#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MST1L	11223	broad.mit.edu	37	1	17083496	17083496	+	RNA	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr1:17083496A>G	ENST00000455405.2	-	0	1092							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										taaggcaaaaacagtggagtc	0.353																																					.													.	.			0			.																																											0	.			GCAAAAACAGTGG	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083496A>G			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	3	0.00	0	B7WPB1|Q13209	RNA	SNP	ENST00000455405.2	37																																																																																						0.353	MST1L-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000400328.1		NM_001271733	
KIF17	57576	broad.mit.edu	37	1	21016763	21016763	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr1:21016763C>A	ENST00000247986.2	-	7	1609	c.1299G>T	c.(1297-1299)agG>agT	p.R433S	KIF17_ENST00000400463.3_Missense_Mutation_p.R433S|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000375044.1_Missense_Mutation_p.R333S			Q9P2E2	KIF17_HUMAN	kinesin family member 17	433					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CTTCCTCCAGCCTGGCCCGAG	0.642																																					p.R433S													.	KIF17	130		0			c.G1299T												51.0	48.0	49.0					1																	21016763		2203	4300	6503	SO:0001583	missense	57576	exon7			CTCCAGCCTGGCC	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1299G>T	1.37:g.21016763C>A	ENSP00000247986:p.Arg433Ser		Somatic	121	0.0082644628	1		WXS	Illumina HiSeq	Phase_I	133	0.05	6	NM_020816	4	0.00	0	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390050	0.42410	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.71698	-0.59;-0.46;-0.46	4.83	3.9	0.45041	.	0.382752	0.15237	U	0.273120	T	0.67392	0.2888	L	0.58101	1.795	0.23834	N	0.996715	B;B	0.20550	0.046;0.029	B;B	0.23275	0.045;0.017	T	0.61187	-0.7113	10	0.59425	D	0.04	.	12.0715	0.53620	0.0:0.6393:0.3607:0.0	.	433;433	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	S	333;433;433	ENSP00000364184:R333S;ENSP00000383311:R433S;ENSP00000247986:R433S	ENSP00000247986:R433S	R	-	3	2	KIF17	20889350	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.288000	0.43514	1.024000	0.39682	0.485000	0.47835	AGG			0.642	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276995.1		NM_020816	
SPOCD1	90853	broad.mit.edu	37	1	32259795	32259795	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr1:32259795G>T	ENST00000360482.2	-	11	2442	c.2313C>A	c.(2311-2313)ccC>ccA	p.P771P	SPOCD1_ENST00000257100.3_Silent_p.P264P|SPOCD1_ENST00000533231.1_Silent_p.P771P|SPOCD1_ENST00000373648.2_3'UTR|RP11-84A19.3_ENST00000527035.1_RNA	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	771					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CTGATGCGATGGGCAGGGCCT	0.652																																					p.P771P													SPOCD1,NS,carcinoma,-1,1	SPOCD1	109	1	0			c.C2313A												78.0	61.0	66.0					1																	32259795		2203	4300	6503	SO:0001819	synonymous_variant	90853	exon11			TGCGATGGGCAGG	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2313C>A	1.37:g.32259795G>T			Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	251	0.02	5	NM_144569	4	0.00	0	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Silent	SNP	ENST00000360482.2	37	CCDS347.1	.	.	.	.	.	.	.	.	.	.	G	4.324	0.059553	0.08339	.	.	ENSG00000134668	ENST00000528579	.	.	.	5.07	-9.44	0.00603	.	.	.	.	.	T	0.23572	0.0570	.	.	.	0.21105	N	0.999782	.	.	.	.	.	.	T	0.25710	-1.0124	5	0.18710	T	0.47	-10.2362	9.8027	0.40775	0.2181:0.2335:0.5484:0.0	.	.	.	.	Q	145	.	ENSP00000437197:P145Q	P	-	2	0	SPOCD1	32032382	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	-0.996000	0.03709	-1.688000	0.01435	-0.259000	0.10710	CCA			0.652	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000381912.1		NM_144569	
SERBP1	26135	broad.mit.edu	37	1	67895862	67895862	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr1:67895862G>T	ENST00000370995.2	-	1	207	c.122C>A	c.(121-123)gCc>gAc	p.A41D	SERBP1_ENST00000361219.6_Missense_Mutation_p.A41D|SERBP1_ENST00000370994.4_Missense_Mutation_p.A41D|SERBP1_ENST00000370990.5_Missense_Mutation_p.A41D			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	41					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						GCCCCCGCCGGCTTCTTTTTT	0.637																																					p.A41D													.	SERBP1	31		0			c.C122A												30.0	38.0	35.0					1																	67895862		2112	4248	6360	SO:0001583	missense	26135	exon1			CCGCCGGCTTCTT	AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.122C>A	1.37:g.67895862G>T	ENSP00000360034:p.Ala41Asp		Somatic	119	0.025210084	3		WXS	Illumina HiSeq	Phase_I	139	0.04	6	NM_015640	57	0.00	0	Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Missense_Mutation	SNP	ENST00000370995.2	37	CCDS30746.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402790	0.62288	.	.	ENSG00000142864	ENST00000370994;ENST00000370995;ENST00000361219;ENST00000370990	.	.	.	4.04	4.04	0.47022	.	0.120909	0.53938	D	0.000057	T	0.48926	0.1527	L	0.51422	1.61	0.49915	D	0.999832	B;D;P;P	0.67145	0.435;0.996;0.617;0.807	B;P;B;B	0.57324	0.159;0.818;0.242;0.344	T	0.39461	-0.9613	9	0.14252	T	0.57	-3.5289	10.7377	0.46135	0.0:0.3098:0.6902:0.0	.	104;104;41;41	D3DQ69;D3DQ70;Q8NC51-3;Q8NC51	.;.;.;PAIRB_HUMAN	D	41	.	ENSP00000354591:A41D	A	-	2	0	SERBP1	67668450	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.730000	0.47335	2.540000	0.85666	0.563000	0.77884	GCC			0.637	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000025984.2		NM_001018067	
ABCD3	5825	broad.mit.edu	37	1	94964163	94964163	+	Silent	SNP	A	A	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr1:94964163A>T	ENST00000370214.4	+	17	1416	c.1392A>T	c.(1390-1392)cgA>cgT	p.R464R	ABCD3_ENST00000454898.2_Silent_p.R488R|ABCD3_ENST00000536817.1_Silent_p.R391R|ABCD3_ENST00000484213.1_3'UTR|ABCD3_ENST00000394233.2_Silent_p.R354R	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3	464	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TTCAGGTTCGATCTGGGGCTA	0.333																																					p.R464R													.	ABCD3	62		0			c.A1392T												94.0	92.0	92.0					1																	94964163		2203	4300	6503	SO:0001819	synonymous_variant	5825	exon17			GGTTCGATCTGGG	M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.1392A>T	1.37:g.94964163A>T			Somatic	140	0.05	7		WXS	Illumina HiSeq	Phase_I	174	0.08	14	NM_002858	0		0	D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	Silent	SNP	ENST00000370214.4	37	CCDS749.1																																																																																					0.333	ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000029597.1		NM_002858	
ADAR	103	broad.mit.edu	37	1	154574388	154574388	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr1:154574388G>T	ENST00000368474.4	-	2	929	c.730C>A	c.(730-732)Cct>Act	p.P244T	ADAR_ENST00000292205.5_Missense_Mutation_p.P287T|ADAR_ENST00000471068.1_5'Flank|ADAR_ENST00000368471.3_5'UTR	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	244					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GCAATAAAAGGCTCAAGAAGA	0.517																																					p.P244T													.	ADAR	113		0			c.C730A												105.0	108.0	107.0					1																	154574388		2203	4300	6503	SO:0001583	missense	103	exon2			TAAAAGGCTCAAG	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.730C>A	1.37:g.154574388G>T	ENSP00000357459:p.Pro244Thr		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	172	0.03	6	NM_001111	11	0.00	0	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.842220	0.32513	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	T;T;T	0.12672	2.66;2.72;2.69	0.676	0.676	0.17958	.	3.391780	0.02987	U	0.146348	T	0.08582	0.0213	L	0.43923	1.385	0.09310	N	1	P;P;P	0.48350	0.75;0.75;0.909	B;B;P	0.50440	0.222;0.222;0.641	T	0.23797	-1.0178	9	0.41790	T	0.15	.	.	.	.	.	244;244;244	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	T	287;244;239	ENSP00000292205:P287T;ENSP00000357459:P244T;ENSP00000431794:P239T	ENSP00000292205:P287T	P	-	1	0	ADAR	152841012	0.533000	0.26354	0.020000	0.16555	0.090000	0.18270	-0.063000	0.11655	0.619000	0.30197	0.313000	0.20887	CCT			0.517	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000090691.2		NM_001111	
PDDC1	347862	mdanderson.org	37	11	775093	775093	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr11:775093G>T	ENST00000319863.8	-	2	135	c.114C>A	c.(112-114)gcC>gcA	p.A38A	PDDC1_ENST00000524550.1_Silent_p.A38A|AP006621.5_ENST00000530083.1_5'Flank|PDDC1_ENST00000526325.1_Silent_p.A38A|PDDC1_ENST00000529966.1_Intron|PDDC1_ENST00000397472.2_Silent_p.A38A|PDDC1_ENST00000442059.2_Intron	NM_182612.2	NP_872418.1	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1	38						extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(3)|urinary_tract(1)	5		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGGTTGAAGGCGGTGCTGG	0.642																																					p.A38A													.	.			0			c.C114A												80.0	64.0	69.0					11																	775093		2196	4293	6489	SO:0001819	synonymous_variant	347862	exon2			GTTGAAGGCGGTG	AK128653	CCDS7713.1	11p15.5	2005-10-26			ENSG00000177225	ENSG00000177225			26616	protein-coding gene	gene with protein product							Standard	XM_005252898		Approved	FLJ34283	uc001lrc.3	Q8NB37	OTTHUMG00000133315	ENST00000319863.8:c.114C>A	11.37:g.775093G>T			Somatic	53	0.0188679245	1		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_182612	0		0	B7ZKW5|Q2NL76|Q6ZQY0|Q8NAE0	Silent	SNP	ENST00000319863.8	37	CCDS7713.1																																																																																					0.642	PDDC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258051.2		NM_182612	
C11orf95	65998	broad.mit.edu	37	11	63533381	63533381	+	lincRNA	SNP	C	C	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr11:63533381C>A	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							AGGCCCTCGGCCTCTCCGCAG	0.682																																					p.A179S													.	.			0			c.G535T												45.0	38.0	40.0					11																	63533381		692	1591	2283			65998	exon2			CCTCGGCCTCTCC																													11.37:g.63533381C>A			Somatic	47	0.0425531915	2		WXS	Illumina HiSeq	Phase_I	38	0.21	8	NM_001144936	0		0		RNA	SNP	ENST00000546282.2	37																																																																																						0.682	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000396567.2			
FAM76B	143684	mdanderson.org	37	11	95521721	95521721	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr11:95521721G>T	ENST00000358780.5	-	2	406	c.94C>A	c.(94-96)Cgg>Agg	p.R32R	FAM76B_ENST00000536839.1_Silent_p.R32R|CEP57_ENST00000325486.5_5'Flank|CEP57_ENST00000537677.1_5'Flank|CEP57_ENST00000538658.1_5'Flank|CEP57_ENST00000325542.5_5'Flank|FAM76B_ENST00000538047.1_5'UTR	NM_144664.4	NP_653265.3	Q5HYJ3	FA76B_HUMAN	family with sequence similarity 76, member B	32						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(1)|kidney(1)|lung(1)	3		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGTGCAATCCGACATTCCTGT	0.343																																					p.R32R													.	.			0			c.C94A												88.0	85.0	86.0					11																	95521721		1834	4092	5926	SO:0001819	synonymous_variant	143684	exon2			CAATCCGACATTC		CCDS41700.1	11q21	2008-02-05			ENSG00000077458	ENSG00000077458			28492	protein-coding gene	gene with protein product						12477932	Standard	NM_144664		Approved	MGC33371	uc001pfn.2	Q5HYJ3	OTTHUMG00000167739	ENST00000358780.5:c.94C>A	11.37:g.95521721G>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_144664	0		0	Q6PIU3|Q8TC53	Silent	SNP	ENST00000358780.5	37	CCDS41700.1																																																																																					0.343	FAM76B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395969.1		NM_144664	
CBL	867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119149218	119149218	+	Splice_Site	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr11:119149218A>G	ENST00000264033.4	+	9	1603		c.e9-1			NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase						cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(5)|p.G397_I429del(1)|p.E369_Q409del(1)|p.E366_K477del(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CTTCTTCTGCAGGAATCAGAA	0.383			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																												.				"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	CBL,colon,carcinoma,0,7	CBL	0	7	8	Unknown(5)|Deletion - In frame(3)	haematopoietic_and_lymphoid_tissue(8)	c.1228-2A>G												109.0	108.0	109.0					11																	119149218		2199	4295	6494	SO:0001630	splice_region_variant	867	exon9	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	TTCTGCAGGAATC	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1228-1A>G	11.37:g.119149218A>G			Somatic	159	0	0		WXS	Illumina HiSeq	.	88	0.52	46	NM_005188	1	1.00	1	A3KMP8	Splice_Site	SNP	ENST00000264033.4	37	CCDS8418.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.629847	0.87660	.	.	ENSG00000110395	ENST00000264033	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2147	0.82198	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBL	118654428	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.894000	0.92506	2.231000	0.72958	0.460000	0.39030	.			0.383	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388219.4		NM_005188	Intron
FBXL14	144699	broad.mit.edu	37	12	1703090	1703090	+	Missense_Mutation	SNP	A	A	C			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr12:1703090A>C	ENST00000339235.3	-	1	241	c.143T>G	c.(142-144)gTg>gGg	p.V48G	WNT5B_ENST00000537031.1_Intron|FBXL14_ENST00000543278.1_5'Flank	NM_152441.2	NP_689654.1	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14	48	F-box.|Required for down-regulation of SNAI1.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	8	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			CTTGGCCTCCACCCCCCGCCA	0.731																																					p.V48G													.	FBXL14	19		0			c.T143G												7.0	9.0	8.0					12																	1703090		2147	4245	6392	SO:0001583	missense	144699	exon1			GCCTCCACCCCCC	BC028132	CCDS8509.1	12p13.33	2011-06-09			ENSG00000171823	ENSG00000171823		"""F-boxes / Leucine-rich repeats"""	28624	protein-coding gene	gene with protein product		609081				12477932	Standard	NM_152441		Approved	MGC40195, Fbl14	uc001qjh.3	Q8N1E6	OTTHUMG00000090369	ENST00000339235.3:c.143T>G	12.37:g.1703090A>C	ENSP00000344855:p.Val48Gly		Somatic	18	0.4444444444	8		WXS	Illumina HiSeq	Phase_I	39	0.54	21	NM_152441	0		0		Missense_Mutation	SNP	ENST00000339235.3	37	CCDS8509.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263601	0.59431	.	.	ENSG00000171823	ENST00000339235	T	0.56776	0.44	4.03	4.03	0.46877	F-box domain, cyclin-like (1);	0.155201	0.43260	D	0.000588	T	0.74913	0.3779	M	0.93678	3.445	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.78001	-0.2375	10	0.87932	D	0	.	6.3942	0.21603	0.8088:0.0:0.1912:0.0	.	48	Q8N1E6	FXL14_HUMAN	G	48	ENSP00000344855:V48G	ENSP00000344855:V48G	V	-	2	0	FBXL14	1573351	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.648000	0.83479	1.684000	0.51022	0.254000	0.18369	GTG			0.731	FBXL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206741.1		NM_152441	
GPR162	27239	broad.mit.edu	37	12	6933751	6933751	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr12:6933751G>T	ENST00000311268.3	+	2	1474	c.687G>T	c.(685-687)ggG>ggT	p.G229G	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						AAGCGGGTGGGCCAGGGGCCT	0.687																																					p.G229G													GPR162,colon,carcinoma,+1,1	GPR162	55	1	0			c.G687T												33.0	37.0	36.0					12																	6933751		2203	4300	6503	SO:0001819	synonymous_variant	27239	exon2			GGGTGGGCCAGGG	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.687G>T	12.37:g.6933751G>T			Somatic	54	0.0185185185	1		WXS	Illumina HiSeq	Phase_I	103	0.05	5	NM_019858	0		0	Q16664|Q59EH5|Q66K56	Silent	SNP	ENST00000311268.3	37	CCDS8563.1																																																																																					0.687	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399478.1		NM_019858	
FAM186A	121006	hgsc.bcm.edu	37	12	50746615	50746615	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr12:50746615T>C	ENST00000327337.5	-	4	3999	c.4000A>G	c.(4000-4002)Act>Gct	p.T1334A	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.T1334A	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1334																	ATCTCCTGAGTCTGCGCCTGC	0.647																																					p.T1334A	NSCLC(138;1796 1887 12511 19463 37884)												.	.			0			c.A4000G												31.0	29.0	30.0					12																	50746615		692	1591	2283	SO:0001583	missense	121006	exon4			CCTGAGTCTGCGC		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4000A>G	12.37:g.50746615T>C	ENSP00000329995:p.Thr1334Ala		Somatic	93	0	0		WXS	Illumina HiSeq	.	122	0.04	5	NM_001145475	0		0		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	c	0.067	-1.211667	0.01555	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.04083	3.71;3.71	4.64	0.534	0.17127	.	.	.	.	.	T	0.01558	0.0050	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46498	-0.9187	9	0.06625	T	0.88	.	1.0819	0.01644	0.1448:0.3146:0.2827:0.2579	.	1334;1334	F5GYN0;A6NE01	.;F186A_HUMAN	A	1334	ENSP00000441337:T1334A;ENSP00000329995:T1334A	ENSP00000329995:T1334A	T	-	1	0	FAM186A	49032882	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.824000	0.00357	-0.094000	0.12374	-0.338000	0.08134	ACT			0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000396838.1		XM_001718353	
BAZ2A	11176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56995804	56995804	+	Silent	SNP	T	T	C			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr12:56995804T>C	ENST00000551812.1	-	20	3796	c.3603A>G	c.(3601-3603)caA>caG	p.Q1201Q	BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000379441.3_Silent_p.Q1171Q|BAZ2A_ENST00000179765.5_Silent_p.Q1169Q|BAZ2A_ENST00000549884.1_Silent_p.Q1199Q	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1201					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GATGCCTAGGTTGCATAGACC	0.592																																					p.Q1201Q													.	.			0			c.A3603G												22.0	22.0	22.0					12																	56995804		1877	4043	5920	SO:0001819	synonymous_variant	11176	exon20			CCTAGGTTGCATA	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.3603A>G	12.37:g.56995804T>C			Somatic	100	0	0		WXS	Illumina HiSeq	.	109	0.16	17	NM_013449	8	0.13	1	B3KN66|O00536|O15030|Q68DI8|Q96H26	Silent	SNP	ENST00000551812.1	37	CCDS44924.1																																																																																					0.592	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000408561.1		NM_013449	
NACA	4666	broad.mit.edu	37	12	57111746	57111746	+	Missense_Mutation	SNP	A	A	G	rs2958150		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr12:57111746A>G	ENST00000454682.1	-	3	3849	c.3568T>C	c.(3568-3570)Tcc>Ccc	p.S1190P	NACA_ENST00000546392.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000393891.4_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1190	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						CCTTTGGGGGATGGGGTAGCT	0.632			T	BCL6	NHL																																.				Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	.	NACA	131		0			.												70.0	79.0	76.0					12																	57111746		1211	2850	4061	SO:0001583	missense	4666	.			TGGGGGATGGGGT	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.3568T>C	12.37:g.57111746A>G	ENSP00000403817:p.Ser1190Pro		Somatic	128	0.0703125	9		WXS	Illumina HiSeq	Phase_I	179	0.07	13	.	0		0		Missense_Mutation	SNP	ENST00000454682.1	37		.	.	.	.	.	.	.	.	.	.	N	4.185	0.032930	0.08101	.	.	ENSG00000196531	ENST00000454682	T	0.48522	0.81	3.45	-6.89	0.01660	.	.	.	.	.	T	0.22513	0.0543	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13656	-1.0501	7	.	.	.	.	3.2779	0.06904	0.2678:0.208:0.4211:0.1031	.	1190	E9PAV3	.	P	1190	ENSP00000403817:S1190P	.	S	-	1	0	NACA	55398013	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.625000	0.05534	-2.321000	0.00641	-2.753000	0.00124	TCC			0.632	NACA-201	KNOWN	basic	protein_coding	protein_coding				NM_005594	
LOC101927592	101927592	broad.mit.edu	37	12	127423596	127423597	+	lincRNA	DEL	TG	TG	-	rs376186206|rs533478047		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr12:127423596_127423597delTG	ENST00000512624.2	-	0	685																											tgtatgtgtttgtgtgtgtgtg	0.356																																					.													.	.			0			.																																											0	.			TGTGTTTGTGTGT																													12.37:g.127423606_127423607delTG			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	DEL	ENST00000512624.2	37																																																																																						0.356	RP11-575F12.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000399788.1			
STOML3	161003	mdanderson.org	37	13	39544325	39544325	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr13:39544325G>T	ENST00000379631.4	-	5	857	c.513C>A	c.(511-513)atC>atA	p.I171I	STOML3_ENST00000423210.1_Silent_p.I162I	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	171					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		TCTTTACCTGGATGCTATGGG	0.418																																					p.I171I													.	.			0			c.C513A												93.0	81.0	85.0					13																	39544325		2203	4300	6503	SO:0001819	synonymous_variant	161003	exon5			TACCTGGATGCTA	BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.513C>A	13.37:g.39544325G>T			Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	125	0.04	5	NM_145286	0		0	B4E285|Q5JS35	Silent	SNP	ENST00000379631.4	37	CCDS9367.1																																																																																					0.418	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000044604.2			
EDNRB	1910	mdanderson.org	37	13	78492307	78492307	+	Silent	SNP	G	G	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr13:78492307G>A	ENST00000334286.5	-	1	638	c.402C>T	c.(400-402)aaC>aaT	p.N134N	EDNRB_ENST00000377211.4_Silent_p.N224N|EDNRB_ENST00000446573.1_Silent_p.N134N|EDNRB_ENST00000475537.1_5'Flank|RNF219-AS1_ENST00000607862.1_RNA	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	134					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TATTGGGACCGTTTCGCATGC	0.493																																					p.N224N													EDNRB_ENST00000377211,NS,carcinoma,0,2	EDNRB_ENST00000377211	0	2	0			c.C672T												127.0	114.0	118.0					13																	78492307		2203	4300	6503	SO:0001819	synonymous_variant	1910	exon2			GGGACCGTTTCGC	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.402C>T	13.37:g.78492307G>A			Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	85	0.05	4	NM_001201397	0		0	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Silent	SNP	ENST00000334286.5	37	CCDS9461.1																																																																																					0.493	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276505.1			
PSMC1	5700	broad.mit.edu	37	14	90735759	90735759	+	Silent	SNP	T	T	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr14:90735759T>G	ENST00000261303.8	+	9	1003	c.900T>G	c.(898-900)ggT>ggG	p.G300G	PSMC1_ENST00000543772.2_Silent_p.G227G	NM_002802.2	NP_002793.2	P62191	PRS4_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 1	300					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|upper_aerodigestive_tract(2)	6		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		CCAATTCTGGTGGTGAGAGAG	0.423																																					p.G300G													.	PSMC1	27		0			c.T900G												88.0	87.0	88.0					14																	90735759		2203	4300	6503	SO:0001819	synonymous_variant	5700	exon9			TTCTGGTGGTGAG	L02426	CCDS32139.1	14q32.11	2010-04-21			ENSG00000100764	ENSG00000100764		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9547	protein-coding gene	gene with protein product		602706				9473509	Standard	NM_002802		Approved	S4, p56	uc001xyf.3	P62191		ENST00000261303.8:c.900T>G	14.37:g.90735759T>G			Somatic	33	0.0909090909	3		WXS	Illumina HiSeq	Phase_I	34	0.29	10	NM_002802	60	0.00	0	B4DR63|P49014|Q03527|Q6IAW0|Q6NW36|Q96AZ3	Silent	SNP	ENST00000261303.8	37	CCDS32139.1																																																																																					0.423	PSMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411253.1		NM_002802	
BCL11B	64919	hgsc.bcm.edu	37	14	99641568	99641568	+	Missense_Mutation	SNP	C	C	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr14:99641568C>G	ENST00000357195.3	-	4	1614	c.1605G>C	c.(1603-1605)gaG>gaC	p.E535D	BCL11B_ENST00000443726.2_Missense_Mutation_p.E341D|BCL11B_ENST00000345514.2_Missense_Mutation_p.E464D	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	535	Glu-rich.				alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E535_E536delEE(1)		NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		cctcctcctcctcgtcctcct	0.697			T	TLX3	T-ALL																																p.E535D				Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,colon,carcinoma,0,1	BCL11B	0	1	1	Deletion - In frame(1)	prostate(1)	c.G1605C												5.0	5.0	5.0					14																	99641568		2084	4070	6154	SO:0001583	missense	64919	exon4			CTCCTCCTCGTCC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1605G>C	14.37:g.99641568C>G	ENSP00000349723:p.Glu535Asp		Somatic	21	0	0		WXS	Illumina HiSeq	.	31	0.13	4	NM_138576	0		0	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.167616	0.38315	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.13657	2.57;2.6;2.57	3.81	0.863	0.19062	.	0.158674	0.40144	N	0.001176	T	0.07324	0.0185	N	0.22421	0.69	0.40982	D	0.984788	B;B	0.31413	0.322;0.185	B;B	0.31390	0.129;0.048	T	0.38394	-0.9663	10	0.30854	T	0.27	-8.4478	4.8239	0.13407	0.0:0.4986:0.1502:0.3512	.	464;535	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	D	535;464;341	ENSP00000349723:E535D;ENSP00000280435:E464D;ENSP00000387419:E341D	ENSP00000280435:E464D	E	-	3	2	BCL11B	98711321	0.591000	0.26824	0.998000	0.56505	0.990000	0.78478	-0.193000	0.09573	-0.059000	0.13154	0.561000	0.74099	GAG			0.697	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000072332.2		NM_138576	
DYNC1H1	1778	hgsc.bcm.edu;mdanderson.org	37	14	102505463	102505463	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr14:102505463G>T	ENST00000360184.4	+	60	11496	c.11332G>T	c.(11332-11334)Gca>Tca	p.A3778S	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3778	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAGAGAGGCTGCAGAGGTCAC	0.542																																					p.A3778S													.	.			0			c.G11332T												86.0	80.0	82.0					14																	102505463		2203	4300	6503	SO:0001583	missense	1778	exon60			GAGGCTGCAGAGG	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11332G>T	14.37:g.102505463G>T	ENSP00000348965:p.Ala3778Ser		Somatic	63	0	0		WXS	Illumina HiSeq	.	86	0.05	4	NM_001376	24	0.00	0	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995177	0.74703	.	.	ENSG00000197102	ENST00000360184	T	0.57907	0.37	5.93	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.45175	0.1329	L	0.41492	1.28	0.80722	D	1	P	0.35192	0.489	B	0.34093	0.175	T	0.39292	-0.9621	10	0.38643	T	0.18	.	15.3189	0.74105	0.0671:0.0:0.9329:0.0	.	3778	Q14204	DYHC1_HUMAN	S	3778	ENSP00000348965:A3778S	ENSP00000348965:A3778S	A	+	1	0	DYNC1H1	101575216	1.000000	0.71417	0.343000	0.25615	0.958000	0.62258	9.869000	0.99810	1.518000	0.48934	0.561000	0.74099	GCA			0.542	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414574.1		NM_001376	
IFT140	9742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1634408	1634408	+	Missense_Mutation	SNP	T	T	C	rs369998823		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr16:1634408T>C	ENST00000426508.2	-	11	1532	c.1169A>G	c.(1168-1170)aAg>aGg	p.K390R	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	390					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CAGCAGGTTCTTCCTGGAACC	0.552																																					p.K390R													.	.			0			c.A1169G							T	ARG/LYS	0,4398		0,0,2199	36.0	29.0	32.0		1169	2.4	1.0	16		32	2,8598	1.2+/-3.3	0,2,4298	no	missense	IFT140	NM_014714.3	26	0,2,6497	CC,CT,TT		0.0233,0.0,0.0154	benign	390/1463	1634408	2,12996	2199	4300	6499	SO:0001583	missense	9742	exon11			AGGTTCTTCCTGG	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1169A>G	16.37:g.1634408T>C	ENSP00000406012:p.Lys390Arg		Somatic	27	0	0		WXS	Illumina HiSeq	.	25	0.20	5	NM_014714	3	0.33	1	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	T	7.394	0.631311	0.14322	0.0	2.33E-4	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.70399	-0.48	5.81	2.37	0.29283	WD40/YVTN repeat-like-containing domain (1);	0.445605	0.26387	N	0.024666	T	0.59376	0.2189	L	0.50333	1.59	0.40475	D	0.98038	B;B	0.13145	0.006;0.007	B;B	0.18561	0.01;0.022	T	0.46735	-0.9170	10	0.16420	T	0.52	.	8.8483	0.35184	0.0:0.2136:0.0:0.7864	.	390;115	Q96RY7;B4DR58	IF140_HUMAN;.	R	390	ENSP00000406012:K390R	ENSP00000380562:K390R	K	-	2	0	IFT140	1574409	1.000000	0.71417	0.999000	0.59377	0.858000	0.48976	1.452000	0.35156	0.137000	0.18759	0.533000	0.62120	AAG			0.552	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250438.2		NM_014714	
PSMB10	5699	broad.mit.edu	37	16	67969561	67969561	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr16:67969561G>T	ENST00000358514.4	-	5	760	c.423C>A	c.(421-423)ggC>ggA	p.G141G	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	141					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	TCAGGTCTACGCCGCCCACGA	0.662																																					p.G141G													.	PSMB10	19		0			c.C423A												98.0	92.0	94.0					16																	67969561		2198	4300	6498	SO:0001819	synonymous_variant	5699	exon5			GTCTACGCCGCCC	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.423C>A	16.37:g.67969561G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	136	0.04	5	NM_002801	274	0.00	0	B2R5J4|Q5U098	Silent	SNP	ENST00000358514.4	37	CCDS10853.1																																																																																					0.662	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268887.1		NM_002801	
SGSM2	9905	mdanderson.org	37	17	2266364	2266364	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:2266364A>G	ENST00000426855.2	+	6	783	c.608A>G	c.(607-609)cAg>cGg	p.Q203R	SGSM2_ENST00000268989.3_Missense_Mutation_p.Q203R|SGSM2_ENST00000574563.1_Missense_Mutation_p.Q203R	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	203					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		GAGCTGGTCCAGCGGCACCGC	0.632																																					p.Q203R													.	.			0			c.A608G												56.0	49.0	51.0					17																	2266364		2203	4300	6503	SO:0001583	missense	9905	exon6			TGGTCCAGCGGCA	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.608A>G	17.37:g.2266364A>G	ENSP00000415107:p.Gln203Arg		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001098509	14	0.00	0	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	ENST00000426855.2	37	CCDS45570.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.904965	0.92035	.	.	ENSG00000141258	ENST00000268989;ENST00000426855	T;T	0.16324	2.35;2.36	5.84	5.84	0.93424	.	0.050302	0.85682	D	0.000000	T	0.44705	0.1306	M	0.79475	2.455	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.996	D;D;D	0.87578	0.998;0.985;0.986	T	0.44498	-0.9324	10	0.87932	D	0	-13.585	15.3978	0.74812	1.0:0.0:0.0:0.0	.	203;203;203	O43147-5;O43147;O43147-2	.;SGSM2_HUMAN;.	R	203	ENSP00000268989:Q203R;ENSP00000415107:Q203R	ENSP00000268989:Q203R	Q	+	2	0	SGSM2	2213114	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.339000	0.96797	2.234000	0.73211	0.460000	0.39030	CAG			0.632	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438186.1		NM_014853	
CAMTA2	23125	mdanderson.org	37	17	4883099	4883099	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:4883099G>T	ENST00000348066.3	-	9	1641	c.1518C>A	c.(1516-1518)ttC>ttA	p.F506L	CAMTA2_ENST00000358183.4_Missense_Mutation_p.F506L|CAMTA2_ENST00000381311.5_Missense_Mutation_p.F508L|CAMTA2_ENST00000572543.1_Missense_Mutation_p.F511L|CAMTA2_ENST00000571831.1_5'Flank|CAMTA2_ENST00000361571.5_Missense_Mutation_p.F505L|CAMTA2_ENST00000414043.3_Missense_Mutation_p.F529L	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	506					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TAAGGTCTGGGAATGATGAAA	0.572																																					p.F529L													.	.			0			c.C1587A												133.0	131.0	132.0					17																	4883099		2203	4300	6503	SO:0001583	missense	23125	exon9			GTCTGGGAATGAT	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1518C>A	17.37:g.4883099G>T	ENSP00000321813:p.Phe506Leu		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001171167	16	0.00	0	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172380	0.78452	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.31247	2.72;1.74;1.5;1.74;1.52	5.09	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.36853	0.0982	L	0.29908	0.895	0.32746	N	0.507012	D;D;D;D;P	0.58268	0.982;0.982;0.982;0.969;0.571	D;D;D;D;B	0.68943	0.952;0.952;0.961;0.914;0.222	T	0.36261	-0.9755	10	0.41790	T	0.15	-18.4322	8.0589	0.30621	0.1779:0.0:0.8221:0.0	.	482;529;508;506;505	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	L	529;508;505;506;506	ENSP00000412886:F529L;ENSP00000370712:F508L;ENSP00000354828:F505L;ENSP00000350910:F506L;ENSP00000321813:F506L	ENSP00000321813:F506L	F	-	3	2	CAMTA2	4823823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.051000	0.57412	2.653000	0.90120	0.655000	0.94253	TTC			0.572	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000216876.1		NM_015099	
BCL6B	255877	broad.mit.edu	37	17	6930932	6930932	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:6930932G>T	ENST00000293805.5	+	9	1526	c.1434G>T	c.(1432-1434)ggG>ggT	p.G478G		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	478					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						TTCTCGGGGGGCCCTAGCTGA	0.622																																					p.G478G													.	BCL6B	85		0			c.G1434T												48.0	53.0	51.0					17																	6930932		1978	4160	6138	SO:0001819	synonymous_variant	255877	exon9			CGGGGGGCCCTAG	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.1434G>T	17.37:g.6930932G>T			Somatic	51	0.0196078431	1		WXS	Illumina HiSeq	Phase_I	51	0.12	6	NM_181844	0		0	Q6PCB4	Silent	SNP	ENST00000293805.5	37	CCDS42248.1																																																																																					0.622	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439455.2		NM_181844	
SLC35G6	643664	mdanderson.org	37	17	7385311	7385311	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:7385311G>T	ENST00000412468.2	+	2	123	c.8G>T	c.(7-9)gGc>gTc	p.G3V	ZBTB4_ENST00000380599.4_5'Flank|ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	3						integral component of membrane (GO:0016021)											TAACAGGCTGGCAGTCACCCC	0.672																																					p.G3V													.	.			0			c.G8T												45.0	47.0	47.0					17																	7385311		2203	4300	6503	SO:0001583	missense	643664	exon2			AGGCTGGCAGTCA		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.8G>T	17.37:g.7385311G>T	ENSP00000396523:p.Gly3Val		Somatic	88	0.0113636364	1		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001102614	0		0		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023260	0.35701	.	.	ENSG00000181222	ENST00000412468	T	0.29655	1.56	4.21	1.94	0.25998	.	.	.	.	.	T	0.19765	0.0475	N	0.14661	0.345	0.42961	D	0.994406	P	0.46457	0.878	B	0.42245	0.381	T	0.10064	-1.0646	9	0.72032	D	0.01	-2.3069	11.8852	0.52598	0.0:0.3462:0.6538:0.0	.	3	P0C7Q6	S35G6_HUMAN	V	3	ENSP00000396523:G3V	ENSP00000396523:G3V	G	+	2	0	SLC35G6	7326035	0.997000	0.39634	0.998000	0.56505	0.824000	0.46624	0.723000	0.25939	0.854000	0.35336	0.462000	0.41574	GGC			0.672	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001102614	
MYH3	4621	mdanderson.org	37	17	10533025	10533025	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:10533025G>T	ENST00000583535.1	-	40	5772	c.5685C>A	c.(5683-5685)acC>acA	p.T1895T	MYH3_ENST00000226209.7_Silent_p.T1895T	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1895					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.T1895T(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TTCGGAATTTGGTGAGATGAG	0.527																																					p.T1895T													MYH3,NS,carcinoma,0,1	MYH3	0	1	1	Substitution - coding silent(1)	lung(1)	c.C5685A												79.0	73.0	75.0					17																	10533025		2203	4300	6503	SO:0001819	synonymous_variant	4621	exon40			GAATTTGGTGAGA		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5685C>A	17.37:g.10533025G>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_002470	79	0.00	0	Q15492	Silent	SNP	ENST00000583535.1	37	CCDS11157.1																																																																																					0.527	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252734.2		NM_002470	
NOS2	4843	mdanderson.org	37	17	26096134	26096134	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:26096134A>G	ENST00000313735.6	-	17	2136	c.1903T>C	c.(1903-1905)Tgc>Cgc	p.C635R		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	635	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GCAAAGGCGCAGAACCGAGGG	0.612																																					p.C635R													.	.			0			c.T1903C												44.0	43.0	44.0					17																	26096134		2203	4300	6503	SO:0001583	missense	4843	exon17			AGGCGCAGAACCG	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1903T>C	17.37:g.26096134A>G	ENSP00000327251:p.Cys635Arg		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_000625	0		0	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.091076	0.76756	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.64991	-0.13	5.26	5.26	0.73747	Flavodoxin/nitric oxide synthase (2);	0.000000	0.85682	D	0.000000	D	0.86912	0.6047	H	0.98295	4.195	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.97;0.999	D	0.91624	0.5313	10	0.66056	D	0.02	.	14.364	0.66792	1.0:0.0:0.0:0.0	.	600;635	F8WEM3;P35228	.;NOS2_HUMAN	R	635;596;600	ENSP00000327251:C635R	ENSP00000305638:C600R	C	-	1	0	NOS2	23120261	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	9.339000	0.96797	1.986000	0.57962	0.379000	0.24179	TGC			0.612	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255597.1		NM_000625	
MYO18A	399687	broad.mit.edu;mdanderson.org	37	17	27437604	27437604	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:27437604G>T	ENST00000527372.1	-	18	3117	c.2937C>A	c.(2935-2937)ggC>ggA	p.G979G	MYO18A_ENST00000531253.1_Silent_p.G979G|MYO18A_ENST00000354329.4_Silent_p.G979G|MYO18A_ENST00000533112.1_Silent_p.G979G	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	979	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.G979G(2)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCGTGGCACTGCCTGCGCGGC	0.627																																					p.G979G	Esophageal Squamous(182;472 2015 7001 15270 22562)												MYO18A_ENST00000527372,NS,carcinoma,0,2	MYO18A	217	2	2	Substitution - coding silent(2)	endometrium(2)	c.C2937A												39.0	43.0	42.0					17																	27437604		1981	4171	6152	SO:0001819	synonymous_variant	399687	exon18			GGCACTGCCTGCG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2937C>A	17.37:g.27437604G>T			Somatic	32	0.0625	2		WXS	Illumina HiSeq	Phase_I	31	0.23	7	NM_078471	4	0.25	1	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	37	CCDS45642.1																																																																																					0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389396.1		NM_078471	
SLFN14	342618	broad.mit.edu;mdanderson.org	37	17	33875849	33875849	+	Silent	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:33875849A>G	ENST00000415846.3	-	4	2183	c.2148T>C	c.(2146-2148)ctT>ctC	p.L716L		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	716							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ATGGAGGGGGAAGGCCATTGA	0.463																																					p.L716L													.	SLFN14	43		0			c.T2148C												92.0	82.0	85.0					17																	33875849		692	1591	2283	SO:0001819	synonymous_variant	342618	exon4			AGGGGGAAGGCCA		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.2148T>C	17.37:g.33875849A>G			Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	148	0.03	5	NM_001129820	0		0	B2RTW9	Silent	SNP	ENST00000415846.3	37	CCDS45650.1																																																																																					0.463	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448928.1		NM_001129820	
SP2	6668	broad.mit.edu	37	17	45993951	45993951	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:45993951T>C	ENST00000376741.4	+	3	651	c.514T>C	c.(514-516)Tcc>Ccc	p.S172P	AC003665.1_ENST00000411573.2_RNA|AC003665.1_ENST00000451140.2_RNA|AC003665.1_ENST00000433001.1_RNA|AC003665.1_ENST00000585280.1_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	172					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						CCCCTCACCGTCCAGTCACAA	0.582																																					p.S172P													.	SP2	38		0			c.T514C												159.0	100.0	120.0					17																	45993951		2203	4300	6503	SO:0001583	missense	6668	exon3			TCACCGTCCAGTC		CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.514T>C	17.37:g.45993951T>C	ENSP00000365931:p.Ser172Pro		Somatic	91	0.0549450549	5		WXS	Illumina HiSeq	Phase_I	114	0.07	8	NM_003110	5	0.00	0	A6NK74	Missense_Mutation	SNP	ENST00000376741.4	37	CCDS11521.2	.	.	.	.	.	.	.	.	.	.	T	16.67	3.187636	0.57909	.	.	ENSG00000167182	ENST00000376741;ENST00000322172	T	0.10960	2.82	5.39	5.39	0.77823	.	0.127199	0.52532	D	0.000065	T	0.11750	0.0286	L	0.42245	1.32	0.39299	D	0.96486	D	0.56035	0.974	P	0.45913	0.497	T	0.13495	-1.0507	10	0.25751	T	0.34	.	9.8501	0.41051	0.1529:0.0:0.0:0.8471	.	172	Q02086	SP2_HUMAN	P	172;165	ENSP00000365931:S172P	ENSP00000316942:S165P	S	+	1	0	SP2	43348950	0.676000	0.27567	0.967000	0.41034	0.927000	0.56198	0.676000	0.25247	2.267000	0.75376	0.383000	0.25322	TCC			0.582	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316777.1		NM_003110	
MYCBPAP	84073	broad.mit.edu	37	17	48585969	48585969	+	Silent	SNP	T	T	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr17:48585969T>G	ENST00000323776.5	+	1	225	c.63T>G	c.(61-63)ggT>ggG	p.G21G	MYCBPAP_ENST00000436259.2_5'Flank|MYCBPAP_ENST00000419930.1_Silent_p.G21G|RP11-94C24.6_ENST00000502300.1_lincRNA	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GGCTGGCGGGTGCGGCGCAGC	0.677																																					p.G21G													.	MYCBPAP	135		0			c.T63G												4.0	6.0	5.0					17																	48585969		2028	4011	6039	SO:0001819	synonymous_variant	84073	exon1			GGCGGGTGCGGCG	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.63T>G	17.37:g.48585969T>G			Somatic	105	0.1904761905	20		WXS	Illumina HiSeq	Phase_I	136	0.26	36	NM_032133	0		0		Silent	SNP	ENST00000323776.5	37	CCDS32680.2																																																																																					0.677	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000347814.1		NM_032133	
CREB3L3	84699	ucsc.edu	37	19	4168454	4168454	+	Splice_Site	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:4168454G>T	ENST00000078445.2	+	6	968	c.821G>T	c.(820-822)cGg>cTg	p.R274L	CREB3L3_ENST00000602147.1_Intron|CREB3L3_ENST00000602257.1_Splice_Site_p.R272L|CREB3L3_ENST00000595923.1_Splice_Site_p.R273L|CREB3L3_ENST00000252587.3_Splice_Site_p.R214L	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	274	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGAGACTCggtgggtagtg	0.517																																					p.R274L													.	CREB3L3	53		0			c.G821T												58.0	41.0	47.0					19																	4168454		2203	4300	6503	SO:0001630	splice_region_variant	84699	exon6			AGACTCGGTGGGT		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.821+1G>T	19.37:g.4168454G>T			Somatic	48	0	0		WXS	Illumina HiSeq		42	0.10	4	NM_032607	0		0	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	ENST00000078445.2	37	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830291	0.71258	.	.	ENSG00000060566	ENST00000078445;ENST00000252587	T;T	0.59083	0.29;0.29	5.06	5.06	0.68205	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	.	.	.	.	D	0.83635	0.5297	H	0.96080	3.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.985;0.99;0.994	D	0.88814	0.3294	9	0.66056	D	0.02	-19.9213	17.3508	0.87323	0.0:0.0:1.0:0.0	.	272;273;274	B7ZL69;Q68CJ9-2;Q68CJ9	.;.;CR3L3_HUMAN	L	274;214	ENSP00000078445:R274L;ENSP00000252587:R214L	ENSP00000078445:R274L	R	+	2	0	CREB3L3	4119454	0.892000	0.30473	0.994000	0.49952	0.052000	0.14988	0.562000	0.23531	2.507000	0.84556	0.655000	0.94253	CGG			0.517	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000457922.1		NM_032607	Missense_Mutation
PLIN5	440503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4529156	4529157	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:4529156_4529157GC>AA	ENST00000381848.3	-	5	528_529	c.448_449GC>TT	c.(448-450)GCt>TTt	p.A150F	CTB-50L17.14_ENST00000586020.1_3'UTR	NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	150	Essential for lipid droplet targeting. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)		p.A150S(1)		endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						AACATCCACAGCATGGCTCACG	0.629																																					p.A150F													PLIN5,NS,carcinoma,0,1	PLIN5	0	1	1	Substitution - Missense(1)	lung(1)	c.G448T																																									SO:0001583	missense	440503	exon5			TCCACAGCATGGC	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.448_449delinsAA	19.37:g.4529156_4529157delinsAA	ENSP00000371272:p.Ala150Phe		Somatic	127	0	0		WXS	Illumina HiSeq	.	132	0.30	39	NM_001013706	2	0.00	0	A2RRC1|Q6ZS68	Missense_Mutation	DNP	ENST00000381848.3	37	CCDS42473.1																																																																																					0.629	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458647.1		NM_001013706	
PTPRS	5802	mdanderson.org	37	19	5246019	5246019	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:5246019C>A	ENST00000587303.1	-	9	855	c.756G>T	c.(754-756)atG>atT	p.M252I	PTPRS_ENST00000592099.1_Missense_Mutation_p.M239I|PTPRS_ENST00000372412.4_Missense_Mutation_p.M253I|PTPRS_ENST00000588012.1_Missense_Mutation_p.M239I|PTPRS_ENST00000348075.2_Missense_Mutation_p.M239I|PTPRS_ENST00000353284.2_Missense_Mutation_p.M239I|PTPRS_ENST00000357368.4_Missense_Mutation_p.M252I|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.M248I			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	252	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TCTCGTGGCTCATGGGCAGGA	0.692																																					p.M252I													.	.			0			c.G756T												26.0	18.0	20.0					19																	5246019		2202	4298	6500	SO:0001583	missense	5802	exon10			GTGGCTCATGGGC	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.756G>T	19.37:g.5246019C>A	ENSP00000467537:p.Met252Ile		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_002850	9	0.00	0	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378766	0.42207	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	4.12	3.02	0.34903	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.640853	0.14448	U	0.318944	T	0.45458	0.1343	L	0.31752	0.955	0.24575	N	0.993904	B;B;B;B;B;B	0.16802	0.0;0.001;0.0;0.019;0.0;0.0	B;B;B;B;B;B	0.17098	0.003;0.002;0.001;0.017;0.0;0.002	T	0.20273	-1.0280	10	0.34782	T	0.22	.	6.2961	0.21087	0.0:0.568:0.3156:0.1164	.	252;239;243;239;252;265	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	I	265;253;252;252;252;248;239;252;243;239	ENSP00000361489:M253I;ENSP00000349932:M252I;ENSP00000262963:M248I;ENSP00000269907:M239I;ENSP00000327313:M239I	ENSP00000262963:M248I	M	-	3	0	PTPRS	5197019	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	1.815000	0.38981	2.130000	0.65690	0.491000	0.48974	ATG			0.692	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000450762.2			
RASAL3	64926	mdanderson.org	37	19	15564108	15564108	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:15564108C>T	ENST00000343625.7	-	15	2565	c.2480G>A	c.(2479-2481)cGc>cAc	p.R827H		NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	827	Arg-rich.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						TTGGCGGCGGCGGGCAGGACG	0.776																																					p.R827H													.	.			0			c.G2480A												4.0	4.0	4.0					19																	15564108		1552	3451	5003	SO:0001583	missense	64926	exon15			CGGCGGCGGGCAG		CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.2480G>A	19.37:g.15564108C>T	ENSP00000341905:p.Arg827His		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_022904	1	0.00	0	Q8N2T9|Q9H735	Missense_Mutation	SNP	ENST00000343625.7	37	CCDS46006.1	.	.	.	.	.	.	.	.	.	.	C	8.015	0.758402	0.15846	.	.	ENSG00000105122	ENST00000343625	T	0.24723	1.84	4.24	-0.411	0.12370	.	1.095120	0.07191	N	0.855737	T	0.11965	0.0291	N	0.08118	0	0.09310	N	1	B;B	0.13145	0.002;0.007	B;B	0.04013	0.001;0.001	T	0.32587	-0.9901	10	0.28530	T	0.3	.	6.3291	0.21260	0.0:0.5237:0.0:0.4763	.	827;827	Q86YV0-2;Q86YV0	.;RASL3_HUMAN	H	827	ENSP00000341905:R827H	ENSP00000341905:R827H	R	-	2	0	RASAL3	15425108	0.886000	0.30341	0.133000	0.22050	0.378000	0.30076	0.482000	0.22276	0.234000	0.21139	0.591000	0.81541	CGC			0.776	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461331.3		NM_022904	
ANKLE1	126549	broad.mit.edu	37	19	17397488	17397501	+	3'UTR	DEL	TGTGTGTGTGTGTT	TGTGTGTGTGTGTT	-	rs534658778|rs576892988|rs371454519|rs563327402|rs1465582|rs56209027|rs71180380	byFrequency	TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	TGTGTGTGTGTGTT	TGTGTGTGTGTGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:17397488_17397501delTGTGTGTGTGTGTT	ENST00000394458.3	+	0	2251_2264				ANKLE1_ENST00000594072.1_3'UTR|ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000598347.1_Frame_Shift_Del_p.VCVCL587fs	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtgtgtgtgtgtgtttgtgtgtgtg	0.528																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTGTGTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TGTGTGTGTGTGTT>-	19.37:g.17397488_17397501delTGTGTGTGTGTGTT			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	14	0.50	7	.	9	0.00	0	A8VU82|Q8N8J8	Frame_Shift_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.528	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
ZNF90	7643	mdanderson.org	37	19	20216113	20216113	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:20216113G>A	ENST00000418063.2	+	3	326	c.214G>A	c.(214-216)Gcc>Acc	p.A72T	ZNF90_ENST00000474284.1_3'UTR	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	72	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						TGAGATGATTGCCAAATCCCC	0.408																																					p.A72T													.	.			0			c.G214A												103.0	103.0	103.0					19																	20216113		692	1591	2283	SO:0001583	missense	7643	exon3			ATGATTGCCAAAT	M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.214G>A	19.37:g.20216113G>A	ENSP00000410466:p.Ala72Thr		Somatic	36	0.0277777778	1		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_007138	2	0.00	0	B9EH87	Missense_Mutation	SNP	ENST00000418063.2	37	CCDS46028.1	.	.	.	.	.	.	.	.	.	.	G	10.07	1.249411	0.22880	.	.	ENSG00000213988	ENST00000418063	T	0.04862	3.54	0.535	-0.73	0.11154	Krueppel-associated box (1);	.	.	.	.	T	0.08758	0.0217	L	0.44542	1.39	0.09310	N	1	D	0.63880	0.993	P	0.52109	0.69	T	0.27157	-1.0082	8	0.40728	T	0.16	.	.	.	.	.	72	Q03938	ZNF90_HUMAN	T	72	ENSP00000410466:A72T	ENSP00000410466:A72T	A	+	1	0	ZNF90	20077113	0.110000	0.22057	0.002000	0.10522	0.004000	0.04260	0.325000	0.19628	-0.309000	0.08779	0.194000	0.17425	GCC			0.408	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350101.1		NM_007138	
ZNF43	7594	mdanderson.org	37	19	21991246	21991246	+	Silent	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:21991246A>G	ENST00000354959.4	-	4	1762	c.1593T>C	c.(1591-1593)acT>acC	p.T531T	ZNF43_ENST00000598381.1_Silent_p.T525T|ZNF43_ENST00000594012.1_Silent_p.T525T|ZNF43_ENST00000595461.1_Silent_p.T525T	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		CTCCAGTATGAGTTATCTTAT	0.353																																					p.T540T													.	.			0			c.T1620C												57.0	61.0	60.0					19																	21991246		2189	4286	6475	SO:0001819	synonymous_variant	7594	exon4			AGTATGAGTTATC	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.1593T>C	19.37:g.21991246A>G			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_001256653	16	0.00	0	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Silent	SNP	ENST00000354959.4	37	CCDS12413.2																																																																																					0.353	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250380.2		NM_003423	
CTC-457E21.6	0	broad.mit.edu	37	19	22788909	22788910	+	RNA	INS	-	-	T	rs3830337|rs397825140	byFrequency	TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:22788909_22788910insT	ENST00000599738.1	+	0	334				CTC-457E21.3_ENST00000600260.1_RNA|CTC-457E21.5_ENST00000598658.1_RNA																							ATGGGCCGAGGTGTTGGCATCT	0.564													TT|T|TT|deletion	1842	0.367812	0.6021	0.379	5008	,	,		20236	0.3244		0.1789	False		,,,				2504	0.2822				.													.	.			0			.																																											0	.			GCCGAGGTGTTGG																													19.37:g.22788910_22788910dupT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000599738.1	37																																																																																						0.564	CTC-457E21.6-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000464575.1			
ETV2	2116	broad.mit.edu	37	19	36135558	36135558	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:36135558C>A	ENST00000403402.1	+	6	1139	c.833C>A	c.(832-834)gCt>gAt	p.A278D	ETV2_ENST00000379026.2_Missense_Mutation_p.A306D|ETV2_ENST00000379023.4_Missense_Mutation_p.A91D|ETV2_ENST00000479824.1_Missense_Mutation_p.A185D|ETV2_ENST00000402764.2_Missense_Mutation_p.A278D			O00321	ETV2_HUMAN	ets variant 2	278					blastocyst development (GO:0001824)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway involved in mesodermal cell fate specification (GO:0060803)|cell differentiation (GO:0030154)|erythrocyte differentiation (GO:0030218)|Notch signaling pathway (GO:0007219)|placenta development (GO:0001890)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of mesoderm development (GO:2000382)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			lung(2)	2	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCCTAGGTGGCTCGGCTGTGG	0.677																																					p.A278D													.	ETV2	11		0			c.C833A												17.0	18.0	18.0					19																	36135558		2195	4278	6473	SO:0001583	missense	2116	exon7			AGGTGGCTCGGCT	AF000671	CCDS32995.2, CCDS74341.1	19q13.11	2008-09-12	2008-09-12		ENSG00000105672	ENSG00000105672			3491	protein-coding gene	gene with protein product		609358	"""ets variant gene 2"""			1340465	Standard	XM_005258654		Approved	ER71	uc002oar.2	O00321	OTTHUMG00000150545	ENST00000403402.1:c.833C>A	19.37:g.36135558C>A	ENSP00000385369:p.Ala278Asp		Somatic	57	0.0350877193	2		WXS	Illumina HiSeq	Phase_I	73	0.14	10	NM_014209	10	0.00	0	A6NFN5|B3KUL0|B9EIN1|Q9UEA0	Missense_Mutation	SNP	ENST00000403402.1	37	CCDS32995.2	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946747	0.92593	.	.	ENSG00000105672	ENST00000379026;ENST00000402764;ENST00000379023;ENST00000403402	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	4.51	4.51	0.55191	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.302462	0.25135	N	0.032880	T	0.68970	0.3059	M	0.93420	3.415	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;0.997	D;D;D;D	0.97110	1.0;0.964;1.0;0.964	T	0.78275	-0.2267	10	0.87932	D	0	.	14.7549	0.69557	0.0:1.0:0.0:0.0	.	91;277;306;278	Q3KNT2;O00321;A6NFN5;B9EIN1	.;ETV2_HUMAN;.;.	D	306;278;91;278	ENSP00000368312:A306D;ENSP00000384524:A278D;ENSP00000368309:A91D;ENSP00000385369:A278D	ENSP00000368309:A91D	A	+	2	0	ETV2	40827398	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.210000	0.77924	2.335000	0.79485	0.505000	0.49811	GCT			0.677	ETV2-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318848.2		XM_209182	
ZNF146	7705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36727687	36727687	+	Silent	SNP	C	C	T	rs369142601		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:36727687C>T	ENST00000443387.2	+	4	1337	c.345C>T	c.(343-345)ctC>ctT	p.L115L	ZNF146_ENST00000456324.1_Silent_p.L115L|ZNF565_ENST00000355114.5_Intron	NM_007145.2	NP_009076.2	Q15072	OZF_HUMAN	zinc finger protein 146	115					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11	Esophageal squamous(110;0.162)					AGTCAAACCTCATCAGACACC	0.433																																					p.L115L													.	.			0			c.C345T							C	,,	0,4406		0,0,2203	59.0	64.0	62.0		345,345,345	2.3	1.0	19		62	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF146	NM_001099638.1,NM_001099639.1,NM_007145.2	,,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,,	115/293,115/293,115/293	36727687	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	7705	exon3			AAACCTCATCAGA	X70394	CCDS12492.1	19q13.1	2013-01-08				ENSG00000167635		"""Zinc fingers, C2H2-type"""	12931	protein-coding gene	gene with protein product		601505				10449921, 8641144	Standard	NM_001099639		Approved	OZF	uc010eeu.3	Q15072		ENST00000443387.2:c.345C>T	19.37:g.36727687C>T			Somatic	115	0	0		WXS	Illumina HiSeq	.	98	0.15	15	NM_001099638	106	0.25	27	Q2TB94	Silent	SNP	ENST00000443387.2	37	CCDS12492.1																																																																																					0.433	ZNF146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451706.1		NM_007145	
FAM98C	147965	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	38899499	38899499	+	Missense_Mutation	SNP	C	C	T	rs200637370		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:38899499C>T	ENST00000252530.5	+	8	1046	c.1027C>T	c.(1027-1029)Cgc>Tgc	p.R343C	FAM98C_ENST00000588262.1_3'UTR|FAM98C_ENST00000343358.7_Missense_Mutation_p.R261C	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	343										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTGTTGGGGTCGCAAGAAGAA	0.612																																					p.R343C													FAM98C,NS,carcinoma,0,1	FAM98C	0	1	0			c.C1027T												35.0	40.0	38.0					19																	38899499		1822	4074	5896	SO:0001583	missense	147965	exon8			TGGGGTCGCAAGA		CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.1027C>T	19.37:g.38899499C>T	ENSP00000252530:p.Arg343Cys		Somatic	127	0	0		WXS	Illumina HiSeq	.	139	0.21	29	NM_174905	51	0.24	12	A6NMW3|Q66K45	Missense_Mutation	SNP	ENST00000252530.5	37	CCDS42562.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550666	0.45383	.	.	ENSG00000130244	ENST00000252530;ENST00000343358	T;T	0.54866	0.55;0.56	5.65	3.45	0.39498	.	2.061740	0.02782	N	0.121035	T	0.69360	0.3102	L	0.53249	1.67	0.09310	N	0.999996	D;D	0.76494	0.999;0.999	P;P	0.59703	0.862;0.732	T	0.56341	-0.7995	10	0.72032	D	0.01	-3.6046	14.0113	0.64498	0.0:0.7105:0.2895:0.0	.	261;343	Q17RN3-2;Q17RN3	.;FA98C_HUMAN	C	343;261	ENSP00000252530:R343C;ENSP00000340348:R261C	ENSP00000252530:R343C	R	+	1	0	FAM98C	43591339	0.004000	0.15560	0.216000	0.23742	0.365000	0.29674	0.240000	0.18042	0.677000	0.31305	0.655000	0.94253	CGC			0.612	FAM98C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000459222.1		NM_174905	
DYRK1B	9149	broad.mit.edu	37	19	40316422	40316422	+	Missense_Mutation	SNP	T	T	G	rs200959786		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:40316422T>G	ENST00000593685.1	-	11	2291	c.1823A>C	c.(1822-1824)gAc>gCc	p.D608A	DYRK1B_ENST00000597639.1_Missense_Mutation_p.D580A|DYRK1B_ENST00000430012.2_Missense_Mutation_p.D568A|DYRK1B_ENST00000323039.5_Missense_Mutation_p.D608A|DYRK1B_ENST00000348817.3_Missense_Mutation_p.D580A			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	608					adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			AGTGGCAGGGTCATCAGGAGG	0.716																																					p.D608A													.	DYRK1B	114		0			c.A1823C												5.0	7.0	7.0					19																	40316422		2119	4177	6296	SO:0001583	missense	9149	exon11			GCAGGGTCATCAG	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1823A>C	19.37:g.40316422T>G	ENSP00000469863:p.Asp608Ala		Somatic	33	0.1515151515	5		WXS	Illumina HiSeq	Phase_I	50	0.28	14	NM_004714	93	0.06	6	O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	37	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	T	17.19	3.327676	0.60743	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.58506	0.33;0.47;0.44	5.25	5.25	0.73442	.	0.507655	0.19528	N	0.112101	T	0.36580	0.0972	N	0.08118	0	0.32145	N	0.584993	B;B;B	0.20780	0.048;0.028;0.048	B;B;B	0.19148	0.024;0.011;0.024	T	0.40979	-0.9534	10	0.21540	T	0.41	.	13.1065	0.59249	0.0:0.0:0.0:1.0	.	568;608;580	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	A	608;580;568	ENSP00000312789:D608A;ENSP00000221803:D580A;ENSP00000403182:D568A	ENSP00000312789:D608A	D	-	2	0	DYRK1B	45008262	0.956000	0.32656	1.000000	0.80357	0.982000	0.71751	0.414000	0.21164	1.967000	0.57214	0.379000	0.24179	GAC			0.716	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462874.2		NM_004714	
LRRC4B	94030	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51020870	51020870	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:51020870G>T	ENST00000599957.1	-	3	2297	c.2100C>A	c.(2098-2100)ttC>ttA	p.F700L	LRRC4B_ENST00000389201.3_Missense_Mutation_p.F700L|ASPDH_ENST00000376916.3_5'Flank|ASPDH_ENST00000597030.1_5'Flank			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	700					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		AGCCGCTCTTGAAGAGCAGAG	0.711																																					p.F700L													.	LRRC4B	89		0			c.C2100A												25.0	28.0	27.0					19																	51020870		1886	4112	5998	SO:0001583	missense	94030	exon3			GCTCTTGAAGAGC	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.2100C>A	19.37:g.51020870G>T	ENSP00000471502:p.Phe700Leu		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	49	0.10	5	NM_001080457	40	0.00	0	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.788|9.788	1.177235|1.177235	0.21787|0.21787	.|.	.|.	ENSG00000131409|ENSG00000131409	ENST00000389201|ENST00000535879	T|.	0.26223|.	1.75|.	2.61|2.61	2.61|2.61	0.31194|0.31194	.|.	0.000000|.	0.64402|.	U|.	0.000006|.	T|T	0.39091|0.39091	0.1065|0.1065	L|L	0.27053|0.27053	0.805|0.805	0.36222|0.36222	D|D	0.852071|0.852071	B|.	0.06786|.	0.001|.	B|.	0.08055|.	0.003|.	T|T	0.38286|0.38286	-0.9668|-0.9668	10|6	0.21014|0.25751	T|T	0.42|0.34	.|.	5.4406|5.4406	0.16507|0.16507	0.1613:0.0:0.8387:0.0|0.1613:0.0:0.8387:0.0	.|.	700|.	Q9NT99|.	LRC4B_HUMAN|.	L|K	700|408	ENSP00000373853:F700L|.	ENSP00000373853:F700L|ENSP00000440583:Q408K	F|Q	-|-	3|1	2|0	LRRC4B|LRRC4B	55712682|55712682	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	0.902000|0.902000	0.28459|0.28459	1.465000|1.465000	0.48006|0.48006	0.455000|0.455000	0.32223|0.32223	TTC|CAA			0.711	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464907.1		NM_001080457	
ZNF616	90317	broad.mit.edu	37	19	52646133	52646133	+	5'Flank	DEL	T	T	-			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr19:52646133delT	ENST00000600228.1	-	0	0				ZNF616_ENST00000596290.1_5'Flank|CTC-471J1.8_ENST00000594362.1_RNA|CTC-471J1.9_ENST00000597886.1_lincRNA|ZNF616_ENST00000597013.1_5'Flank	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		cctgggagAAttttttttttt	0.453																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			GGAGAATTTTTTT	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1			19.37:g.52646133delT	Exception_encountered		Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	1	0.00	0	B3KRV1|Q0P658|Q658V7	RNA	DEL	ENST00000600228.1	37	CCDS33090.1																																																																																					0.453	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462451.1		XM_030892	
CAPN14	440854	broad.mit.edu	37	2	31428301	31428301	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr2:31428301G>T	ENST00000403897.3	-	2	154	c.13C>A	c.(13-15)Cca>Aca	p.P5T	CAPN14_ENST00000444918.2_Missense_Mutation_p.P5T	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	5					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						CGGAAAGGTGGCCACAGAGAC	0.577																																					p.P5T													CAPN14,colon,carcinoma,0,1	CAPN14	36	1	0			c.C13A												46.0	50.0	49.0					2																	31428301		692	1591	2283	SO:0001583	missense	440854	exon2			AAGGTGGCCACAG	AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.13C>A	2.37:g.31428301G>T	ENSP00000385247:p.Pro5Thr		Somatic	185	0.0054054054	1		WXS	Illumina HiSeq	Phase_I	263	0.02	6	NM_001145122	0		0	B3KRU9	Missense_Mutation	SNP	ENST00000403897.3	37	CCDS46254.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704494	0.30232	.	.	ENSG00000214711	ENST00000444918;ENST00000403897	D;D	0.86097	-2.07;-2.07	4.53	-3.68	0.04463	.	.	.	.	.	T	0.66781	0.2824	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.53718	-0.8399	9	0.62326	D	0.03	.	6.8277	0.23893	0.6241:0.0:0.2508:0.1251	.	5	A8MX76	CAN14_HUMAN	T	5	ENSP00000398670:P5T;ENSP00000385247:P5T	ENSP00000381805:P5T	P	-	1	0	CAPN14	31281805	0.000000	0.05858	0.000000	0.03702	0.139000	0.21198	-0.399000	0.07250	-0.631000	0.05560	0.561000	0.74099	CCA			0.577	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325010.1		NM_001145122	
RGPD2	729857	broad.mit.edu	37	2	88125234	88125234	+	Silent	SNP	T	T	C	rs550032815	byFrequency	TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr2:88125234T>C	ENST00000398146.3	-	1	237	c.15A>G	c.(13-15)aaA>aaG	p.K5K	RGPD2_ENST00000420840.2_Intron|RGPD2_ENST00000327544.6_5'UTR			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	5					protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						CCCCGTAGGCTTTGCTGCGCC	0.667													.|||	4	0.000798722	0.0	0.0	5008	,	,		10105	0.0		0.002	False		,,,				2504	0.002				p.K5K													.	RGPD2	14		0			c.A15G												36.0	56.0	50.0					2																	88125234		692	1591	2283	SO:0001819	synonymous_variant	729857	exon1			GTAGGCTTTGCTG		CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.15A>G	2.37:g.88125234T>C			Somatic	56	0.0178571429	1		WXS	Illumina HiSeq	Phase_I	79	0.13	10	NM_001078170	0		0	P0C839|Q68DN6|Q6V1X0	Silent	SNP	ENST00000398146.3	37	CCDS42710.2																																																																																					0.667	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000330534.2		NM_001078170	
RBMS1	5937	hgsc.bcm.edu;mdanderson.org	37	2	161223862	161223862	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr2:161223862G>T	ENST00000348849.3	-	2	546	c.116C>A	c.(115-117)cCc>cAc	p.P39H	RBMS1_ENST00000392753.3_Missense_Mutation_p.P39H|RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000409289.2_Missense_Mutation_p.P6H|RBMS1_ENST00000409972.1_Missense_Mutation_p.P6H|RBMS1_ENST00000409075.1_Missense_Mutation_p.P6H	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	39					DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								ggtggtgctgGGACTGGGAGG	0.527																																					p.P39H													.	.			0			c.C116A												74.0	72.0	73.0					2																	161223862		2203	4300	6503	SO:0001583	missense	5937	exon2			GTGCTGGGACTGG	D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.116C>A	2.37:g.161223862G>T	ENSP00000294904:p.Pro39His		Somatic	63	0	0		WXS	Illumina HiSeq	.	64	0.06	4	NM_016836	1	0.00	0	Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Missense_Mutation	SNP	ENST00000348849.3	37	CCDS2213.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876706	0.91664	.	.	ENSG00000153250	ENST00000348849;ENST00000409075;ENST00000409289;ENST00000392753;ENST00000409972;ENST00000428519	T;T;T;T;T;T	0.36699	1.24;1.89;1.89;1.24;1.89;3.08	5.62	5.62	0.85841	.	0.102468	0.64402	D	0.000002	T	0.62122	0.2402	M	0.75777	2.31	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.91635	0.998;0.997;0.999;0.997;0.99;0.998	T	0.56463	-0.7975	10	0.33141	T	0.24	.	19.6217	0.95660	0.0:0.0:1.0:0.0	.	6;39;39;6;6;39	D3DPB2;P29558;P29558-2;E7EPF2;E7ETU5;B4DN88	.;RBMS1_HUMAN;.;.;.;.	H	39;6;6;39;6;6	ENSP00000294904:P39H;ENSP00000386347:P6H;ENSP00000386571:P6H;ENSP00000376508:P39H;ENSP00000387280:P6H;ENSP00000389016:P6H	ENSP00000294904:P39H	P	-	2	0	RBMS1	160932108	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.795000	0.96236	0.655000	0.94253	CCC			0.527	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255043.4		NM_016836	
RAPH1	65059	broad.mit.edu	37	2	204322299	204322299	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr2:204322299T>C	ENST00000319170.5	-	8	1411	c.1112A>G	c.(1111-1113)aAa>aGa	p.K371R	RAPH1_ENST00000419464.1_Missense_Mutation_p.K371R|RAPH1_ENST00000418114.1_Missense_Mutation_p.K371R|RAPH1_ENST00000457812.1_Missense_Mutation_p.K371R|RAPH1_ENST00000439222.1_Missense_Mutation_p.K396R|RAPH1_ENST00000423104.1_Missense_Mutation_p.K398R|RAPH1_ENST00000308091.4_Missense_Mutation_p.K423R|RAPH1_ENST00000374489.2_Missense_Mutation_p.K398R|RAPH1_ENST00000374493.3_Missense_Mutation_p.K423R|RAPH1_ENST00000453034.1_Missense_Mutation_p.K423R|RAPH1_ENST00000374488.2_Missense_Mutation_p.K396R	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	371					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGCTGTTTCTTTTTTCCCCAA	0.373																																					p.K423R													.	RAPH1	118		0			c.A1268G												157.0	168.0	164.0					2																	204322299		2203	4300	6503	SO:0001583	missense	65059	exon10			GTTTCTTTTTTCC	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.1112A>G	2.37:g.204322299T>C	ENSP00000316543:p.Lys371Arg		Somatic	61	0.0327868852	2		WXS	Illumina HiSeq	Phase_I	87	0.03	3	NM_203365	0		0	Q96Q37|Q9C0I2	Missense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543609	0.65198	.	.	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201	T;T;T;T;T;T;T;T;T;T;T	0.51325	0.81;0.72;0.71;0.8;0.79;0.79;0.79;0.81;0.8;0.78;0.8	5.27	5.27	0.74061	.	0.000000	0.47852	D	0.000206	T	0.58779	0.2146	L	0.45581	1.43	0.53005	D	0.999962	D;B;B	0.76494	0.999;0.001;0.071	D;B;B	0.71184	0.972;0.003;0.019	T	0.61618	-0.7026	10	0.72032	D	0.01	-17.4157	10.1509	0.42794	0.0:0.0791:0.0:0.9209	.	423;423;371	Q70E73-6;C9K0J5;Q70E73	.;.;RAPH1_HUMAN	R	371;371;423;398;396;423;396;371;398;423;396;371;398	ENSP00000392854:K371R;ENSP00000316543:K371R;ENSP00000363617:K423R;ENSP00000363613:K398R;ENSP00000363612:K396R;ENSP00000311293:K423R;ENSP00000411138:K396R;ENSP00000390578:K371R;ENSP00000397751:K398R;ENSP00000406662:K423R;ENSP00000396711:K371R	ENSP00000311293:K423R	K	-	2	0	RAPH1	204030544	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.966000	0.63715	1.990000	0.58119	0.454000	0.30748	AAA			0.373	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256363.2		NM_025252	
NSFL1C	55968	mdanderson.org	37	20	1424505	1424505	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr20:1424505G>T	ENST00000216879.4	-	9	1869	c.1002C>A	c.(1000-1002)gcC>gcA	p.A334A	NSFL1C_ENST00000350991.4_Silent_p.A336A|NSFL1C_ENST00000461211.1_5'UTR|NSFL1C_ENST00000476071.1_Silent_p.A336A|NSFL1C_ENST00000353088.2_Silent_p.A303A|NSFL1C_ENST00000381658.4_Silent_p.A223A	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	334	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.					chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						TAAAGCTGGTGGCAGCCATGG	0.567																																					p.A334A													.	.			0			c.C1002A												57.0	49.0	52.0					20																	1424505		2203	4300	6503	SO:0001819	synonymous_variant	55968	exon9			GCTGGTGGCAGCC	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.1002C>A	20.37:g.1424505G>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_016143	215	0.00	0	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Silent	SNP	ENST00000216879.4	37	CCDS13015.1																																																																																					0.567	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077525.2		NM_016143	
SOGA1	140710	broad.mit.edu;mdanderson.org	37	20	35438485	35438485	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr20:35438485G>T	ENST00000357779.3	-	7	2095	c.1769C>A	c.(1768-1770)gCt>gAt	p.A590D	SOGA1_ENST00000456801.2_Missense_Mutation_p.A431D|SOGA1_ENST00000279034.6_Missense_Mutation_p.A590D|SOGA1_ENST00000237536.4_Missense_Mutation_p.A828D			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	590					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GTGGGCCTCAGCCAGCACCAG	0.552																																					p.A828D													.	SOGA1	136		0			c.C2483A												21.0	23.0	22.0					20																	35438485		2042	4215	6257	SO:0001583	missense	140710	exon7			GCCTCAGCCAGCA	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1769C>A	20.37:g.35438485G>T	ENSP00000350424:p.Ala590Asp		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	28	0.21	6	NM_080627	0		0	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	G	22.2	4.255994	0.80246	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.26	5.26	0.73747	.	0.214357	0.40469	N	0.001097	T	0.40815	0.1132	N	0.08118	0	0.42359	D	0.992408	D	0.71674	0.998	P	0.62649	0.905	T	0.27872	-1.0061	10	0.15066	T	0.55	-14.742	17.7963	0.88572	0.0:0.0:1.0:0.0	.	590	O94964-4	.	D	828;590;431;590	ENSP00000237536:A828D;ENSP00000279034:A590D;ENSP00000413886:A431D;ENSP00000350424:A590D	ENSP00000237536:A828D	A	-	2	0	KIAA0889	34871899	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.215000	0.77966	2.735000	0.93741	0.561000	0.74099	GCT			0.552	SOGA1-201	KNOWN	basic	protein_coding	protein_coding				NM_199181	
NFATC2	4773	mdanderson.org	37	20	50049146	50049146	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr20:50049146G>T	ENST00000396009.3	-	9	2399	c.2180C>A	c.(2179-2181)cCc>cAc	p.P727H	NFATC2_ENST00000414705.1_Missense_Mutation_p.P707H|NFATC2_ENST00000371564.3_Missense_Mutation_p.P727H|NFATC2_ENST00000609943.1_Missense_Mutation_p.P707H|NFATC2_ENST00000609507.1_Missense_Mutation_p.P508H|NFATC2_ENST00000610033.1_Missense_Mutation_p.P508H	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	727					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CTGCTGGCAGGGAGCCATGGT	0.682																																					p.P727H													.	.			0			c.C2180A												23.0	28.0	26.0					20																	50049146		2202	4298	6500	SO:0001583	missense	4773	exon9			TGGCAGGGAGCCA	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2180C>A	20.37:g.50049146G>T	ENSP00000379330:p.Pro727His		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_012340	0		0	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749296	0.89753	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.19394	2.15;2.15;2.17	5.31	5.31	0.75309	.	0.235442	0.44483	D	0.000459	T	0.39886	0.1095	L	0.49778	1.585	0.48632	D	0.999685	D;D;D;D	0.76494	0.998;0.997;0.999;0.998	P;P;P;P	0.60345	0.832;0.817;0.873;0.786	T	0.17930	-1.0353	10	0.87932	D	0	-20.4008	18.9958	0.92812	0.0:0.0:1.0:0.0	.	707;707;727;727	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	H	727;727;707	ENSP00000360619:P727H;ENSP00000379330:P727H;ENSP00000396471:P707H	ENSP00000360619:P727H	P	-	2	0	NFATC2	49482553	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.470000	0.97683	2.494000	0.84150	0.555000	0.69702	CCC			0.682	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079730.2		NM_012340	
DSCAM	1826	broad.mit.edu	37	21	41719815	41719815	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr21:41719815A>G	ENST00000400454.1	-	6	1469	c.992T>C	c.(991-993)gTt>gCt	p.V331A		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	331	Ig-like C2-type 4.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGACAAGGAAACTTGGCTACC	0.483																																					p.V331A	Melanoma(134;970 1778 1785 21664 32388)												.	DSCAM	347		0			c.T992C												106.0	97.0	100.0					21																	41719815		1957	4161	6118	SO:0001583	missense	1826	exon6			AAGGAAACTTGGC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.992T>C	21.37:g.41719815A>G	ENSP00000383303:p.Val331Ala		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	128	0.03	4	NM_001271534	0		0	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	A	9.251	1.040727	0.19669	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;D	0.83075	-1.05;-1.68	5.58	5.58	0.84498	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74053	0.3666	L	0.33753	1.03	0.43377	D	0.995478	B	0.21905	0.062	B	0.23852	0.049	T	0.68573	-0.5373	10	0.07175	T	0.84	.	15.7461	0.77944	1.0:0.0:0.0:0.0	.	331	O60469	DSCAM_HUMAN	A	331;83	ENSP00000383303:V331A;ENSP00000385342:V83A	ENSP00000383303:V331A	V	-	2	0	DSCAM	40641685	1.000000	0.71417	0.986000	0.45419	0.961000	0.63080	7.460000	0.80816	2.111000	0.64477	0.533000	0.62120	GTT			0.483	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195029.1		NM_001389	
PI4KAP2	375133	broad.mit.edu	37	22	21829278	21829279	+	RNA	DEL	AT	AT	-	rs2308062		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr22:21829278_21829279delAT	ENST00000450651.1	-	0	1839							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						CTTGACATAAATAGAGGCCCCT	0.589																																					.													.	PI4KAP2	11		0			.																																											0	.			ACATAAATAGAGG			22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21829278_21829279delAT			Somatic	22	0.1363636364	3		WXS	Illumina HiSeq	Phase_I	22	0.32	7	.	3	0.00	0	Q6ICJ0|Q6ZT68|Q8WUK7	RNA	DEL	ENST00000450651.1	37																																																																																						0.589	PI4KAP2-005	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000334908.1			
ZNF280B	140883	bcgsc.ca	37	22	22842518	22842518	+	Silent	SNP	G	G	A	rs73156173	byFrequency	TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr22:22842518G>A	ENST00000406426.1	-	4	1948	c.1206C>T	c.(1204-1206)ccC>ccT	p.P402P	ZNF280B_ENST00000360412.2_Silent_p.P402P			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GGCACACATAGGGCATTTCGC	0.423																																					p.P402P													.	ZNF280B	67		0			c.C1206T												125.0	118.0	120.0					22																	22842518		2203	4300	6503	SO:0001819	synonymous_variant	140883	exon4			CACATAGGGCATT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1206C>T	22.37:g.22842518G>A			Somatic	138	0.0144927536	2		WXS	Illumina HiSeq	Phase_1	163	0.09	15	NM_080764	3	0.67	2		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																					0.423	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321170.2		NM_080764	
ZNF280B	140883	mdanderson.org	37	22	22843071	22843071	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr22:22843071G>T	ENST00000406426.1	-	4	1395	c.653C>A	c.(652-654)cCc>cAc	p.P218H	ZNF280B_ENST00000360412.2_Missense_Mutation_p.P218H			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P218L(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		ATTATTTGAGGGTGTACTTTG	0.388																																					p.P218H													ZNF280B,NS,carcinoma,0,1	ZNF280B	0	1	1	Substitution - Missense(1)	lung(1)	c.C653A												121.0	114.0	116.0					22																	22843071		2203	4300	6503	SO:0001583	missense	140883	exon4			TTTGAGGGTGTAC	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.653C>A	22.37:g.22843071G>T	ENSP00000385998:p.Pro218His		Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	140	0.04	5	NM_080764	0		0		Missense_Mutation	SNP	ENST00000406426.1	37	CCDS13799.1	.	.	.	.	.	.	.	.	.	.	G	6.272	0.418322	0.11870	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.23147	1.92;1.92	4.43	2.33	0.28932	.	.	.	.	.	T	0.38772	0.1053	M	0.66939	2.045	0.26113	N	0.980659	D	0.71674	0.998	D	0.64877	0.93	T	0.22138	-1.0225	9	0.14656	T	0.56	-0.3109	6.6945	0.23191	0.2146:0.0:0.7854:0.0	.	218	Q86YH2	Z280B_HUMAN	H	218	ENSP00000385998:P218H;ENSP00000353586:P218H	ENSP00000353586:P218H	P	-	2	0	ZNF280B	21173071	0.419000	0.25449	0.650000	0.29550	0.150000	0.21749	0.455000	0.21843	0.618000	0.30179	0.655000	0.94253	CCC			0.388	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321170.2		NM_080764	
MMP11	4320	broad.mit.edu	37	22	24121476	24121476	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr22:24121476C>A	ENST00000215743.3	+	2	263	c.211C>A	c.(211-213)Cct>Act	p.P71T	MMP11_ENST00000477567.1_3'UTR	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	71					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	AGCCCCCCGGCCTGCCAGCAG	0.716																																					p.P71T													.	MMP11	53		0			c.C211A												12.0	14.0	13.0					22																	24121476		2201	4289	6490	SO:0001583	missense	4320	exon2			CCCCGGCCTGCCA		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.211C>A	22.37:g.24121476C>A	ENSP00000215743:p.Pro71Thr		Somatic	37	0.027027027	1		WXS	Illumina HiSeq	Phase_I	72	0.13	9	NM_005940	0		0	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	37	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.146839	0.37923	.	.	ENSG00000099953	ENST00000215743	T	0.10860	2.83	4.03	0.723	0.18231	.	0.915240	0.09390	N	0.808641	T	0.05318	0.0141	N	0.24115	0.695	0.09310	N	1	B	0.19817	0.039	B	0.14578	0.011	T	0.43032	-0.9416	10	0.02654	T	1	.	4.7355	0.12986	0.0:0.4036:0.3864:0.21	.	71	P24347	MMP11_HUMAN	T	71	ENSP00000215743:P71T	ENSP00000215743:P71T	P	+	1	0	MMP11	22451476	.	.	0.001000	0.08648	0.004000	0.04260	.	.	0.461000	0.27071	-0.688000	0.03733	CCT			0.716	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319891.2		NM_005940	
MN1	4330	mdanderson.org	37	22	28195192	28195192	+	Missense_Mutation	SNP	G	G	T	rs375740551		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr22:28195192G>T	ENST00000302326.4	-	1	2294	c.1340C>A	c.(1339-1341)gCg>gAg	p.A447E		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	447					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GTAGGGGGGCGCGTCGAAATG	0.647			T	ETV6	"""AML, meningioma"""																																p.A447E				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	.			0			c.C1340A							G	GLU/ALA	1,4057		0,1,2028	15.0	19.0	18.0		1340	3.8	1.0	22		18	0,8342		0,0,4171	no	missense	MN1	NM_002430.2	107	0,1,6199	TT,TG,GG		0.0,0.0246,0.0081	possibly-damaging	447/1321	28195192	1,12399	2029	4171	6200	SO:0001583	missense	4330	exon1			GGGGGCGCGTCGA	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1340C>A	22.37:g.28195192G>T	ENSP00000304956:p.Ala447Glu		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_002430	0		0	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475466	0.63737	2.46E-4	0.0	ENSG00000169184	ENST00000302326	T	0.54866	0.55	3.75	3.75	0.43078	.	1.217320	0.05531	N	0.563863	T	0.54663	0.1872	N	0.19112	0.55	0.37162	D	0.902647	D	0.60575	0.988	P	0.57204	0.815	T	0.52185	-0.8609	10	0.42905	T	0.14	-6.5381	11.3779	0.49739	0.0:0.0:1.0:0.0	.	447	Q10571	MN1_HUMAN	E	447	ENSP00000304956:A447E	ENSP00000304956:A447E	A	-	2	0	MN1	26525192	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.425000	0.59875	2.392000	0.81423	0.313000	0.20887	GCG			0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
SYN3	8224	broad.mit.edu	37	22	32923915	32923915	+	Silent	SNP	T	T	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr22:32923915T>G	ENST00000358763.2	-	12	1550	c.1308A>C	c.(1306-1308)ccA>ccC	p.P436P	SYN3_ENST00000332840.5_Silent_p.P436P	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	436	J; Pro-rich linker.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CTTGCGGAGGTGGGCGTGGCT	0.582																																					p.P436P													.	SYN3	77		0			c.A1308C												26.0	25.0	25.0					22																	32923915		2201	4296	6497	SO:0001819	synonymous_variant	8224	exon11			CGGAGGTGGGCGT	AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.1308A>C	22.37:g.32923915T>G			Somatic	120	0.1583333333	19		WXS	Illumina HiSeq	Phase_I	144	0.16	23	NM_133633	0		0	B1B1F9	Silent	SNP	ENST00000358763.2	37	CCDS13908.1																																																																																					0.582	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075892.4			
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46763694	46763694	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr22:46763694C>T	ENST00000262738.3	-	28	8010	c.8011G>A	c.(8011-8013)Ggg>Agg	p.G2671R		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2671					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCCAGCAGCCCCAGCAGCCAG	0.657											OREG0026655	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G2671R													.	.			0			c.G8011A												39.0	35.0	36.0					22																	46763694		2199	4299	6498	SO:0001583	missense	9620	exon28			GCAGCCCCAGCAG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.8011G>A	22.37:g.46763694C>T	ENSP00000262738:p.Gly2671Arg		Somatic	75	0	0	941	WXS	Illumina HiSeq	.	107	0.24	26	NM_014246	4	0.50	2	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	c	32	5.143568	0.94603	.	.	ENSG00000075275	ENST00000262738	T	0.46451	0.87	4.94	4.94	0.65067	GPCR, family 2-like (1);	0.000000	0.64402	U	0.000003	T	0.77772	0.4180	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86754	0.1962	10	0.87932	D	0	.	17.8334	0.88689	0.0:1.0:0.0:0.0	.	2671	Q9NYQ6	CELR1_HUMAN	R	2671	ENSP00000262738:G2671R	ENSP00000262738:G2671R	G	-	1	0	CELSR1	45142358	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.261000	0.78400	2.295000	0.77249	0.567000	0.79289	GGG			0.657	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
EMC3-AS1	442075	broad.mit.edu	37	3	10035779	10035783	+	RNA	DEL	AGTCT	AGTCT	-	rs35714562|rs199577504		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	AGTCT	AGTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr3:10035779_10035783delAGTCT	ENST00000326237.3	+	0	354																											GGGGAAGAGAAGTCTGATCTGACAT	0.38																																					.													.	.			0			.																																											0	.			AAGAGAAGTCTGA																													3.37:g.10035779_10035783delAGTCT			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	14	0.36	5	.	0		0		RNA	DEL	ENST00000326237.3	37																																																																																						0.380	AC034193.5-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000339468.1			
MAP4	4134	broad.mit.edu;mdanderson.org	37	3	47963340	47963340	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr3:47963340G>T	ENST00000360240.6	-	5	962	c.444C>A	c.(442-444)gaC>gaA	p.D148E	MAP4_ENST00000426837.2_Missense_Mutation_p.D165E|MAP4_ENST00000395734.3_Missense_Mutation_p.D148E|MAP4_ENST00000383737.4_Missense_Mutation_p.D148E	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	148					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	AATCTGCCAGGTCATCATCAT	0.383																																					p.D148E													.	MAP4	176		0			c.C444A												126.0	116.0	120.0					3																	47963340		2203	4300	6503	SO:0001583	missense	4134	exon5			TGCCAGGTCATCA		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.444C>A	3.37:g.47963340G>T	ENSP00000353375:p.Asp148Glu		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	63	0.06	4	NM_001134364	9	0.00	0	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	37	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634761	0.29068	.	.	ENSG00000047849	ENST00000383737;ENST00000395734;ENST00000426837;ENST00000360240	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	4.48	1.95	0.26073	.	.	.	.	.	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B;B;B	0.27823	0.19;0.152;0.116	B;B;B	0.27500	0.067;0.08;0.055	T	0.25950	-1.0117	9	0.32370	T	0.25	-0.4046	5.9071	0.19006	0.3211:0.0:0.6789:0.0	.	125;148;148	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	E	148;148;165;148	ENSP00000373243:D148E;ENSP00000379083:D148E;ENSP00000407602:D165E;ENSP00000353375:D148E	ENSP00000353375:D148E	D	-	3	2	MAP4	47938344	0.049000	0.20398	0.027000	0.17364	0.544000	0.35116	1.166000	0.31834	0.304000	0.22809	0.655000	0.94253	GAC			0.383	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000346085.1		NM_002375	
NT5DC2	64943	mdanderson.org	37	3	52558632	52558632	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr3:52558632G>T	ENST00000307076.4	-	14	1817	c.1417C>A	c.(1417-1419)Ctc>Atc	p.L473I	NT5DC2_ENST00000307092.4_Missense_Mutation_p.L414I|NT5DC2_ENST00000422318.2_Missense_Mutation_p.L510I|NT5DC2_ENST00000459839.1_Missense_Mutation_p.L485I	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	473							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		AGGCAGCTGAGGGAGGCCATG	0.622																																					p.L510I													.	.			0			c.C1528A												86.0	73.0	77.0					3																	52558632		2203	4300	6503	SO:0001583	missense	64943	exon14			AGCTGAGGGAGGC	AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.1417C>A	3.37:g.52558632G>T	ENSP00000302468:p.Leu473Ile		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001134231	829	0.00	1	C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	ENST00000307076.4	37	CCDS2858.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.385969	0.25031	.	.	ENSG00000168268	ENST00000307092;ENST00000307076;ENST00000422318;ENST00000459839	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	5.74	3.85	0.44370	HAD-like domain (1);	0.179222	0.47093	D	0.000248	T	0.08088	0.0202	N	0.05158	-0.105	0.33780	D	0.624143	B;B;B	0.16603	0.018;0.008;0.008	B;B;B	0.25405	0.06;0.02;0.029	T	0.26573	-1.0099	10	0.02654	T	1	-38.5811	7.3015	0.26424	0.0839:0.0:0.5962:0.3199	.	485;473;510	C9JTZ6;Q9H857;E9PAL9	.;NT5D2_HUMAN;.	I	414;473;510;485	ENSP00000306017:L414I;ENSP00000302468:L473I;ENSP00000406933:L510I;ENSP00000419547:L485I	ENSP00000302468:L473I	L	-	1	0	NT5DC2	52533672	0.988000	0.35896	0.982000	0.44146	0.977000	0.68977	1.908000	0.39907	1.434000	0.47414	0.650000	0.86243	CTC			0.622	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000351509.1		NM_022908	
CHCHD6	84303	broad.mit.edu;bcgsc.ca	37	3	126571534	126571534	+	Silent	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr3:126571534C>T	ENST00000290913.3	+	5	549	c.456C>T	c.(454-456)gaC>gaT	p.D152D	CHCHD6_ENST00000508789.1_Silent_p.D153D	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6	152					cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(3)|lung(3)	8						GACGCCGTGACACCTTCTACA	0.567																																					p.D152D													.	CHCHD6	18		0			c.C456T												144.0	113.0	123.0					3																	126571534		2203	4300	6503	SO:0001819	synonymous_variant	84303	exon5			CCGTGACACCTTC	BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.456C>T	3.37:g.126571534C>T			Somatic	94	0.0212765957	2		WXS	Illumina HiSeq	Phase_I	92	0.30	28	NM_032343	14	0.71	10	D6R9U0|D6RIB4|H8Y0Y7	Silent	SNP	ENST00000290913.3	37	CCDS3041.1	.	.	.	.	.	.	.	.	.	.	C	5.617	0.298497	0.10622	.	.	ENSG00000159685	ENST00000513253	.	.	.	4.8	-0.305	0.12784	.	.	.	.	.	T	0.18759	0.0450	.	.	.	0.21553	N	0.999641	.	.	.	.	.	.	T	0.22591	-1.0212	4	.	.	.	-21.7831	0.281	0.00245	0.2601:0.243:0.255:0.2419	.	.	.	.	I	86	.	.	T	+	2	0	CHCHD6	128054224	0.012000	0.17670	0.011000	0.14972	0.832000	0.47134	-0.735000	0.04888	-0.263000	0.09378	-0.218000	0.12543	ACA			0.567	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356432.1		NM_032343	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142186852	142186852	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr3:142186852A>G	ENST00000350721.4	-	39	6732	c.6611T>C	c.(6610-6612)aTg>aCg	p.M2204T	RP11-383G6.3_ENST00000460977.1_RNA|ATR_ENST00000383101.3_Missense_Mutation_p.M2140T	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2204					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GGATTTTTTCATATGAATAGC	0.333								Other conserved DNA damage response genes																													p.M2204T													.	.			0			c.T6611C												122.0	131.0	128.0					3																	142186852		2203	4298	6501	SO:0001583	missense	545	exon39			TTTTTCATATGAA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6611T>C	3.37:g.142186852A>G	ENSP00000343741:p.Met2204Thr		Somatic	45	0	0		WXS	Illumina HiSeq	.	48	0.44	21	NM_001184	2	1.00	2	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	A	10.60	1.396575	0.25205	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.04360	3.64;4.07	5.54	5.54	0.83059	.	0.089509	0.85682	D	0.000000	T	0.06962	0.0177	L	0.57536	1.79	0.58432	D	0.999997	B	0.27971	0.196	B	0.25291	0.059	T	0.28554	-1.0040	10	0.12103	T	0.63	-14.9375	15.962	0.79939	1.0:0.0:0.0:0.0	.	2204	Q13535	ATR_HUMAN	T	2204;2140	ENSP00000343741:M2204T;ENSP00000372581:M2140T	ENSP00000343741:M2204T	M	-	2	0	ATR	143669542	1.000000	0.71417	0.984000	0.44739	0.944000	0.59088	9.040000	0.93783	2.229000	0.72834	0.482000	0.46254	ATG			0.333	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353995.2		NM_001184	
TP63	8626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	189597936	189597936	+	Intron	SNP	C	C	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr3:189597936C>G	ENST00000264731.3	+	11	1438				TP63_ENST00000437221.1_Missense_Mutation_p.S384C|TP63_ENST00000392460.3_Intron|TP63_ENST00000449992.1_Intron|TP63_ENST00000440651.2_Intron|TP63_ENST00000392463.2_Intron|TP63_ENST00000456148.1_Intron|TP63_ENST00000418709.2_Missense_Mutation_p.S478C|TP63_ENST00000320472.5_Intron|TP63_ENST00000382063.4_Intron|TP63_ENST00000392461.3_Intron|TP63_ENST00000354600.5_Intron	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63						apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TTTAGACATTCCAAGCCCCCA	0.458										HNSCC(45;0.13)																											p.S478C													.	.			0			c.C1433G												117.0	107.0	110.0					3																	189597936		1568	3582	5150	SO:0001627	intron_variant	8626	exon11			GACATTCCAAGCC	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1350-6247C>G	3.37:g.189597936C>G			Somatic	129	0	0		WXS	Illumina HiSeq	.	129	0.26	33	NM_001114979	0		0	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141356	0.57044	.	.	ENSG00000073282	ENST00000418709;ENST00000437221	D;D	0.99685	-6.38;-6.4	5.79	5.79	0.91817	.	.	.	.	.	D	0.99697	0.9885	.	.	.	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.76071	0.938;0.987	D	0.98221	1.0478	7	.	.	.	.	19.0252	0.92930	0.0:1.0:0.0:0.0	.	384;478	Q9H3D4-6;Q9H3D4-5	.;.	C	478;384	ENSP00000407144:S478C;ENSP00000392488:S384C	.	S	+	2	0	TP63	191080630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.485000	0.66850	2.734000	0.93682	0.655000	0.94253	TCC			0.458	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000343865.1		NM_003722	
LINC00969	440993	broad.mit.edu;ucsc.edu	37	3	195400728	195400728	+	lincRNA	SNP	A	A	G	rs12107841	byFrequency	TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr3:195400728A>G	ENST00000445430.1	+	0	1324									long intergenic non-protein coding RNA 969																		GATTGTGCCCAGCCTGTACGC	0.587																																					.													.	.			0			.																																											0	.			GTGCCCAGCCTGT	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195400728A>G			Somatic	61	0.0163934426	1		WXS	Illumina HiSeq	Phase_I	68	0.13	9	.	6	0.00	0		RNA	SNP	ENST00000445430.1	37																																																																																						0.587	LINC00969-038	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000341951.1			
ZDHHC11	79844	mdanderson.org	37	5	840644	840644	+	Missense_Mutation	SNP	G	G	C	rs200038670		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr5:840644G>C	ENST00000283441.8	-	5	1133	c.750C>G	c.(748-750)caC>caG	p.H250Q	ZDHHC11_ENST00000503758.2_5'UTR|ZDHHC11_ENST00000511539.1_Missense_Mutation_p.H37Q|ZDHHC11_ENST00000424784.2_Missense_Mutation_p.H250Q	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	250						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.H250Q(2)		haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCTGGCCCAGGTGCACCAAGC	0.602																																					p.H250Q													.	.			2	Substitution - Missense(2)	lung(2)	c.C750G												137.0	146.0	143.0					5																	840644		2203	4300	6503	SO:0001583	missense	79844	exon5			GCCCAGGTGCACC	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.750C>G	5.37:g.840644G>C	ENSP00000283441:p.His250Gln		Somatic	28	0.0357142857	1		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_024786	15	0.20	3	Q6UWR9	Missense_Mutation	SNP	ENST00000283441.8	37	CCDS3857.1	.	.	.	.	.	.	.	.	.	.	g	5.277	0.236438	0.10023	.	.	ENSG00000188818	ENST00000424784;ENST00000283441;ENST00000511193;ENST00000511539	T;T;T;T	0.43688	1.86;1.86;0.99;0.94	2.74	-0.394	0.12434	.	642.914000	0.00961	U	0.003101	T	0.25494	0.0620	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.15870	0.014;0.001	T	0.27606	-1.0069	10	0.29301	T	0.29	-6.9343	13.336	0.60518	0.0:0.2548:0.7452:0.0	.	250;37	Q9H8X9;Q6UWR9	ZDH11_HUMAN;.	Q	250;250;25;37	ENSP00000397719:H250Q;ENSP00000283441:H250Q;ENSP00000426873:H25Q;ENSP00000427067:H37Q	ENSP00000283441:H250Q	H	-	3	2	ZDHHC11	893644	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.474000	0.06607	-0.110000	0.12022	-2.048000	0.00412	CAC	0.001		0.602	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206681.3		NM_024786	
IRX2	153572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	2749803	2749803	+	Silent	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr5:2749803C>T	ENST00000382611.6	-	2	596	c.348G>A	c.(346-348)gcG>gcA	p.A116A	C5orf38_ENST00000505778.1_5'Flank|IRX2_ENST00000302057.5_Silent_p.A116A|IRX2_ENST00000502957.1_5'UTR|C5orf38_ENST00000515640.1_5'Flank|C5orf38_ENST00000457752.2_5'Flank|C5orf38_ENST00000334000.3_5'Flank|C5orf38_ENST00000397835.4_5'Flank	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	116					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		TCTTGCGGTACGCGGGGTCGT	0.677																																					p.A116A													IRX2,NS,carcinoma,0,1	IRX2	0	1	0			c.G348A												115.0	93.0	100.0					5																	2749803		2203	4300	6503	SO:0001819	synonymous_variant	153572	exon2			GCGGTACGCGGGG	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.348G>A	5.37:g.2749803C>T			Somatic	57	0	0		WXS	Illumina HiSeq	.	52	0.31	16	NM_001134222	1	0.00	0	Q68A19|Q7Z2I7	Silent	SNP	ENST00000382611.6	37	CCDS3868.1																																																																																					0.677	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206749.2			
DMGDH	29958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78347182	78347182	+	Silent	SNP	T	T	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr5:78347182T>G	ENST00000255189.3	-	5	701	c.673A>C	c.(673-675)Agg>Cgg	p.R225R	DMGDH_ENST00000540686.1_Intron|DMGDH_ENST00000380311.4_Intron	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	225					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		CCATCTGACCTGGCTTTCAGA	0.423																																					p.R225R													.	.			0			c.A673C												174.0	173.0	173.0					5																	78347182		2203	4300	6503	SO:0001819	synonymous_variant	29958	exon5			CTGACCTGGCTTT	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.673A>C	5.37:g.78347182T>G			Somatic	105	0	0		WXS	Illumina HiSeq	.	112	0.32	36	NM_013391	0		0	B2RBN0|B4E1J9	Silent	SNP	ENST00000255189.3	37	CCDS4044.1																																																																																					0.423	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226963.3		NM_013391	
NDST1	3340	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	149915275	149915277	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr5:149915275_149915277delCCA	ENST00000261797.6	+	6	1767_1769	c.1265_1267delCCA	c.(1264-1269)cccaca>cca	p.T423del	NDST1_ENST00000523767.1_In_Frame_Del_p.T423del	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	423	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATGGCATTCCCACAGACATGGG	0.606																																					p.422_422del													.	NDST1	79		0			c.1264_1266del																																									SO:0001651	inframe_deletion	3340	exon6			GCATTCCCACAGA	U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1265_1267delCCA	5.37:g.149915275_149915277delCCA	ENSP00000261797:p.Thr423del		Somatic	106	0	0		WXS	Illumina HiSeq	.	97	0.29	28	NM_001543	3	0.00	0	Q96E57	In_Frame_Del	DEL	ENST00000261797.6	37	CCDS34277.1																																																																																					0.606	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374314.2		NM_001543	
F13A1	2162	mdanderson.org	37	6	6248642	6248642	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr6:6248642C>T	ENST00000264870.3	-	6	966	c.701G>A	c.(700-702)gGc>gAc	p.G234D		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	234					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GTCCAGGATGCCATCTTCAAA	0.423																																					p.G234D													.	.			0			c.G701A												70.0	62.0	65.0					6																	6248642		2203	4300	6503	SO:0001583	missense	2162	exon6			AGGATGCCATCTT	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.701G>A	6.37:g.6248642C>T	ENSP00000264870:p.Gly234Asp		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_000129	0		0	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606530	0.46527	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	D	0.93133	-3.17	4.99	4.12	0.48240	.	0.249361	0.40144	N	0.001162	T	0.80449	0.4625	L	0.40543	1.245	0.42406	D	0.992583	B;P	0.36392	0.122;0.551	B;B	0.29267	0.094;0.1	T	0.79688	-0.1699	10	0.44086	T	0.13	.	6.5527	0.22444	0.0:0.7106:0.0:0.2894	.	171;234	F5H080;P00488	.;F13A_HUMAN	D	234;171	ENSP00000264870:G234D	ENSP00000264870:G234D	G	-	2	0	F13A1	6193641	0.973000	0.33851	1.000000	0.80357	0.993000	0.82548	3.217000	0.51184	1.087000	0.41251	0.563000	0.77884	GGC			0.423	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039756.3		NM_000129	
BTN2A3P	54718	broad.mit.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	.		9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											0	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	80	0.025	2		WXS	Illumina HiSeq	Phase_I	69	0.09	6	.	1	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
DPCR1	135656	mdanderson.org	37	6	30920763	30920763	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr6:30920763C>T	ENST00000462446.1	+	3	4079	c.4051C>T	c.(4051-4053)Cgg>Tgg	p.R1351W	DPCR1_ENST00000304311.2_Missense_Mutation_p.R193W|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	475						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CTATATGATGCGGACACGCCG	0.498																																					p.R1351W													.	.			0			c.C4051T												118.0	90.0	99.0					6																	30920763		2203	4300	6503	SO:0001583	missense	135656	exon3			ATGATGCGGACAC	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.4051C>T	6.37:g.30920763C>T	ENSP00000417182:p.Arg1351Trp		Somatic	80	0.0125	1		WXS	Illumina HiSeq	Phase_I	81	0.05	4	NM_080870	0		0	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345940	0.82022	.	.	ENSG00000168631	ENST00000462446;ENST00000450344;ENST00000304311	T;T	0.38240	1.27;1.15	3.82	0.601	0.17529	.	.	.	.	.	T	0.31482	0.0798	L	0.48642	1.525	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.05484	-1.0882	9	0.87932	D	0	-2.0425	5.8829	0.18866	0.4178:0.4:0.1823:0.0	.	1351	E9PEI6	.	W	1351;475;193	ENSP00000417182:R1351W;ENSP00000305948:R193W	ENSP00000305948:R193W	R	+	1	2	DPCR1	31028742	0.000000	0.05858	0.002000	0.10522	0.845000	0.48019	-0.320000	0.08028	0.340000	0.23745	0.574000	0.79327	CGG			0.498	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000076173.3		NM_080870	
GPR6	2830	broad.mit.edu	37	6	110300642	110300642	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr6:110300642G>T	ENST00000275169.3	+	1	345	c.327G>T	c.(325-327)gtG>gtT	p.V109V	GPR6_ENST00000414000.2_Silent_p.V124V	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	109					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		CCATGTTCGTGCTGGTAGGCA	0.637																																					p.V109V													GPR6,caecum,carcinoma,+2,1	GPR6	46	1	0			c.G327T												95.0	84.0	88.0					6																	110300642		2203	4300	6503	SO:0001819	synonymous_variant	0	exon1			GTTCGTGCTGGTA		CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.327G>T	6.37:g.110300642G>T			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	54	0.11	6	NM_005284	0		0	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Silent	SNP	ENST00000275169.3	37	CCDS5079.1																																																																																					0.637	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041774.1			
MUC17	140453	hgsc.bcm.edu	37	7	100679221	100679221	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr7:100679221G>T	ENST00000306151.4	+	3	4588	c.4524G>T	c.(4522-4524)acG>acT	p.T1508T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1508	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAATCTCAACGCCTAGTGAAG	0.468																																					p.T1508T													.	.			0			c.G4524T												209.0	197.0	201.0					7																	100679221		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CTCAACGCCTAGT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4524G>T	7.37:g.100679221G>T			Somatic	90	0	0		WXS	Illumina HiSeq	.	73	0.08	6	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																					0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
MDFIC	29969	mdanderson.org	37	7	114563096	114563096	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr7:114563096G>T	ENST00000393486.1	+	2	598	c.8G>T	c.(7-9)gGc>gTc	p.G3V	MDFIC_ENST00000257724.3_Missense_Mutation_p.G112V|MDFIC_ENST00000423503.1_Missense_Mutation_p.G3V|MDFIC_ENST00000448022.1_Missense_Mutation_p.G3V	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						CCCATGTCCGGCGCGGGCGAA	0.801																																					p.G112V													.	.			0			c.G335T												1.0	2.0	2.0					7																	114563096		515	1027	1542	SO:0001583	missense	29969	exon2			TGTCCGGCGCGGG	AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.8G>T	7.37:g.114563096G>T	ENSP00000377126:p.Gly3Val		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_001166346	0		0		Missense_Mutation	SNP	ENST00000393486.1	37	CCDS55155.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.616366	0.46736	.	.	ENSG00000135272	ENST00000257724;ENST00000393486;ENST00000448022;ENST00000423503	.	.	.	4.52	0.178	0.15058	.	1.076730	0.07219	N	0.860538	T	0.18467	0.0443	N	0.22421	0.69	0.23611	N	0.997299	P	0.44044	0.825	B	0.39935	0.314	T	0.16453	-1.0402	9	0.56958	D	0.05	-0.1713	2.7479	0.05272	0.3538:0.0:0.4407:0.2055	.	3	Q9P1T7	MDFIC_HUMAN	V	112;3;3;3	.	ENSP00000257724:G112V	G	+	2	0	MDFIC	114350332	0.272000	0.24172	0.547000	0.28179	0.558000	0.35554	0.383000	0.20651	0.130000	0.18549	0.557000	0.71058	GGC			0.801	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059968.4		NM_199072	
EPHB6	2051	bcgsc.ca;mdanderson.org	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000442129.1_Silent_p.S172S|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S													.	EPHB6	168		0			c.C516T												83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	7.37:g.142562074C>T			Somatic	71	0.014084507	1		WXS	Illumina HiSeq	Phase_1	106	0.05	5	NM_004445	4	0.00	0	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	CCDS5873.2																																																																																					0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341329.1			
KCNH2	3757	hgsc.bcm.edu;mdanderson.org	37	7	150645544	150645544	+	Missense_Mutation	SNP	G	G	T	rs199473433		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr7:150645544G>T	ENST00000262186.5	-	11	3081	c.2680C>A	c.(2680-2682)Cgc>Agc	p.R894S	KCNH2_ENST00000392968.2_Missense_Mutation_p.R798S|KCNH2_ENST00000330883.4_Missense_Mutation_p.R554S	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	894					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TTGTCCGTGCGCCTGCGGAAG	0.652																																					p.R894S	GBM(137;110 1844 13671 20123 45161)												KCNH2,NS,adenocarcinoma,+1,1	KCNH2	1	1	0			c.C2680A												39.0	37.0	38.0					7																	150645544		2203	4300	6503	SO:0001583	missense	3757	exon11			CCGTGCGCCTGCG	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.2680C>A	7.37:g.150645544G>T	ENSP00000262186:p.Arg894Ser		Somatic	23	0	0		WXS	Illumina HiSeq	.	30	0.07	2	NM_000238	2	0.00	0	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968037	0.53507	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186	D;D;D	0.98550	-4.69;-4.77;-4.99	3.87	3.87	0.44632	.	0.065888	0.52532	D	0.000062	D	0.97932	0.9320	M	0.64997	1.995	0.80722	D	1	D;D;P	0.63880	0.993;0.993;0.626	D;D;B	0.71184	0.972;0.972;0.076	D	0.96159	0.9114	10	0.15952	T	0.53	.	9.0155	0.36168	0.0:0.0:0.7798:0.2202	.	798;894;554	C4PFH9;Q12809;Q12809-2	.;KCNH2_HUMAN;.	S	554;798;894	ENSP00000328531:R554S;ENSP00000376695:R798S;ENSP00000262186:R894S	ENSP00000262186:R894S	R	-	1	0	KCNH2	150276477	0.998000	0.40836	1.000000	0.80357	0.938000	0.57974	2.842000	0.48230	2.172000	0.68678	0.491000	0.48974	CGC			0.652	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350741.2		NM_000238	
SFRP1	6422	broad.mit.edu	37	8	41166547	41166547	+	Silent	SNP	G	G	T	rs551082706		TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr8:41166547G>T	ENST00000220772.3	-	1	469	c.132C>A	c.(130-132)ggC>ggA	p.G44G	SFRP1_ENST00000379845.3_5'Flank	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	44					bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.G44G(3)		breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			TCTGGTACGGGCCGATGTCCG	0.687																																					p.G44G													SFRP1_ENST00000220772,NS,carcinoma,0,3	SFRP1	60	3	3	Substitution - coding silent(3)	endometrium(2)|lung(1)	c.C132A												41.0	42.0	42.0					8																	41166547		2202	4300	6502	SO:0001819	synonymous_variant	6422	exon1			GTACGGGCCGATG	AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.132C>A	8.37:g.41166547G>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	32	0.22	7	NM_003012	0		0	O00546|O14779	Silent	SNP	ENST00000220772.3	37	CCDS34886.1																																																																																					0.687	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377132.1		NM_003012	
AGO2	27161	broad.mit.edu	37	8	141551316	141551316	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr8:141551316G>T	ENST00000220592.5	-	15	2093	c.1981C>A	c.(1981-1983)Ccc>Acc	p.P661T	AGO2_ENST00000519980.1_Missense_Mutation_p.P661T	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	661	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										ATGCGGGTGGGCTTGAAGCGC	0.612																																					p.P661T													.	.			0			c.C1981A												110.0	86.0	94.0					8																	141551316		2200	4300	6500	SO:0001583	missense	27161	exon15			GGGTGGGCTTGAA	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1981C>A	8.37:g.141551316G>T	ENSP00000220592:p.Pro661Thr		Somatic	54	0.0185185185	1		WXS	Illumina HiSeq	Phase_I	83	0.08	7	NM_012154	6	0.00	0	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988289	0.93106	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.49432	0.78;0.78	5.36	5.36	0.76844	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	D	0.84079	0.5393	H	0.99675	4.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91325	0.5085	10	0.72032	D	0.01	-18.2573	19.4371	0.94799	0.0:0.0:1.0:0.0	.	661;661	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	T	661	ENSP00000220592:P661T;ENSP00000430176:P661T	ENSP00000220592:P661T	P	-	1	0	EIF2C2	141620498	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.774000	0.98992	2.642000	0.89623	0.650000	0.86243	CCC			0.612	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377866.4			
UBQLN1	29979	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	86294939	86294939	+	Frame_Shift_Del	DEL	T	T	-			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr9:86294939delT	ENST00000376395.4	-	4	985	c.462delA	c.(460-462)ggafs	p.G154fs	UBQLN1_ENST00000257468.7_Frame_Shift_Del_p.G154fs	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	154					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						GACCTGCAAGTCCCCCAAGGC	0.388																																					p.L155fs	Melanoma(186;1284 2073 12755 14558 18426)												.	UBQLN1	49		0			c.463delC												60.0	59.0	59.0					9																	86294939		2203	4300	6503	SO:0001589	frameshift_variant	29979	exon4			TGCAAGTCCCCCA	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.462delA	9.37:g.86294939delT	ENSP00000365576:p.Gly154fs		Somatic	87	0	0		WXS	Illumina HiSeq	.	83	0.23	19	NM_053067	3	0.00	0	Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Del	DEL	ENST00000376395.4	37	CCDS6663.1																																																																																					0.388	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000052834.1		NM_013438	
UBQLN1	29979	bcgsc.ca	37	9	86294940	86294940	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr9:86294940C>A	ENST00000376395.4	-	4	984	c.461G>T	c.(460-462)gGa>gTa	p.G154V	UBQLN1_ENST00000257468.7_Missense_Mutation_p.G154V	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	154					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						ACCTGCAAGTCCCCCAAGGCC	0.383																																					p.G154V	Melanoma(186;1284 2073 12755 14558 18426)												.	UBQLN1	49		0			c.G461T												59.0	58.0	58.0					9																	86294940		2203	4300	6503	SO:0001583	missense	29979	exon4			GCAAGTCCCCCAA	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.461G>T	9.37:g.86294940C>A	ENSP00000365576:p.Gly154Val		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_1	82	0.23	19	NM_053067	3	0.00	0	Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Missense_Mutation	SNP	ENST00000376395.4	37	CCDS6663.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251363	0.80135	.	.	ENSG00000135018	ENST00000376395;ENST00000257468	D;D	0.84298	-1.83;-1.83	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.92698	0.7679	M	0.83603	2.65	0.80722	D	1	P;D	0.65815	0.802;0.995	P;D	0.63957	0.477;0.92	D	0.92796	0.6252	10	0.62326	D	0.03	.	19.6453	0.95775	0.0:1.0:0.0:0.0	.	154;154	Q9UMX0-2;Q9UMX0	.;UBQL1_HUMAN	V	154	ENSP00000365576:G154V;ENSP00000257468:G154V	ENSP00000257468:G154V	G	-	2	0	UBQLN1	85484760	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.950000	0.63603	2.744000	0.94065	0.650000	0.86243	GGA			0.383	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000052834.1		NM_013438	
UBQLN1	29979	hgsc.bcm.edu	37	9	86294943	86294943	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr9:86294943delC	ENST00000376395.4	-	4	981	c.458delG	c.(457-459)gggfs	p.G154fs	UBQLN1_ENST00000257468.7_Frame_Shift_Del_p.G154fs	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	154					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						TGCAAGTCCCCCAAGGCCACC	0.378																																					p.G153fs	Melanoma(186;1284 2073 12755 14558 18426)												.	UBQLN1	49		0			c.459delG												56.0	55.0	55.0					9																	86294943		2203	4300	6503	SO:0001589	frameshift_variant	29979	exon4			AGTCCCCCAAGGC	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.458delG	9.37:g.86294943delC	ENSP00000365576:p.Gly154fs		Somatic	84	0	0		WXS	Illumina HiSeq	.	85	0.00	0	NM_053067	5	0.00	0	Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Del	DEL	ENST00000376395.4	37	CCDS6663.1																																																																																					0.378	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000052834.1		NM_013438	
FBP2	8789	mdanderson.org	37	9	97325644	97325644	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr9:97325644G>T	ENST00000375337.3	-	6	871	c.805C>A	c.(805-807)Cag>Aag	p.Q269K	PCAT7_ENST00000452148.2_RNA	NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	269					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				GGGCTCTTCTGGTTGGCTGGG	0.607																																					p.Q269K													.	.			0			c.C805A												127.0	113.0	118.0					9																	97325644		2203	4300	6503	SO:0001583	missense	8789	exon6			TCTTCTGGTTGGC	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.805C>A	9.37:g.97325644G>T	ENSP00000364486:p.Gln269Lys		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_003837	0		0	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	.	3.033	-0.199308	0.06219	.	.	ENSG00000130957	ENST00000375337	T	0.70164	-0.46	4.82	2.94	0.34122	.	0.183884	0.47455	N	0.000227	T	0.26484	0.0647	N	0.00569	-1.365	0.35081	D	0.763402	B	0.02656	0.0	B	0.01281	0.0	T	0.41520	-0.9504	10	0.02654	T	1	-0.198	9.6753	0.40037	0.0:0.1377:0.5772:0.2851	.	269	O00757	F16P2_HUMAN	K	269	ENSP00000364486:Q269K	ENSP00000364486:Q269K	Q	-	1	0	FBP2	96365465	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.118000	0.31246	0.623000	0.30267	0.460000	0.39030	CAG			0.607	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053189.1		NM_003837	
FIBCD1	84929	bcgsc.ca	37	9	133805022	133805022	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr9:133805022G>T	ENST00000372338.4	-	2	726	c.484C>A	c.(484-486)Cgg>Agg	p.R162R	FIBCD1_ENST00000253018.4_Silent_p.R4R|FIBCD1_ENST00000448616.1_Silent_p.R162R|FIBCD1_ENST00000372337.2_Silent_p.R4R	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	162						integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		TGCCCCTTCCGCAGCCCCATG	0.706																																					p.R162R													.	FIBCD1	34		0			c.C484A												12.0	14.0	13.0					9																	133805022		2175	4251	6426	SO:0001819	synonymous_variant	84929	exon3			CCTTCCGCAGCCC	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.484C>A	9.37:g.133805022G>T			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_1	44	0.09	4	NM_001145106	1	0.00	0	A3KFK0|Q6UXK6|Q96SJ7	Silent	SNP	ENST00000372338.4	37	CCDS6937.1	.	.	.	.	.	.	.	.	.	.	G	9.342	1.063295	0.20067	.	.	ENSG00000130720	ENST00000444139	.	.	.	5.04	3.01	0.34805	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.6772	0.17755	0.1049:0.0:0.5074:0.3877	.	.	.	.	X	115	.	.	C	-	3	2	FIBCD1	132794843	0.997000	0.39634	0.999000	0.59377	0.640000	0.38277	2.342000	0.43992	1.128000	0.42052	0.462000	0.41574	TGC			0.706	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054687.2		NM_032843	
SETX	23064	mdanderson.org	37	9	135203904	135203904	+	Silent	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr9:135203904G>T	ENST00000224140.5	-	10	3263	c.3081C>A	c.(3079-3081)atC>atA	p.I1027I	SETX_ENST00000372169.2_Silent_p.I1027I|SETX_ENST00000393220.1_Silent_p.I1027I	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1027					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CAAGACTCAGGATTCTTTCAT	0.373																																					p.I1027I													.	.			0			c.C3081A												115.0	114.0	114.0					9																	135203904		2203	4300	6503	SO:0001819	synonymous_variant	23064	exon10			ACTCAGGATTCTT	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.3081C>A	9.37:g.135203904G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_015046	0		0	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	ENST00000224140.5	37	CCDS6947.1																																																																																					0.373	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054774.3		NM_015046	
ENTPD2	954	ucsc.edu;bcgsc.ca	37	9	139944978	139944978	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chr9:139944978G>T	ENST00000355097.2	-	6	834	c.787C>A	c.(787-789)Cac>Aac	p.H263N	ENTPD2_ENST00000312665.5_Missense_Mutation_p.H263N|ENTPD2_ENST00000460614.1_5'Flank|RP11-229P13.15_ENST00000439076.1_RNA	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	263					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CAGCAGGGGTGGAAGCCGTGG	0.632											OREG0019627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H263N													.	ENTPD2	30		0			c.C787A												26.0	23.0	24.0					9																	139944978		2197	4293	6490	SO:0001583	missense	954	exon6			AGGGGTGGAAGCC	U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.787C>A	9.37:g.139944978G>T	ENSP00000347213:p.His263Asn		Somatic	39	0	0	1652	WXS	Illumina HiSeq		30	0.13	4	NM_203468	0		0	O15464|Q5SPY6|Q5SPY7	Missense_Mutation	SNP	ENST00000355097.2	37	CCDS7026.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588134	0.28268	.	.	ENSG00000054179	ENST00000355097;ENST00000312665	T;T	0.09350	2.99;2.99	4.66	3.69	0.42338	.	0.209851	0.49305	D	0.000155	T	0.10121	0.0248	N	0.16708	0.43	0.41073	D	0.985462	B;P	0.38745	0.259;0.645	B;P	0.47744	0.137;0.556	T	0.35919	-0.9769	10	0.21014	T	0.42	-16.1399	10.9642	0.47403	0.0:0.0:0.8135:0.1865	.	263;263	Q9Y5L3-2;Q9Y5L3	.;ENTP2_HUMAN	N	263	ENSP00000347213:H263N;ENSP00000312494:H263N	ENSP00000312494:H263N	H	-	1	0	ENTPD2	139064799	0.999000	0.42202	0.921000	0.36526	0.238000	0.25445	2.910000	0.48766	2.117000	0.64856	0.561000	0.74099	CAC			0.632	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055169.1		NM_203468	
MT-CO1	4512	hgsc.bcm.edu;broad.mit.edu	37	M	3150	3150	+	5'Flank	SNP	T	T	C			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrM:3150T>C	ENST00000361624.2	+	0	0				MT-TW_ENST00000387382.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-ND2_ENST00000361453.3_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GAAATAAGGCCTACTTCACAA	0.453																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6053	.			AAGGCCTACTTCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3150T>C	Exception_encountered		Somatic	10	0	0		WXS	Illumina HiSeq	.	28	0.14	4	.	0		0	Q34770	RNA	SNP	ENST00000361624.2	37																																																																																						0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024028	
DMD	1756	broad.mit.edu	37	X	31462743	31462743	+	Splice_Site	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrX:31462743G>T	ENST00000357033.4	-	60	9145	c.8939C>A	c.(8938-8940)gCa>gAa	p.A2980E	DMD_ENST00000378707.3_Splice_Site_p.A520E|DMD_ENST00000359836.1_Splice_Site_p.A520E|DMD_ENST00000474231.1_Splice_Site_p.A520E|DMD_ENST00000541735.1_Splice_Site_p.A520E|DMD_ENST00000378677.2_Splice_Site_p.A2976E|DMD_ENST00000343523.2_Splice_Site_p.A520E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2980					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCCTCGAAGTGCCTGTGTGCA	0.448																																					p.A2980E													.	DMD	2127		0			c.C8939A												115.0	88.0	97.0					X																	31462743		2202	4300	6502	SO:0001630	splice_region_variant	1756	exon60			CGAAGTGCCTGTG	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8938-1C>A	X.37:g.31462743G>T			Somatic	35	0.0571428571	2		WXS	Illumina HiSeq	Phase_I	63	0.11	7	NM_004006	4	0.00	0	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Splice_Site	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.254385	0.39896	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.64	2.89	0.33648	.	0.243724	0.20272	U	0.095624	T	0.43478	0.1249	L	0.29908	0.895	0.31505	N	0.664323	D;B;B;B;B;B;B;B;B;B;B	0.55385	0.971;0.022;0.153;0.022;0.022;0.001;0.014;0.014;0.016;0.013;0.138	P;B;B;B;B;B;B;B;B;B;B	0.56042	0.79;0.027;0.153;0.012;0.012;0.005;0.046;0.046;0.012;0.007;0.073	T	0.40515	-0.9559	10	0.11794	T	0.64	.	9.2818	0.37733	0.3147:0.0:0.6853:0.0	.	2972;2980;2976;1639;1636;520;520;520;520;520;2857	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	E	2972;1639;1636;676;2976;2980;520;520;2980;2857;520;520;520	ENSP00000350765:A676E;ENSP00000367948:A2976E;ENSP00000354923:A2980E;ENSP00000352894:A520E;ENSP00000340057:A520E;ENSP00000367979:A520E;ENSP00000444119:A520E;ENSP00000417123:A520E	ENSP00000340057:A520E	A	-	2	0	DMD	31372664	1.000000	0.71417	0.997000	0.53966	0.910000	0.53928	1.836000	0.39191	0.547000	0.28938	0.594000	0.82650	GCA			0.448	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056182.2		NM_004006	Missense_Mutation
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	32663131	32663131	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrX:32663131C>A	ENST00000357033.4	-	10	1305	c.1099G>T	c.(1099-1101)Gag>Tag	p.E367*	DMD_ENST00000288447.4_Nonsense_Mutation_p.E359*|DMD_ENST00000378677.2_Nonsense_Mutation_p.E363*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	367					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTAGAAATCTCTCCTTGTGCT	0.363																																					p.E367X													.	.			0			c.G1099T												224.0	190.0	202.0					X																	32663131		2202	4300	6502	SO:0001587	stop_gained	1756	exon10			AAATCTCTCCTTG	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1099G>T	X.37:g.32663131C>A	ENSP00000354923:p.Glu367*		Somatic	74	0	0		WXS	Illumina HiSeq	.	122	0.43	52	NM_004006	6	0.33	2	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	39	7.608102	0.98387	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	.	.	.	5.52	5.52	0.82312	.	0.192432	0.24391	U	0.038930	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	12.1871	0.54245	0.0:0.9198:0.0:0.0802	.	.	.	.	X	359;363;367;367;244;359	.	ENSP00000288447:E359X	E	-	1	0	DMD	32573052	0.966000	0.33281	1.000000	0.80357	0.976000	0.68499	1.971000	0.40530	2.458000	0.83093	0.600000	0.82982	GAG			0.363	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056182.2		NM_004006	
RBM3	5935	broad.mit.edu	37	X	48434994	48434994	+	Splice_Site	SNP	T	T	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrX:48434994T>G	ENST00000376759.3	+	5	476		c.e5+2		AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000430348.2_Splice_Site|RBM3_ENST00000354480.2_Splice_Site|RBM3_ENST00000466764.1_Splice_Site|RBM3_ENST00000376755.1_Splice_Site	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3						positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)	p.?(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TAATGGCAGGTGGGTAGCCAA	0.517																																					.													.	RBM3	20		1	Unknown(1)	ovary(1)	c.413+2T>G												59.0	56.0	57.0					X																	48434994		2193	4272	6465	SO:0001630	splice_region_variant	5935	exon5			GGCAGGTGGGTAG	BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.413+2T>G	X.37:g.48434994T>G			Somatic	24	0.1666666667	4		WXS	Illumina HiSeq	Phase_I	42	0.17	7	NM_006743	0		0		Splice_Site	SNP	ENST00000376759.3	37	CCDS14301.1	.	.	.	.	.	.	.	.	.	.	t	11.97	1.798592	0.31777	.	.	ENSG00000102317	ENST00000376759;ENST00000430348;ENST00000376755;ENST00000354480	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3004	0.43648	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM3	48319938	1.000000	0.71417	0.999000	0.59377	0.387000	0.30353	2.025000	0.41059	1.792000	0.52537	0.481000	0.45027	.			0.517	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060755.1		NM_006743	Intron
HUWE1	10075	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	53585984	53585984	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrX:53585984C>T	ENST00000342160.3	-	57	8410	c.7953G>A	c.(7951-7953)tgG>tgA	p.W2651*	MIRLET7F2_ENST00000385277.1_RNA|MIR98_ENST00000606724.1_RNA|HUWE1_ENST00000262854.6_Nonsense_Mutation_p.W2651*			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2651					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ATTCTTCTGTCCAGCGGGTCA	0.522																																					p.W2651X													.	HUWE1	724		0			c.G7953A												48.0	33.0	38.0					X																	53585984		2192	4272	6464	SO:0001587	stop_gained	10075	exon58			TTCTGTCCAGCGG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7953G>A	X.37:g.53585984C>T	ENSP00000340648:p.Trp2651*		Somatic	119	0.0084033613	1		WXS	Illumina HiSeq	Phase_I	169	0.40	68	NM_031407	3	0.00	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Nonsense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	52|52	19.764200|19.764200	0.99923|0.99923	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.44052|.	0.1275|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.41910|.	-0.9482|.	3|.	.|0.02654	.|T	.|1	.|.	16.9394|16.9394	0.86213|0.86213	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	N|X	1685|2651	.|.	.|ENSP00000262854:W2651X	D|W	-|-	1|3	0|0	HUWE1|HUWE1	53602709|53602709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.059000|7.059000	0.76684|0.76684	2.261000|2.261000	0.74972|0.74972	0.513000|0.513000	0.50165|0.50165	GAC|TGG			0.522	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056766.1		XM_497119	
FGD1	2245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54476099	54476099	+	Missense_Mutation	SNP	T	T	A			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrX:54476099T>A	ENST00000375135.3	-	14	2874	c.2141A>T	c.(2140-2142)aAc>aTc	p.N714I		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	714					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TACTGGAGAGTTGGGTGGGGT	0.537																																					p.N714I													.	.			0			c.A2141T												137.0	137.0	137.0					X																	54476099		2203	4300	6503	SO:0001583	missense	2245	exon14			GGAGAGTTGGGTG	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2141A>T	X.37:g.54476099T>A	ENSP00000364277:p.Asn714Ile		Somatic	57	0	0		WXS	Illumina HiSeq	.	57	0.35	20	NM_004463	22	0.36	8	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	T	9.026	0.986147	0.18889	.	.	ENSG00000102302	ENST00000375135	T	0.65732	-0.17	5.56	4.19	0.49359	Zinc finger, FYVE/PHD-type (1);	0.106962	0.41712	D	0.000834	T	0.42471	0.1204	N	0.19112	0.55	0.36187	D	0.849831	B;P	0.41848	0.172;0.763	B;B	0.35114	0.05;0.196	T	0.56836	-0.7913	10	0.52906	T	0.07	-8.5395	10.0778	0.42370	0.0:0.0981:0.0:0.9019	.	472;714	B4DS99;P98174	.;FGD1_HUMAN	I	714	ENSP00000364277:N714I	ENSP00000364277:N714I	N	-	2	0	FGD1	54492824	1.000000	0.71417	0.989000	0.46669	0.261000	0.26267	3.734000	0.55037	1.862000	0.54008	0.417000	0.27973	AAC			0.537	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056801.1		NM_004463	
AWAT1	158833	mdanderson.org	37	X	69458085	69458085	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrX:69458085G>T	ENST00000374521.3	+	5	525	c.484G>T	c.(484-486)Gcc>Tcc	p.A162S		NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	162					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						GAGCCAGCCAGCCATCAACTA	0.527																																					p.A162S													.	.			0			c.G484T												110.0	89.0	96.0					X																	69458085		2203	4300	6503	SO:0001583	missense	158833	exon5			CAGCCAGCCATCA	BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.484G>T	X.37:g.69458085G>T	ENSP00000363645:p.Ala162Ser		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_001013579	0		0	Q5JT21|Q6IEE4	Missense_Mutation	SNP	ENST00000374521.3	37	CCDS35321.1	.	.	.	.	.	.	.	.	.	.	G	0.140	-1.102892	0.01828	.	.	ENSG00000204195	ENST00000374521	T	0.11063	2.81	4.93	-2.83	0.05769	.	0.492682	0.19321	N	0.117139	T	0.02230	0.0069	N	0.01473	-0.845	0.21105	N	0.999789	B	0.09022	0.002	B	0.12837	0.008	T	0.40040	-0.9584	10	0.02654	T	1	-3.8467	5.2567	0.15552	0.2438:0.0:0.2704:0.4858	.	162	Q58HT5	AWAT1_HUMAN	S	162	ENSP00000363645:A162S	ENSP00000363645:A162S	A	+	1	0	AWAT1	69374810	0.000000	0.05858	0.030000	0.17652	0.677000	0.39632	-0.083000	0.11286	-0.492000	0.06687	0.600000	0.82982	GCC			0.527	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057066.3		NM_001013579	
PNMA3	29944	broad.mit.edu	37	X	152226011	152226011	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA06-01A-12D-A435-10	TCGA-ZM-AA06-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2dc9fe22-781b-41a9-9eda-d7faaa6af579	8eeb0d34-42a4-47a8-9857-139c9c599b8d	g.chrX:152226011A>G	ENST00000370264.4	+	1	625	c.599A>G	c.(598-600)gAa>gGa	p.E200G	PNMA3_ENST00000370265.4_Missense_Mutation_p.E200G|PNMA3_ENST00000447306.1_Missense_Mutation_p.E200G			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	200					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					cccgagggggaaaagaggcgg	0.587																																					p.E200G													.	PNMA3	81		0			c.A599G												65.0	64.0	64.0					X																	152226011		2203	4300	6503	SO:0001583	missense	29944	exon2			AGGGGGAAAAGAG	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.599A>G	X.37:g.152226011A>G	ENSP00000359286:p.Glu200Gly		Somatic	48	0.2708333333	13		WXS	Illumina HiSeq	Phase_I	55	0.31	17	NM_013364	3	0.00	0	D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	a	13.68	2.310689	0.40895	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.13538	2.58;2.58;2.58	1.98	1.98	0.26296	.	.	.	.	.	T	0.31827	0.0809	M	0.75447	2.3	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04693	-1.0933	9	0.87932	D	0	.	5.4244	0.16417	1.0:0.0:0.0:0.0	.	200	Q9UL41	PNMA3_HUMAN	G	200	ENSP00000359288:E200G;ENSP00000407642:E200G;ENSP00000359286:E200G	ENSP00000359286:E200G	E	+	2	0	PNMA3	151976667	0.302000	0.24454	0.007000	0.13788	0.009000	0.06853	2.310000	0.43708	1.055000	0.40461	0.378000	0.23410	GAA			0.587	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060946.2		NM_013364	
