#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ATAD3C	219293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1396296	1396296	+	Splice_Site	SNP	C	C	T	rs202189170	byFrequency	TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:1396296C>T	ENST00000378785.2	+	10	1974	c.979C>T	c.(979-981)Cgg>Tgg	p.R327W		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	327							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AGAAGGAAAGCGGTAAGTGTC	0.642													c|||	2	0.000399361	0.0015	0.0	5008	,	,		15611	0.0		0.0	False		,,,				2504	0.0				p.R327W													.	.			0			c.C979T							C	TRP/ARG	1,1383		0,1,691	109.0	93.0	98.0		979	2.4	1.0	1		98	1,3181		0,1,1590	yes	missense-near-splice	ATAD3C	NM_001039211.2	101	0,2,2281	TT,TC,CC		0.0314,0.0723,0.0438	probably-damaging	327/412	1396296	2,4564	692	1591	2283	SO:0001630	splice_region_variant	219293	exon10			GGAAAGCGGTAAG	AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.980+1C>T	1.37:g.1396296C>T			Somatic	87	0	0		WXS	Illumina HiSeq	.	72	0.15	11	NM_001039211	15	0.07	1	Q8N1Z5	Missense_Mutation	SNP	ENST00000378785.2	37	CCDS44039.1	.	.	.	.	.	.	.	.	.	.	.	14.77	2.634903	0.47049	7.23E-4	3.14E-4	ENSG00000215915	ENST00000378785	D	0.94723	-3.5	2.37	2.37	0.29283	.	0.000000	0.85682	D	0.000000	D	0.92224	0.7534	L	0.29908	0.895	0.28843	N	0.896484	D	0.69078	0.997	P	0.52343	0.696	D	0.88078	0.2805	10	0.87932	D	0	.	11.6921	0.51521	0.0:1.0:0.0:0.0	.	327	Q5T2N8	ATD3C_HUMAN	W	327	ENSP00000368062:R327W	ENSP00000368062:R327W	R	+	1	2	ATAD3C	1386159	1.000000	0.71417	0.992000	0.48379	0.010000	0.07245	7.417000	0.80156	1.139000	0.42245	0.205000	0.17691	CGG			0.642	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001279.3		NM_001039211	Missense_Mutation
MTOR	2475	broad.mit.edu	37	1	11264759	11264759	+	Splice_Site	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:11264759G>T	ENST00000361445.4	-	26	3879	c.3803C>A	c.(3802-3804)gCc>gAc	p.A1268D		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1268					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AGCGCCCCAGGCCTGTGATCC	0.488																																					p.A1268D													.	MTOR	327		0			c.C3803A												34.0	33.0	33.0					1																	11264759		2203	4300	6503	SO:0001630	splice_region_variant	2475	exon26			CCCCAGGCCTGTG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3802-1C>A	1.37:g.11264759G>T			Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	226	0.04	8	NM_004958	0		0	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Splice_Site	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	33	5.270403	0.95429	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.11277	2.79	5.92	5.92	0.95590	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41026	0.1141	M	0.86097	2.795	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.29305	-1.0016	10	0.87932	D	0	-12.7744	20.3213	0.98679	0.0:0.0:1.0:0.0	.	1268	P42345	MTOR_HUMAN	D	1268	ENSP00000354558:A1268D	ENSP00000354558:A1268D	A	-	2	0	MTOR	11187346	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	9.373000	0.97168	2.810000	0.96702	0.650000	0.86243	GCC			0.488	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005558.1		NM_004958	Missense_Mutation
Unknown	0	bcgsc.ca	37	1	17077196	17077196	+	IGR	SNP	G	G	T	rs373381630		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:17077196G>T								RNU1-4 (10022 upstream) : MST1L (4208 downstream)																							GACCTGGAGAGTGCCCTCATC	0.677																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100421113	.			TGGAGAGTGCCCT																													1.37:g.17077196G>T			Somatic	67	0.0298507463	2		WXS	Illumina HiSeq	Phase_1	118	0.14	16	.	0		0		RNA	SNP		37																																																																																					0	0.677										
HSPG2	3339	broad.mit.edu	37	1	22213941	22213941	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:22213941G>T	ENST00000374695.3	-	8	1009	c.930C>A	c.(928-930)tgC>tgA	p.C310*		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	310	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TGCCGTCCTCGCAGTCCTCCT	0.697																																					p.C310X													.	HSPG2	311		0			c.C930A												76.0	83.0	81.0					1																	22213941		2203	4300	6503	SO:0001587	stop_gained	3339	exon8			GTCCTCGCAGTCC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.930C>A	1.37:g.22213941G>T	ENSP00000363827:p.Cys310*		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	104	0.03	3	NM_005529	0		0	Q16287|Q5SZI3|Q9H3V5	Nonsense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.00|14.00	2.405558|2.405558	0.42715|0.42715	.|.	.|.	ENSG00000142798|ENSG00000142798	ENST00000412328;ENST00000374673|ENST00000374695	T|.	0.54279|.	0.58|.	5.09|5.09	2.94|2.94	0.34122|0.34122	.|.	.|0.000000	.|0.43416	.|D	.|0.000568	T|.	0.42944|.	0.1225|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	D|.	0.71674|.	0.998|.	D|.	0.70487|.	0.969|.	T|.	0.53173|.	-0.8476|.	6|.	.|.	.|.	.|.	.|.	7.4055|7.4055	0.26987|0.26987	0.2627:0.0:0.7373:0.0|0.2627:0.0:0.7373:0.0	.|.	233|.	Q5SZI5|.	.|.	E|X	233;137|310	ENSP00000405412:A233E|.	.|.	A|C	-|-	2|3	0|2	HSPG2|HSPG2	22086528|22086528	0.951000|0.951000	0.32395|0.32395	0.898000|0.898000	0.35279|0.35279	0.311000|0.311000	0.27955|0.27955	1.503000|1.503000	0.35715|0.35715	1.154000|1.154000	0.42482|0.42482	0.462000|0.462000	0.41574|0.41574	GCG|TGC			0.697	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007598.1		NM_005529	
CCDC28B	79140	broad.mit.edu	37	1	32670247	32670248	+	Intron	DEL	TG	TG	-			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:32670247_32670248delTG	ENST00000373602.5	+	5	895				IQCC_ENST00000291358.6_5'Flank|IQCC_ENST00000537469.1_5'Flank|CCDC28B_ENST00000483009.1_Intron|RP4-622L5.7_ENST00000421616.1_RNA|CCDC28B_ENST00000421922.2_Frame_Shift_Del_p.C192fs|RP4-622L5.7_ENST00000373604.4_RNA	NM_024296.3	NP_077272.2	Q9BUN5	CC28B_HUMAN	coiled-coil domain containing 28B						cilium assembly (GO:0042384)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AACCCGTCTATGTGTGTGTGTT	0.5																																					.													.	CCDC28B	21		0			.																																									SO:0001627	intron_variant	79140	.			CGTCTATGTGTGT	BC022848	CCDS354.2, CCDS72749.1	1p36.11-p34.2	2008-02-05			ENSG00000160050	ENSG00000160050			28163	protein-coding gene	gene with protein product		610162				16327777	Standard	XM_006710892		Approved	MGC1203, RP4-622L5.5	uc001bul.1	Q9BUN5	OTTHUMG00000005738	ENST00000373602.5:c.548+26TG>-	1.37:g.32670255_32670256delTG			Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	169	0.05	8	.	0		0	A8K789|Q8TBV8	Frame_Shift_Del	DEL	ENST00000373602.5	37	CCDS354.2																																																																																					0.500	CCDC28B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000015723.4		NM_024296	
WLS	79971	hgsc.bcm.edu;ucsc.edu	37	1	68564463	68564463	+	Intron	SNP	C	C	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:68564463C>A	ENST00000354777.2	-	12	1756				GNG12-AS1_ENST00000420587.1_RNA|WLS_ENST00000540432.1_Intron|GNG12-AS1_ENST00000413628.1_RNA	NM_001002292.3	NP_001002292.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator						anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						attttaaaaccatgcaaaata	0.323																																					.													.	.			0			.												42.0	41.0	41.0					1																	68564463		2203	4300	6503	SO:0001627	intron_variant	100289178	.			TAAAACCATGCAA	BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000354777.2:c.1511-27G>T	1.37:g.68564463C>A			Somatic	101	0	0		WXS	Illumina HiSeq	.	181	0.13	23	.	0		0	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	RNA	SNP	ENST00000354777.2	37	CCDS30750.1																																																																																					0.323	WLS-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000025370.1		NM_024911	
ST6GALNAC5	81849	broad.mit.edu	37	1	77334301	77334301	+	Silent	SNP	A	A	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:77334301A>G	ENST00000477717.1	+	2	370	c.135A>G	c.(133-135)caA>caG	p.Q45Q	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	45	Poly-Gln.				glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						agcagcagcaacagcagcagc	0.716																																					p.Q45Q													.	ST6GALNAC5	59		0			c.A135G												11.0	12.0	12.0					1																	77334301		2032	3963	5995	SO:0001819	synonymous_variant	81849	exon2			GCAGCAACAGCAG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.135A>G	1.37:g.77334301A>G			Somatic	85	0.0117647059	1		WXS	Illumina HiSeq	Phase_I	177	0.03	6	NM_030965	0		0	B1AK82	Silent	SNP	ENST00000477717.1	37	CCDS673.1																																																																																					0.716	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026692.2		NM_030965	
OLFML3	56944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114523051	114523051	+	Missense_Mutation	SNP	A	A	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:114523051A>T	ENST00000320334.4	+	2	286	c.212A>T	c.(211-213)aAg>aTg	p.K71M	OLFML3_ENST00000393300.2_Missense_Mutation_p.K51M|OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000369551.1_Missense_Mutation_p.K51M	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	71					multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGGCAGAGAAGGAGCGGGAG	0.612																																					p.K71M													.	.			0			c.A212T												73.0	77.0	76.0					1																	114523051		2203	4300	6503	SO:0001583	missense	56944	exon2			CAGAGAAGGAGCG	AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.212A>T	1.37:g.114523051A>T	ENSP00000322273:p.Lys71Met		Somatic	130	0	0		WXS	Illumina HiSeq	.	159	0.19	30	NM_020190	5	0.20	1	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Missense_Mutation	SNP	ENST00000320334.4	37	CCDS870.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.987202	0.74589	.	.	ENSG00000116774	ENST00000369551;ENST00000320334;ENST00000393300	D;D;D	0.90324	-2.65;-2.65;-2.65	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.90431	0.7004	L	0.34521	1.04	0.52099	D	0.999948	D;D	0.89917	1.0;0.999	D;P	0.70935	0.971;0.907	D	0.92284	0.5836	10	0.66056	D	0.02	.	14.7677	0.69651	1.0:0.0:0.0:0.0	.	51;71	Q9NRN5-2;Q9NRN5	.;OLFL3_HUMAN	M	51;71;51	ENSP00000358564:K51M;ENSP00000322273:K71M;ENSP00000376977:K51M	ENSP00000322273:K71M	K	+	2	0	OLFML3	114324574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.249000	0.51437	1.968000	0.57251	0.459000	0.35465	AAG			0.612	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033119.1		NM_020190	
RRNAD1	51093	mdanderson.org	37	1	156704005	156704005	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:156704005G>T	ENST00000368216.4	+	6	1471	c.841G>T	c.(841-843)Gcc>Tcc	p.A281S	RRNAD1_ENST00000476229.1_Intron|RRNAD1_ENST00000368218.4_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	281						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						GGTGGCCCTGGCCTCAGTGGG	0.642																																					p.A281S													.	.			0			c.G841T												89.0	77.0	81.0					1																	156704005		2203	4300	6503	SO:0001583	missense	51093	exon6			GCCCTGGCCTCAG	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.841G>T	1.37:g.156704005G>T	ENSP00000357199:p.Ala281Ser		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_015997	22	0.00	0	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	ENST00000368216.4	37	CCDS1154.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116917	0.77323	.	.	ENSG00000143303	ENST00000368216;ENST00000519086	T;T	0.43294	0.95;0.95	5.28	5.28	0.74379	.	0.054787	0.64402	D	0.000001	T	0.38639	0.1048	L	0.53249	1.67	0.80722	D	1	P	0.51791	0.948	P	0.53102	0.718	T	0.37033	-0.9723	10	0.62326	D	0.03	-14.5193	9.9413	0.41583	0.0927:0.0:0.9073:0.0	.	281	Q96FB5	RRNAD_HUMAN	S	281;260	ENSP00000357199:A281S;ENSP00000429756:A260S	ENSP00000357199:A281S	A	+	1	0	RRNAD1	154970629	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.400000	0.66320	2.494000	0.84150	0.561000	0.74099	GCC			0.642	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098973.1		NM_015997	
ZC3H11A	9877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	203819655	203819655	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr1:203819655T>C	ENST00000545588.1	+	15	5779	c.1952T>C	c.(1951-1953)gTg>gCg	p.V651A	ZC3H11A_ENST00000367212.3_Missense_Mutation_p.V651A|ZC3H11A_ENST00000332127.4_Missense_Mutation_p.V651A|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.V651A|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.V651A	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	651					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AAACCCAAAGTGAACGTGAAG	0.423																																					p.V651A													.	.			0			c.T1952C												118.0	120.0	119.0					1																	203819655		2203	4300	6503	SO:0001583	missense	9877	exon18			CCAAAGTGAACGT		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.1952T>C	1.37:g.203819655T>C	ENSP00000438527:p.Val651Ala		Somatic	142	0	0		WXS	Illumina HiSeq	.	192	0.17	32	NM_014827	6	0.50	3	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408891	0.83340	.	.	ENSG00000058673	ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18	5.62	5.62	0.85841	.	0.060915	0.64402	D	0.000002	T	0.74566	0.3733	M	0.77103	2.36	0.46167	D	0.998904	D	0.89917	1.0	D	0.91635	0.999	T	0.72478	-0.4281	10	0.21014	T	0.42	-18.7661	14.8047	0.69945	0.0:0.0:0.0:1.0	.	651	O75152	ZC11A_HUMAN	A	651;597;651;651;651;651	ENSP00000356183:V651A;ENSP00000356181:V651A;ENSP00000333253:V651A;ENSP00000438527:V651A;ENSP00000356179:V651A	ENSP00000333253:V651A	V	+	2	0	ZC3H11A	202086278	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.612000	0.54142	2.139000	0.66308	0.533000	0.62120	GTG			0.423	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087471.3		NM_014827	
CDHR1	92211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85972858	85972858	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr10:85972858G>C	ENST00000372117.3	+	16	1897	c.1794G>C	c.(1792-1794)gaG>gaC	p.E598D	CDHR1_ENST00000332904.3_Missense_Mutation_p.E598D|CDHR1_ENST00000440770.2_Missense_Mutation_p.E302D	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	598	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CCATAGACGAGGATGCAGAGG	0.557																																					p.E598D													.	.			0			c.G1794C												113.0	99.0	104.0					10																	85972858		2203	4300	6503	SO:0001583	missense	92211	exon16			AGACGAGGATGCA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1794G>C	10.37:g.85972858G>C	ENSP00000361189:p.Glu598Asp		Somatic	93	0	0		WXS	Illumina HiSeq	.	148	0.11	16	NM_001171971	0		0	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	G	2.481	-0.319677	0.05386	.	.	ENSG00000148600	ENST00000332904;ENST00000372117;ENST00000440770	T;T;T	0.52526	0.66;0.66;0.66	5.93	2.82	0.32997	Cadherin (4);Cadherin-like (1);	0.571454	0.20829	N	0.084934	T	0.23688	0.0573	N	0.20483	0.58	0.30015	N	0.814806	B;B;B	0.27625	0.183;0.002;0.003	B;B;B	0.25506	0.061;0.006;0.015	T	0.09443	-1.0674	10	0.12430	T	0.62	-6.9964	3.1163	0.06376	0.0849:0.2078:0.4443:0.263	.	302;598;598	E7EN47;Q96JP9-2;Q96JP9	.;.;CDHR1_HUMAN	D	598;598;302	ENSP00000331063:E598D;ENSP00000361189:E598D;ENSP00000415980:E302D	ENSP00000331063:E598D	E	+	3	2	CDHR1	85962838	1.000000	0.71417	0.998000	0.56505	0.287000	0.27160	0.747000	0.26290	1.523000	0.49018	0.655000	0.94253	GAG			0.557	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049111.1		NM_033100	
ACSL5	51703	broad.mit.edu	37	10	114182136	114182136	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr10:114182136G>T	ENST00000393081.1	+	17	1837	c.1530G>T	c.(1528-1530)aaG>aaT	p.K510N	ACSL5_ENST00000356116.1_Missense_Mutation_p.K566N|ACSL5_ENST00000433418.1_Missense_Mutation_p.K510N|ACSL5_ENST00000354655.4_Missense_Mutation_p.K510N|ACSL5_ENST00000369410.3_Missense_Mutation_p.K292N|ACSL5_ENST00000354273.4_Missense_Mutation_p.K510N|RP11-324O2.6_ENST00000424422.1_RNA	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	510					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		ACCCTGAGAAGACACAGGAAG	0.517																																					p.K566N													.	ACSL5	51		0			c.G1698T												109.0	101.0	103.0					10																	114182136		2203	4300	6503	SO:0001583	missense	51703	exon17			TGAGAAGACACAG	AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.1530G>T	10.37:g.114182136G>T	ENSP00000376796:p.Lys510Asn		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	92	0.05	5	NM_016234	17	0.00	0	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Missense_Mutation	SNP	ENST00000393081.1	37	CCDS7573.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.011141	0.54361	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273;ENST00000369410	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.71	-1.65	0.08291	AMP-dependent synthetase/ligase (1);	0.059403	0.64402	D	0.000001	T	0.64583	0.2611	M	0.91038	3.17	0.58432	D	0.999998	D;D;D;D	0.57899	0.958;0.975;0.981;0.957	D;P;D;P	0.64321	0.924;0.856;0.914;0.885	T	0.71586	-0.4548	10	0.62326	D	0.03	-19.2743	12.5337	0.56131	0.5642:0.0:0.4358:0.0	.	292;510;566;510	B4DX30;A6GV77;Q9ULC5-3;Q9ULC5	.;.;.;ACSL5_HUMAN	N	510;510;566;510;510;292	ENSP00000346680:K510N;ENSP00000376796:K510N;ENSP00000348429:K566N;ENSP00000403647:K510N;ENSP00000346223:K510N;ENSP00000358418:K292N	ENSP00000346223:K510N	K	+	3	2	ACSL5	114172126	0.997000	0.39634	0.912000	0.35992	0.983000	0.72400	0.524000	0.22940	-0.182000	0.10602	0.555000	0.69702	AAG			0.517	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050386.1		NM_016234	
ZDHHC24	254359	mdanderson.org	37	11	66307129	66307129	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr11:66307129G>T	ENST00000310442.3	-	3	960	c.726C>A	c.(724-726)tgC>tgA	p.C242*	ZDHHC24_ENST00000526986.1_Intron|CTD-3074O7.12_ENST00000602427.1_lincRNA|ZDHHC24_ENST00000525925.1_5'Flank	NM_207340.1	NP_997223.1	Q6UX98	ZDH24_HUMAN	zinc finger, DHHC-type containing 24	242						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|ovary(1)|prostate(1)|skin(1)	7						GCAGGTTGTGGCAGGGACCCA	0.687																																					p.C242X													.	.			0			c.C726A												20.0	23.0	22.0					11																	66307129		2199	4293	6492	SO:0001587	stop_gained	254359	exon3			GTTGTGGCAGGGA	BC005015	CCDS8143.1	11q13.2	2008-05-02				ENSG00000174165		"""Zinc fingers, DHHC-type"""	27387	protein-coding gene	gene with protein product							Standard	NM_207340		Approved		uc001oin.1	Q6UX98		ENST00000310442.3:c.726C>A	11.37:g.66307129G>T	ENSP00000309429:p.Cys242*		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_207340	63	0.00	0	Q6PEW7|Q9BSJ0	Nonsense_Mutation	SNP	ENST00000310442.3	37	CCDS8143.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171970	0.94807	.	.	ENSG00000174165	ENST00000310442	.	.	.	4.95	2.94	0.34122	.	0.913837	0.09376	N	0.810696	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-0.1776	10.7178	0.46023	0.0:0.4845:0.5155:0.0	.	.	.	.	X	242	.	ENSP00000309429:C242X	C	-	3	2	ZDHHC24	66063705	0.004000	0.15560	0.589000	0.28718	0.990000	0.78478	0.024000	0.13555	1.011000	0.39340	0.491000	0.48974	TGC			0.687	ZDHHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393089.1		NM_207340	
UNC93B1	81622	broad.mit.edu	37	11	67763107	67763107	+	Silent	SNP	A	A	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr11:67763107A>G	ENST00000227471.2	-	10	1414	c.1335T>C	c.(1333-1335)agT>agC	p.S445S	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	446					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											TGTTCAGGGCACTGCCCACAC	0.617																																					.													.	.			0			.												10.0	10.0	10.0					11																	67763107		1758	3730	5488	SO:0001819	synonymous_variant	81622	.			CAGGGCACTGCCC	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1335T>C	11.37:g.67763107A>G			Somatic	75	0.0266666667	2		WXS	Illumina HiSeq	Phase_I	82	0.06	5	.	72	0.00	0	O95764|Q569H6|Q710D4	Silent	SNP	ENST00000227471.2	37																																																																																						0.617	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_030930	
BCL9L	283149	mdanderson.org	37	11	118769751	118769751	+	Silent	SNP	G	G	A	rs141872454		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr11:118769751G>A	ENST00000334801.3	-	8	4837	c.3873C>T	c.(3871-3873)gaC>gaT	p.D1291D	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1291	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.D1291D(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GTGGGTATGCGTCGCCCATGC	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		15302	0.0		0.001	False		,,,				2504	0.0				p.D1291D													BCL9L_ENST00000392849,NS,carcinoma,0,2	BCL9L_ENST00000392849	0	2	2	Substitution - coding silent(2)	endometrium(2)	c.C3873T							G		0,4400		0,0,2200	28.0	27.0	27.0		3873	-5.3	0.0	11	dbSNP_134	27	3,8583	3.0+/-9.4	0,3,4290	yes	coding-synonymous	BCL9L	NM_182557.2		0,3,6490	AA,AG,GG		0.0349,0.0,0.0231		1291/1500	118769751	3,12983	2200	4293	6493	SO:0001819	synonymous_variant	283149	exon8			GTATGCGTCGCCC	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3873C>T	11.37:g.118769751G>A			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_182557	5	0.00	0	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	ENST00000334801.3	37	CCDS8403.1																																																																																			0		0.697	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389653.1		NM_182557	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,25136	KRAS_ENST00000256078	0	25136	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T												91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		Somatic	181	0	0		WXS	Illumina HiSeq	.	302	0.07	20	NM_004985	1	0.00	0	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
RACGAP1	29127	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	50393482	50393482	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr12:50393482G>C	ENST00000427314.2	-	10	888	c.665C>G	c.(664-666)aCt>aGt	p.T222S	RACGAP1_ENST00000312377.5_Missense_Mutation_p.T222S|RACGAP1_ENST00000547905.1_Missense_Mutation_p.T222S|RACGAP1_ENST00000454520.2_Missense_Mutation_p.T222S|RACGAP1_ENST00000547061.1_5'UTR|RACGAP1_ENST00000551016.1_Missense_Mutation_p.T222S|RACGAP1_ENST00000434422.1_Missense_Mutation_p.T222S	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						ATTGGGAACAGTCACTGTAGT	0.438																																					p.T222S													.	.			0			c.C665G												83.0	74.0	77.0					12																	50393482		2203	4300	6503	SO:0001583	missense	29127	exon10			GGAACAGTCACTG		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.665C>G	12.37:g.50393482G>C	ENSP00000404190:p.Thr222Ser		Somatic	94	0	0		WXS	Illumina HiSeq	.	101	0.10	10	NM_013277	7	0.00	0		Missense_Mutation	SNP	ENST00000427314.2	37	CCDS8795.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483735	0.44147	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000549342;ENST00000552310;ENST00000550149	T;T;T;T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46;2.71;-0.46;-0.46	5.42	5.42	0.78866	.	0.091527	0.85682	D	0.000000	T	0.56321	0.1977	L	0.45051	1.395	0.58432	D	0.999998	B	0.22146	0.065	B	0.18263	0.021	T	0.51116	-0.8746	10	0.17832	T	0.49	-16.6555	12.9821	0.58570	0.084:0.0:0.916:0.0	.	222	Q9H0H5	RGAP1_HUMAN	S	222;222;222;222;222;222;13;222;148	ENSP00000404190:T222S;ENSP00000309871:T222S;ENSP00000413241:T222S;ENSP00000404808:T222S;ENSP00000449374:T222S;ENSP00000449370:T222S;ENSP00000449565:T13S;ENSP00000448697:T222S;ENSP00000446642:T148S	ENSP00000309871:T222S	T	-	2	0	RACGAP1	48679749	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.056000	0.71111	2.536000	0.85505	0.462000	0.41574	ACT			0.438	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405997.1		NM_013277	
KRT82	3888	mdanderson.org	37	12	52794398	52794398	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr12:52794398G>T	ENST00000257974.2	-	4	767	c.690C>A	c.(688-690)gaC>gaA	p.D230E	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	230	Coil 1B.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		GGAAGGCTGTGTCCACGTCCT	0.612																																					p.D230E													.	.			0			c.C690A												100.0	84.0	89.0					12																	52794398		2203	4300	6503	SO:0001583	missense	3888	exon4			GGCTGTGTCCACG	Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.690C>A	12.37:g.52794398G>T	ENSP00000257974:p.Asp230Glu		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_033033	0		0		Missense_Mutation	SNP	ENST00000257974.2	37	CCDS8826.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464779	0.63513	.	.	ENSG00000161850	ENST00000257974	D	0.91237	-2.81	5.03	1.68	0.24146	Filament (1);	0.000000	0.52532	D	0.000071	D	0.95258	0.8462	M	0.92459	3.31	0.27952	N	0.937104	D	0.89917	1.0	D	0.87578	0.998	D	0.88764	0.3259	10	0.87932	D	0	.	7.8157	0.29258	0.3802:0.0:0.6198:0.0	.	230	Q9NSB4	KRT82_HUMAN	E	230	ENSP00000257974:D230E	ENSP00000257974:D230E	D	-	3	2	KRT82	51080665	0.567000	0.26626	0.999000	0.59377	0.805000	0.45488	1.018000	0.30002	0.647000	0.30713	0.462000	0.41574	GAC			0.612	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405189.1		NM_033033	
HNRNPA1	3178	hgsc.bcm.edu	37	12	54677045	54677045	+	Intron	SNP	G	G	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr12:54677045G>A	ENST00000340913.6	+	8	960				HNRNPA1_ENST00000547276.1_Intron|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000546500.1_Intron|HNRNPA1_ENST00000330752.8_Intron	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1						cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						CCAAGTACTTGGTGTGACAGC	0.493																																					.	Colon(83;502 1289 8436 16406 24870)												.	.			0			.												53.0	71.0	65.0					12																	54677045		2054	4205	6259	SO:0001627	intron_variant	664709	.			GTACTTGGTGTGA	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.907+27G>A	12.37:g.54677045G>A			Somatic	84	0	0		WXS	Illumina HiSeq	.	124	0.11	14	.	0		0	A8K4Z8|Q3MIB7|Q6PJZ7	RNA	SNP	ENST00000340913.6	37	CCDS44909.1																																																																																					0.493	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000405480.1		NM_031157	
ZMYM2	7750	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	20610939	20610939	+	Missense_Mutation	SNP	A	A	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr13:20610939A>T	ENST00000382874.2	+	13	2372	c.2182A>T	c.(2182-2184)Aac>Tac	p.N728Y	ZMYM2_ENST00000382883.3_Missense_Mutation_p.N210Y|ZMYM2_ENST00000382869.3_Missense_Mutation_p.N728Y|ZMYM2_ENST00000382871.2_Missense_Mutation_p.N728Y	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	728					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TGTTACTTGCAACTATTGTTC	0.328																																					p.N728Y													.	.			0			c.A2182T												125.0	117.0	119.0					13																	20610939		1837	4093	5930	SO:0001583	missense	7750	exon13			ACTTGCAACTATT	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.2182A>T	13.37:g.20610939A>T	ENSP00000372327:p.Asn728Tyr		Somatic	126	0	0		WXS	Illumina HiSeq	.	136	0.09	12	NM_001190964	3	0.00	0	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.437051	0.83885	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382883;ENST00000382870	T;T;T;T	0.45668	2.18;2.18;2.18;0.89	5.51	5.51	0.81932	TRASH (1);Zinc finger, MYM-type (1);	0.000000	0.85682	D	0.000000	T	0.59770	0.2218	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62440	-0.6854	10	0.72032	D	0.01	-8.193	15.6207	0.76805	1.0:0.0:0.0:0.0	.	728	Q9UBW7	ZMYM2_HUMAN	Y	728;728;728;728;210;108	ENSP00000372322:N728Y;ENSP00000372327:N728Y;ENSP00000372324:N728Y;ENSP00000372336:N210Y	ENSP00000372322:N728Y	N	+	1	0	ZMYM2	19508939	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.097000	0.63578	0.397000	0.26171	AAC			0.328	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044051.2		NM_003453	
NUPL1	9818	bcgsc.ca	37	13	25875927	25875927	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr13:25875927T>C	ENST00000381736.3	+	1	266	c.16T>C	c.(16-18)Tcc>Ccc	p.S6P	RP11-271M24.2_ENST00000568856.2_lincRNA|NUPL1_ENST00000381718.3_Missense_Mutation_p.S6P|NUPL1_ENST00000466694.1_3'UTR|NUPL1_ENST00000463407.1_Missense_Mutation_p.S6P	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1	6					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		CACAGGGTTCTCCTTCGGGTC	0.672																																					p.S6P	Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)												.	NUPL1	37		0			c.T16C												35.0	35.0	35.0					13																	25875927		2202	4300	6502	SO:0001583	missense	9818	exon1			GGGTTCTCCTTCG	AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.16T>C	13.37:g.25875927T>C	ENSP00000371155:p.Ser6Pro		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_1	58	0.07	4	NM_014089	8	0.00	0	A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	Missense_Mutation	SNP	ENST00000381736.3	37	CCDS9314.1	.	.	.	.	.	.	.	.	.	.	T	11.92	1.783878	0.31593	.	.	ENSG00000139496	ENST00000381736;ENST00000381745;ENST00000313619;ENST00000463407;ENST00000381718;ENST00000381747	T;T;T;T	0.38560	1.28;1.17;1.36;1.13	4.4	3.18	0.36537	.	0.222263	0.45126	D	0.000398	T	0.41949	0.1181	L	0.60455	1.87	0.41244	D	0.986662	B;B;B	0.34015	0.435;0.435;0.435	B;B;B	0.40602	0.234;0.234;0.334	T	0.32613	-0.9900	10	0.54805	T	0.06	-5.4636	8.183	0.31322	0.1786:0.0:0.0:0.8214	.	6;6;6	A6NI12;Q9BVL2;Q9BVL2-2	.;NUPL1_HUMAN;.	P	6	ENSP00000371155:S6P;ENSP00000418555:S6P;ENSP00000371137:S6P;ENSP00000371166:S6P	ENSP00000318459:S6P	S	+	1	0	NUPL1	24773927	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	2.474000	0.45154	0.622000	0.30249	0.482000	0.46254	TCC			0.672	NUPL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000044228.2			
TPTE2P2	644623	broad.mit.edu	37	13	52855276	52855277	+	RNA	DEL	TG	TG	-	rs373565102|rs377643612		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr13:52855276_52855277delTG	ENST00000451298.1	-	0	333																											ctggtgtgcttgtgtgtgtgtg	0.47																																					.													.	.			0			.																																											0	.			TGTGCTTGTGTGT																													13.37:g.52855286_52855287delTG			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	11	0.64	7	.	0		0		RNA	DEL	ENST00000451298.1	37																																																																																						0.470	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000471093.1			
ACIN1	22985	broad.mit.edu	37	14	23530745	23530745	+	Silent	SNP	T	T	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr14:23530745T>G	ENST00000262710.1	-	17	3687	c.3360A>C	c.(3358-3360)ccA>ccC	p.P1120P	ACIN1_ENST00000555053.1_Silent_p.P1107P|ACIN1_ENST00000357481.2_Silent_p.P362P|ACIN1_ENST00000557515.1_Silent_p.P361P|ACIN1_ENST00000457657.1_Silent_p.P1080P|ACIN1_ENST00000338631.6_Silent_p.P393P|ACIN1_ENST00000397341.3_Silent_p.P362P|ACIN1_ENST00000605057.1_Silent_p.P1062P	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1120	Pro-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		GGGGTGGGGGTGGGGGGTGCA	0.657																																					p.P1120P													.	ACIN1	147		0			c.A3360C												7.0	10.0	9.0					14																	23530745		2074	3973	6047	SO:0001819	synonymous_variant	22985	exon17			TGGGGGTGGGGGG	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3360A>C	14.37:g.23530745T>G			Somatic	50	0.1	5		WXS	Illumina HiSeq	Phase_I	77	0.23	18	NM_014977	67	0.04	3	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	ENST00000262710.1	37	CCDS9587.1																																																																																					0.657	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000071707.3		NM_014977	
KIAA0586	9786	broad.mit.edu	37	14	58934640	58934640	+	Splice_Site	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr14:58934640G>T	ENST00000556134.1	+	17	2671	c.2397G>T	c.(2395-2397)caG>caT	p.Q799H	KIAA0586_ENST00000423743.3_Splice_Site_p.Q770H|KIAA0586_ENST00000261244.5_Splice_Site_p.Q738H|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000354386.6_Splice_Site_p.Q867H	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	799					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTACTGTGCAGGTATGCCAGG	0.348																																					p.Q867H													.	KIAA0586	180		0			c.G2601T												60.0	57.0	58.0					14																	58934640		1821	4084	5905	SO:0001630	splice_region_variant	9786	exon18			TGTGCAGGTATGC	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2397+1G>T	14.37:g.58934640G>T			Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	143	0.03	5	NM_001244189	0		0	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Splice_Site	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.017526	0.75161	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.77711	0.4171	M	0.76002	2.32	0.51482	D	0.999924	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.998;0.994;0.999;0.999	T	0.79417	-0.1812	10	0.87932	D	0	.	19.663	0.95879	0.0:0.0:1.0:0.0	.	674;674;867;738;799;770	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	H	867;799;770;738;674	ENSP00000346359:Q867H;ENSP00000452351:Q799H;ENSP00000399427:Q770H;ENSP00000261244:Q738H	ENSP00000261244:Q738H	Q	+	3	2	KIAA0586	58004393	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	6.654000	0.74387	2.648000	0.89879	0.655000	0.94253	CAG			0.348	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000411887.1		NM_014749	Missense_Mutation
IRF2BPL	64207	mdanderson.org	37	14	77493785	77493785	+	Silent	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr14:77493785C>T	ENST00000238647.3	-	1	1249	c.351G>A	c.(349-351)caG>caA	p.Q117Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	117	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgctgctgctgtt	0.701																																					p.Q117Q													.	.			0			c.G351A												3.0	2.0	2.0					14																	77493785		1218	2264	3482	SO:0001819	synonymous_variant	64207	exon1			CTGCTGCTGCTGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.351G>A	14.37:g.77493785C>T			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_024496	1	0.00	0	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																					0.701	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414298.1		NM_024496	
TDP1	55775	mdanderson.org	37	14	90499479	90499479	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr14:90499479G>T	ENST00000335725.4	+	16	1924	c.1674G>T	c.(1672-1674)aaG>aaT	p.K558N	TDP1_ENST00000357382.3_Missense_Mutation_p.K319N|TDP1_ENST00000393454.2_Missense_Mutation_p.K558N|TDP1_ENST00000555880.1_Intron|TDP1_ENST00000393452.3_Missense_Mutation_p.V574F	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	558					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		TGAAACAGAAGTTCTTCGCTG	0.443								Repair of DNA-protein crosslinks																													p.K558N													.	.			0			c.G1674T												63.0	59.0	60.0					14																	90499479		2203	4300	6503	SO:0001583	missense	55775	exon16			ACAGAAGTTCTTC	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.1674G>T	14.37:g.90499479G>T	ENSP00000337353:p.Lys558Asn		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	106	0.05	5	NM_018319	14	0.00	0	Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Missense_Mutation	SNP	ENST00000335725.4	37	CCDS9888.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.181|7.181	0.589586|0.589586	0.13812|0.13812	.|.	.|.	ENSG00000042088|ENSG00000042088	ENST00000393454;ENST00000335725;ENST00000357382|ENST00000393452;ENST00000556063	T;T;T|T	0.42131|0.33438	0.98;0.98;0.98|1.41	5.9|5.9	0.81|0.81	0.18732|0.18732	.|.	0.254499|.	0.44688|.	D|.	0.000432|.	T|T	0.16599|0.16599	0.0399|0.0399	N|N	0.16478|0.16478	0.41|0.41	0.32703|0.32703	N|N	0.512588|0.512588	B;B;B|P	0.09022|0.38250	0.001;0.002;0.002|0.624	B;B;B|B	0.10450|0.34722	0.005;0.002;0.004|0.188	T|T	0.19257|0.19257	-1.0311|-1.0311	10|9	0.19147|0.51188	T|T	0.46|0.08	-23.9936|-23.9936	7.9911|7.9911	0.30242|0.30242	0.6564:0.0:0.3436:0.0|0.6564:0.0:0.3436:0.0	.|.	558;319;558|574	B2RDI0;Q86TV8;Q9NUW8|E7EPD8	.;.;TYDP1_HUMAN|.	N|F	558;558;319|574;199	ENSP00000377099:K558N;ENSP00000337353:K558N;ENSP00000349952:K319N|ENSP00000377098:V574F	ENSP00000337353:K558N|ENSP00000377098:V574F	K|V	+|+	3|1	2|0	TDP1|TDP1	89569232|89569232	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.201000|0.201000	0.24016|0.24016	0.879000|0.879000	0.28146|0.28146	-0.089000|-0.089000	0.12484|0.12484	-0.225000|-0.225000	0.12378|0.12378	AAG|GTT			0.443	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411239.1		NM_018319	
TRMT61A	115708	mdanderson.org	37	14	104001019	104001019	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr14:104001019G>T	ENST00000389749.4	+	4	838	c.731G>T	c.(730-732)aGc>aTc	p.S244I		NM_152307.2	NP_689520.2	Q96FX7	TRM61_HUMAN	tRNA methyltransferase 61 homolog A (S. cerevisiae)	244						nucleus (GO:0005634)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			skin(1)	1						CGCACTGTCAGCCTGCCACCG	0.697																																					p.S244I													.	.			0			c.G731T												15.0	22.0	20.0					14																	104001019		2135	4223	6358	SO:0001583	missense	115708	exon4			CTGTCAGCCTGCC	AK097771	CCDS41994.1	14q32	2009-01-09	2009-01-09	2009-01-09		ENSG00000166166			23790	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 172"""	C14orf172		16043508	Standard	NM_152307		Approved	FLJ40452, GCD14, Gcd14p, hTRM61	uc010aws.3	Q96FX7		ENST00000389749.4:c.731G>T	14.37:g.104001019G>T	ENSP00000374399:p.Ser244Ile		Somatic	35	0.0857142857	3		WXS	Illumina HiSeq	Phase_I	67	0.15	10	NM_152307	13	0.00	0	A6NN78|Q8N7Q9	Missense_Mutation	SNP	ENST00000389749.4	37	CCDS41994.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.78|11.78	1.740375|1.740375	0.30865|0.30865	.|.	.|.	ENSG00000166166|ENSG00000166166	ENST00000299202|ENST00000389749;ENST00000299201	.|T	.|0.45668	.|0.89	4.67|4.67	3.63|3.63	0.41609|0.41609	.|.	.|0.658034	.|0.15514	.|N	.|0.258391	T|T	0.26774|0.26774	0.0655|0.0655	N|N	0.20483|0.20483	0.58|0.58	0.41995|0.41995	D|D	0.990869|0.990869	.|B	.|0.24132	.|0.098	.|B	.|0.23716	.|0.048	T|T	0.11179|0.11179	-1.0598|-1.0598	5|10	.|0.42905	.|T	.|0.14	-4.0183|-4.0183	8.2926|8.2926	0.31967|0.31967	0.2251:0.0:0.7749:0.0|0.2251:0.0:0.7749:0.0	.|.	.|244	.|Q96FX7	.|TRM61_HUMAN	S|I	146|244	.|ENSP00000374399:S244I	.|ENSP00000299201:S244I	A|S	+|+	1|2	0|0	TRMT61A|TRMT61A	103070772|103070772	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.671000|0.671000	0.39405|0.39405	2.535000|2.535000	0.45685|0.45685	2.140000|2.140000	0.66376|0.66376	0.313000|0.313000	0.20887|0.20887	GCC|AGC			0.697	TRMT61A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414988.1		NM_152307	
TMEM179	388021	mdanderson.org	37	14	105070822	105070822	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr14:105070822G>T	ENST00000556573.1	-	1	498	c.257C>A	c.(256-258)gCc>gAc	p.A86D	TMEM179_ENST00000341595.3_Missense_Mutation_p.A86D			Q6ZVK1	T179A_HUMAN	transmembrane protein 179	86						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)	4			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		GGCGTGCGCGGCGGCCAGCAG	0.746																																					p.A86D													.	.			0			c.C257A												5.0	7.0	6.0					14																	105070822		2070	4132	6202	SO:0001583	missense	388021	exon1			TGCGCGGCGGCCA	AK124477	CCDS66723.1, CCDS73688.1	14q32.33	2012-04-11	2006-10-16	2006-10-16	ENSG00000258986	ENSG00000258986			20137	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 90"""	C14orf90			Standard	NM_001286390		Approved	FLJ42486, TMEM179A	uc001yox.1	Q6ZVK1	OTTHUMG00000170829	ENST00000556573.1:c.257C>A	14.37:g.105070822G>T	ENSP00000450958:p.Ala86Asp		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_207379	0		0		Missense_Mutation	SNP	ENST00000556573.1	37		.	.	.	.	.	.	.	.	.	.	G	23.2	4.392483	0.83011	.	.	ENSG00000189203;ENSG00000258986;ENSG00000258986	ENST00000415614;ENST00000556573;ENST00000341595	T;T;T	0.22945	1.93;1.93;1.93	2.75	1.69	0.24217	.	0.199608	0.43110	D	0.000605	T	0.33469	0.0864	L	0.59436	1.845	0.50632	D	0.999888	D	0.53462	0.96	P	0.52856	0.711	T	0.18366	-1.0339	10	0.56958	D	0.05	.	9.9686	0.41741	0.1293:0.0:0.8707:0.0	.	86	Q6ZVK1-2	.	D	86	ENSP00000397763:A86D;ENSP00000450958:A86D;ENSP00000340477:A86D	ENSP00000340477:A86D	A	-	2	0	RP11-614O9.3;TMEM179	104141867	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.901000	0.69861	1.352000	0.45808	0.462000	0.41574	GCC			0.746	TMEM179-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000410585.1		NM_207379	
RP11-160C18.2	0	broad.mit.edu	37	15	79023030	79023031	+	RNA	INS	-	-	G	rs35207108|rs397818089|rs186704195	byFrequency	TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr15:79023030_79023031insG	ENST00000568337.1	+	0	31																											ccaccatgcccggccCTTGCTG	0.446													ggg|GG|GGG|deletion	2403	0.479832	0.174	0.6225	5008	,	,		18119	0.4722		0.7465	False		,,,				2504	0.5256				.													.	.			0			.																																											0	.			CATGCCCGGCCCT																													15.37:g.79023032_79023032dupG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	7	0.57	4	.	0		0		RNA	INS	ENST00000568337.1	37																																																																																						0.446	RP11-160C18.2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000421327.1			
MSLN	10232	mdanderson.org	37	16	816065	816065	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr16:816065C>T	ENST00000382862.3	+	11	997	c.902C>T	c.(901-903)gCc>gTc	p.A301V	MSLN_ENST00000563941.1_Missense_Mutation_p.A301V|MSLN_ENST00000566549.1_Missense_Mutation_p.A301V|MSLN_ENST00000545450.2_Missense_Mutation_p.A301V	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	301					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				GCAGAGACAGCCTGTCCTTCA	0.612																																					p.A301V													.	.			0			c.C902T												33.0	35.0	34.0					16																	816065		2175	4281	6456	SO:0001583	missense	10232	exon12			AGACAGCCTGTCC	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.902C>T	16.37:g.816065C>T	ENSP00000372313:p.Ala301Val		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_005823	0		0	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Missense_Mutation	SNP	ENST00000382862.3	37	CCDS32356.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759902	0.31137	.	.	ENSG00000102854	ENST00000446427;ENST00000445361;ENST00000545450;ENST00000382862	T;T	0.17691	2.26;2.26	4.67	-3.17	0.05202	.	0.938402	0.08871	N	0.881510	T	0.09686	0.0238	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.10296	0.001;0.001;0.003;0.001	B;B;B;B	0.13407	0.005;0.008;0.009;0.005	T	0.38908	-0.9639	10	0.39692	T	0.17	-0.6079	1.0935	0.01668	0.1399:0.2779:0.301:0.2813	.	300;301;301;301	Q13421-4;Q13421;Q13421-2;Q13421-3	.;MSLN_HUMAN;.;.	V	301	ENSP00000442965:A301V;ENSP00000372313:A301V	ENSP00000372313:A301V	A	+	2	0	MSLN	756066	0.000000	0.05858	0.173000	0.22940	0.071000	0.16799	-1.097000	0.03349	-0.187000	0.10516	0.551000	0.68910	GCC			0.612	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000109253.2			
MEFV	4210	broad.mit.edu	37	16	3304501	3304501	+	Silent	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr16:3304501G>T	ENST00000219596.1	-	2	606	c.567C>A	c.(565-567)ggC>ggA	p.G189G	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	189					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CCCTGCAGGGGCCGGGGCTTC	0.781																																					p.G189G													MEFV,NS,carcinoma,-2,1	MEFV	170	1	0			c.C567A												4.0	5.0	5.0					16																	3304501		1729	3556	5285	SO:0001819	synonymous_variant	4210	exon2			GCAGGGGCCGGGG	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.567C>A	16.37:g.3304501G>T			Somatic	29	0.0689655172	2		WXS	Illumina HiSeq	Phase_I	38	0.11	4	NM_000243	0		0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																					0.781	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251464.1		NM_000243	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3830851	3830851	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr16:3830851C>T	ENST00000262367.5	-	8	2514	c.1705G>A	c.(1705-1707)Ggt>Agt	p.G569S	CREBBP_ENST00000382070.3_Missense_Mutation_p.G531S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	569					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CCAATGTTACCAGAGTTGGAG	0.483			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.G569S				Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.			0			c.G1705A												108.0	95.0	100.0					16																	3830851		2197	4300	6497	SO:0001583	missense	1387	exon8			TGTTACCAGAGTT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.1705G>A	16.37:g.3830851C>T	ENSP00000262367:p.Gly569Ser		Somatic	89	0	0		WXS	Illumina HiSeq	.	127	0.12	15	NM_004380	1	0.00	0	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902779	0.52227	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.84070	-1.8;-1.74	5.53	5.53	0.82687	.	0.216002	0.41194	D	0.000923	D	0.87386	0.6164	M	0.64404	1.975	0.58432	D	0.999999	B;D	0.69078	0.23;0.997	B;P	0.62560	0.183;0.904	D	0.85196	0.1012	10	0.30078	T	0.28	-3.4353	12.7623	0.57372	0.0:0.9246:0.0:0.0754	.	599;569	Q4LE28;Q92793	.;CBP_HUMAN	S	569;599;531	ENSP00000262367:G569S;ENSP00000371502:G531S	ENSP00000262367:G569S	G	-	1	0	CREBBP	3770852	1.000000	0.71417	0.609000	0.28983	0.959000	0.62525	5.640000	0.67875	2.604000	0.88044	0.591000	0.81541	GGT			0.483	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251591.2		NM_004380	
SH2B1	25970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28883695	28883695	+	Silent	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr16:28883695C>T	ENST00000322610.8	+	9	2137	c.1698C>T	c.(1696-1698)ctC>ctT	p.L566L	SH2B1_ENST00000395532.4_Silent_p.L566L|SH2B1_ENST00000337120.5_Silent_p.L566L|SH2B1_ENST00000545570.1_Silent_p.L256L|SH2B1_ENST00000538342.1_Silent_p.L230L|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000359285.5_Silent_p.L566L			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	566	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						AATACGTCCTCACCTTCAACT	0.627																																					p.L566L													.	.			0			c.C1698T												51.0	52.0	51.0					16																	28883695		2197	4300	6497	SO:0001819	synonymous_variant	25970	exon7			CGTCCTCACCTTC	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1698C>T	16.37:g.28883695C>T			Somatic	74	0	0		WXS	Illumina HiSeq	.	83	0.16	13	NM_001145796	54	0.02	1	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Silent	SNP	ENST00000322610.8	37	CCDS53996.1																																																																																					0.627	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000432666.1		NM_015503	
TANGO6	79613	mdanderson.org	37	16	68912021	68912021	+	Splice_Site	SNP	G	G	T	rs201648074		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr16:68912021G>T	ENST00000261778.1	+	6	1144	c.1132G>T	c.(1132-1134)Gtt>Ttt	p.V378F		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	378						integral component of membrane (GO:0016021)											TTTTTTGTAGGTTCTGGATTT	0.308																																					p.V378F													.	.			0			c.G1132T												75.0	67.0	70.0					16																	68912021		1855	4103	5958	SO:0001630	splice_region_variant	79613	exon6			TTGTAGGTTCTGG		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.1132-1G>T	16.37:g.68912021G>T			Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	86	0.06	5	NM_024562	0		0	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	37	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	G	9.592	1.126358	0.20959	.	.	ENSG00000103047	ENST00000261778	T	0.69806	-0.43	5.33	1.85	0.25348	.	.	.	.	.	T	0.48804	0.1520	N	0.24115	0.695	0.25999	N	0.982141	B	0.23735	0.09	B	0.24006	0.05	T	0.31081	-0.9956	8	.	.	.	-2.4143	8.6197	0.33853	0.7447:0.0:0.2553:0.0	.	378	Q9C0B7	TMCO7_HUMAN	F	378	ENSP00000261778:V378F	.	V	+	1	0	TMCO7	67469522	1.000000	0.71417	0.992000	0.48379	0.366000	0.29705	1.026000	0.30103	0.045000	0.15804	-1.128000	0.01989	GTT	0.002		0.308	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433471.2		XM_928235.2	Missense_Mutation
PIEZO1	9780	broad.mit.edu	37	16	88800398	88800398	+	Missense_Mutation	SNP	G	G	C	rs144777557|rs144269709|rs62639697	byFrequency	TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr16:88800398G>C	ENST00000301015.9	-	17	2491	c.2245C>G	c.(2245-2247)Cag>Gag	p.Q749E	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	749					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.Q749delQ(1)|p.E756_D757insE(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						tcctcctcctgctgctgctgc	0.667																																					p.Q749E													.	PIEZO1	79		2	Insertion - In frame(1)|Deletion - In frame(1)	prostate(1)|breast(1)	c.C2245G												8.0	10.0	9.0					16																	88800398		685	1572	2257	SO:0001583	missense	9780	exon17			CCTCCTGCTGCTG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2245C>G	16.37:g.88800398G>C	ENSP00000301015:p.Gln749Glu		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	79	0.04	3	NM_001142864	0		0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.005|0.005	-2.233254|-2.233254	0.00277|0.00277	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.40756	.|1.02	0.844|0.844	0.844|0.844	0.18943|0.18943	.|.	.|3.384400	.|0.02084	.|N	.|0.052613	T|T	0.19604|0.19604	0.0471|0.0471	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.38436|0.38436	-0.9661|-0.9661	5|10	.|0.02654	.|T	.|1	.|.	7.2811|7.2811	0.26312|0.26312	0.0:0.4248:0.5752:0.0|0.0:0.4248:0.5752:0.0	rs62639697|rs62639697	.|749	.|Q92508	.|PIEZ1_HUMAN	G|E	694|749	.|ENSP00000301015:Q749E	.|ENSP00000301015:Q749E	A|Q	-|-	2|1	0|0	FAM38A|FAM38A	87327899|87327899	0.000000|0.000000	0.05858|0.05858	0.092000|0.092000	0.20876|0.20876	0.022000|0.022000	0.10575|0.10575	-0.494000|-0.494000	0.06451|0.06451	-1.966000|-1.966000	0.01009|0.01009	-1.954000|-1.954000	0.00483|0.00483	GCA|CAG			0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000345699.4		NM_014745	
GAS8	2622	mdanderson.org	37	16	90097758	90097758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr16:90097758G>T	ENST00000268699.4	+	3	264	c.142G>T	c.(142-144)Gaa>Taa	p.E48*	C16orf3_ENST00000408886.2_5'Flank|GAS8_ENST00000536122.1_Nonsense_Mutation_p.E23*|GAS8_ENST00000540721.1_3'UTR	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8	48	Regulates microtubule-binding. {ECO:0000250}.				cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		CGAGCGGGAGGAACGAAACTA	0.622																																					p.E48X													.	.			0			c.G142T												98.0	91.0	93.0					16																	90097758		2198	4300	6498	SO:0001587	stop_gained	2622	exon3			CGGGAGGAACGAA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.142G>T	16.37:g.90097758G>T	ENSP00000268699:p.Glu48*		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001481	1	0.00	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Nonsense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	G	37	6.600438	0.97697	.	.	ENSG00000141013	ENST00000536122;ENST00000268699;ENST00000540721;ENST00000537797	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-32.8035	20.2366	0.98359	0.0:0.0:1.0:0.0	.	.	.	.	X	23;48;19;48	.	.	E	+	1	0	GAS8	88625259	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.564000	0.98151	2.792000	0.96026	0.557000	0.71058	GAA			0.622	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000272877.2			
CTC1	80169	mdanderson.org	37	17	8138529	8138529	+	Silent	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:8138529G>T	ENST00000315684.8	-	8	1288	c.1281C>A	c.(1279-1281)ggC>ggA	p.G427G	CTC1_ENST00000581671.1_5'Flank	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	427					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GCAGAACGGCGCCACGGAGGC	0.607																																					p.G427G													.	.			0			c.C1281A												62.0	70.0	68.0					17																	8138529		2063	4201	6264	SO:0001819	synonymous_variant	80169	exon8			AACGGCGCCACGG	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.1281C>A	17.37:g.8138529G>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_025099	1	0.00	0	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Silent	SNP	ENST00000315684.8	37	CCDS42259.1																																																																																					0.607	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000442012.1		NM_025099	
MYO1D	4642	broad.mit.edu	37	17	31105537	31105537	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:31105537G>A	ENST00000318217.5	-	3	663	c.359C>T	c.(358-360)gCg>gTg	p.A120V	MYO1D_ENST00000579584.1_Missense_Mutation_p.A120V|MYO1D_ENST00000583621.1_Missense_Mutation_p.A120V|MYO1D_ENST00000394649.4_Missense_Mutation_p.A32V	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	120	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GGTGATGGCCGCAATATACTG	0.438																																					p.A120V													.	MYO1D	93		0			c.C359T												190.0	165.0	174.0					17																	31105537		2203	4300	6503	SO:0001583	missense	4642	exon3			ATGGCCGCAATAT	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.359C>T	17.37:g.31105537G>A	ENSP00000324527:p.Ala120Val		Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	279	0.01	4	NM_015194	2	0.00	0	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	G	35	5.452549	0.96223	.	.	ENSG00000176658	ENST00000318217	D	0.90133	-2.62	5.2	5.2	0.72013	Myosin head, motor domain (3);	0.000000	0.37261	U	0.002172	D	0.96537	0.8870	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97086	0.9787	10	0.87932	D	0	.	16.6187	0.84924	0.0:0.0:1.0:0.0	.	31;120	Q7Z3N6;O94832	.;MYO1D_HUMAN	V	120	ENSP00000324527:A120V	ENSP00000324527:A120V	A	-	2	0	MYO1D	28129650	1.000000	0.71417	0.633000	0.29310	0.993000	0.82548	9.596000	0.98267	2.861000	0.98227	0.655000	0.94253	GCG			0.438	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447457.1			
AOC3	8639	broad.mit.edu	37	17	41004673	41004673	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:41004673T>C	ENST00000308423.2	+	1	1473	c.1313T>C	c.(1312-1314)cTc>cCc	p.L438P	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	438					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	AACCAGGGCCTCCCCCTGCGG	0.552																																					p.L438P	NSCLC(3;192 220 10664 11501 16477)												.	AOC3	88		0			c.T1313C												104.0	92.0	96.0					17																	41004673		2203	4300	6503	SO:0001583	missense	8639	exon1			AGGGCCTCCCCCT	AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1313T>C	17.37:g.41004673T>C	ENSP00000312326:p.Leu438Pro		Somatic	103	0.0097087379	1		WXS	Illumina HiSeq	Phase_I	122	0.03	4	NM_003734	1	0.00	0	B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	ENST00000308423.2	37	CCDS11444.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.045936	0.36085	.	.	ENSG00000131471	ENST00000308423	T	0.03920	3.76	4.64	4.64	0.57946	Copper amine oxidase, C-terminal (3);	0.075920	0.56097	D	0.000025	T	0.20129	0.0484	M	0.80982	2.52	0.20703	N	0.999863	D	0.89917	1.0	D	0.78314	0.991	T	0.02560	-1.1141	10	0.66056	D	0.02	.	10.631	0.45536	0.0:0.0785:0.0:0.9215	.	438	Q16853	AOC3_HUMAN	P	438	ENSP00000312326:L438P	ENSP00000312326:L438P	L	+	2	0	AOC3	38258199	0.001000	0.12720	0.997000	0.53966	0.634000	0.38068	1.191000	0.32138	2.093000	0.63338	0.482000	0.46254	CTC			0.552	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452444.1		NM_003734	
KIF2B	84643	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	51901904	51901904	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:51901904C>T	ENST00000268919.4	+	1	1666	c.1510C>T	c.(1510-1512)Cgg>Tgg	p.R504W		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	504	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R504W(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ACTGGTGCTCCGGGACTCCTT	0.478																																					p.R504W													KIF2B,NS,carcinoma,0,2	KIF2B	0	2	1	Substitution - Missense(1)	endometrium(1)	c.C1510T												52.0	50.0	51.0					17																	51901904		2203	4300	6503	SO:0001583	missense	84643	exon1			GTGCTCCGGGACT	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1510C>T	17.37:g.51901904C>T	ENSP00000268919:p.Arg504Trp		Somatic	58	0	0		WXS	Illumina HiSeq	.	95	0.04	4	NM_032559	0		0	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165087	0.57476	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.76448	-1.02	5.51	3.36	0.38483	Kinesin, motor domain (4);	0.000000	0.40728	N	0.001034	D	0.89598	0.6761	M	0.92691	3.335	0.41912	D	0.990472	D	0.89917	1.0	D	0.91635	0.999	D	0.91670	0.5349	10	0.87932	D	0	.	12.1655	0.54127	0.3756:0.6244:0.0:0.0	.	504	Q8N4N8	KIF2B_HUMAN	W	504;392	ENSP00000268919:R504W	ENSP00000268919:R504W	R	+	1	2	KIF2B	49256903	0.097000	0.21791	0.999000	0.59377	0.996000	0.88848	0.660000	0.25009	1.408000	0.46895	0.655000	0.94253	CGG			0.478	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438854.1		NM_032559	
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																					.													.	.			0			.																																											0	.			TTCCACAAGTCTC	AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	94	0.04	4	.	41	0.00	0		RNA	SNP	ENST00000430983.1	37																																																																																						0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000255102.1		NM_153032	
SDK2	54549	broad.mit.edu	37	17	71386453	71386453	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:71386453C>A	ENST00000392650.3	-	29	4165	c.4165G>T	c.(4165-4167)Gcc>Tcc	p.A1389S	SDK2_ENST00000388726.3_Missense_Mutation_p.A1389S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1389	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ACCACCAAGGCCTCGGCAGCT	0.677																																					p.A1389S													.	SDK2	219		0			c.G4165T												28.0	25.0	26.0					17																	71386453		2201	4300	6501	SO:0001583	missense	54549	exon29			CCAAGGCCTCGGC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4165G>T	17.37:g.71386453C>A	ENSP00000376421:p.Ala1389Ser		Somatic	54	0.037037037	2		WXS	Illumina HiSeq	Phase_I	36	0.17	6	NM_001144952	0		0	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712052	0.89112	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.53857	0.6;0.6;0.6	5.2	5.2	0.72013	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.055341	0.64402	D	0.000001	T	0.67126	0.2860	L	0.52266	1.64	0.54753	D	0.999988	D;D;D	0.69078	0.997;0.985;0.991	D;D;D	0.81914	0.995;0.98;0.991	T	0.62272	-0.6889	10	0.27082	T	0.32	.	18.3342	0.90282	0.0:1.0:0.0:0.0	.	1389;1389;1389	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	S	1013;1389;1389;565;1389	ENSP00000376421:A1389S;ENSP00000373378:A1389S;ENSP00000407098:A565S	ENSP00000324967:A1389S	A	-	1	0	SDK2	68898048	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.333000	0.79214	2.430000	0.82344	0.561000	0.74099	GCC			0.677	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327598.2		NM_019064	
LLGL2	3993	broad.mit.edu;mdanderson.org	37	17	73568068	73568068	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:73568068G>T	ENST00000392550.3	+	19	2500	c.2383G>T	c.(2383-2385)Gtg>Ttg	p.V795L	LLGL2_ENST00000577200.1_Missense_Mutation_p.V795L|LLGL2_ENST00000167462.5_Missense_Mutation_p.V795L	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	795					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GCCCCTCGAAGTGGCCCATGA	0.652																																					p.V795L													.	LLGL2	155		0			c.G2383T												40.0	37.0	38.0					17																	73568068		2202	4300	6502	SO:0001583	missense	3993	exon19			CTCGAAGTGGCCC	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.2383G>T	17.37:g.73568068G>T	ENSP00000376333:p.Val795Leu		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_004524	66	0.00	0	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663680	0.67700	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.56275	0.47;0.47	5.29	5.29	0.74685	.	0.236967	0.42294	D	0.000721	T	0.57607	0.2065	L	0.59436	1.845	0.47547	D	0.99945	B;P;P;P;P	0.41848	0.2;0.651;0.763;0.747;0.754	B;B;P;P;B	0.44772	0.142;0.266;0.453;0.46;0.41	T	0.56329	-0.7997	10	0.35671	T	0.21	-23.4617	18.9172	0.92510	0.0:0.0:1.0:0.0	.	422;784;784;795;795	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	L	795;795;784	ENSP00000167462:V795L;ENSP00000376333:V795L	ENSP00000167462:V795L	V	+	1	0	LLGL2	71079663	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.807000	0.99171	2.484000	0.83849	0.462000	0.41574	GTG			0.652	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000447633.1		NM_004524	
RAC3	5881	broad.mit.edu	37	17	79991663	79991663	+	Silent	SNP	G	G	T	rs556605529		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr17:79991663G>T	ENST00000306897.4	+	6	675	c.537G>T	c.(535-537)ccG>ccT	p.P179P	DCXR_ENST00000584318.1_5'Flank	NM_005052.2	NP_005043.1	P60763	RAC3_HUMAN	ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)	179					actin cytoskeleton organization (GO:0030036)|cell projection assembly (GO:0030031)|GTP catabolic process (GO:0006184)|intracellular signal transduction (GO:0035556)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|kidney(1)|skin(1)	3	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			TGCTCTGCCCGCCCCCAGTGA	0.667																																					p.P179P													.	RAC3	8		0			c.G537T												31.0	29.0	30.0					17																	79991663		2198	4297	6495	SO:0001819	synonymous_variant	5881	exon6			CTGCCCGCCCCCA	AF008591	CCDS11798.1	17q25.3	2014-01-30				ENSG00000169750		"""Endogenous ligands"""	9803	protein-coding gene	gene with protein product		602050					Standard	NM_005052		Approved		uc002kdf.3	P60763		ENST00000306897.4:c.537G>T	17.37:g.79991663G>T			Somatic	91	0.032967033	3		WXS	Illumina HiSeq	Phase_I	138	0.07	10	NM_005052	71	0.00	0	O14658|Q5U0M8	Silent	SNP	ENST00000306897.4	37	CCDS11798.1																																																																																					0.667	RAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442064.1			
TCEB3B	51224	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	44560885	44560885	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr18:44560885C>T	ENST00000332567.4	-	1	1103	c.751G>A	c.(751-753)Gag>Aag	p.E251K	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	251					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CATGATTTCTCCCTGATCAAA	0.572																																					p.E251K													.	.			0			c.G751A												47.0	49.0	48.0					18																	44560885		2203	4300	6503	SO:0001583	missense	51224	exon1			ATTTCTCCCTGAT	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.751G>A	18.37:g.44560885C>T	ENSP00000331302:p.Glu251Lys		Somatic	94	0	0		WXS	Illumina HiSeq	.	150	0.11	16	NM_016427	0		0	Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	37	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	C	7.405	0.633546	0.14322	.	.	ENSG00000206181	ENST00000332567	T	0.12774	2.65	1.72	-2.78	0.05859	.	0.000000	0.32769	U	0.005671	T	0.07279	0.0184	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15009	-1.0452	10	0.51188	T	0.08	.	4.1342	0.10162	0.0:0.2539:0.2331:0.513	.	251	Q8IYF1	ELOA2_HUMAN	K	251	ENSP00000331302:E251K	ENSP00000331302:E251K	E	-	1	0	TCEB3B	42814883	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.170000	0.16663	-0.962000	0.03604	-0.369000	0.07265	GAG			0.572	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255900.1		NM_016427	
CXXC1	30827	hgsc.bcm.edu	37	18	47812290	47812290	+	Missense_Mutation	SNP	C	C	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr18:47812290C>G	ENST00000285106.6	-	5	1182	c.468G>C	c.(466-468)caG>caC	p.Q156H	CXXC1_ENST00000587396.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.Q156H|CXXC1_ENST00000412036.2_Missense_Mutation_p.Q156H	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	156					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.Q156H(1)		autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						gctgctgctgctggtgatgct	0.557																																					p.Q156H													CXXC1,NS,carcinoma,0,1	CXXC1	0	1	1	Substitution - Missense(1)	lung(1)	c.G468C												43.0	39.0	40.0					18																	47812290		2203	4300	6503	SO:0001583	missense	30827	exon5			CTGCTGCTGGTGA	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.468G>C	18.37:g.47812290C>G	ENSP00000285106:p.Gln156His		Somatic	63	0.0158730159	1		WXS	Illumina HiSeq	.	85	0.05	4	NM_001101654	26	0.00	0	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	37	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	C	5.912	0.352385	0.11182	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.24151	1.88;1.87	2.57	-0.917	0.10485	.	0.739778	0.10861	U	0.626054	T	0.08758	0.0217	N	0.14661	0.345	0.27196	N	0.960293	P;B;B;B;B	0.43094	0.799;0.438;0.42;0.296;0.191	B;B;B;B;B	0.24006	0.05;0.02;0.031;0.014;0.014	T	0.22800	-1.0206	10	0.40728	T	0.16	-0.5462	4.5447	0.12074	0.0:0.4012:0.4494:0.1494	.	156;156;156;156;23	B4DGL1;B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;.;CXXC1_HUMAN;.	H	156	ENSP00000285106:Q156H;ENSP00000390475:Q156H	ENSP00000285106:Q156H	Q	-	3	2	CXXC1	46066288	0.955000	0.32602	0.993000	0.49108	0.749000	0.42624	-0.083000	0.11286	0.025000	0.15241	0.542000	0.68232	CAG			0.557	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255927.2		NM_014593	
MED16	10025	hgsc.bcm.edu	37	19	879943	879943	+	Missense_Mutation	SNP	G	G	C	rs201392672|rs76403059	byFrequency	TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:879943G>C	ENST00000589119.1	-	7	1346	c.1347C>G	c.(1345-1347)caC>caG	p.H449Q	MED16_ENST00000395808.3_Missense_Mutation_p.H449Q|MED16_ENST00000606828.1_Intron|MED16_ENST00000269814.4_Missense_Mutation_p.H449Q|MED16_ENST00000325464.1_Missense_Mutation_p.H449Q|MED16_ENST00000312090.6_Missense_Mutation_p.H449Q			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	449					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACCTTCCCGTGGCTGTCAA	0.672																																					p.H449Q													MED16,colon,carcinoma,0,1	MED16	0	1	0			c.C1347G												13.0	11.0	12.0					19																	879943		2152	4247	6399	SO:0001583	missense	10025	exon8			CTTCCCGTGGCTG	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1347C>G	19.37:g.879943G>C	ENSP00000464810:p.His449Gln		Somatic	111	0.018018018	2		WXS	Illumina HiSeq	.	130	0.05	6	NM_005481	7	0.00	0	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	C	3.376	-0.127462	0.06753	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000424039	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.21	-7.89	0.01174	WD40 repeat-like-containing domain (1);	0.323237	0.32357	N	0.006220	T	0.21307	0.0513	L	0.37850	1.14	0.37741	D	0.925623	B;B;B;B;B	0.13145	0.006;0.007;0.002;0.001;0.001	B;B;B;B;B	0.14023	0.006;0.006;0.003;0.006;0.01	T	0.20009	-1.0288	10	0.15066	T	0.55	-14.2411	8.1092	0.30905	0.4704:0.1904:0.3392:0.0	.	449;449;449;449;449	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	Q	449;449;449;449;449;305;210;208;449	ENSP00000325612:H449Q;ENSP00000308528:H449Q;ENSP00000379153:H449Q;ENSP00000269814:H449Q	ENSP00000269814:H449Q	H	-	3	2	MED16	830943	0.000000	0.05858	0.886000	0.34754	0.057000	0.15508	-3.404000	0.00482	-1.779000	0.01280	-2.326000	0.00250	CAC			0.672	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000457902.3		NM_005481	
PCSK4	54760	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	1487795	1487795	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:1487795G>C	ENST00000300954.5	-	5	643	c.582C>G	c.(580-582)agC>agG	p.S194R	CTB-25B13.6_ENST00000585643.1_RNA|PCSK4_ENST00000587784.1_5'UTR	NM_017573.3	NP_060043.2			proprotein convertase subtilisin/kexin type 4											cervix(2)|endometrium(2)|kidney(1)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTTCTCTTTGCTGGGGGTGT	0.687																																					p.S194R													.	.			0			c.C582G												11.0	13.0	12.0					19																	1487795		2159	4249	6408	SO:0001583	missense	54760	exon5			CTCTTTGCTGGGG	AK057235	CCDS12069.2	19p13.3	2008-02-05			ENSG00000115257	ENSG00000115257			8746	protein-coding gene	gene with protein product		600487				7782070	Standard	XM_005259586		Approved	PC4, SPC5, DKFZp434B217, MGC34749	uc002ltb.1	Q6UW60	OTTHUMG00000128541	ENST00000300954.5:c.582C>G	19.37:g.1487795G>C	ENSP00000300954:p.Ser194Arg		Somatic	27	0	0		WXS	Illumina HiSeq	.	42	0.10	4	NM_017573	1	0.00	0		Missense_Mutation	SNP	ENST00000300954.5	37	CCDS12069.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.003|7.003	0.555327|0.555327	0.13436|0.13436	.|.	.|.	ENSG00000115257|ENSG00000115257	ENST00000441747|ENST00000300954	.|D	.|0.87650	.|-2.28	2.09|2.09	-2.61|-2.61	0.06171|0.06171	.|Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	.|0.733388	.|0.11954	.|N	.|0.513413	D|D	0.85383|0.85383	0.5684|0.5684	L|L	0.50993|0.50993	1.605|1.605	0.09310|0.09310	N|N	0.999999|0.999999	B|P	0.26708|0.50369	0.157|0.934	B|P	0.25140|0.52856	0.058|0.711	T|T	0.76578|0.76578	-0.2908|-0.2908	8|10	0.62326|0.33141	D|T	0.03|0.24	.|.	8.2533|8.2533	0.31739|0.31739	0.4594:0.0:0.5406:0.0|0.4594:0.0:0.5406:0.0	.|.	36|194	B3KQ28|Q6UW60	.|PCSK4_HUMAN	G|R	36|194	.|ENSP00000300954:S194R	ENSP00000402772:A36G|ENSP00000300954:S194R	A|S	-|-	2|3	0|2	PCSK4|PCSK4	1438795|1438795	0.000000|0.000000	0.05858|0.05858	0.574000|0.574000	0.28523|0.28523	0.315000|0.315000	0.28087|0.28087	-2.139000|-2.139000	0.01302|0.01302	-0.639000|-0.639000	0.05502|0.05502	-0.339000|-0.339000	0.08088|0.08088	GCA|AGC			0.687	PCSK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449703.1		NM_017573	
ILF3	3609	bcgsc.ca;mdanderson.org	37	19	10798068	10798068	+	Silent	SNP	T	T	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:10798068T>G	ENST00000590261.1	+	17	2106	c.2106T>G	c.(2104-2106)ggT>ggG	p.G702G	ILF3_ENST00000318511.3_Silent_p.G702G|ILF3_ENST00000449870.1_Silent_p.G706G|ILF3_ENST00000588657.1_Silent_p.G706G			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	702	Interaction with PRMT1.|Poly-Gly.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			CCAGTGGCGGTGGCGGCGGGG	0.632																																					p.G706G													.	ILF3	99		0			c.T2118G												13.0	14.0	14.0					19																	10798068		1952	3853	5805	SO:0001819	synonymous_variant	3609	exon18			TGGCGGTGGCGGC	U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.2106T>G	19.37:g.10798068T>G			Somatic	81	0.0617283951	5		WXS	Illumina HiSeq	Phase_1	111	0.14	16	NM_017620	5	0.00	0	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Silent	SNP	ENST00000590261.1	37	CCDS12246.1																																																																																					0.632	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452074.1			
TECR	9524	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	14675087	14675087	+	Silent	SNP	C	C	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:14675087C>A	ENST00000215567.5	+	7	614	c.477C>A	c.(475-477)cgC>cgA	p.R159R	TECR_ENST00000596073.1_Silent_p.R4R|TECR_ENST00000436007.2_Silent_p.R174R|TECR_ENST00000600083.1_Silent_p.R4R	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	159					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						TGCCTTTGCGCAACATCTTCA	0.652																																					p.R159R													TECR,NS,carcinoma,+1,1	TECR	1	1	0			c.C477A												61.0	47.0	52.0					19																	14675087		2203	4299	6502	SO:0001819	synonymous_variant	9524	exon7			TTTGCGCAACATC	AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.477C>A	19.37:g.14675087C>A			Somatic	36	0	0		WXS	Illumina HiSeq	.	50	0.12	6	NM_138501	217	0.15	32	B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Silent	SNP	ENST00000215567.5	37	CCDS12313.1																																																																																					0.652	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466000.1		NM_138501	
SPRED3	399473	hgsc.bcm.edu;mdanderson.org	37	19	38882866	38882866	+	Missense_Mutation	SNP	T	T	C	rs151129136		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:38882866T>C	ENST00000338502.4	+	3	464	c.361T>C	c.(361-363)Tcc>Ccc	p.S121P	SPRED3_ENST00000587564.2_3'UTR|SPRED3_ENST00000587013.1_Missense_Mutation_p.S165P|SPRED3_ENST00000586301.1_Missense_Mutation_p.S121P	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	121	Ser-rich.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ACTCAccccctcctcctcctc	0.642																																					p.S121P													SPRED3_ENST00000396877,bladder,carcinoma,-1,2	SPRED3_ENST00000396877	-1	2	0			c.T361C												37.0	46.0	43.0					19																	38882866		2055	4192	6247	SO:0001583	missense	399473	exon3			ACCCCCTCCTCCT		CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.361T>C	19.37:g.38882866T>C	ENSP00000345405:p.Ser121Pro		Somatic	54	0.0185185185	1		WXS	Illumina HiSeq	.	64	0.06	4	NM_001042522	0		0	Q2MJR1	Missense_Mutation	SNP	ENST00000338502.4	37	CCDS42560.1	.	.	.	.	.	.	.	.	.	.	T	10.99	1.507507	0.27036	.	.	ENSG00000188766	ENST00000338502;ENST00000396877	D	0.81996	-1.56	3.34	3.34	0.38264	.	.	.	.	.	T	0.75982	0.3924	N	0.14661	0.345	0.32547	N	0.532858	P;P	0.48350	0.676;0.909	B;P	0.51297	0.307;0.665	T	0.78109	-0.2332	9	0.48119	T	0.1	-4.4806	8.6897	0.34260	0.0:0.0:0.0:1.0	.	121;121	Q2MJR0;Q2MJR1	SPRE3_HUMAN;.	P	121	ENSP00000345405:S121P	ENSP00000345405:S121P	S	+	1	0	SPRED3	43574706	0.997000	0.39634	0.988000	0.46212	0.536000	0.34869	2.869000	0.48444	1.487000	0.48415	0.379000	0.24179	TCC			0.642	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459216.1		XM_351191	
PAFAH1B3	5050	mdanderson.org	37	19	42806188	42806188	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:42806188G>T	ENST00000262890.3	-	2	343	c.82C>A	c.(82-84)Cat>Aat	p.H28N	PAFAH1B3_ENST00000538771.1_Missense_Mutation_p.H28N|PRR19_ENST00000341747.3_5'Flank|PRR19_ENST00000598490.1_5'Flank	NM_002573.3	NP_002564.1	Q15102	PA1B3_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)	28					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)			breast(1)|large_intestine(2)|ovary(1)	4		Prostate(69;0.0704)				ACGAACCGATGGTGCTGCGGG	0.637																																					p.H28N													.	.			0			c.C82A												42.0	39.0	40.0					19																	42806188		2196	4286	6482	SO:0001583	missense	5050	exon2			ACCGATGGTGCTG	D63391	CCDS12602.1	19q13.1	2011-10-24	2010-02-10			ENSG00000079462			8576	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 1 subunit"""	603074	"""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit (29kD)"", ""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 3 (29kDa)"""			7669037	Standard	NM_002573		Approved		uc010xwj.1	Q15102		ENST00000262890.3:c.82C>A	19.37:g.42806188G>T	ENSP00000262890:p.His28Asn		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_002573	13	0.00	0	Q53X88	Missense_Mutation	SNP	ENST00000262890.3	37	CCDS12602.1	.	.	.	.	.	.	.	.	.	.	G	1.184	-0.637188	0.03557	.	.	ENSG00000079462	ENST00000538771;ENST00000262890	T;T	0.39406	1.08;1.08	4.52	4.52	0.55395	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.260464	0.35739	N	0.003008	T	0.09992	0.0245	N	0.00142	-2.005	0.36210	D	0.851321	B	0.02656	0.0	B	0.01281	0.0	T	0.22347	-1.0219	10	0.14252	T	0.57	-9.5927	9.9323	0.41530	0.0:0.0:0.7972:0.2028	.	28	Q15102	PA1B3_HUMAN	N	28	ENSP00000444935:H28N;ENSP00000262890:H28N	ENSP00000262890:H28N	H	-	1	0	PAFAH1B3	47498028	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	1.037000	0.30241	2.338000	0.79540	0.561000	0.74099	CAT			0.637	PAFAH1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463726.1		NM_002573	
MEGF8	1954	mdanderson.org	37	19	42838351	42838351	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:42838351G>T	ENST00000251268.6	+	3	544	c.544G>T	c.(544-546)Ggc>Tgc	p.G182C	MEGF8_ENST00000334370.4_Missense_Mutation_p.G182C	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	182	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGCAGCCACGGCACCTGCGC	0.697																																					p.G182C													MEGF8_ENST00000334370,NS,carcinoma,-1,2	MEGF8_ENST00000334370	-1	2	0			c.G544T												10.0	14.0	13.0					19																	42838351		2020	4131	6151	SO:0001583	missense	1954	exon3			AGCCACGGCACCT	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.544G>T	19.37:g.42838351G>T	ENSP00000251268:p.Gly182Cys		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001271938	0		0	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	G	16.75	3.209538	0.58343	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.39229	1.13;1.09	5.23	4.2	0.49525	.	.	.	.	.	T	0.42404	0.1201	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.51490	-0.8699	9	0.87932	D	0	-13.7586	11.527	0.50586	0.0879:0.0:0.9121:0.0	.	182	Q7Z7M0-2	.	C	182	ENSP00000334219:G182C;ENSP00000251268:G182C	ENSP00000251268:G182C	G	+	1	0	MEGF8	47530191	1.000000	0.71417	0.993000	0.49108	0.401000	0.30781	3.608000	0.54109	1.217000	0.43442	-0.348000	0.07805	GGC			0.697	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
KLK12	43849	ucsc.edu;bcgsc.ca	37	19	51534068	51534068	+	Silent	SNP	G	G	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:51534068G>A	ENST00000525263.1	-	4	686	c.567C>T	c.(565-567)ggC>ggT	p.G189G	KLK12_ENST00000529888.1_Missense_Mutation_p.R103C|CTC-518B2.9_ENST00000594910.1_RNA|KLK11_ENST00000319720.7_5'Flank|KLK12_ENST00000319590.4_Silent_p.G189G|KLK12_ENST00000250351.4_Silent_p.G189G|KLK11_ENST00000391804.3_5'Flank|KLK12_ENST00000250352.11_Silent_p.G79G			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	189	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		GCCCCGGGACGCCGCCTGCAC	0.637																																					p.R103C													.	KLK12	30		0			c.C307T												124.0	118.0	120.0					19																	51534068		2203	4300	6503	SO:0001819	synonymous_variant	43849	exon4			CGGGACGCCGCCT		CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.567C>T	19.37:g.51534068G>A			Somatic	67	0	0		WXS	Illumina HiSeq		37	0.11	4	NM_145895	0		0	Q9UKR1|Q9UKR2	Missense_Mutation	SNP	ENST00000525263.1	37	CCDS12821.1	.	.	.	.	.	.	.	.	.	.	g	7.615	0.675657	0.14841	.	.	ENSG00000186474	ENST00000529888	D	0.84516	-1.86	4.37	-2.36	0.06663	.	.	.	.	.	T	0.71592	0.3358	.	.	.	0.22401	N	0.999137	B	0.02656	0.0	B	0.01281	0.0	T	0.59484	-0.7446	8	0.87932	D	0	.	0.5401	0.00644	0.3365:0.1652:0.3168:0.1814	.	103	Q9UKR2	.	C	103	ENSP00000434036:R103C	ENSP00000434036:R103C	R	-	1	0	KLK12	56225880	0.000000	0.05858	0.091000	0.20842	0.021000	0.10359	-0.182000	0.09726	-0.156000	0.11079	-0.680000	0.03767	CGT			0.637	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000386288.1		NM_019598	
ZNF880	400713	broad.mit.edu;mdanderson.org	37	19	52888125	52888125	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr19:52888125C>T	ENST00000422689.2	+	4	1307	c.1292C>T	c.(1291-1293)aCt>aTt	p.T431I		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	431					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CTAATTCACACTGGAGAGAAA	0.408																																					p.T431I													.	ZNF880	45		0			c.C1292T												70.0	66.0	67.0					19																	52888125		1568	3582	5150	SO:0001583	missense	400713	exon4			TTCACACTGGAGA	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1292C>T	19.37:g.52888125C>T	ENSP00000406318:p.Thr431Ile		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	56	0.11	6	NM_001145434	1	0.00	0	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	C	10.40	1.339216	0.24253	.	.	ENSG00000221923	ENST00000422689	T	0.25749	1.78	1.96	0.753	0.18404	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38825	0.1055	M	0.62723	1.935	0.23896	N	0.996533	D	0.59767	0.986	P	0.59288	0.855	T	0.17228	-1.0376	8	.	.	.	.	8.7806	0.34789	0.0:0.7632:0.2368:0.0	.	431	Q6PDB4	ZN880_HUMAN	I	431	ENSP00000406318:T431I	.	T	+	2	0	ZNF880	57579937	0.015000	0.18098	0.163000	0.22734	0.138000	0.21146	0.403000	0.20982	0.100000	0.17581	0.501000	0.49751	ACT			0.408	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397374.1		NM_001145434	
AC016995.3	0	broad.mit.edu	37	2	38710019	38710019	+	lincRNA	DEL	T	T	-	rs2005502|rs57303101|rs538061888|rs200292719	byFrequency	TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr2:38710019delT	ENST00000417039.1	-	0	696																											CTTtaaaaaataaataaataa	0.244																																					.													.	.			0			.																																											0	.			AAAAAATAAATAA																													2.37:g.38710019delT			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	90	0.18	16	.	1	0.00	0		RNA	DEL	ENST00000417039.1	37																																																																																						0.244	AC016995.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000331173.1			
IL36A	27179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	113763655	113763655	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr2:113763655A>G	ENST00000259211.6	+	2	526	c.115A>G	c.(115-117)Atg>Gtg	p.M39V		NM_014440.1	NP_055255.1	Q9UHA7	IL36A_HUMAN	interleukin 36, alpha	39					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			large_intestine(1)|lung(3)|ovary(2)|skin(1)|stomach(2)	9						GAAGGACCGTATGTCTCCAGG	0.517																																					p.M39V													.	.			0			c.A115G												50.0	54.0	52.0					2																	113763655		2054	4204	6258	SO:0001583	missense	27179	exon2			GACCGTATGTCTC	AF201831	CCDS42734.1	2q12-q14.1	2011-07-14	2011-06-06	2011-06-06	ENSG00000136694	ENSG00000136694		"""Interleukins and interleukin receptors"""	15562	protein-coding gene	gene with protein product		605509	"""interleukin 1 family, member 6 (epsilon)"""	IL1F6		10625660	Standard	XM_005263639		Approved	FIL1, FIL1E, IL-1F6, IL1(EPSILON), MGC129553, MGC129552	uc010yxr.2	Q9UHA7	OTTHUMG00000153320	ENST00000259211.6:c.115A>G	2.37:g.113763655A>G	ENSP00000259211:p.Met39Val		Somatic	66	0	0		WXS	Illumina HiSeq	.	107	0.05	5	NM_014440	0		0	B2RAD9|Q53SR7|Q5BLR4|Q7RTZ8	Missense_Mutation	SNP	ENST00000259211.6	37	CCDS42734.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.869185	0.00547	.	.	ENSG00000136694	ENST00000259211	T	0.15487	2.42	4.69	-3.68	0.04463	.	1.380940	0.04319	N	0.350340	T	0.07593	0.0191	N	0.02202	-0.64	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37549	-0.9701	10	0.27082	T	0.32	25.0497	12.2382	0.54528	0.3549:0.0:0.6451:0.0	.	39	Q9UHA7	IL36A_HUMAN	V	39	ENSP00000259211:M39V	ENSP00000259211:M39V	M	+	1	0	IL36A	113480126	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.908000	0.04063	-1.335000	0.02241	-1.463000	0.01021	ATG			0.517	IL36A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000330711.1		NM_014440	
HOXD9	3235	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	176988212	176988212	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr2:176988212C>T	ENST00000249499.6	+	1	1125	c.716C>T	c.(715-717)tCg>tTg	p.S239L	HOXD-AS2_ENST00000440016.2_RNA	NM_014213.3	NP_055028.3	P28356	HXD9_HUMAN	homeobox D9	239					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal system morphogenesis (GO:0048704)|hindlimb morphogenesis (GO:0035137)|mammary gland development (GO:0030879)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		ACGGGCGGCTCGTCGGAGCCC	0.682																																					p.S239L	GBM(47;924 952 7959 9248 12176)												.	.			0			c.C716T												6.0	7.0	7.0					2																	176988212		2100	4137	6237	SO:0001583	missense	3235	exon1			GCGGCTCGTCGGA		CCDS2267.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128709	ENSG00000128709		"""Homeoboxes / ANTP class : HOXL subclass"""	5140	protein-coding gene	gene with protein product		142982	"""homeo box D9"""	HOX4C, HOX4		1973146, 1358459	Standard	NM_014213		Approved		uc010zex.2	P28356	OTTHUMG00000132516	ENST00000249499.6:c.716C>T	2.37:g.176988212C>T	ENSP00000249499:p.Ser239Leu		Somatic	114	0	0		WXS	Illumina HiSeq	.	185	0.11	21	NM_014213	0		0	Q86ST1	Missense_Mutation	SNP	ENST00000249499.6	37	CCDS2267.2	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164646	0.38217	.	.	ENSG00000128709	ENST00000249499	D	0.94092	-3.35	4.55	3.61	0.41365	.	6.884870	0.00166	N	0.000013	D	0.90140	0.6919	L	0.40543	1.245	0.21325	N	0.99972	B	0.27971	0.196	B	0.19666	0.026	T	0.76740	-0.2848	10	0.24483	T	0.36	.	10.3261	0.43793	0.1484:0.7076:0.144:0.0	.	239	P28356	HXD9_HUMAN	L	239	ENSP00000249499:S239L	ENSP00000249499:S239L	S	+	2	0	HOXD9	176696458	0.997000	0.39634	0.979000	0.43373	0.831000	0.47069	1.252000	0.32874	2.215000	0.71742	0.555000	0.69702	TCG			0.682	HOXD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255698.4			
PRR21	643905	hgsc.bcm.edu	37	2	240982009	240982009	+	Missense_Mutation	SNP	G	G	A	rs202192655		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr2:240982009G>A	ENST00000408934.1	-	1	390	c.391C>T	c.(391-393)Ccc>Tcc	p.P131S		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	131	Pro-rich.							p.P131S(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						AGGGCCGTGGGTGAAGAGGCA	0.647																																					p.P131S													PRR21,NS,malignant_melanoma,0,2	PRR21	0	2	2	Substitution - Missense(2)	NS(2)	c.C391T												4.0	3.0	3.0					2																	240982009		1301	2740	4041	SO:0001583	missense	643905	exon1			CCGTGGGTGAAGA	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.391C>T	2.37:g.240982009G>A	ENSP00000386166:p.Pro131Ser		Somatic	8	0.125	1		WXS	Illumina HiSeq	.	20	0.25	5	NM_001080835	0		0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	-	0.018	-1.469388	0.01044	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13307	2.6;2.6	1.73	-3.03	0.05429	.	.	.	.	.	T	0.10766	0.0263	N	0.08118	0	0.09310	N	1	D	0.63880	0.993	P	0.61940	0.896	T	0.12993	-1.0526	9	0.10111	T	0.7	.	7.6745	0.28478	0.3709:0.0:0.6291:0.0	.	131	Q8WXC7	PRR21_HUMAN	S	131	ENSP00000386166:P131S;ENSP00000418240:P131S	ENSP00000386166:P131S	P	-	1	0	PRR21	240630682	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.053000	0.03500	-0.874000	0.04027	-0.481000	0.04817	CCC			0.647	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001080835	
NINL	22981	broad.mit.edu	37	20	25436407	25436407	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr20:25436407G>T	ENST00000278886.6	-	23	3932	c.3859C>A	c.(3859-3861)Cag>Aag	p.Q1287K	NINL_ENST00000422516.1_Missense_Mutation_p.Q938K|NINL_ENST00000464285.1_5'UTR	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1287					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GCTTTCAGCTGTTTCTCATGT	0.537																																					p.Q1287K													.	NINL	148		0			c.C3859A												166.0	180.0	176.0					20																	25436407		2203	4300	6503	SO:0001583	missense	22981	exon23			TCAGCTGTTTCTC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3859C>A	20.37:g.25436407G>T	ENSP00000278886:p.Gln1287Lys		Somatic	118	0.0254237288	3		WXS	Illumina HiSeq	Phase_I	153	0.05	7	NM_025176	4	0.25	1	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	G	4.493	0.091415	0.08632	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.32023	1.47;1.47	5.02	0.595	0.17490	.	0.391934	0.24678	N	0.036493	T	0.20129	0.0484	L	0.57536	1.79	0.09310	N	1	B;B;P	0.38440	0.228;0.226;0.631	B;B;B	0.36608	0.121;0.069;0.229	T	0.09574	-1.0668	10	0.13470	T	0.59	-8.3836	2.2555	0.04054	0.1522:0.1377:0.4509:0.2592	.	938;1287;78	Q9Y2I6-2;Q9Y2I6;Q9HAD5	.;NINL_HUMAN;.	K	1287;938	ENSP00000278886:Q1287K;ENSP00000410431:Q938K	ENSP00000278886:Q1287K	Q	-	1	0	NINL	25384407	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	0.674000	0.25218	0.293000	0.22520	-0.218000	0.12543	CAG			0.537	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078445.3		NM_025176	
SERINC3	10955	broad.mit.edu	37	20	43142664	43142664	+	Missense_Mutation	SNP	G	G	T	rs370153515		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr20:43142664G>T	ENST00000342374.4	-	2	214	c.57C>A	c.(55-57)agC>agA	p.S19R	SERINC3_ENST00000468234.1_5'UTR|SERINC3_ENST00000541235.1_5'UTR|SERINC3_ENST00000255175.1_Missense_Mutation_p.S19R	NM_006811.2	NP_006802.1	Q13530	SERC3_HUMAN	serine incorporator 3	19					phosphatidylserine metabolic process (GO:0006658)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(4)|large_intestine(2)|lung(8)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			ATGAGGCACCGCTGCAGAGGC	0.498																																					p.S19R													.	SERINC3	42		0			c.C57A												135.0	113.0	121.0					20																	43142664		2203	4300	6503	SO:0001583	missense	10955	exon2			GGCACCGCTGCAG	U49188	CCDS13333.1	20q13.12	2008-05-14	2005-11-15	2005-11-15	ENSG00000132824	ENSG00000132824			11699	protein-coding gene	gene with protein product		607165	"""tumor differentially expressed 1"""	TDE1		10559794	Standard	NM_006811		Approved	DIFF33, TDE, SBBI99, TMS-1, AIGP1	uc002xme.3	Q13530	OTTHUMG00000033087	ENST00000342374.4:c.57C>A	20.37:g.43142664G>T	ENSP00000340243:p.Ser19Arg		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	116	0.03	4	NM_006811	0		0	B4DUE9|O43717|Q9BR33	Missense_Mutation	SNP	ENST00000342374.4	37	CCDS13333.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693170	0.68271	.	.	ENSG00000132824	ENST00000255175;ENST00000342374	T;T	0.14893	2.47;2.47	5.21	-6.96	0.01622	.	0.300348	0.45126	D	0.000396	T	0.26412	0.0645	L	0.52126	1.63	0.80722	D	1	D;D	0.55385	0.965;0.971	P;D	0.67382	0.889;0.951	T	0.25117	-1.0141	10	0.87932	D	0	-3.2596	12.5664	0.56312	0.252:0.0:0.6447:0.1034	.	19;19	Q53GK8;Q13530	.;SERC3_HUMAN	R	19	ENSP00000255175:S19R;ENSP00000340243:S19R	ENSP00000255175:S19R	S	-	3	2	SERINC3	42576078	0.661000	0.27430	0.313000	0.25210	0.985000	0.73830	-0.070000	0.11523	-1.303000	0.02332	-0.373000	0.07131	AGC			0.498	SERINC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080544.3		NM_006811	
SLC2A10	81031	broad.mit.edu	37	20	45354027	45354027	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr20:45354027G>A	ENST00000359271.2	+	2	602	c.352G>A	c.(352-354)Gct>Act	p.A118T		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	118					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				CTCCTCCATGGCTTGCTGTAT	0.657																																					p.A118T													.	SLC2A10	75		0			c.G352A												74.0	71.0	72.0					20																	45354027		2203	4300	6503	SO:0001583	missense	81031	exon2			TCCATGGCTTGCT	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.352G>A	20.37:g.45354027G>A	ENSP00000352216:p.Ala118Thr		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_030777	0		0	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840577	0.51057	.	.	ENSG00000197496	ENST00000359271	T	0.73047	-0.71	5.01	5.01	0.66863	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.368026	0.30293	N	0.009957	T	0.69495	0.3117	N	0.21583	0.68	0.47778	D	0.999517	D	0.64830	0.994	P	0.61328	0.887	T	0.63010	-0.6732	10	0.02654	T	1	-0.0052	18.6864	0.91565	0.0:0.0:1.0:0.0	.	118	O95528	GTR10_HUMAN	T	118	ENSP00000352216:A118T	ENSP00000352216:A118T	A	+	1	0	SLC2A10	44787434	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	5.268000	0.65536	2.494000	0.84150	0.407000	0.27541	GCT			0.657	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079578.2			
SPO11	23626	mdanderson.org	37	20	55904934	55904934	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr20:55904934C>T	ENST00000371263.3	+	1	120	c.11C>T	c.(10-12)gCa>gTa	p.A4V	SPO11_ENST00000345868.4_Missense_Mutation_p.A4V|SPO11_ENST00000371260.4_Missense_Mutation_p.A4V	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB	4					DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)			autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			ATGGCCTTTGCACCTATGGGG	0.662								Editing and processing nucleases																													p.A4V													.	.			0			c.C11T												40.0	36.0	37.0					20																	55904934		2203	4300	6503	SO:0001583	missense	23626	exon1			CCTTTGCACCTAT	AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.11C>T	20.37:g.55904934C>T	ENSP00000360310:p.Ala4Val		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_012444	0		0	Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Missense_Mutation	SNP	ENST00000371263.3	37	CCDS13456.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.712277	0.68730	.	.	ENSG00000054796	ENST00000371263;ENST00000345868;ENST00000371260	T;T;T	0.65549	-0.16;-0.16;-0.16	4.34	4.34	0.51931	Meiosis-specific protein Spo11 (1);	0.307405	0.27319	N	0.019919	T	0.54983	0.1892	L	0.32530	0.975	0.28306	N	0.922914	B;P	0.34955	0.29;0.477	B;B	0.41946	0.185;0.371	T	0.52177	-0.8610	10	0.28530	T	0.3	-7.1224	12.7002	0.57026	0.0:1.0:0.0:0.0	.	4;4	Q9Y5K1-2;Q9Y5K1	.;SPO11_HUMAN	V	4	ENSP00000360310:A4V;ENSP00000316034:A4V;ENSP00000360307:A4V	ENSP00000316034:A4V	A	+	2	0	SPO11	55338341	0.182000	0.23173	0.984000	0.44739	0.949000	0.60115	1.250000	0.32850	2.129000	0.65627	0.491000	0.48974	GCA			0.662	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079836.2		NM_012444	
BAGE2	85319	broad.mit.edu	37	21	11083997	11083998	+	RNA	INS	-	-	G	rs60923226|rs201443565|rs564847764|rs370113266		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr21:11083997_11083998insG	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		atgatttgtgtttgtgtgtttg	0.277																																					.													.	.			0			.																																											85319	.			TTTGTGTTTGTGT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11083997_11083998insG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	INS	ENST00000470054.1	37																																																																																						0.277	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
BAGE2	85319	broad.mit.edu	37	21	11083998	11083999	+	RNA	INS	-	-	GTG	rs60923226|rs201443565|rs564847764		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr21:11083998_11083999insGTG	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tgatttgtgtttgtgtgtttgt	0.272																																					.													.	.			0			.																																											85319	.			TTGTGTTTGTGTG	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11083998_11083999insGTG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	INS	ENST00000470054.1	37																																																																																						0.272	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
POM121L1P	25812	mdanderson.org	37	22	22985347	22985347	+	RNA	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr22:22985347G>T	ENST00000402027.1	-	0	1597					NR_024591.1		Q3SYA9	P12L1_HUMAN	POM121 transmembrane nucleoporin-like 1, pseudogene																		AGCTGTGGCTGAGGCCCAGAA	0.627																																					.													.	.			0			.																																											25812	.			GTGGCTGAGGCCC			22q11.22	2013-10-11	2012-03-13	2009-01-15	ENSG00000183169	ENSG00000183169			16439	pseudogene	pseudogene	"""POM121-like 2"""		"""POM121 membrane glycoprotein-like 1 (rat)"", ""POM121 membrane glycoprotein-like 1, pseudogene"""	POM121L1		9074928	Standard	NR_024591		Approved		uc011ait.1	Q3SYA9	OTTHUMG00000151169		22.37:g.22985347G>T			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	.	0		0		RNA	SNP	ENST00000402027.1	37		.	.	.	.	.	.	.	.	.	.	g	0.610	-0.825483	0.02734	.	.	ENSG00000183169	ENST00000402027	.	.	.	.	.	.	.	.	.	.	.	T	0.25419	0.0618	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25813	-1.0121	3	0.44086	T	0.13	.	.	.	.	.	.	.	.	K	404	.	ENSP00000385643:Q404K	Q	-	1	0	POM121L1P	21315347	0.500000	0.26091	0.004000	0.12327	0.004000	0.04260	-0.441000	0.06879	-1.138000	0.02884	-1.217000	0.01609	CAG			0.627	POM121L1P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene		OTTHUMT00000468457.1		NR_024591	
TTC28	23331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	28501285	28501285	+	Missense_Mutation	SNP	C	C	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr22:28501285C>G	ENST00000397906.2	-	8	3430	c.3289G>C	c.(3289-3291)Gtc>Ctc	p.V1097L		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1097					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						AAGTACATGACTGCTTGGGAA	0.468																																					p.V1097L													.	.			0			c.G3289C												74.0	61.0	65.0					22																	28501285		692	1591	2283	SO:0001583	missense	23331	exon8			ACATGACTGCTTG	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.3289G>C	22.37:g.28501285C>G	ENSP00000381003:p.Val1097Leu		Somatic	241	0	0		WXS	Illumina HiSeq	.	382	0.10	37	NM_001145418	0		0	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	37	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624496	0.66901	.	.	ENSG00000100154	ENST00000397906	D	0.92446	-3.04	5.81	5.81	0.92471	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.065094	0.64402	D	0.000009	D	0.90473	0.7016	N	0.17723	0.515	0.80722	D	1	P	0.43701	0.815	P	0.51777	0.679	D	0.87899	0.2689	10	0.20519	T	0.43	-39.946	19.0707	0.93134	0.0:1.0:0.0:0.0	.	1097	Q96AY4	TTC28_HUMAN	L	1097	ENSP00000381003:V1097L	ENSP00000381003:V1097L	V	-	1	0	TTC28	26831285	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.090000	0.76916	2.746000	0.94184	0.655000	0.94253	GTC			0.468	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000320930.2		XM_929318	
NELFA	7469	mdanderson.org	37	4	1989687	1989687	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr4:1989687G>T	ENST00000411638.2	-	4	607	c.592C>A	c.(592-594)Cac>Aac	p.H198N	NELFA_ENST00000542778.1_Missense_Mutation_p.H63N|NELFA_ENST00000382882.3_Missense_Mutation_p.H209N|MIR943_ENST00000401286.1_RNA	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	198	HDAg-like.				gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										CCCTTGGCGTGGAAGGGCACC	0.647																																					p.H209N													.	.			0			c.C625A												33.0	36.0	35.0					4																	1989687		2203	4300	6503	SO:0001583	missense	7469	exon4			TGGCGTGGAAGGG	AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.592C>A	4.37:g.1989687G>T	ENSP00000399165:p.His198Asn		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	40	0.10	4	NM_005663	10	0.00	0	A2A2T1|O95392	Missense_Mutation	SNP	ENST00000411638.2	37		.	.	.	.	.	.	.	.	.	.	G	27.4	4.831816	0.91036	.	.	ENSG00000185049	ENST00000382882;ENST00000416258;ENST00000542778;ENST00000411638;ENST00000431323;ENST00000455762	T;T;T;T;T	0.45276	1.63;0.91;0.9;1.63;1.63	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.60431	0.2268	L	0.57536	1.79	0.80722	D	1	D	0.61080	0.989	D	0.72982	0.979	T	0.55218	-0.8175	10	0.30078	T	0.28	-21.978	17.4301	0.87537	0.0:0.0:1.0:0.0	.	198	Q9H3P2	NELFA_HUMAN	N	209;202;63;198;214;128	ENSP00000372335:H209N;ENSP00000387647:H202N;ENSP00000445757:H63N;ENSP00000399165:H198N;ENSP00000395761:H214N	ENSP00000372335:H209N	H	-	1	0	WHSC2	1959485	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.430000	0.90283	2.454000	0.82982	0.563000	0.77884	CAC			0.647	NELFA-015	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000473007.1		NM_005663	
BEND4	389206	hgsc.bcm.edu;broad.mit.edu	37	4	42145741	42145742	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr4:42145741_42145742delAG	ENST00000502486.1	-	3	1336_1337	c.757_758delCT	c.(757-759)ctafs	p.L253fs	BEND4_ENST00000504360.1_Frame_Shift_Del_p.L249fs	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	253										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						GTAATTTTGTAGAGAGTCAGTG	0.48																																					p.253_253del													.	BEND4	67		0			c.758_759del																																									SO:0001589	frameshift_variant	389206	exon3			TTTTGTAGAGAGT	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.757_758delCT	4.37:g.42145745_42145746delAG	ENSP00000421169:p.Leu253fs		Somatic	114	0	0		WXS	Illumina HiSeq	.	148	0.08	12	NM_001159547	6	0.00	0	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Frame_Shift_Del	DEL	ENST00000502486.1	37	CCDS47048.1																																																																																					0.480	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000360975.2		NM_207406	
KIT	3815	hgsc.bcm.edu;broad.mit.edu	37	4	55599320	55599320	+	Missense_Mutation	SNP	G	G	T	rs121913506		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr4:55599320G>T	ENST00000288135.5	+	17	2543	c.2446G>T	c.(2446-2448)Gac>Tac	p.D816Y		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816Y(46)|p.D816H(42)|p.D816F(6)|p.D816I(2)|p.D816N(1)|p.R815_D816insVI(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTAGCCAGAGACATCAAGAA	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816Y			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,0,932	KIT	0	932	98	Substitution - Missense(97)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(68)|testis(15)|ovary(10)|soft_tissue(3)|genital_tract(1)|skin(1)	c.G2446T												144.0	146.0	145.0					4																	55599320		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GCCAGAGACATCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2446G>T	4.37:g.55599320G>T	ENSP00000288135:p.Asp816Tyr		Somatic	62	0.0161290323	1		WXS	Illumina HiSeq	.	116	0.09	11	NM_000222	1	0.00	0	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976091	0.92982	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83755	-1.76;-1.76	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.87869	0.6286	L	0.39692	1.235	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.65684	0.937;0.919	D	0.88642	0.3176	10	0.87932	D	0	.	19.6484	0.95791	0.0:0.0:1.0:0.0	.	812;816	P10721-2;P10721	.;KIT_HUMAN	Y	816;812	ENSP00000288135:D816Y;ENSP00000390987:D812Y	ENSP00000288135:D816Y	D	+	1	0	KIT	55294077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.659000	0.90383	0.585000	0.79938	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
DSPP	1834	bcgsc.ca	37	4	88536953	88536953	+	Missense_Mutation	SNP	G	G	A	rs200486992		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr4:88536953G>A	ENST00000282478.7	+	4	3172	c.3139G>A	c.(3139-3141)Gat>Aat	p.D1047N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1047N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1047	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgatagcagtga	0.527																																					p.D1047N													.	DSPP	174		0			c.G3139A												46.0	57.0	53.0					4																	88536953		1537	2773	4310	SO:0001583	missense	1834	exon5			AGCAGCGATAGCA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3139G>A	4.37:g.88536953G>A	ENSP00000282478:p.Asp1047Asn		Somatic	50	0.02	1		WXS	Illumina HiSeq	Phase_1	71	0.10	7	NM_014208	0		0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	g	3.566	-0.088574	0.07097	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88201	-2.35;-2.35	1.51	-1.84	0.07809	.	.	.	.	.	T	0.78355	0.4270	L	0.34521	1.04	0.09310	N	1	B	0.26708	0.157	B	0.08055	0.003	T	0.61637	-0.7022	9	0.38643	T	0.18	.	5.2365	0.15448	0.5606:0.0:0.4394:0.0	.	1047	Q9NZW4	DSPP_HUMAN	N	1047	ENSP00000382213:D1047N;ENSP00000282478:D1047N	ENSP00000282478:D1047N	D	+	1	0	DSPP	88755977	0.032000	0.19561	0.079000	0.20413	0.006000	0.05464	0.451000	0.21779	-0.607000	0.05738	-0.791000	0.03333	GAT			0.527	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	114271404	114271404	+	Splice_Site	SNP	A	A	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr4:114271404A>C	ENST00000357077.4	+	37	4478	c.4425A>C	c.(4423-4425)aaA>aaC	p.K1475N	ANK2_ENST00000394537.3_Splice_Site_p.K1475N|ANK2_ENST00000264366.6_Splice_Site_p.K1442N|ANK2_ENST00000509550.1_Splice_Site_p.K651N|ANK2_ENST00000510275.2_Splice_Site_p.K127N|ANK2_ENST00000506722.1_Splice_Site_p.K1466N	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1475	Death 1. {ECO:0000255|PROSITE- ProRule:PRU00064}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CATCAGAAAAAAGTAAGAATT	0.338																																					p.K1475N													.	.			0			c.A4425C												51.0	51.0	51.0					4																	114271404		2197	4295	6492	SO:0001630	splice_region_variant	287	exon37			AGAAAAAAGTAAG	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4426+1A>C	4.37:g.114271404A>C			Somatic	34	0	0		WXS	Illumina HiSeq	.	55	0.09	5	NM_001148	0		0	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.66|17.66	3.445057|3.445057	0.63178|0.63178	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000509550;ENST00000510275|ENST00000514960;ENST00000504415	T;T;T;T;T;T;T;T|T;T	0.66280|0.76186	1.78;-0.2;1.78;-0.16;1.78;1.78;1.76;1.76|-1.0;0.3	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.111859|0.111859	0.39083|0.39083	N|N	0.001468|0.001468	T|T	0.77811|0.77811	0.4186|0.4186	M|M	0.61703|0.61703	1.905|1.905	0.45791|0.45791	D|D	0.998679|0.998679	B;B;P;B;B;B|.	0.41910|.	0.002;0.418;0.764;0.209;0.414;0.122|.	B;B;B;B;B;B|.	0.36922|.	0.002;0.157;0.199;0.138;0.076;0.236|.	T|T	0.73557|0.73557	-0.3945|-0.3945	10|8	0.28530|0.16420	T|T	0.3|0.52	.|.	14.1969|14.1969	0.65677|0.65677	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	651;1442;476;1475;1475;1466|.	E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5|.	.;ANK2_HUMAN;.;.;.;.|.	N|Q	1388;1466;1490;1475;1475;1442;651;127|477;128	ENSP00000421011:K1388N;ENSP00000421067:K1466N;ENSP00000424722:K1490N;ENSP00000378044:K1475N;ENSP00000349588:K1475N;ENSP00000264366:K1442N;ENSP00000426944:K651N;ENSP00000421023:K127N|ENSP00000422853:K477Q;ENSP00000426994:K128Q	ENSP00000264366:K1442N|ENSP00000426994:K128Q	K|K	+|+	3|1	2|0	ANK2|ANK2	114490853|114490853	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.224000|6.224000	0.72265|0.72265	2.082000|2.082000	0.62665|0.62665	0.533000|0.533000	0.62120|0.62120	AAA|AAA			0.338	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000256422.2		NM_001148	Missense_Mutation
DDX60	55601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	169146761	169146761	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr4:169146761C>T	ENST00000393743.3	-	34	4891	c.4600G>A	c.(4600-4602)Gag>Aag	p.E1534K		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1534					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GTAAAGTCCTCCATAATTTTC	0.348																																					p.E1534K													.	.			0			c.G4600A												104.0	107.0	106.0					4																	169146761		2203	4300	6503	SO:0001583	missense	55601	exon34			AGTCCTCCATAAT	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.4600G>A	4.37:g.169146761C>T	ENSP00000377344:p.Glu1534Lys		Somatic	116	0	0		WXS	Illumina HiSeq	.	132	0.12	16	NM_017631	3	0.67	2	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.415|2.415	-0.334517|-0.334517	0.05278|0.05278	.|.	.|.	ENSG00000137628|ENSG00000137628	ENST00000393743|ENST00000511317	T|.	0.16597|.	2.33|.	5.82|5.82	-5.37|-5.37	0.02681|0.02681	.|.	1.039030|.	0.07563|.	N|.	0.917281|.	T|.	0.14399|.	0.0348|.	N|N	0.04880|0.04880	-0.145|-0.145	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.08055|.	0.001;0.003|.	T|.	0.32428|.	-0.9907|.	10|.	0.02654|.	T|.	1|.	.|.	8.9614|8.9614	0.35849|0.35849	0.0:0.4726:0.2276:0.2998|0.0:0.4726:0.2276:0.2998	.|.	1534;26|.	Q8IY21;Q9NT91|.	DDX60_HUMAN;.|.	K|X	1534|26	ENSP00000377344:E1534K|.	ENSP00000377344:E1534K|.	E|W	-|-	1|3	0|0	DDX60|DDX60	169383336|169383336	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.893000|-0.893000	0.04127|0.04127	-1.205000|-1.205000	0.02645|0.02645	-0.471000|-0.471000	0.05019|0.05019	GAG|TGG			0.348	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364622.1		NM_017631	
BRD9	65980	mdanderson.org	37	5	884095	884095	+	Missense_Mutation	SNP	G	G	T	rs372444870		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr5:884095G>T	ENST00000467963.1	-	8	1090	c.924C>A	c.(922-924)gaC>gaA	p.D308E	BRD9_ENST00000435709.2_Missense_Mutation_p.D192E|BRD9_ENST00000494422.1_Intron|BRD9_ENST00000323510.4_Missense_Mutation_p.D212E|BRD9_ENST00000388890.4_Missense_Mutation_p.D192E|BRD9_ENST00000483173.1_Missense_Mutation_p.D255E	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	308					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CCCGAGCTTCGTCAGCTGCGT	0.632																																					p.D308E													.	.			0			c.C924A												131.0	101.0	111.0					5																	884095		2203	4300	6503	SO:0001583	missense	65980	exon8			AGCTTCGTCAGCT	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.924C>A	5.37:g.884095G>T	ENSP00000419765:p.Asp308Glu		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_023924	6	0.00	0	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	37	CCDS34127.2	.	.	.	.	.	.	.	.	.	.	g	8.749	0.920842	0.17982	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963;ENST00000435709;ENST00000489093	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	4.85	-1.02	0.10135	.	0.093476	0.64402	D	0.000001	T	0.52354	0.1729	M	0.72479	2.2	0.53688	D	0.999977	D;D;D;D	0.64830	0.994;0.984;0.993;0.98	D;P;P;P	0.63192	0.912;0.855;0.715;0.715	T	0.53301	-0.8458	10	0.12766	T	0.61	-18.5571	12.1767	0.54190	0.7593:0.0:0.2407:0.0	.	255;308;212;192	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	E	212;192;255;308;192;212	ENSP00000323557:D212E;ENSP00000373542:D192E;ENSP00000419845:D255E;ENSP00000419765:D308E;ENSP00000402984:D192E;ENSP00000420722:D212E	ENSP00000323557:D212E	D	-	3	2	BRD9	937095	0.980000	0.34600	0.020000	0.16555	0.002000	0.02628	0.224000	0.17738	-0.661000	0.05345	-1.753000	0.00675	GAC			0.632	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354113.1		NM_023924	
SEPT8	23176	mdanderson.org	37	5	132096546	132096546	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr5:132096546C>A	ENST00000378719.2	-	9	1471	c.1234G>T	c.(1234-1236)Gcc>Tcc	p.A412S	SEPT8_ENST00000458488.2_Missense_Mutation_p.A412S|SEPT8_ENST00000378699.2_Missense_Mutation_p.A352S|SEPT8_ENST00000378706.1_Missense_Mutation_p.A412S|SEPT8_ENST00000448933.1_Missense_Mutation_p.A352S|SEPT8_ENST00000481030.1_5'UTR|SEPT8_ENST00000296873.7_Missense_Mutation_p.A412S|SEPT8_ENST00000378721.4_Missense_Mutation_p.A410S|SEPT8_ENST00000378701.1_Missense_Mutation_p.A410S	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8	412					cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.A412S(1)	SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCGTGCAAGGCCTGCGACTGC	0.647																																					p.A412S													SEPT8,NS,carcinoma,0,1	SEPT8	0	1	1	Substitution - Missense(1)	lung(1)	c.G1234T												75.0	84.0	81.0					5																	132096546		2105	4217	6322	SO:0001583	missense	23176	exon9			GCAAGGCCTGCGA	AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.1234G>T	5.37:g.132096546C>A	ENSP00000367991:p.Ala412Ser		Somatic	61	0.0163934426	1		WXS	Illumina HiSeq	Phase_I	116	0.12	14	NM_015146	0		0	A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	Missense_Mutation	SNP	ENST00000378719.2	37	CCDS43358.1	.	.	.	.	.	.	.	.	.	.	C	9.058	0.993883	0.19043	.	.	ENSG00000164402	ENST00000378719;ENST00000378721;ENST00000296873;ENST00000448933;ENST00000378706;ENST00000378699;ENST00000378701;ENST00000458488	D;D;D;D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5	5.7	4.78	0.61160	.	0.474581	0.22708	N	0.056614	T	0.61565	0.2357	N	0.14661	0.345	0.32810	D	0.501365	B;B;B;B	0.09022	0.001;0.002;0.0;0.001	B;B;B;B	0.10450	0.003;0.005;0.004;0.005	T	0.56086	-0.8037	10	0.02654	T	1	.	12.0014	0.53232	0.3358:0.6642:0.0:0.0	.	410;410;412;412	B7ZVZ1;A6NFQ9;F6W7K9;Q92599	.;.;.;SEPT8_HUMAN	S	412;410;412;352;412;352;410;412	ENSP00000367991:A412S;ENSP00000367993:A410S;ENSP00000296873:A412S;ENSP00000399840:A352S;ENSP00000367978:A412S;ENSP00000367971:A352S;ENSP00000367973:A410S;ENSP00000394766:A412S	ENSP00000296873:A412S	A	-	1	0	SEPT8	132124445	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.306000	0.51881	2.683000	0.91414	0.655000	0.94253	GCC			0.647	SEPT8-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000132827.2		XM_034872	
FAM53C	51307	broad.mit.edu	37	5	137681245	137681245	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr5:137681245G>T	ENST00000239906.5	+	4	1296	c.868G>T	c.(868-870)Gag>Tag	p.E290*	FAM53C_ENST00000513056.1_Silent_p.T99T|RP11-256P1.1_ENST00000504539.1_RNA|FAM53C_ENST00000434981.2_Nonsense_Mutation_p.E290*	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	290										breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCGGCGCCACGAGGAAGACCC	0.617																																					p.E290X													.	FAM53C	35		0			c.G868T												46.0	55.0	52.0					5																	137681245		2202	4300	6502	SO:0001587	stop_gained	51307	exon4			CGCCACGAGGAAG	AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.868G>T	5.37:g.137681245G>T	ENSP00000239906:p.Glu290*		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	113	0.03	3	NM_001135647	2	0.00	0	B2RDJ5|D3DQB9	Nonsense_Mutation	SNP	ENST00000239906.5	37	CCDS4204.1	.	.	.	.	.	.	.	.	.	.	G	39	7.598061	0.98381	.	.	ENSG00000120709	ENST00000434981;ENST00000239906	.	.	.	5.55	5.55	0.83447	.	0.151126	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-3.6793	18.4386	0.90656	0.0:0.0:1.0:0.0	.	.	.	.	X	290	.	ENSP00000239906:E290X	E	+	1	0	FAM53C	137709144	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	3.573000	0.53856	2.894000	0.99253	0.655000	0.94253	GAG			0.617	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251278.2		NM_016605	
KIAA1191	57179	mdanderson.org	37	5	175777718	175777718	+	Silent	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr5:175777718C>T	ENST00000298569.4	-	6	890	c.357G>A	c.(355-357)caG>caA	p.Q119Q	KIAA1191_ENST00000510164.1_Silent_p.Q119Q|KIAA1191_ENST00000393725.2_Silent_p.Q100Q|RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393728.2_Intron|KIAA1191_ENST00000533553.1_Intron	NM_020444.3	NP_065177.2	Q96A73	P33MX_HUMAN	KIAA1191	119						cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GCTCAAAATGCTGAATGCTTT	0.537																																					p.Q119Q													.	.			0			c.G357A												146.0	123.0	131.0					5																	175777718		2203	4300	6503	SO:0001819	synonymous_variant	57179	exon6			AAAATGCTGAATG	BC010448	CCDS4399.1, CCDS43402.1, CCDS75373.1	5q35.2	2008-02-05			ENSG00000122203	ENSG00000122203			29209	protein-coding gene	gene with protein product						10574461, 10565538	Standard	XM_005265941		Approved	FLJ21022	uc003mdy.3	Q96A73	OTTHUMG00000130656	ENST00000298569.4:c.357G>A	5.37:g.175777718C>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_020444	13	0.00	0	B2RD69|B8K1S6|Q6IA24|Q8NDU3|Q9BRE5|Q9H7D5|Q9ULM9	Silent	SNP	ENST00000298569.4	37	CCDS4399.1																																																																																					0.537	KIAA1191-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253146.2		NM_020444	
LOC202181	202181	broad.mit.edu	37	5	177099140	177099140	+	RNA	SNP	T	T	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr5:177099140T>A	ENST00000515045.1	-	0	70					NR_026921.1																						GATCACGATGTAATCCTCCAT	0.756																																					.													.	.			0			.																																											0	.			ACGATGTAATCCT																													5.37:g.177099140T>A			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	31	0.13	4	.	0		0		RNA	SNP	ENST00000515045.1	37																																																																																						0.756	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000373167.1			
RPP40	10799	ucsc.edu	37	6	4995431	4995431	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr6:4995431C>T	ENST00000380051.2	-	8	1017	c.973G>A	c.(973-975)Gaa>Aaa	p.E325K	RPP40_ENST00000464646.1_Missense_Mutation_p.E265K|RPP40_ENST00000319533.5_Missense_Mutation_p.E302K	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	325					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				TCATTTTTTTCCCAAGAAACA	0.388																																					p.E325K													.	RPP40	36		0			c.G973A												71.0	72.0	72.0					6																	4995431		2203	4300	6503	SO:0001583	missense	10799	exon8			TTTTTTCCCAAGA	U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.973G>A	6.37:g.4995431C>T	ENSP00000369391:p.Glu325Lys		Somatic	101	0.0099009901	1		RNA-Seq	Illumina HiSeq		122	0.01	1	NM_006638	71	0.10	7	Q5VX97|Q8WVK8	Missense_Mutation	SNP	ENST00000380051.2	37	CCDS34333.1	.	.	.	.	.	.	.	.	.	.	C	0.180	-1.062924	0.01950	.	.	ENSG00000124787	ENST00000380051;ENST00000319533;ENST00000464646	T;T;T	0.41758	0.99;0.99;0.99	4.96	3.81	0.43845	.	0.242381	0.49916	D	0.000127	T	0.03095	0.0091	N	0.00707	-1.245	0.20196	N	0.999929	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.45600	-0.9250	10	0.05959	T	0.93	-5.6552	9.1685	0.37065	0.0:0.0884:0.0:0.9116	.	302;325	O75818-2;O75818	.;RPP40_HUMAN	K	325;302;265	ENSP00000369391:E325K;ENSP00000317998:E302K;ENSP00000419431:E265K	ENSP00000317998:E302K	E	-	1	0	RPP40	4940430	1.000000	0.71417	0.998000	0.56505	0.239000	0.25481	2.455000	0.44988	0.749000	0.32854	-0.302000	0.09304	GAA			0.388	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039733.2		NM_006638	
PFDN6	10471	broad.mit.edu	37	6	33258148	33258148	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr6:33258148G>T	ENST00000395131.1	+	4	587	c.181G>T	c.(181-183)Ggt>Tgt	p.G61C	PFDN6_ENST00000374606.5_Missense_Mutation_p.G61C|PFDN6_ENST00000374610.2_Missense_Mutation_p.G61C|PFDN6_ENST00000374607.1_Missense_Mutation_p.G61C|WDR46_ENST00000477718.1_5'Flank|RGL2_ENST00000437840.2_5'Flank|WDR46_ENST00000374617.4_5'Flank|PFDN6_ENST00000463584.1_Missense_Mutation_p.G61C			O15212	PFD6_HUMAN	prefoldin subunit 6	61					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	prefoldin complex (GO:0016272)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(1)	2						TAAACTTCTGGGTCCGGTGCT	0.537																																					p.G61C													.	PFDN6	9		0			c.G181T												101.0	101.0	101.0					6																	33258148		2203	4300	6503	SO:0001583	missense	10471	exon3			CTTCTGGGTCCGG	BC039033	CCDS4773.1	6p21.3	2006-02-24	2006-02-24	2006-02-24	ENSG00000204220	ENSG00000204220			4926	protein-coding gene	gene with protein product		605660	"""HLA class II region expressed gene KE2"", ""prefoldin 6"""	HKE2		9545376, 9630229	Standard	NM_001185181		Approved	KE-2, H2-KE2, PFD6	uc031sny.1	O15212	OTTHUMG00000031247	ENST00000395131.1:c.181G>T	6.37:g.33258148G>T	ENSP00000378563:p.Gly61Cys		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	186	0.03	5	NM_001185181	770	0.00	1		Missense_Mutation	SNP	ENST00000395131.1	37	CCDS4773.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.576008	0.86645	.	.	ENSG00000204220	ENST00000395131;ENST00000374606;ENST00000374610;ENST00000374607;ENST00000463584	D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98	5.63	4.76	0.60689	Prefoldin beta-like (1);Prefoldin (1);	0.000000	0.85682	D	0.000000	D	0.92351	0.7573	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93701	0.7015	10	0.87932	D	0	.	10.5071	0.44841	0.0867:0.0:0.9133:0.0	.	61	O15212	PFD6_HUMAN	C	61	ENSP00000378563:G61C;ENSP00000363734:G61C;ENSP00000363738:G61C;ENSP00000363735:G61C;ENSP00000420135:G61C	ENSP00000363734:G61C	G	+	1	0	PFDN6	33366126	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.672000	0.83956	1.618000	0.50286	0.643000	0.83706	GGT			0.537	PFDN6-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276361.1		NM_014260	
SLC26A8	116369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35960389	35960389	+	Silent	SNP	A	A	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr6:35960389A>G	ENST00000490799.1	-	6	1043	c.690T>C	c.(688-690)agT>agC	p.S230S	SLC26A8_ENST00000355574.2_Silent_p.S230S|SLC26A8_ENST00000394602.2_Intron	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						CCAGGTAAGCACTCATTGCAG	0.478																																					p.S230S													.	.			0			c.T690C												131.0	124.0	127.0					6																	35960389		2203	4300	6503	SO:0001819	synonymous_variant	116369	exon6			GTAAGCACTCATT	AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.690T>C	6.37:g.35960389A>G			Somatic	60	0	0		WXS	Illumina HiSeq	.	57	0.16	9	NM_052961	0		0		Silent	SNP	ENST00000490799.1	37	CCDS4813.1																																																																																					0.478	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040325.2			
SMPD2	6610	broad.mit.edu	37	6	109764880	109764880	+	Silent	SNP	A	A	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr6:109764880A>G	ENST00000258052.3	+	10	1403	c.1044A>G	c.(1042-1044)ggA>ggG	p.G348G	PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	348					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		CGGCTGGAGGAGGGGCCGGGG	0.632																																					p.G348G													.	SMPD2	25		0			c.A1044G												48.0	54.0	52.0					6																	109764880		2203	4300	6503	SO:0001819	synonymous_variant	6610	exon10			TGGAGGAGGGGCC	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.1044A>G	6.37:g.109764880A>G			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	106	0.04	4	NM_003080	83	0.02	2	Q5TED1|Q9BWR3	Silent	SNP	ENST00000258052.3	37	CCDS5075.1																																																																																					0.632	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041755.1			
TTYH3	80727	mdanderson.org	37	7	2686862	2686862	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr7:2686862G>A	ENST00000258796.7	+	3	585	c.380G>A	c.(379-381)cGc>cAc	p.R127H	TTYH3_ENST00000403167.1_5'Flank|TTYH3_ENST00000407643.1_Missense_Mutation_p.R127H	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	127					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		CACGCCAACCGCACGGTGGCC	0.711																																					p.R127H													.	.			0			c.G380A												12.0	14.0	13.0					7																	2686862		2184	4269	6453	SO:0001583	missense	80727	exon3			CCAACCGCACGGT		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.380G>A	7.37:g.2686862G>A	ENSP00000258796:p.Arg127His		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_025250	4	0.00	0	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Missense_Mutation	SNP	ENST00000258796.7	37	CCDS34588.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695794	0.30052	.	.	ENSG00000136295	ENST00000258796;ENST00000407643	T;T	0.10573	2.86;2.86	5.37	5.37	0.77165	.	0.099877	0.64402	D	0.000001	T	0.05318	0.0141	N	0.03324	-0.35	0.80722	D	1	B	0.12630	0.006	B	0.13407	0.009	T	0.21690	-1.0238	10	0.02654	T	1	.	19.0999	0.93269	0.0:0.0:1.0:0.0	.	127	Q9C0H2	TTYH3_HUMAN	H	127	ENSP00000258796:R127H;ENSP00000385316:R127H	ENSP00000258796:R127H	R	+	2	0	TTYH3	2653388	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.203000	0.58453	2.524000	0.85096	0.561000	0.74099	CGC			0.711	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325082.2		XM_166523	
TSPAN13	27075	broad.mit.edu	37	7	16817466	16817466	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr7:16817466G>T	ENST00000262067.4	+	4	789	c.356G>T	c.(355-357)cGa>cTa	p.R119L	TSPAN13_ENST00000466195.1_3'UTR	NM_014399.3	NP_055214.1	O95857	TSN13_HUMAN	tetraspanin 13	119						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	7	Lung NSC(10;0.0494)|all_lung(11;0.109)			UCEC - Uterine corpus endometrioid carcinoma (126;0.188)		GCAAGTGCTCGAAATGACATC	0.388																																					p.R119L													.	TSPAN13	13		0			c.G356T												106.0	98.0	100.0					7																	16817466		2203	4300	6503	SO:0001583	missense	27075	exon4			GTGCTCGAAATGA	AF100759	CCDS5363.1	7p21.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000106537	ENSG00000106537		"""Tetraspanins"""	21643	protein-coding gene	gene with protein product		613139	"""transmembrane 4 superfamily member 13"""	TM4SF13			Standard	NM_014399		Approved	NET-6	uc003stq.3	O95857	OTTHUMG00000022968	ENST00000262067.4:c.356G>T	7.37:g.16817466G>T	ENSP00000262067:p.Arg119Leu		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	253	0.02	5	NM_014399	0		0		Missense_Mutation	SNP	ENST00000262067.4	37	CCDS5363.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893749	0.52121	.	.	ENSG00000106537	ENST00000262067	D	0.82893	-1.66	5.74	3.92	0.45320	.	0.170354	0.52532	D	0.000071	T	0.73102	0.3544	L	0.47190	1.495	0.25552	N	0.987078	B	0.06786	0.001	B	0.11329	0.006	T	0.54200	-0.8329	10	0.09338	T	0.73	-21.2365	8.8657	0.35284	0.281:0.0:0.719:0.0	.	119	O95857	TSN13_HUMAN	L	119	ENSP00000262067:R119L	ENSP00000262067:R119L	R	+	2	0	TSPAN13	16783991	1.000000	0.71417	0.970000	0.41538	0.996000	0.88848	2.605000	0.46283	1.433000	0.47394	0.655000	0.94253	CGA			0.388	TSPAN13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250178.2		NM_014399	
RP11-368M16.3	0	broad.mit.edu	37	7	57701205	57701207	+	RNA	DEL	CAG	CAG	-	rs573176039|rs202197842	byFrequency	TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr7:57701205_57701207delCAG	ENST00000605139.1	-	0	416																											CACCATGGCACAGTGCTGTGCAG	0.522																																					.													.	.			0			.																																											0	.			ATGGCACAGTGCT																													7.37:g.57701205_57701207delCAG			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000605139.1	37																																																																																						0.522	RP11-368M16.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000468775.1			
COL26A1	136227	broad.mit.edu	37	7	101091318	101091318	+	RNA	DEL	A	A	-			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr7:101091318delA	ENST00000397927.3	+	0	598				COL26A1_ENST00000528707.1_RNA|COL26A1_ENST00000313669.7_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											TACAGAAGCCAAAAACAGCAC	0.577																																					.													.	.			0			.																																											136227	.			GAAGCCAAAAACA	AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101091318delA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	Q32M90	RNA	DEL	ENST00000397927.3	37																																																																																						0.577	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000315898.2		NM_133457	
NUP205	23165	broad.mit.edu	37	7	135291662	135291662	+	Splice_Site	SNP	A	A	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr7:135291662A>G	ENST00000285968.6	+	21	3095	c.3069A>G	c.(3067-3069)ccA>ccG	p.P1023P		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1023					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TACAAGATCCAGGTATAGCCT	0.408																																					p.P1023P													.	NUP205	198		0			c.A3069G												114.0	107.0	110.0					7																	135291662		2203	4300	6503	SO:0001630	splice_region_variant	23165	exon21			AGATCCAGGTATA	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3070+1A>G	7.37:g.135291662A>G			Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	160	0.02	3	NM_015135	0		0	A6H8X3|Q86YC1	Splice_Site	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																					0.408	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340358.1			Silent
GIMAP6	474344	broad.mit.edu	37	7	150325069	150325069	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr7:150325069T>C	ENST00000328902.5	-	3	833	c.617A>G	c.(616-618)gAg>gGg	p.E206G	GIMAP6_ENST00000493969.1_3'UTR	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	206	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCCTGCTCCTCCCCCTGTGC	0.537																																					p.E276G													.	GIMAP6	60		0			c.A827G												120.0	126.0	124.0					7																	150325069		2203	4300	6503	SO:0001583	missense	474344	exon3			TGCTCCTCCCCCT	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.617A>G	7.37:g.150325069T>C	ENSP00000330374:p.Glu206Gly		Somatic	93	0.0215053763	2		WXS	Illumina HiSeq	Phase_I	149	0.03	5	NM_001244072	1	0.00	0	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	37	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	T	4.619	0.115073	0.08831	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.06218	3.33	4.2	-8.4	0.00965	AIG1 (1);	1.587260	0.03706	N	0.249495	T	0.04861	0.0131	L	0.37507	1.11	0.09310	N	1	B;B	0.24426	0.041;0.103	B;B	0.30572	0.117;0.058	T	0.34279	-0.9835	10	0.26408	T	0.33	.	3.2795	0.06909	0.1753:0.0943:0.1338:0.5966	.	206;126	Q6P9H5;Q6P9H5-2	GIMA6_HUMAN;.	G	206;267	ENSP00000330374:E206G	ENSP00000330374:E206G	E	-	2	0	GIMAP6	149956002	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-2.136000	0.01305	-1.814000	0.01224	0.460000	0.39030	GAG			0.537	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353457.1		NM_024711	
ATG9B	285973	broad.mit.edu	37	7	150715013	150715013	+	Missense_Mutation	SNP	A	A	C			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr7:150715013A>C	ENST00000377974.2	-	8	2072	c.1997T>G	c.(1996-1998)gTt>gGt	p.V666G	ATG9B_ENST00000444312.1_Missense_Mutation_p.V152G|ATG9B_ENST00000605938.1_Missense_Mutation_p.V666G|ATG9B_ENST00000494791.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	666					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GATGTCCCCAACCCCAGCCAC	0.587											OREG0018444	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	ATG9B	51		0			.																																									SO:0001583	missense	285973	.			TCCCCAACCCCAG	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.1997T>G	7.37:g.150715013A>C	ENSP00000475005:p.Val666Gly		Somatic	66	0.0303030303	2	1734	WXS	Illumina HiSeq	Phase_I	90	0.07	6	.	1	0.00	0	A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	ENST00000377974.2	37		.	.	.	.	.	.	.	.	.	.	A	18.03	3.531478	0.64972	.	.	ENSG00000248602	ENST00000377974;ENST00000444312;ENST00000397266	.	.	.	5.43	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.72112	0.3420	.	.	.	.	.	.	D	0.89917	1.0	D	0.83275	0.996	T	0.80612	-0.1305	7	0.87932	D	0	.	8.802	0.34914	0.9115:0.0:0.0885:0.0	.	666	Q674R7	ATG9B_HUMAN	G	666;152;666	.	ENSP00000444232:V666G	V	-	2	0	AC010973.1	150345946	1.000000	0.71417	0.659000	0.29680	0.974000	0.67602	7.426000	0.80270	2.054000	0.61138	0.460000	0.39030	GTT			0.587	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_173681	
MFHAS1	9258	broad.mit.edu	37	8	8747748	8747748	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr8:8747748G>T	ENST00000276282.6	-	1	3407	c.2821C>A	c.(2821-2823)Ctg>Atg	p.L941M		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	941										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCAATGGACAGGGTGTCTGGC	0.507																																					p.L941M	Melanoma(103;1201 2045 17515 28966)												.	MFHAS1	58		0			c.C2821A												99.0	99.0	99.0					8																	8747748		2203	4300	6503	SO:0001583	missense	9258	exon1			TGGACAGGGTGTC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2821C>A	8.37:g.8747748G>T	ENSP00000276282:p.Leu941Met		Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	244	0.02	4	NM_004225	4	0.00	0	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872493	0.72180	.	.	ENSG00000147324	ENST00000276282	T	0.38887	1.11	5.72	4.79	0.61399	.	0.000000	0.64402	D	0.000014	T	0.57902	0.2085	L	0.54323	1.7	0.51012	D	0.999902	D	0.89917	1.0	D	0.69307	0.963	T	0.55464	-0.8137	10	0.45353	T	0.12	.	15.2994	0.73936	0.0:0.14:0.8599:0.0	.	941	Q9Y4C4	MFHA1_HUMAN	M	941	ENSP00000276282:L941M	ENSP00000276282:L941M	L	-	1	2	MFHAS1	8785158	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.001000	0.49488	2.715000	0.92844	0.655000	0.94253	CTG			0.507	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374724.2		NM_004225	
DUSP26	78986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	33449560	33449560	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr8:33449560G>T	ENST00000256261.4	-	4	1124	c.607C>A	c.(607-609)Cgc>Agc	p.R203S	DUSP26_ENST00000523956.1_Missense_Mutation_p.R203S	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	203	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		CGCAGCCTGCGGTCCAGGGCC	0.652																																					p.R203S													.	.			0			c.C607A												59.0	61.0	61.0					8																	33449560		2203	4300	6503	SO:0001583	missense	78986	exon4			GCCTGCGGTCCAG	AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.607C>A	8.37:g.33449560G>T	ENSP00000256261:p.Arg203Ser		Somatic	71	0	0		WXS	Illumina HiSeq	.	83	0.13	11	NM_024025	0		0	D3DSV8|Q9BTW0	Missense_Mutation	SNP	ENST00000256261.4	37	CCDS6092.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.317783	0.23994	.	.	ENSG00000133878	ENST00000256261;ENST00000523956	D;D	0.85861	-2.04;-2.04	4.8	4.8	0.61643	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.655189	0.16024	N	0.233169	T	0.67906	0.2943	N	0.08118	0	0.44677	D	0.997664	B	0.12013	0.005	B	0.14578	0.011	T	0.61589	-0.7032	10	0.07325	T	0.83	-26.6292	11.1317	0.48351	0.0:0.0:0.7667:0.2333	.	203	Q9BV47	DUS26_HUMAN	S	203	ENSP00000256261:R203S;ENSP00000429176:R203S	ENSP00000256261:R203S	R	-	1	0	DUSP26	33569102	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.326000	0.43849	2.388000	0.81334	0.549000	0.68633	CGC			0.652	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376564.1		NM_024025	
EPPK1	83481	bcgsc.ca;mdanderson.org	37	8	144940501	144940501	+	Silent	SNP	G	G	A	rs540333192	byFrequency	TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr8:144940501G>A	ENST00000525985.1	-	2	6992	c.6921C>T	c.(6919-6921)gtC>gtT	p.V2307V				P58107	EPIPL_HUMAN	epiplakin 1	2307						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGTAGCCGGTGACGGCGCGCT	0.701													G|||	3	0.000599042	0.0	0.0014	5008	,	,		71043	0.0		0.001	False		,,,				2504	0.001				p.V2307V													.	EPPK1	199		0			c.C6921T												149.0	148.0	148.0					8																	144940501		2183	4263	6446	SO:0001819	synonymous_variant	83481	exon1			GCCGGTGACGGCG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6921C>T	8.37:g.144940501G>A			Somatic	89	0.0112359551	1		WXS	Illumina HiSeq	Phase_1	150	0.08	12	NM_031308	3	0.00	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																						0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
PLEC	5339	broad.mit.edu;mdanderson.org	37	8	144996952	144996952	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr8:144996952G>T	ENST00000322810.4	-	31	7725	c.7556C>A	c.(7555-7557)gCt>gAt	p.A2519D	PLEC_ENST00000527096.1_Missense_Mutation_p.A2405D|PLEC_ENST00000354958.2_Missense_Mutation_p.A2360D|PLEC_ENST00000354589.3_Missense_Mutation_p.A2382D|PLEC_ENST00000436759.2_Missense_Mutation_p.A2409D|PLEC_ENST00000357649.2_Missense_Mutation_p.A2386D|PLEC_ENST00000356346.3_Missense_Mutation_p.A2368D|PLEC_ENST00000398774.2_Missense_Mutation_p.A2350D|PLEC_ENST00000345136.3_Missense_Mutation_p.A2382D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2519	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GAGGCGCTCAGCCTCAGCGCT	0.701																																					p.A2519D													.	PLEC	1144		0			c.C7556A												9.0	10.0	10.0					8																	144996952		2110	4236	6346	SO:0001583	missense	5339	exon31			CGCTCAGCCTCAG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7556C>A	8.37:g.144996952G>T	ENSP00000323856:p.Ala2519Asp		Somatic	37	0.0810810811	3		WXS	Illumina HiSeq	Phase_I	62	0.16	10	NM_201380	5	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655978	0.47467	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.78816	-1.18;-1.18;-1.21;-1.21;-1.19;-1.18;-1.17;-1.18;-1.18	5.08	5.08	0.68730	.	0.190384	0.31519	U	0.007510	D	0.84656	0.5520	L	0.55481	1.735	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.998;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.70016	0.967;0.967;0.967;0.928;0.967;0.967;0.967;0.967	T	0.81649	-0.0837	10	0.23891	T	0.37	.	18.0666	0.89392	0.0:0.0:1.0:0.0	.	2409;2368;2360;2519;2350;2382;2386;2382	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	D	2382;2386;2382;2350;2519;2360;2368;2409;2405	ENSP00000344848:A2382D;ENSP00000350277:A2386D;ENSP00000346602:A2382D;ENSP00000381756:A2350D;ENSP00000323856:A2519D;ENSP00000347044:A2360D;ENSP00000348702:A2368D;ENSP00000388180:A2409D;ENSP00000434583:A2405D	ENSP00000323856:A2519D	A	-	2	0	PLEC	145068940	1.000000	0.71417	0.993000	0.49108	0.900000	0.52787	5.529000	0.67135	2.379000	0.81126	0.549000	0.68633	GCT			0.701	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
ADGRF5P1	389740	broad.mit.edu	37	9	66518311	66518312	+	RNA	INS	-	-	TATTTTATTTTATTT	rs58954057|rs201464262|rs372731552		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr9:66518311_66518312insTATTTTATTTTATTT	ENST00000590130.1	-	0	168																											GGGATGTTTACtattttatttt	0.411																																					.													.	.			0			.																																											0	.			TGTTTACTATTTT																													9.37:g.66518311_66518312insTATTTTATTTTATTT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000590130.1	37																																																																																						0.411	RP11-262H14.7-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000459856.1			
LOC100132077	100132077	broad.mit.edu	37	9	97109268	97109275	+	lincRNA	DEL	AAAAAAGA	AAAAAAGA	-	rs371617960		TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	AAAAAAGA	AAAAAAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chr9:97109268_97109275delAAAAAAGA	ENST00000454869.1	+	0	698					NR_033937.1																						caaaaaaaagaaaaaagaaaaaaagaaa	0.471																																					.													.	.			0			.																																											0	.			AAAAAGAAAAAAG																													9.37:g.97109276_97109283delAAAAAAGA			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000454869.1	37																																																																																						0.471	RP11-307E17.8-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000053177.1			
MT-CO1	4512	hgsc.bcm.edu	37	M	5824	5824	+	5'Flank	SNP	G	G	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chrM:5824G>A	ENST00000361624.2	+	0	0				MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TA_ENST00000387392.1_RNA|MT-TC_ENST00000387405.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ATCACCTCGGAGCTGGTAAAA	0.498																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			CTCGGAGCTGGTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5824G>A	Exception_encountered		Somatic	94	0	0		WXS	Illumina HiSeq	.	234	0.26	60	.	0		0	Q34770	RNA	SNP	ENST00000361624.2	37																																																																																						0.498	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024028	
SHROOM2	357	broad.mit.edu	37	X	9863376	9863376	+	Silent	SNP	T	T	G			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chrX:9863376T>G	ENST00000380913.3	+	4	1518	c.1428T>G	c.(1426-1428)ggT>ggG	p.G476G		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	476					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GCTGGCAGGGTCCCCGGCCCT	0.672																																					p.G476G													.	SHROOM2	139		0			c.T1428G												14.0	16.0	15.0					X																	9863376		2197	4290	6487	SO:0001819	synonymous_variant	357	exon4			GCAGGGTCCCCGG	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.1428T>G	X.37:g.9863376T>G			Somatic	54	0.0925925926	5		WXS	Illumina HiSeq	Phase_I	69	0.17	12	NM_001649	1	0.00	0	B9EIQ7	Silent	SNP	ENST00000380913.3	37	CCDS14135.1																																																																																					0.672	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055721.1		NM_001649	
Unknown	0	bcgsc.ca	37	X	27537820	27537820	+	IGR	SNP	G	G	A			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chrX:27537820G>A								RP11-268G12.1 (120706 upstream) : DCAF8L2 (70679 downstream)																							ACAGAAAAATGCGCGTGTTAA	0.373																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AAAAATGCGCGTG																													X.37:g.27537820G>A			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_1	50	0.18	9	.	0		0		RNA	SNP		37																																																																																					0	0.373										
FOXP3	50943	broad.mit.edu	37	X	49113925	49113925	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chrX:49113925G>T	ENST00000376207.4	-	4	600	c.413C>A	c.(412-414)aCt>aAt	p.T138N	FOXP3_ENST00000518685.1_Missense_Mutation_p.T103N|FOXP3_ENST00000376199.2_Missense_Mutation_p.T103N|FOXP3_ENST00000455775.2_Missense_Mutation_p.T138N|FOXP3_ENST00000557224.1_Missense_Mutation_p.T103N|FOXP3_ENST00000376197.1_Missense_Mutation_p.T88N	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3	138					B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					GAAGACCCCAGTGGCGGTGGT	0.662																																					p.T138N	GBM(182;1432 2112 16160 23073 31774)												.	FOXP3	26		0			c.C413A												58.0	49.0	52.0					X																	49113925		2201	4300	6501	SO:0001583	missense	50943	exon4			ACCCCAGTGGCGG		CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.413C>A	X.37:g.49113925G>T	ENSP00000365380:p.Thr138Asn		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	224	0.02	5	NM_014009	0		0	A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Missense_Mutation	SNP	ENST00000376207.4	37	CCDS14323.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.144958	0.37825	.	.	ENSG00000049768	ENST00000376207;ENST00000376199;ENST00000557224;ENST00000518685;ENST00000376197;ENST00000455775	D;D;D;D;D;D	0.97994	-3.79;-3.66;-4.65;-3.66;-4.63;-4.27	5.13	4.25	0.50352	.	0.094414	0.46442	D	0.000298	D	0.95853	0.8650	N	0.24115	0.695	0.09310	N	0.999997	P;P;D;P;P	0.59357	0.895;0.951;0.985;0.895;0.937	B;P;P;B;P	0.55391	0.328;0.551;0.775;0.328;0.649	D	0.90523	0.4490	10	0.56958	D	0.05	.	9.0273	0.36239	0.111:0.0:0.889:0.0	.	138;138;103;138;103	B9UN80;B7ZLG1;Q9BZS1-3;Q9BZS1;Q9BZS1-2	.;.;.;FOXP3_HUMAN;.	N	138;103;103;103;88;138	ENSP00000365380:T138N;ENSP00000365372:T103N;ENSP00000451208:T103N;ENSP00000428952:T103N;ENSP00000365369:T88N;ENSP00000396415:T138N	ENSP00000365369:T88N	T	-	2	0	FOXP3	49000869	0.855000	0.29742	0.309000	0.25155	0.487000	0.33371	4.171000	0.58236	2.267000	0.75376	0.513000	0.50165	ACT			0.662	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060814.1		NM_014009	
H2BFM	286436	broad.mit.edu	37	X	103294936	103294936	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chrX:103294936G>T	ENST00000355016.3	+	1	421	c.393G>T	c.(391-393)aaG>aaT	p.K131N	H2BFM_ENST00000243297.5_Missense_Mutation_p.K234N	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	131						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						AGATGGGCAAGCTCGCCGAGG	0.632																																					p.K131N													.	H2BFM	25		0			c.G393T												6.0	7.0	7.0					X																	103294936		687	1564	2251	SO:0001583	missense	286436	exon1			GGGCAAGCTCGCC	AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.393G>T	X.37:g.103294936G>T	ENSP00000347119:p.Lys131Asn		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	56	0.14	8	NM_001164416	1	0.00	0	A6NP82	Missense_Mutation	SNP	ENST00000355016.3	37	CCDS55468.1	.	.	.	.	.	.	.	.	.	.	.	15.77	2.932112	0.52866	.	.	ENSG00000101812	ENST00000243297;ENST00000355016;ENST00000417637	T;T;T	0.46819	0.86;0.86;0.86	2.66	1.77	0.24775	Histone-fold (2);	0.136209	0.24037	U	0.042133	T	0.38026	0.1025	N	0.19112	0.55	0.33773	D	0.623293	D	0.59357	0.985	P	0.51324	0.666	T	0.52208	-0.8606	10	0.87932	D	0	.	7.0558	0.25099	0.1505:0.0:0.8495:0.0	.	234	P0C1H6	H2BFM_HUMAN	N	234;131;29	ENSP00000243297:K234N;ENSP00000347119:K131N;ENSP00000402466:K29N	ENSP00000243297:K234N	K	+	3	2	H2BFM	103181592	1.000000	0.71417	0.013000	0.15412	0.004000	0.04260	1.478000	0.35442	0.384000	0.24942	0.519000	0.50382	AAG			0.632	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000057758.2		XM_210048	
ARHGAP4	393	broad.mit.edu	37	X	153187251	153187251	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA05-01A-12D-A435-10	TCGA-ZM-AA05-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7861cef-4a7b-40e7-8a95-da3755f13c76	0d13d0e4-a10b-4704-b72f-3297e33db2fd	g.chrX:153187251G>T	ENST00000350060.5	-	2	120	c.79C>A	c.(79-81)Cag>Aag	p.Q27K	ARHGAP4_ENST00000370028.3_Missense_Mutation_p.Q27K|ARHGAP4_ENST00000393721.1_Missense_Mutation_p.Q27K|ARHGAP4_ENST00000537206.1_Missense_Mutation_p.Q4K|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.Q27K	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	27	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCGCTCAGCTGCCAGCGCATC	0.692																																					p.Q27K													.	ARHGAP4	103		0			c.C79A																																									SO:0001583	missense	393	exon2			TCAGCTGCCAGCG	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.79C>A	X.37:g.153187251G>T	ENSP00000203786:p.Gln27Lys		Somatic	17	0.0588235294	1		WXS	Illumina HiSeq	Phase_I	35	0.20	7	NM_001666	7	0.00	0	Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	37	CCDS14736.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033601	0.93575	.	.	ENSG00000089820	ENST00000393721;ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206;ENST00000442262;ENST00000422091	T;T;T;T;T;T;T	0.43294	2.28;0.95;0.95;0.95;0.95;0.95;0.95	4.95	4.95	0.65309	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.42053	D	0.000776	T	0.64316	0.2587	M	0.72894	2.215	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	T	0.67741	-0.5592	10	0.59425	D	0.04	.	16.3521	0.83215	0.0:0.0:1.0:0.0	.	27;27	Q86UY3;P98171	.;RHG04_HUMAN	K	27;27;27;27;4;4;4	ENSP00000377322:Q27K;ENSP00000359045:Q27K;ENSP00000203786:Q27K;ENSP00000359033:Q27K;ENSP00000444169:Q4K;ENSP00000398259:Q4K;ENSP00000413782:Q4K	ENSP00000203786:Q27K	Q	-	1	0	ARHGAP4	152840445	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.397000	0.79903	2.203000	0.70933	0.436000	0.28706	CAG			0.692	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000061119.1		NM_001666	
