119808	0.0045	0.0	5008	,	,		44027	0.0		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001627	intron_variant	0	.			GGACAAGGGGCCA																												ENST00000412938.1:c.2337+31G>-	22.37:g.18843462delG			Somatic	60	0.1	6		WXS	Illumina HiSeq	Phase_I	108	0.26	28	.	0		0		RNA	DEL	ENST00000412938.1	37																																																																																						0.627	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000471615.1			
TMEM175	84286	mdanderson.org	37	4	947055	947055	+	Silent	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr4:947055G>T	ENST00000264771.4	+	8	725	c.540G>T	c.(538-540)ctG>ctT	p.L180L	TMEM175_ENST00000515740.1_Silent_p.L64L|TMEM175_ENST00000508204.1_Silent_p.L98L|TMEM175_ENST00000504180.1_3'UTR	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	180						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACAGGGCTCTGTACCGACGAC	0.617																																					p.L180L													.	.			0			c.G540T												123.0	101.0	109.0					4																	947055		2203	4300	6503	SO:0001819	synonymous_variant	84286	exon8			GGCTCTGTACCGA	BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.540G>T	4.37:g.947055G>T			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_032326	29	0.00	0	D3DVN4|Q8ND13	Silent	SNP	ENST00000264771.4	37	CCDS3341.1																																																																																					0.617	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239193.2		NM_032326	
DSPP	1834	ucsc.edu	37	4	88536880	88536880	+	Silent	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr4:88536880C>T	ENST00000282478.7	+	4	3099	c.3066C>T	c.(3064-3066)agC>agT	p.S1022S	DSPP_ENST00000399271.1_Silent_p.S1022S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1022	Asp/Ser-rich.			S -> G (in Ref. 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaatagcagtg	0.517																																					p.S1022S													.	DSPP	174		0			c.C3066T												43.0	36.0	39.0					4																	88536880		1598	2799	4397	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAATAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3066C>T	4.37:g.88536880C>T			Somatic	63	0.0158730159	1		WXS	Illumina HiSeq		44	0.09	4	NM_014208	0		0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																					0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
HERC5	51191	broad.mit.edu;bcgsc.ca	37	4	89388236	89388236	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr4:89388236A>G	ENST00000264350.3	+	7	1091	c.938A>G	c.(937-939)gAt>gGt	p.D313G	HERC5_ENST00000508159.1_5'Flank	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	313					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TATGTTTCTGATTTGGGAAAG	0.393																																					p.D313G	Esophageal Squamous(39;887 1012 34045 50514)												.	HERC5	114		0			c.A938G												180.0	178.0	178.0					4																	89388236		2203	4300	6503	SO:0001583	missense	51191	exon7			TTTCTGATTTGGG	AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.938A>G	4.37:g.89388236A>G	ENSP00000264350:p.Asp313Gly		Somatic	117	0.0085470085	1		WXS	Illumina HiSeq	Phase_I	83	0.07	6	NM_016323	33	0.03	1	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	.	.	.	.	.	.	.	.	.	.	A	11.42	1.633794	0.29068	.	.	ENSG00000138646	ENST00000264350	D	0.82711	-1.64	4.32	1.9	0.25705	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.536026	0.17732	N	0.163865	T	0.74306	0.3699	L	0.51422	1.61	0.58432	D	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.67546	-0.5643	10	0.62326	D	0.03	.	4.3011	0.10925	0.6202:0.1725:0.2073:0.0	.	313	Q9UII4	HERC5_HUMAN	G	313	ENSP00000264350:D313G	ENSP00000264350:D313G	D	+	2	0	HERC5	89607259	0.175000	0.23083	0.968000	0.41197	0.997000	0.91878	0.949000	0.29109	0.437000	0.26423	0.477000	0.44152	GAT			0.393	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253554.2		NM_016323	
MEGF10	84466	mdanderson.org	37	5	126753482	126753482	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr5:126753482G>T	ENST00000274473.6	+	11	1550	c.1283G>T	c.(1282-1284)tGc>tTc	p.C428F	MEGF10_ENST00000418761.2_Missense_Mutation_p.C428F|MEGF10_ENST00000503335.2_Missense_Mutation_p.C428F|MEGF10_ENST00000508365.1_Missense_Mutation_p.C428F	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	428	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ACTGGAAAGTGCACCTGTGCC	0.502																																					p.C428F													MEGF10,NS,adenocarcinoma,-1,1	MEGF10	-1	1	0			c.G1283T												76.0	64.0	68.0					5																	126753482		2203	4300	6503	SO:0001583	missense	84466	exon10			GAAAGTGCACCTG	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1283G>T	5.37:g.126753482G>T	ENSP00000274473:p.Cys428Phe		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001256545	3	0.00	0	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817067	0.90790	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.69	5.69	0.88448	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.94185	0.8134	H	0.99682	4.7	0.80722	D	1	D;P	0.71674	0.998;0.941	D;P	0.74674	0.984;0.821	D	0.96604	0.9447	10	0.87932	D	0	-19.465	19.8251	0.96614	0.0:0.0:1.0:0.0	.	428;428	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	F	428	ENSP00000423354:C428F;ENSP00000423195:C428F;ENSP00000416284:C428F;ENSP00000274473:C428F	ENSP00000274473:C428F	C	+	2	0	MEGF10	126781381	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.864000	0.99589	2.692000	0.91855	0.655000	0.94253	TGC			0.502	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250973.2		NM_032446	
PCDHB4	56131	hgsc.bcm.edu	37	5	140503155	140503155	+	Silent	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr5:140503155G>T	ENST00000194152.1	+	1	1575	c.1575G>T	c.(1573-1575)gcG>gcT	p.A525A	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	525	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.682																																					p.A525A													PCDHB4,caecum,carcinoma,+1,1	PCDHB4	1	1	0			c.G1575T												69.0	78.0	75.0					5																	140503155		2203	4298	6501	SO:0001819	synonymous_variant	56131	exon1			GCAGGCGTTCGAG	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1575G>T	5.37:g.140503155G>T			Somatic	40	0.05	2		WXS	Illumina HiSeq	.	33	0.12	4	NM_018938	0		0	Q4V761	Silent	SNP	ENST00000194152.1	37	CCDS4246.1																																																																																					0.682	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251812.2		NM_018938	
GABRA1	2554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	161277838	161277838	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr5:161277838T>C	ENST00000428797.2	+	3	377	c.22T>C	c.(22-24)Tct>Cct	p.S8P	GABRA1_ENST00000420560.1_Missense_Mutation_p.S8P|GABRA1_ENST00000444819.1_Missense_Mutation_p.S8P|GABRA1_ENST00000437025.2_Missense_Mutation_p.S8P|GABRA1_ENST00000023897.6_Missense_Mutation_p.S8P|GABRA1_ENST00000393943.4_Missense_Mutation_p.S8P	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	8					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCCAGGTCTGTCTGACTGTCT	0.443																																					p.S8P													.	.			0			c.T22C												112.0	107.0	109.0					5																	161277838		2203	4300	6503	SO:0001583	missense	2554	exon3			GGTCTGTCTGACT		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.22T>C	5.37:g.161277838T>C	ENSP00000393097:p.Ser8Pro		Somatic	69	0	0		WXS	Illumina HiSeq	.	53	0.15	8	NM_001127643	0		0	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	T	8.398	0.841233	0.16891	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000521339;ENST00000420560;ENST00000522651;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-0.46;-1.25;-0.56;-1.25;-0.54	5.37	2.78	0.32641	.	0.568216	0.19121	N	0.122169	T	0.57932	0.2087	N	0.14661	0.345	0.20196	N	0.999927	B	0.02656	0.0	B	0.01281	0.0	T	0.42548	-0.9445	10	0.30078	T	0.28	.	7.4385	0.27169	0.0:0.2009:0.0:0.7991	.	8	P14867	GBRA1_HUMAN	P	8;8;8;8;14;8;8;8;8	ENSP00000023897:S8P;ENSP00000393097:S8P;ENSP00000377517:S8P;ENSP00000415441:S8P;ENSP00000430895:S14P;ENSP00000408041:S8P;ENSP00000430507:S8P;ENSP00000414232:S8P;ENSP00000430435:S8P	ENSP00000023897:S8P	S	+	1	0	GABRA1	161210416	1.000000	0.71417	0.690000	0.30148	0.684000	0.39900	1.326000	0.33735	0.278000	0.22164	0.524000	0.50904	TCT			0.443	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252702.2		NM_000806.5	
PPARD	5467	mdanderson.org	37	6	35391795	35391795	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr6:35391795G>T	ENST00000311565.4	+	7	846	c.497G>T	c.(496-498)aGc>aTc	p.S166I	PPARD_ENST00000540939.1_Missense_Mutation_p.S63I|PPARD_ENST00000448077.2_Missense_Mutation_p.S127I|PPARD_ENST00000360694.3_Missense_Mutation_p.S166I|PPARD_ENST00000444397.1_Missense_Mutation_p.S166I|PPARD_ENST00000337400.2_Missense_Mutation_p.S166I|PPARD_ENST00000418635.2_Missense_Mutation_p.S68I	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	166					adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	AACGAGGGGAGCCAGTACAAC	0.567																																					p.S166I													.	.			0			c.G497T												85.0	88.0	87.0					6																	35391795		2203	4300	6503	SO:0001583	missense	5467	exon7			AGGGGAGCCAGTA	L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.497G>T	6.37:g.35391795G>T	ENSP00000310928:p.Ser166Ile		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001171818	26	0.00	0	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Missense_Mutation	SNP	ENST00000311565.4	37	CCDS4803.1	.	.	.	.	.	.	.	.	.	.	G	9.760	1.169751	0.21621	.	.	ENSG00000112033	ENST00000448077;ENST00000360694;ENST00000418635;ENST00000444397;ENST00000311565;ENST00000337400;ENST00000540939	D;D;D;D;D;D;D	0.94793	-3.31;-3.33;-3.2;-3.52;-3.33;-3.52;-3.29	4.51	-0.123	0.13527	.	0.617998	0.18901	N	0.128029	T	0.73776	0.3630	N	0.22421	0.69	0.26040	N	0.981627	B;B;B;B	0.33694	0.421;0.138;0.29;0.089	B;B;B;B	0.26693	0.072;0.032;0.032;0.052	T	0.68465	-0.5401	10	0.51188	T	0.08	.	1.8265	0.03122	0.315:0.1337:0.4157:0.1356	.	68;127;166;166	E9PE18;B7Z3W1;Q03181;F1D8S7	.;.;PPARD_HUMAN;.	I	127;166;68;166;166;166;63	ENSP00000414372:S127I;ENSP00000353916:S166I;ENSP00000413314:S68I;ENSP00000410837:S166I;ENSP00000310928:S166I;ENSP00000337063:S166I;ENSP00000443759:S63I	ENSP00000310928:S166I	S	+	2	0	PPARD	35499773	0.964000	0.33143	0.912000	0.35992	0.568000	0.35870	1.519000	0.35888	-0.250000	0.09555	0.467000	0.42956	AGC			0.567	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040288.1		NM_006238	
TAAR9	134860	broad.mit.edu	37	6	132860291	132860291	+	RNA	SNP	C	C	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr6:132860291C>A	ENST00000434551.1	+	0	863					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		AATTTTATAACTCCTCCTTAT	0.373																																					.	Colon(10;433 445 15992 45047 47213)												.	.			0			.												107.0	100.0	102.0					6																	132860291		1866	4109	5975			134860	.			TTATAACTCCTCC	AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132860291C>A			Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	99	0.04	4	.	0		0		RNA	SNP	ENST00000434551.1	37																																																																																						0.373	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000042254.2		NM_175057	
SNX9	51429	bcgsc.ca;mdanderson.org	37	6	158296192	158296192	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr6:158296192C>T	ENST00000392185.3	+	4	455	c.284C>T	c.(283-285)gCc>gTc	p.A95V	RP11-52J3.2_ENST00000422776.1_RNA|RP11-52J3.2_ENST00000457427.1_RNA	NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	95					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		TCGTCGGCTGCCAGCAACAAT	0.483																																					p.A95V													.	SNX9	43		0			c.C284T												84.0	70.0	75.0					6																	158296192		2203	4300	6503	SO:0001583	missense	51429	exon4			CGGCTGCCAGCAA	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.284C>T	6.37:g.158296192C>T	ENSP00000376024:p.Ala95Val		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_1	104	0.05	5	NM_016224	55	0.00	0	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	37	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301155	0.23650	.	.	ENSG00000130340	ENST00000539592;ENST00000392185	T	0.46819	0.86	5.62	4.74	0.60224	.	0.937004	0.08676	N	0.910064	T	0.16981	0.0408	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.02365	-1.1170	10	0.46703	T	0.11	-0.7649	12.222	0.54439	0.0:0.9173:0.0:0.0827	.	95	Q9Y5X1	SNX9_HUMAN	V	95	ENSP00000376024:A95V	ENSP00000376024:A95V	A	+	2	0	SNX9	158216180	0.212000	0.23540	1.000000	0.80357	0.026000	0.11368	0.676000	0.25247	2.613000	0.88420	0.557000	0.71058	GCC			0.483	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042856.1			
DACT2	168002	mdanderson.org	37	6	168711949	168711949	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr6:168711949G>T	ENST00000366795.3	-	2	350	c.262C>A	c.(262-264)Cag>Aag	p.Q88K	DACT2_ENST00000366796.3_Missense_Mutation_p.Q88K|DACT2_ENST00000610183.1_Intron|DACT2_ENST00000607983.1_Intron	NM_214462.3	NP_999627.2	Q5SW24	DACT2_HUMAN	dishevelled-binding antagonist of beta-catenin 2	88					epithelial cell morphogenesis (GO:0003382)|hematopoietic progenitor cell differentiation (GO:0002244)|inner medullary collecting duct development (GO:0072061)|negative regulation of cell adhesion (GO:0007162)|negative regulation of nodal signaling pathway (GO:1900108)|skin development (GO:0043588)	mitochondrion (GO:0005739)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)|transcription factor binding (GO:0008134)			endometrium(1)	1		Breast(66;1.46e-05)|Ovarian(120;0.0728)		OV - Ovarian serous cystadenocarcinoma(33;5.33e-21)|BRCA - Breast invasive adenocarcinoma(81;1.18e-06)|GBM - Glioblastoma multiforme(31;0.000957)		CCGATGTCCTGTTGTCTCAGC	0.542																																					p.Q88K													.	.			0			c.C262A												159.0	156.0	157.0					6																	168711949		692	1591	2283	SO:0001583	missense	168002	exon2			TGTCCTGTTGTCT	AF318336	CCDS47519.1, CCDS69241.1, CCDS75554.1	6q27	2013-05-15	2013-05-15	2003-09-17	ENSG00000164488	ENSG00000164488			21231	protein-coding gene	gene with protein product		608966	"""chromosome 6 open reading frame 116"", ""dapper homolog 2, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)"""	C6orf116			Standard	NM_001286351		Approved	bA503C24.7, DAPPER2	uc003qwq.3	Q5SW24	OTTHUMG00000016046	ENST00000366795.3:c.262C>A	6.37:g.168711949G>T	ENSP00000355760:p.Gln88Lys		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_214462	13	0.00	0	Q2NKJ2|Q569G0|Q8WYW2	Missense_Mutation	SNP	ENST00000366795.3	37	CCDS47519.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514901	0.44763	.	.	ENSG00000164488	ENST00000366796;ENST00000366795	T;T	0.50001	0.76;0.76	4.24	4.24	0.50183	.	0.211286	0.41938	D	0.000788	T	0.60560	0.2278	M	0.69823	2.125	0.38707	D	0.953115	D	0.89917	1.0	D	0.78314	0.991	T	0.66834	-0.5823	10	0.62326	D	0.03	-30.2068	15.993	0.80220	0.0:0.0:1.0:0.0	.	88	Q5SW24	DACT2_HUMAN	K	88	ENSP00000355761:Q88K;ENSP00000355760:Q88K	ENSP00000355760:Q88K	Q	-	1	0	DACT2	168454798	1.000000	0.71417	0.890000	0.34922	0.085000	0.17905	6.658000	0.74407	2.054000	0.61138	0.543000	0.68304	CAG			0.542	DACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043193.1			
AP5Z1	9907	mdanderson.org	37	7	4828510	4828510	+	Silent	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr7:4828510C>T	ENST00000348624.4	+	13	1729	c.1635C>T	c.(1633-1635)ggC>ggT	p.G545G	AP5Z1_ENST00000401897.1_Silent_p.G545G|MIR4656_ENST00000579503.1_RNA	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	545					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CCATGGCCGGCTGTGCCCGCG	0.701																																					p.G545G													KIAA0415_ENST00000450194,NS,carcinoma,+1,2	KIAA0415_ENST00000450194	1	2	0			c.C1635T												16.0	19.0	18.0					7																	4828510		2182	4268	6450	SO:0001819	synonymous_variant	9907	exon13			GGCCGGCTGTGCC	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1635C>T	7.37:g.4828510C>T			Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_014855	42	0.00	0	Q8N3X2|Q96H80	Silent	SNP	ENST00000348624.4	37	CCDS47528.1																																																																																					0.701	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323771.1			
RADIL	55698	mdanderson.org	37	7	4876055	4876055	+	Missense_Mutation	SNP	G	G	T	rs200447001	byFrequency	TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr7:4876055G>T	ENST00000399583.3	-	3	904	c.717C>A	c.(715-717)gaC>gaA	p.D239E	RADIL_ENST00000536091.1_Missense_Mutation_p.D239E|RADIL_ENST00000538469.1_5'UTR	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	239			D -> N (in dbSNP:rs3763384). {ECO:0000269|PubMed:11347906, ECO:0000269|PubMed:17974005, ECO:0000269|PubMed:19690332}.		multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		ACCGCATGGCGTCGGGGCCGG	0.706													G|||	11	0.00219649	0.0083	0.0	5008	,	,		13147	0.0		0.0	False		,,,				2504	0.0				p.D239E													.	.			0			c.C717A							G	GLU/ASP	18,4114		0,18,2048	13.0	20.0	18.0		717	3.0	0.0	7		18	0,8362		0,0,4181	yes	missense	RADIL	NM_018059.4	45	0,18,6229	TT,TG,GG		0.0,0.4356,0.1441	benign	239/1076	4876055	18,12476	2066	4181	6247	SO:0001583	missense	55698	exon3			CATGGCGTCGGGG	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.717C>A	7.37:g.4876055G>T	ENSP00000382492:p.Asp239Glu		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_018059	12	0.00	0	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	CCDS43544.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	4.646	0.120135	0.08881	0.004356	0.0	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091	T;T	0.22945	3.34;1.93	4.85	2.99	0.34606	.	0.607882	0.16897	N	0.195056	T	0.10680	0.0261	N	0.10664	0.02	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35201	-0.9798	10	0.06236	T	0.91	-25.6462	9.4722	0.38849	0.0:0.1551:0.6839:0.161	.	239	Q96JH8	RADIL_HUMAN	E	239;213;239	ENSP00000382492:D239E;ENSP00000442533:D239E	ENSP00000320946:D213E	D	-	3	2	RADIL	4842581	0.011000	0.17503	0.029000	0.17559	0.005000	0.04900	0.486000	0.22340	0.429000	0.26202	0.462000	0.41574	GAC	0.001		0.706	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323769.2		NM_018059	
TWIST1	7291	mdanderson.org	37	7	19156362	19156362	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr7:19156362C>T	ENST00000242261.5	-	1	933	c.583G>A	c.(583-585)Gcc>Acc	p.A195T	AC003986.6_ENST00000419944.1_RNA	NM_000474.3	NP_000465.1	Q15672	TWST1_HUMAN	twist family bHLH transcription factor 1	195					aortic valve morphogenesis (GO:0003180)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in heart valve development (GO:2000793)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cranial suture morphogenesis (GO:0060363)|embryonic camera-type eye formation (GO:0060900)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cushion morphogenesis (GO:0003203)|eyelid development in camera-type eye (GO:0061029)|in utero embryonic development (GO:0001701)|mitral valve morphogenesis (GO:0003183)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell motility (GO:2000147)|positive regulation of endocardial cushion to mesenchymal transition involved in heart valve formation (GO:2000802)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of bone mineralization (GO:0030500)|rhythmic process (GO:0048511)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription factor binding (GO:0008134)			lung(2)|upper_aerodigestive_tract(1)	3						ATGGACCAGGCCCCCTCCATC	0.677																																					p.A195T													.	.			0			c.G583A												34.0	31.0	32.0					7																	19156362		2202	4299	6501	SO:0001583	missense	7291	exon1			ACCAGGCCCCCTC	U80998	CCDS5367.1	7p21	2014-02-07	2013-10-17	2003-03-28	ENSG00000122691	ENSG00000122691		"""Basic helix-loop-helix proteins"""	12428	protein-coding gene	gene with protein product	"""Saethre-Chotzen syndrome"""	601622	"""blepharophimosis, epicanthus inversus and ptosis 3"", ""acrocephalosyndactyly 3"", ""twist homolog 1 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 1"", ""craniosynostosis"""	ACS3, BPES3, TWIST, CRS		8995765, 11474656, 17343269	Standard	XR_428085		Approved	SCS, H-twist, BPES2, bHLHa38, CRS1	uc003sum.3	Q15672	OTTHUMG00000090821	ENST00000242261.5:c.583G>A	7.37:g.19156362C>T	ENSP00000242261:p.Ala195Thr		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_000474	76	0.00	0	A4D128|Q92487|Q99804	Missense_Mutation	SNP	ENST00000242261.5	37	CCDS5367.1	.	.	.	.	.	.	.	.	.	.	c	18.87	3.716471	0.68844	.	.	ENSG00000122691	ENST00000242261	D	0.97114	-4.25	4.29	4.29	0.51040	.	0.144352	0.31301	N	0.007887	D	0.97176	0.9077	M	0.77820	2.39	0.51482	D	0.999924	P	0.47910	0.902	P	0.48552	0.581	D	0.97629	1.0141	10	0.54805	T	0.06	-13.0343	16.5828	0.84718	0.0:1.0:0.0:0.0	.	195	Q15672	TWST1_HUMAN	T	195	ENSP00000242261:A195T	ENSP00000242261:A195T	A	-	1	0	TWIST1	19122887	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.787000	0.69013	2.217000	0.71921	0.449000	0.29647	GCC			0.677	TWIST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207625.1		NM_000474	
DPY19L2P2	349152	broad.mit.edu	37	7	102883750	102883750	+	RNA	DEL	T	T	-			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr7:102883750delT	ENST00000312132.4	-	0	2616							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										GTGAACATAAttttttttttt	0.353																																					.													.	.			0			.																																											0	.			ACATAATTTTTTT	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102883750delT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	11	0.36	4	.	0		0	Q8N9V4|Q8ND62	RNA	DEL	ENST00000312132.4	37																																																																																						0.353	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000347877.1		NM_182634	
KCNH2	3757	mdanderson.org	37	7	150644785	150644785	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr7:150644785G>T	ENST00000262186.5	-	12	3275	c.2874C>A	c.(2872-2874)ttC>ttA	p.F958L	KCNH2_ENST00000330883.4_Missense_Mutation_p.F618L|KCNH2_ENST00000392968.2_Missense_Mutation_p.F862L	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	958					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TGGGGCTGGAGAAGGGCACCA	0.721																																					p.F958L	GBM(137;110 1844 13671 20123 45161)												.	.			0			c.C2874A												5.0	7.0	6.0					7																	150644785		2112	4123	6235	SO:0001583	missense	3757	exon12			GCTGGAGAAGGGC	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.2874C>A	7.37:g.150644785G>T	ENSP00000262186:p.Phe958Leu		Somatic	54	0.0185185185	1		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_000238	4	0.00	0	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322547	0.60634	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186	D;D;D	0.98400	-4.61;-4.69;-4.91	4.84	4.84	0.62591	.	0.264488	0.34986	N	0.003523	D	0.94122	0.8115	N	0.25647	0.755	0.80722	D	1	B;B;B	0.30326	0.276;0.276;0.187	B;B;B	0.25140	0.045;0.045;0.058	D	0.92972	0.6398	10	0.07990	T	0.79	.	13.455	0.61193	0.0:0.0:1.0:0.0	.	862;958;618	C4PFH9;Q12809;Q12809-2	.;KCNH2_HUMAN;.	L	618;862;958	ENSP00000328531:F618L;ENSP00000376695:F862L;ENSP00000262186:F958L	ENSP00000262186:F958L	F	-	3	2	KCNH2	150275718	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.649000	0.46656	2.228000	0.72767	0.561000	0.74099	TTC			0.721	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350741.2		NM_000238	
TNKS	8658	mdanderson.org	37	8	9627763	9627763	+	Silent	SNP	A	A	G			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr8:9627763A>G	ENST00000310430.6	+	26	3914	c.3888A>G	c.(3886-3888)agA>agG	p.R1296R	TNKS_ENST00000518281.1_Silent_p.R1059R	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1296	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		TCATCTACAGAGGAGAACAGG	0.463																																					p.R1296R													.	.			0			c.A3888G												67.0	56.0	60.0					8																	9627763		2201	4298	6499	SO:0001819	synonymous_variant	8658	exon26			CTACAGAGGAGAA	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3888A>G	8.37:g.9627763A>G			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_003747	24	0.00	0	O95272|Q4G0F2	Silent	SNP	ENST00000310430.6	37	CCDS5974.1																																																																																					0.463	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206935.1		NM_003747	
MLLT3	4300	hgsc.bcm.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S154S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,4	MLLT3	0	4	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T												9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	9.37:g.20414373G>A			Somatic	33	0.0606060606	2		WXS	Illumina HiSeq	.	47	0.09	4	NM_004529	2	0.00	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																					0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051872.1		NM_004529	
PRSS3	5646	broad.mit.edu	37	9	33794809	33794809	+	Intron	SNP	G	G	A	rs201061108		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr9:33794809G>A	ENST00000361005.5	+	2	211				PRSS3_ENST00000379405.3_5'Flank|PRSS3_ENST00000429677.3_Intron|PRSS3_ENST00000342836.4_Missense_Mutation_p.S7N|RP11-133O22.6_ENST00000454429.2_RNA	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			AGAGAGACAAGTGGCTTCACA	0.502																																					p.S7N													.	PRSS3	79		0			c.G20A																																									SO:0001627	intron_variant	5646	exon2			AGACAAGTGGCTT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.212-1832G>A	9.37:g.33794809G>A			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	61	0.11	7	NM_001197097	0		0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.932356	0.00488	.	.	ENSG00000010438	ENST00000457896;ENST00000342836	D;D	0.88741	-2.29;-2.42	1.75	-2.5	0.06384	.	.	.	.	.	T	0.69260	0.3091	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59096	-0.7518	9	0.02654	T	1	.	5.9988	0.19509	0.4674:0.0:0.5326:0.0	.	7	P35030-4	.	N	5;7	ENSP00000401249:S5N;ENSP00000340889:S7N	ENSP00000340889:S7N	S	+	2	0	PRSS3	33784809	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-1.129000	0.03244	-0.673000	0.05259	-1.096000	0.02151	AGT			0.502	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052121.1		NM_002771	
LOC100132077	100132077	broad.mit.edu	37	9	97109268	97109275	+	lincRNA	DEL	AAAAAAGA	AAAAAAGA	-	rs371617960		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	AAAAAAGA	AAAAAAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr9:97109268_97109275delAAAAAAGA	ENST00000454869.1	+	0	698					NR_033937.1																						caaaaaaaagaaaaaagaaaaaaagaaa	0.471																																					.													.	.			0			.																																											0	.			AAAAAGAAAAAAG																													9.37:g.97109276_97109283delAAAAAAGA			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000454869.1	37																																																																																						0.471	RP11-307E17.8-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000053177.1			
MT-CYB	4519	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	15765	15765	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chrM:15765G>A	ENST00000361789.2	+	1	1019	c.1019G>A	c.(1018-1020)gGa>gAa	p.G340E	MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	340					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CTGAATCGGAGGACAACCAGT	0.413																																					p.G340E													.	.			0			c.G1019A																																									SO:0001583	missense	0	exon1			TCGGAGGACAACC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.1019G>A	M.37:g.15765G>A	ENSP00000354554:p.Gly340Glu		Somatic	23	0	0		WXS	Illumina HiSeq	.	12	0.83	10	ENST00000361789	0		0	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																						0.413	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024038	
SYTL4	94121	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	99945112	99945112	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chrX:99945112C>A	ENST00000372989.1	-	10	1099	c.768G>T	c.(766-768)atG>atT	p.M256I	SYTL4_ENST00000455616.1_Missense_Mutation_p.M256I|SYTL4_ENST00000263033.5_Missense_Mutation_p.M256I|SYTL4_ENST00000372981.1_Missense_Mutation_p.M256I|SYTL4_ENST00000276141.6_Missense_Mutation_p.M256I|SYTL4_ENST00000454200.2_Missense_Mutation_p.M257I	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	256					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCTTAAATATCATCTCACCCT	0.443																																					p.M256I													.	.			0			c.G768T												95.0	81.0	85.0					X																	99945112		2203	4300	6503	SO:0001583	missense	94121	exon9			AAATATCATCTCA		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.768G>T	X.37:g.99945112C>A	ENSP00000362080:p.Met256Ile		Somatic	130	0	0		WXS	Illumina HiSeq	.	171	0.07	12	NM_001129896	3	0.00	0	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	c	10.06	1.246605	0.22796	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	T;T;T;T;T;T	0.63580	2.11;2.11;2.11;2.11;2.11;-0.05	5.7	4.83	0.62350	.	0.464796	0.26293	N	0.025211	T	0.51839	0.1698	L	0.47716	1.5	0.23950	N	0.996375	B;B	0.13145	0.007;0.0	B;B	0.09377	0.004;0.001	T	0.34229	-0.9837	9	.	.	.	-16.0292	10.3346	0.43841	0.0:0.6446:0.2774:0.078	.	256;256	Q96C24-2;Q96C24	.;SYTL4_HUMAN	I	256;256;257;256;256;256	ENSP00000362080:M256I;ENSP00000390252:M256I;ENSP00000403556:M257I;ENSP00000276141:M256I;ENSP00000263033:M256I;ENSP00000362072:M256I	.	M	-	3	0	SYTL4	99831768	0.988000	0.35896	1.000000	0.80357	0.982000	0.71751	0.175000	0.16762	2.396000	0.81511	0.591000	0.81541	ATG			0.443	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000057488.1		NM_080737	
NBPF9	400818	hgsc.bcm.edu	37	1	144813815	144813815	+	Silent	SNP	A	A	G	rs371436644		TCGA-YU-AA61-01A-11D-A435-10	TCGA-YU-AA61-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a045392a-1a5d-4642-8bd1-f1671db2fd63	1a30d3c6-2e38-4057-b0a9-4509f5a563a4	g.chr1:144813815A>G	ENST00000440491.2	+	2	288	c.288A>G	c.(286-288)gcA>gcG	p.A96A	NBPF9_ENST00000338347.4_Silent_p.A96A|NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000281815.8_5'UTR	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	354						cytoplasm (GO:0005737)		p.A96A(5)		NS(2)|prostate(1)	3						AGAAGCTTGCAGAGCAGCTGA	0.532																																					.													NBPF9_ENST00000338347,NS,carcinoma,0,5	NBPF9_ENST00000338347	0	5	5	Substitution - coding silent(5)	kidney(4)|endometrium(1)	.												1.0	1.0	1.0					1																	144813815		263	708	971	SO:0001819	synonymous_variant	400818	.			GCTTGCAGAGCAG		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000440491.2:c.288A>G	1.37:g.144813815A>G			Somatic	14	0.1428571429	2		WXS	Illumina HiSeq	.	14	0.36	5	.	8	0.00	0		Silent	SNP	ENST00000440491.2	37		.	.	.	.	.	.	.	.	.	.	.	1.684	-0.505860	0.04261	.	.	ENSG00000168614	ENST00000375552	.	.	.	0.723	-0.563	0.11778	.	.	.	.	.	T	0.07908	0.0198	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.36040	-0.9764	4	.	.	.	.	2.9279	0.05789	0.6738:0.0:0.3262:0.0	.	.	.	.	R	95	.	.	Q	+	2	0	NBPF9	143525172	0.031000	0.19500	0.003000	0.11579	0.003000	0.03518	0.134000	0.15932	-0.209000	0.10156	-1.211000	0.01629	CAG			0.532	NBPF9-203	KNOWN	basic	protein_coding	protein_coding				NM_001037675	
