#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PTPRF	5792	mdanderson.org	37	1	44064408	44064408	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr1:44064408C>T	ENST00000359947.4	+	13	2477	c.2137C>T	c.(2137-2139)Cgg>Tgg	p.R713W	PTPRF_ENST00000372413.3_Missense_Mutation_p.R713W|PTPRF_ENST00000372414.3_Missense_Mutation_p.R713W|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000438120.1_Missense_Mutation_p.R713W|PTPRF_ENST00000422171.2_Missense_Mutation_p.R70W	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	713	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGGGCCTCCGCGGAAGGTGGA	0.622																																					p.R713W													.	.			0			c.C2137T												53.0	53.0	53.0					1																	44064408		2203	4300	6503	SO:0001583	missense	5792	exon13			CCTCCGCGGAAGG	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2137C>T	1.37:g.44064408C>T	ENSP00000353030:p.Arg713Trp		Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	70	0.06	4	NM_002840	3	0.00	0	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.42|15.42	2.828596|2.828596	0.50845|0.50845	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171	.|T;T;T;T;T	.|0.59083	.|0.29;0.29;0.29;0.29;0.29	4.35|4.35	-0.522|-0.522	0.11928|0.11928	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.568034	.|0.13365	.|N	.|0.393399	T|T	0.81192|0.81192	0.4771|0.4771	H|H	0.95679|0.95679	3.705|3.705	0.45528|0.45528	D|D	0.998488|0.998488	.|D;D;D;D;D	.|0.89917	.|1.0;0.994;1.0;0.995;0.999	.|D;P;D;P;D	.|0.77004	.|0.989;0.79;0.985;0.788;0.985	D|D	0.84394|0.84394	0.0556|0.0556	5|10	.|0.54805	.|T	.|0.06	.|.	14.2344|14.2344	0.65916|0.65916	0.6255:0.3745:0.0:0.0|0.6255:0.3745:0.0:0.0	.|.	.|369;70;472;713;713	.|Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586	.|.;.;.;.;PTPRF_HUMAN	V|W	278;135|713;713;713;713;70	.|ENSP00000353030:R713W;ENSP00000398822:R713W;ENSP00000361491:R713W;ENSP00000361490:R713W;ENSP00000387885:R70W	.|ENSP00000353030:R713W	A|R	+|+	2|1	0|2	PTPRF|PTPRF	43836995|43836995	0.001000|0.001000	0.12720|0.12720	0.485000|0.485000	0.27403|0.27403	0.852000|0.852000	0.48524|0.48524	-0.042000|-0.042000	0.12063|0.12063	0.027000|0.027000	0.15297|0.15297	-0.513000|-0.513000	0.04457|0.04457	GCG|CGG			0.622	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000019710.1			
LRRC53	100144878	bcgsc.ca;mdanderson.org	37	1	74946064	74946064	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr1:74946064G>A	ENST00000294635.4	-	3	791	c.677C>T	c.(676-678)gCt>gTt	p.A226V	TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|LRRC53_ENST00000416014.2_Missense_Mutation_p.A226V|TNNI3K_ENST00000326637.3_Intron			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53	226	LRRCT.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						TAAAAACCGAGCAAGGGGATG	0.488																																					.													.	.			0			.																																									SO:0001583	missense	100144878	.			AACCGAGCAAGGG			1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.677C>T	1.37:g.74946064G>A	ENSP00000294635:p.Ala226Val		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_1	63	0.08	5	.	0		0		Missense_Mutation	SNP	ENST00000294635.4	37		.	.	.	.	.	.	.	.	.	.	G	12.98	2.101414	0.37048	.	.	ENSG00000162621	ENST00000416014;ENST00000294635	T;T	0.51325	0.71;0.71	5.46	4.51	0.55191	.	0.165361	0.35349	N	0.003276	T	0.36468	0.0968	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.07673	-1.0760	7	0.19590	T	0.45	-3.821	14.4828	0.67594	0.0:0.0:0.8523:0.1477	.	.	.	.	V	226	ENSP00000391861:A226V;ENSP00000294635:A226V	ENSP00000294635:A226V	A	-	2	0	LRRC53	74718652	0.334000	0.24739	0.063000	0.19743	0.975000	0.68041	3.006000	0.49529	2.559000	0.86315	0.462000	0.41574	GCT			0.488	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000026515.2			
BCL9	607	hgsc.bcm.edu;broad.mit.edu	37	1	147084715	147084715	+	Silent	SNP	T	T	C			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr1:147084715T>C	ENST00000234739.3	+	5	827	c.87T>C	c.(85-87)cgT>cgC	p.R29R	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	29					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TGATGGTCCGTCCCCCTACAG	0.502			T	"""IGH@, IGL@"""	B-ALL																																p.R29R				Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	BCL9_ENST00000234739,right_upper_lobe,carcinoma,0,1	BCL9_ENST00000234739	0	1	0			c.T87C												87.0	90.0	89.0					1																	147084715		2203	4300	6503	SO:0001819	synonymous_variant	607	exon5			GGTCCGTCCCCCT	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.87T>C	1.37:g.147084715T>C			Somatic	74	0	0		WXS	Illumina HiSeq	.	61	0.05	3	NM_004326	1	0.00	0	Q5T489	Silent	SNP	ENST00000234739.3	37	CCDS30833.1																																																																																					0.502	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039468.1		NM_004326	
DHX9	1660	mdanderson.org	37	1	182852411	182852411	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr1:182852411C>T	ENST00000367549.3	+	25	3162	c.3052C>T	c.(3052-3054)Cgt>Tgt	p.R1018C	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1018					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						CACTGAAGGGCGTAATGCACT	0.393																																					p.R1018C	Colon(69;210 1162 3697 13559 39565)												.	.			0			c.C3052T												140.0	119.0	125.0					1																	182852411		1905	4124	6029	SO:0001583	missense	1660	exon25			GAAGGGCGTAATG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3052C>T	1.37:g.182852411C>T	ENSP00000356520:p.Arg1018Cys		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	119	0.04	5	NM_001357	48	0.00	0	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265194	0.80358	.	.	ENSG00000135829	ENST00000367549	T	0.61742	0.08	5.38	5.38	0.77491	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.74974	0.3787	M	0.80746	2.51	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64877	0.93;0.93	T	0.78529	-0.2169	10	0.72032	D	0.01	.	14.0387	0.64660	0.151:0.849:0.0:0.0	.	297;1018	B3KU66;Q08211	.;DHX9_HUMAN	C	1018	ENSP00000356520:R1018C	ENSP00000356520:R1018C	R	+	1	0	DHX9	181119034	1.000000	0.71417	0.992000	0.48379	0.969000	0.65631	4.228000	0.58619	2.501000	0.84356	0.650000	0.86243	CGT			0.393	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085522.2		NM_030588	
TRIM67	440730	mdanderson.org	37	1	231299690	231299690	+	Silent	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr1:231299690G>T	ENST00000366653.5	+	1	975	c.975G>T	c.(973-975)ctG>ctT	p.L325L	TRIM67_ENST00000366652.2_Silent_p.L325L|TRIM67_ENST00000449018.3_Silent_p.L263L|TRIM67_ENST00000444294.3_Silent_p.L325L			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	325					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				TGTGTTATCTGTGCCTGGAGG	0.652																																					p.L325L													.	.			0			c.G975T												19.0	22.0	21.0					1																	231299690		2061	4193	6254	SO:0001819	synonymous_variant	440730	exon1			TTATCTGTGCCTG	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.975G>T	1.37:g.231299690G>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001004342	0		0	Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	ENST00000366653.5	37	CCDS44333.1																																																																																					0.652	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000092649.3		NM_001004342	
CAMK2G	818	mdanderson.org	37	10	75585052	75585052	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr10:75585052G>T	ENST00000444854.2	-	7	565	c.445C>A	c.(445-447)Ctt>Att	p.L149I	CAMK2G_ENST00000472912.1_5'UTR|CAMK2G_ENST00000305762.7_Silent_p.P359P|CAMK2G_ENST00000322680.3_Silent_p.P348P|CAMK2G_ENST00000423381.1_Silent_p.P380P|CAMK2G_ENST00000372765.1_Intron|CAMK2G_ENST00000394762.2_Intron|CAMK2G_ENST00000322635.3_Intron|CAMK2G_ENST00000351293.3_Intron			Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	CCGTCTGCAAGGGCGCGGGCT	0.592																																					p.P369P													.	.			0			c.C1107A												160.0	131.0	141.0					10																	75585052		2203	4300	6503	SO:0001583	missense	818	exon15			CTGCAAGGGCGCG	U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000444854.2:c.445C>A	10.37:g.75585052G>T	ENSP00000399680:p.Leu149Ile		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001204492	1	0.00	0	O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Silent	SNP	ENST00000444854.2	37		.	.	.	.	.	.	.	.	.	.	G	13.74	2.327825	0.41197	.	.	ENSG00000148660	ENST00000441192;ENST00000444854	T	0.73789	-0.78	5.99	3.99	0.46301	.	.	.	.	.	T	0.65133	0.2662	.	.	.	0.22342	N	0.999183	.	.	.	.	.	.	T	0.53655	-0.8408	5	.	.	.	.	6.6192	0.22794	0.0897:0.0:0.6597:0.2505	.	.	.	.	I	127;149	ENSP00000399680:L149I	.	L	-	1	0	CAMK2G	75255058	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.323000	0.43823	2.840000	0.97914	0.655000	0.94253	CTT			0.592	CAMK2G-204	KNOWN	basic	protein_coding	protein_coding				NM_172169	
HPS1	3257	bcgsc.ca	37	10	100184075	100184075	+	Silent	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr10:100184075G>T	ENST00000325103.6	-	14	1625	c.1392C>A	c.(1390-1392)tcC>tcA	p.S464S	HPS1_ENST00000361490.4_Silent_p.S464S|HPS1_ENST00000467246.1_5'UTR	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	464					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		CTCACTCCCAGGAGGATCCGG	0.587									Hermansky-Pudlak syndrome																												p.S464S													HPS1,colon,carcinoma,-1,1	HPS1	65	1	0			c.C1392A												56.0	44.0	48.0					10																	100184075		2203	4300	6503	SO:0001819	synonymous_variant	3257	exon14	Familial Cancer Database	HPS, HPS1-8	CTCCCAGGAGGAT	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.1392C>A	10.37:g.100184075G>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_1	49	0.08	4	NM_000195	28	0.00	0	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Silent	SNP	ENST00000325103.6	37	CCDS7475.1																																																																																					0.587	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049776.1		NM_000195, NM_182637, NM_182638, NM_182639	
FGFR2	2263	mdanderson.org	37	10	123256223	123256223	+	Silent	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr10:123256223G>T	ENST00000358487.5	-	13	1958	c.1686C>A	c.(1684-1686)gtC>gtA	p.V562V	FGFR2_ENST00000357555.5_Silent_p.V473V|FGFR2_ENST00000360144.3_Silent_p.V474V|FGFR2_ENST00000346997.2_Silent_p.V560V|FGFR2_ENST00000369060.4_Silent_p.V446V|FGFR2_ENST00000356226.4_Silent_p.V445V|FGFR2_ENST00000369056.1_Silent_p.V563V|FGFR2_ENST00000457416.2_Silent_p.V563V|FGFR2_ENST00000351936.6_Silent_p.V560V|FGFR2_ENST00000369061.4_Silent_p.V450V|FGFR2_ENST00000478859.1_Silent_p.V334V|FGFR2_ENST00000369059.1_Silent_p.V448V	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	562	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	ACTCAACTATGACATAGAGAG	0.493		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.V563V				Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	.			0			c.C1689A												75.0	78.0	77.0					10																	123256223		2203	4300	6503	SO:0001819	synonymous_variant	2263	exon13	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AACTATGACATAG	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1686C>A	10.37:g.123256223G>T			Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	75	0.05	4	NM_022970	1	0.00	0	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Silent	SNP	ENST00000358487.5	37	CCDS31298.1																																																																																					0.493	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000050715.1		NM_022976, NM_000141	
CDKN1C	1028	mdanderson.org	37	11	2905277	2905277	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr11:2905277C>A	ENST00000414822.3	-	2	1299	c.908G>T	c.(907-909)gGc>gTc	p.G303V	CDKN1C_ENST00000380725.1_Missense_Mutation_p.A115S|CDKN1C_ENST00000313407.6_Missense_Mutation_p.G292V|CDKN1C_ENST00000440480.2_Missense_Mutation_p.G292V|CDKN1C_ENST00000430149.2_Missense_Mutation_p.G303V	NM_000076.2	NP_000067.1	P49918	CDN1C_HUMAN	cyclin-dependent kinase inhibitor 1C (p57, Kip2)	303					adrenal gland development (GO:0030325)|aging (GO:0007568)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|digestive system development (GO:0055123)|embryonic placenta morphogenesis (GO:0060669)|genetic imprinting (GO:0071514)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|myeloid cell differentiation (GO:0030099)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of kinase activity (GO:0033673)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron maturation (GO:0042551)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|skeletal system development (GO:0001501)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)			central_nervous_system(1)|lung(1)	2		all_epithelial(84;0.000187)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|Breast(177;0.00328)|all_neural(188;0.00681)|all_lung(207;0.157)|Lung NSC(207;0.216)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGAGCCCACGCCAGGGGCGGC	0.716																																					p.G303V	GBM(111;59 1151 2497 5746 16112 18241 29216)												CDKN1C,NS,carcinoma,0,1	CDKN1C	0	1	0			c.G908T												5.0	7.0	6.0					11																	2905277		2071	4132	6203	SO:0001583	missense	1028	exon2			CCCACGCCAGGGG	D64137	CCDS7738.1, CCDS44519.1	11p15.5	2014-09-17	2004-02-13		ENSG00000129757	ENSG00000129757			1786	protein-coding gene	gene with protein product		600856	"""Beckwith-Wiedemann syndrome"""	BWCR, BWS		7729684	Standard	NM_000076		Approved	P57, KIP2	uc001lws.4	P49918	OTTHUMG00000010040	ENST00000414822.3:c.908G>T	11.37:g.2905277C>A	ENSP00000413720:p.Gly303Val		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_000076	1	0.00	0		Missense_Mutation	SNP	ENST00000414822.3	37	CCDS7738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.479|4.479	0.088788|0.088788	0.08583|0.08583	.|.	.|.	ENSG00000129757|ENSG00000129757	ENST00000380725|ENST00000414822;ENST00000440480;ENST00000313407;ENST00000430149	D|D;D;D;D	0.84146|0.94138	-1.81|-3.04;-3.36;-3.36;-3.04	3.63|3.63	-1.54|-1.54	0.08584|0.08584	.|.	.|.	.|.	.|.	.|.	D|D	0.86686|0.86686	0.5992|0.5992	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999999|0.999999	B|P	0.25105|0.37594	0.118|0.601	B|B	0.17098|0.34093	0.017|0.175	T|T	0.77197|0.77197	-0.2676|-0.2676	9|9	0.27082|0.72032	T|D	0.32|0.01	.|.	10.3181|10.3181	0.43749|0.43749	0.0:0.4819:0.4083:0.1098|0.0:0.4819:0.4083:0.1098	.|.	115|303	A6NK88|P49918	.|CDN1C_HUMAN	S|V	115|303;292;292;303	ENSP00000370101:A115S|ENSP00000413720:G303V;ENSP00000411257:G292V;ENSP00000321019:G292V;ENSP00000411552:G303V	ENSP00000370101:A115S|ENSP00000321019:G292V	A|G	-|-	1|2	0|0	CDKN1C|CDKN1C	2861853|2861853	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.027000|0.027000	0.11550|0.11550	0.266000|0.266000	0.18534|0.18534	-0.039000|-0.039000	0.13602|0.13602	0.491000|0.491000	0.48974|0.48974	GCG|GGC			0.716	CDKN1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000027774.2		NM_000076	
FOLH1	2346	mdanderson.org	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																					p.Y277Y													.	.			0			c.T831C												61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346	exon7			ATAAGCATATTCT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	153	0.05	7	NM_004476	0		0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																			0.006		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390896.1		NM_004476	
TMX2	51075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57505458	57505458	+	Silent	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr11:57505458G>A	ENST00000278422.4	+	3	336	c.324G>A	c.(322-324)ttG>ttA	p.L108L	TMX2-CTNND1_ENST00000528395.1_Intron|TMX2_ENST00000378312.4_Intron	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2	108					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						TCTTCCGCTTGGATATTCGCA	0.398																																					p.L108L													.	.			0			c.G324A												157.0	144.0	148.0					11																	57505458		2201	4296	6497	SO:0001819	synonymous_variant	51075	exon3			CCGCTTGGATATT	AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.324G>A	11.37:g.57505458G>A			Somatic	209	0	0		WXS	Illumina HiSeq	.	121	0.15	18	NM_015959	1	0.00	0	B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Silent	SNP	ENST00000278422.4	37	CCDS7967.1																																																																																					0.398	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393708.1		NM_015959	
C11orf30	56946	broad.mit.edu	37	11	76257194	76257194	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr11:76257194G>T	ENST00000529032.1	+	19	3627	c.3627G>T	c.(3625-3627)gaG>gaT	p.E1209D	C11orf30_ENST00000524490.1_Missense_Mutation_p.E1111D|C11orf30_ENST00000525919.1_Missense_Mutation_p.E1210D|C11orf30_ENST00000343878.3_Intron|C11orf30_ENST00000334736.3_Missense_Mutation_p.E1209D|C11orf30_ENST00000533248.1_Missense_Mutation_p.E1118D|C11orf30_ENST00000525038.1_Missense_Mutation_p.E1210D|C11orf30_ENST00000524767.1_Missense_Mutation_p.E1224D			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	1209					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						AATGTAGAGAGTCCTGTTCGA	0.527																																					p.E1209D													.	C11orf30	123		0			c.G3627T												87.0	89.0	88.0					11																	76257194		2200	4292	6492	SO:0001583	missense	56946	exon20			TAGAGAGTCCTGT	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.3627G>T	11.37:g.76257194G>T	ENSP00000432327:p.Glu1209Asp		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	122	0.03	4	NM_020193	0		0	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.20|10.20	1.285699|1.285699	0.23478|0.23478	.|.	.|.	ENSG00000158636|ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032|ENST00000531793	.|.	.|.	.|.	6.06|6.06	3.07|3.07	0.35406|0.35406	.|.	0.295989|.	0.34531|.	N|.	0.003897|.	T|T	0.34366|0.34366	0.0895|0.0895	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	B;B;B;B;B;B|.	0.22080|.	0.064;0.0;0.001;0.003;0.0;0.003|.	B;B;B;B;B;B|.	0.22753|.	0.041;0.002;0.002;0.003;0.002;0.003|.	T|T	0.05649|0.05649	-1.0872|-1.0872	9|5	0.49607|.	T|.	0.09|.	-3.4235|-3.4235	6.4556|6.4556	0.21928|0.21928	0.2125:0.3628:0.4247:0.0|0.2125:0.3628:0.4247:0.0	.|.	1118;1210;1224;1210;1111;1209|.	B7ZKT8;B7ZKU2;B7ZKU0;Q17RM7;E9PMC9;Q7Z589|.	.;.;.;.;.;EMSY_HUMAN|.	D|I	1111;1209;891;1224;1118;1210;1210;1209|68	.|.	ENSP00000334130:E1209D|.	E|S	+|+	3|2	2|0	C11orf30|C11orf30	75934842|75934842	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.966000|0.966000	0.29331|0.29331	0.831000|0.831000	0.34780|0.34780	-0.181000|-0.181000	0.13052|0.13052	GAG|AGT			0.527	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000383288.2		NM_020193	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	78780952	78780952	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr11:78780952G>C	ENST00000278550.7	-	5	500	c.38C>G	c.(37-39)aCc>aGc	p.T13S	TENM4_ENST00000533038.1_5'UTR	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	13	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GCGGCGCCGGGTCAGCGAGCG	0.682																																					p.T13S													.	.			0			c.C38G												32.0	34.0	33.0					11																	78780952		692	1591	2283	SO:0001583	missense	26011	exon5			CGCCGGGTCAGCG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.38C>G	11.37:g.78780952G>C	ENSP00000278550:p.Thr13Ser		Somatic	63	0	0		WXS	Illumina HiSeq	.	34	0.21	7	NM_001098816	0		0	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699302	0.68501	.	.	ENSG00000149256	ENST00000278550	T	0.38722	1.12	4.54	4.54	0.55810	Teneurin intracellular, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.53481	0.1799	L	0.31926	0.97	0.53688	D	0.999975	D;D	0.71674	0.998;0.979	D;D	0.76071	0.987;0.973	T	0.49194	-0.8965	9	.	.	.	.	17.8567	0.88765	0.0:0.0:1.0:0.0	.	13;13	G3CAT1;Q6N022	.;TEN4_HUMAN	S	13	ENSP00000278550:T13S	.	T	-	2	0	ODZ4	78458600	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.229000	0.95273	2.525000	0.85131	0.655000	0.94253	ACC			0.682	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391406.2			
PRDM10	56980	mdanderson.org	37	11	129788444	129788444	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr11:129788444C>T	ENST00000360871.3	-	14	2435	c.2204G>A	c.(2203-2205)cGc>cAc	p.R735H	PRDM10_ENST00000358825.5_Missense_Mutation_p.R739H|PRDM10_ENST00000528746.1_Missense_Mutation_p.R709H|PRDM10_ENST00000304538.6_Missense_Mutation_p.R649H|PRDM10_ENST00000423662.2_Missense_Mutation_p.R653H|PRDM10_ENST00000526082.1_Missense_Mutation_p.R653H	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	739					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CAGCATGCCGCGCCGCCGGAA	0.587																																					p.R739H													.	.			0			c.G2216A												119.0	114.0	115.0					11																	129788444		2201	4297	6498	SO:0001583	missense	56980	exon15			ATGCCGCGCCGCC	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2204G>A	11.37:g.129788444C>T	ENSP00000354118:p.Arg735His		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_020228	0		0	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	C	34	5.409514	0.96072	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.11712	2.78;2.78;2.78;2.76;2.82;2.75;2.85	5.69	5.69	0.88448	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.33644	0.0870	M	0.63843	1.955	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.991;0.996;0.991;0.996;0.961;0.996	T	0.00733	-1.1589	10	0.56958	D	0.05	-9.529	19.8045	0.96525	0.0:1.0:0.0:0.0	.	649;735;739;653;649;653	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	H	739;649;735;653;709;653;452	ENSP00000351686:R739H;ENSP00000302669:R649H;ENSP00000354118:R735H;ENSP00000398431:R653H;ENSP00000431262:R709H;ENSP00000432237:R653H;ENSP00000435940:R452H	ENSP00000302669:R649H	R	-	2	0	PRDM10	129293654	1.000000	0.71417	0.187000	0.23214	0.963000	0.63663	7.461000	0.80834	2.676000	0.91093	0.655000	0.94253	CGC			0.587	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386076.1		NM_199437	
TRAFD1	10906	mdanderson.org	37	12	112589913	112589913	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr12:112589913T>C	ENST00000257604.5	+	10	2205	c.1588T>C	c.(1588-1590)Tcc>Ccc	p.S530P	TRAFD1_ENST00000412615.2_Missense_Mutation_p.S530P|Y_RNA_ENST00000363265.1_RNA	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	530					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						GCCCTCTTTCTCCCCTGGGCC	0.552																																					p.S530P													.	.			0			c.T1588C												86.0	95.0	92.0					12																	112589913		2203	4300	6503	SO:0001583	missense	10906	exon10			TCTTTCTCCCCTG	AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.1588T>C	12.37:g.112589913T>C	ENSP00000257604:p.Ser530Pro		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001143906	13	0.00	0	A8K5L6|B4DI89	Missense_Mutation	SNP	ENST00000257604.5	37	CCDS9160.1	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.476284	0.01035	.	.	ENSG00000135148	ENST00000412615;ENST00000257604	T;T	0.28895	1.59;1.59	6.16	3.39	0.38822	.	0.321128	0.30473	N	0.009558	T	0.05777	0.0151	N	0.00210	-1.845	0.22552	N	0.998992	B	0.02656	0.0	B	0.04013	0.001	T	0.39981	-0.9587	10	0.02654	T	1	-4.6778	8.4145	0.32664	0.0:0.7603:0.0:0.2397	.	530	O14545	TRAD1_HUMAN	P	530	ENSP00000396526:S530P;ENSP00000257604:S530P	ENSP00000257604:S530P	S	+	1	0	TRAFD1	111074296	0.020000	0.18652	0.134000	0.22075	0.082000	0.17680	-0.670000	0.05256	0.493000	0.27837	-0.137000	0.14449	TCC			0.552	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405214.1		NM_006700	
NOC4L	79050	mdanderson.org	37	12	132632486	132632486	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr12:132632486G>T	ENST00000330579.1	+	6	706	c.665G>T	c.(664-666)cGg>cTg	p.R222L	NOC4L_ENST00000535343.1_3'UTR|NOC4L_ENST00000538784.1_5'Flank	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	222					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CTGCCCCGCCGGGAGCCCACC	0.692																																					p.R222L													.	.			0			c.G665T												22.0	23.0	23.0					12																	132632486		2192	4294	6486	SO:0001583	missense	79050	exon6			CCCGCCGGGAGCC		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.665G>T	12.37:g.132632486G>T	ENSP00000328854:p.Arg222Leu		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_024078	22	0.00	0	Q8N2S5|Q96I14	Missense_Mutation	SNP	ENST00000330579.1	37	CCDS9277.1	.	.	.	.	.	.	.	.	.	.	a	7.964	0.747577	0.15710	.	.	ENSG00000184967	ENST00000330579;ENST00000541954	T;T	0.34275	1.37;1.37	4.78	0.669	0.17918	.	0.257899	0.39341	N	0.001390	T	0.14657	0.0354	N	0.08118	0	0.80722	D	1	B	0.11235	0.004	B	0.14023	0.01	T	0.07309	-1.0779	10	0.29301	T	0.29	-18.6077	4.2733	0.10797	0.5447:0.1688:0.2865:0.0	.	222	Q9BVI4	NOC4L_HUMAN	L	222;189	ENSP00000328854:R222L;ENSP00000438255:R189L	ENSP00000328854:R222L	R	+	2	0	NOC4L	131198439	0.967000	0.33354	0.297000	0.24988	0.126000	0.20510	1.044000	0.30329	-0.094000	0.12374	-0.459000	0.05422	CGG			0.692	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398999.1		NM_024078	
RP11-146E13.4	0	broad.mit.edu	37	14	19857036	19857036	+	lincRNA	SNP	A	A	G	rs374719458		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr14:19857036A>G	ENST00000548109.1	+	0	72																											CTGGATAATAAAGTTCATCTC	0.373																																					.													.	.			0			.																																											0	.			ATAATAAAGTTCA																													14.37:g.19857036A>G			Somatic	50	0.02	1		WXS	Illumina HiSeq	Phase_I	56	0.13	7	.	2	0.00	0		RNA	SNP	ENST00000548109.1	37																																																																																						0.373	RP11-146E13.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409408.1			
RPS6KL1	83694	mdanderson.org	37	14	75378050	75378050	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr14:75378050G>A	ENST00000555647.1	-	7	852	c.565C>T	c.(565-567)Cgg>Tgg	p.R189W	RPS6KL1_ENST00000557413.1_Missense_Mutation_p.R189W|RPS6KL1_ENST00000354625.2_Missense_Mutation_p.R158W|RPS6KL1_ENST00000554900.1_5'Flank|RPS6KL1_ENST00000358328.4_Missense_Mutation_p.R189W			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		ATGGTCAGCCGCTCCCTGCTC	0.617																																					p.R189W													.	.			0			c.C565T												103.0	91.0	95.0					14																	75378050		2203	4300	6503	SO:0001583	missense	83694	exon6			TCAGCCGCTCCCT	BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.565C>T	14.37:g.75378050G>A	ENSP00000452027:p.Arg189Trp		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_031464	0		0	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Missense_Mutation	SNP	ENST00000555647.1	37	CCDS9834.2	.	.	.	.	.	.	.	.	.	.	G	35	5.439982	0.96168	.	.	ENSG00000198208	ENST00000555647;ENST00000354625;ENST00000557413;ENST00000358328	T;T;T;T	0.08282	3.11;3.11;3.11;3.11	5.72	5.72	0.89469	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.234091	0.38492	N	0.001662	T	0.30947	0.0781	M	0.80183	2.485	0.54753	D	0.999988	D;D;D	0.76494	0.998;0.999;0.999	P;P;D	0.69824	0.762;0.857;0.966	T	0.01326	-1.1384	10	0.72032	D	0.01	-30.497	15.4725	0.75449	0.0:0.0:0.8608:0.1392	.	189;189;158	Q9Y6S9;Q9Y6S9-4;Q9Y6S9-2	RPKL1_HUMAN;.;.	W	189;158;189;189	ENSP00000452027:R189W;ENSP00000346644:R158W;ENSP00000450567:R189W;ENSP00000351086:R189W	ENSP00000346644:R158W	R	-	1	2	RPS6KL1	74447803	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.396000	0.73234	2.692000	0.91855	0.561000	0.74099	CGG			0.617	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413732.1			
DIO2	1734	broad.mit.edu	37	14	80669620	80669620	+	Silent	SNP	A	A	C			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr14:80669620A>C	ENST00000557010.1	-	4	619	c.234T>G	c.(232-234)ggT>ggG	p.G78G	DIO2_ENST00000422005.3_Silent_p.G78G|DIO2_ENST00000555750.1_Silent_p.G114G|DIO2_ENST00000557125.1_Intron|DIO2_ENST00000438257.4_Silent_p.G78G	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	78					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		GGGCATCCTCACCCAATTTCA	0.423																																					.													.	DIO2	73		0			.												23.0	23.0	23.0					14																	80669620		1932	4131	6063	SO:0001819	synonymous_variant	1734	.			ATCCTCACCCAAT	AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.234T>G	14.37:g.80669620A>C			Somatic	162	0.1913580247	31		WXS	Illumina HiSeq	Phase_I	204	0.19	38	.	0		0	B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Silent	SNP	ENST00000557010.1	37	CCDS45146.1																																																																																					0.423	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000413428.2			
CHGA	1113	broad.mit.edu;mdanderson.org	37	14	93399135	93399135	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr14:93399135A>G	ENST00000216492.5	+	7	1509	c.1229A>G	c.(1228-1230)cAg>cGg	p.Q410R	CHGA_ENST00000334654.4_Missense_Mutation_p.Q259R	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	410					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		CTGCCCCTCCAGGTCCGAGGC	0.711																																					p.Q410R	Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)												.	CHGA	32		0			c.A1229G												12.0	14.0	13.0					14																	93399135		2183	4275	6458	SO:0001583	missense	1113	exon7			CCCTCCAGGTCCG		CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.1229A>G	14.37:g.93399135A>G	ENSP00000216492:p.Gln410Arg		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	77	0.06	5	NM_001275	2	0.00	0	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	37	CCDS9906.1	.	.	.	.	.	.	.	.	.	.	A	0.401	-0.918462	0.02396	.	.	ENSG00000100604	ENST00000216492;ENST00000334654	T;T	0.01705	4.68;4.68	4.32	-2.4	0.06583	.	1.106060	0.06935	N	0.811682	T	0.02380	0.0073	L	0.57536	1.79	0.09310	N	1	B;B	0.16603	0.018;0.0	B;B	0.16289	0.015;0.001	T	0.45411	-0.9263	10	0.24483	T	0.36	-3.6738	7.8018	0.29178	0.2438:0.4903:0.266:0.0	.	259;410	G5E968;P10645	.;CMGA_HUMAN	R	410;259	ENSP00000216492:Q410R;ENSP00000334023:Q259R	ENSP00000216492:Q410R	Q	+	2	0	CHGA	92468888	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.886000	0.04157	-1.149000	0.02843	0.459000	0.35465	CAG			0.711	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412411.1		NM_001275	
AHNAK2	113146	broad.mit.edu	37	14	105406606	105406606	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr14:105406606G>T	ENST00000333244.5	-	7	15301	c.15182C>A	c.(15181-15183)aCa>aAa	p.T5061K	AHNAK2_ENST00000557457.1_Missense_Mutation_p.T59K	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5061						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCTTTTCTGTGTCTTGAAA	0.557																																					p.T5061K													.	AHNAK2	719		0			c.C15182A												108.0	114.0	112.0					14																	105406606		2052	4189	6241	SO:0001583	missense	113146	exon7			TTTTCTGTGTCTT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.15182C>A	14.37:g.105406606G>T	ENSP00000353114:p.Thr5061Lys		Somatic	230	0	0		WXS	Illumina HiSeq	Phase_I	212	0.03	6	NM_138420	1	0.00	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461897	0.26248	.	.	ENSG00000185567	ENST00000557457;ENST00000333244	T;T	0.01838	4.61;5.37	2.49	0.478	0.16789	.	.	.	.	.	T	0.01523	0.0049	L	0.38531	1.155	0.09310	N	1	P	0.38020	0.615	B	0.34779	0.189	T	0.35201	-0.9798	9	0.06365	T	0.9	.	3.2291	0.06742	0.3172:0.2549:0.4279:0.0	.	5061	Q8IVF2	AHNK2_HUMAN	K	59;5061	ENSP00000450998:T59K;ENSP00000353114:T5061K	ENSP00000353114:T5061K	T	-	2	0	AHNAK2	104477651	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.572000	0.05881	-0.033000	0.13736	0.561000	0.74099	ACA			0.557	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000410300.1		NM_138420	
Unknown	0	bcgsc.ca	37	15	23469716	23469716	+	IGR	SNP	G	G	A	rs62001522		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr15:23469716G>A								GOLGA8EP (21296 upstream) : RP11-566K19.9 (104243 downstream)																							TGGAGAGGAGGCCACGGGAAC	0.612																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	646507	.			GAGGAGGCCACGG																													15.37:g.23469716G>A			Somatic	35	0.0285714286	1		WXS	Illumina HiSeq	Phase_1	38	0.26	10	.	0		0		RNA	SNP		37																																																																																					0	0.612										
DISP2	85455	mdanderson.org	37	15	40661845	40661845	+	Missense_Mutation	SNP	A	A	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr15:40661845A>T	ENST00000267889.3	+	8	3619	c.3532A>T	c.(3532-3534)Acc>Tcc	p.T1178S	RP11-64K12.4_ENST00000558421.1_RNA|LINC00594_ENST00000561261.1_lincRNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	1178					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CAGCTTTGACACCAGCACAGC	0.662																																					p.T1178S													.	.			0			c.A3532T												69.0	77.0	74.0					15																	40661845		2203	4300	6503	SO:0001583	missense	85455	exon8			TTTGACACCAGCA	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.3532A>T	15.37:g.40661845A>T	ENSP00000267889:p.Thr1178Ser		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_033510	0		0	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	37	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.094188	0.56075	.	.	ENSG00000140323	ENST00000267889	T	0.11821	2.74	5.5	5.5	0.81552	.	0.155728	0.56097	D	0.000035	T	0.11410	0.0278	N	0.24115	0.695	0.26714	N	0.970919	B	0.29988	0.264	B	0.31101	0.124	T	0.18147	-1.0346	10	0.31617	T	0.26	-27.5825	15.7778	0.78236	1.0:0.0:0.0:0.0	.	1178	A7MBM2	DISP2_HUMAN	S	1178	ENSP00000267889:T1178S	ENSP00000267889:T1178S	T	+	1	0	DISP2	38449137	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.969000	0.76092	2.313000	0.78055	0.454000	0.30748	ACC			0.662	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252249.1		NM_033510	
PLEKHO2	80301	mdanderson.org	37	15	65157774	65157774	+	Missense_Mutation	SNP	G	G	A	rs151003394		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr15:65157774G>A	ENST00000323544.4	+	6	1288	c.1160G>A	c.(1159-1161)cGc>cAc	p.R387H	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	387										NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						TTCCATCCCCGCTGCTCCTCC	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19269	0.0		0.0	False		,,,				2504	0.0				p.R387H													.	.			0			c.G1160A							G	HIS/ARG,HIS/ARG	17,4387	24.3+/-50.5	0,17,2185	67.0	66.0	66.0		1010,1160	5.3	1.0	15	dbSNP_134	66	0,8598		0,0,4299	yes	missense,missense	PLEKHO2	NM_001195059.1,NM_025201.4	29,29	0,17,6484	AA,AG,GG		0.0,0.386,0.1307	probably-damaging,probably-damaging	337/441,387/491	65157774	17,12985	2202	4299	6501	SO:0001583	missense	80301	exon6			ATCCCCGCTGCTC	AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.1160G>A	15.37:g.65157774G>A	ENSP00000326706:p.Arg387His		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_025201	29	0.00	0	Q7L4H4|Q8WYS8	Missense_Mutation	SNP	ENST00000323544.4	37	CCDS10196.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	17.22	3.334592	0.60853	0.00386	0.0	ENSG00000241839	ENST00000323544	T	0.52754	0.65	5.35	5.35	0.76521	.	0.060012	0.64402	D	0.000012	T	0.59348	0.2187	L	0.34521	1.04	0.47659	D	0.999483	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.62196	-0.6905	10	0.72032	D	0.01	.	16.2526	0.82494	0.0:0.0:1.0:0.0	.	337;387	Q8TD55-2;Q8TD55	.;PKHO2_HUMAN	H	387	ENSP00000326706:R387H	ENSP00000326706:R387H	R	+	2	0	PLEKHO2	62944827	1.000000	0.71417	1.000000	0.80357	0.191000	0.23601	5.835000	0.69368	2.496000	0.84212	0.561000	0.74099	CGC	0.002		0.647	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256659.1		NM_025201	
LMAN1L	79748	mdanderson.org	37	15	75108636	75108636	+	Missense_Mutation	SNP	G	G	T	rs3803568	byFrequency	TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr15:75108636G>T	ENST00000309664.5	+	2	453	c.314G>T	c.(313-315)cGg>cTg	p.R105L	LMAN1L_ENST00000379709.3_Missense_Mutation_p.R105L	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	105	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.		R -> Q (in dbSNP:rs3803568).			integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTGGGGCGCCGGGGAGCCCAG	0.677																																					p.R105L													.	.			0			c.G314T												28.0	30.0	29.0					15																	75108636		2196	4296	6492	SO:0001583	missense	79748	exon2			GGCGCCGGGGAGC	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.314G>T	15.37:g.75108636G>T	ENSP00000310431:p.Arg105Leu		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_021819	0		0	Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	37	CCDS10270.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942384	0.34283	.	.	ENSG00000140506	ENST00000309664;ENST00000456603;ENST00000379709	T;T	0.56941	0.43;0.43	5.49	2.3	0.28687	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.813563	0.11162	N	0.592908	T	0.20861	0.0502	N	0.01771	-0.73	0.34184	P	0.32874499999999995	B;B;B;B	0.15473	0.002;0.011;0.002;0.013	B;B;B;B	0.13407	0.006;0.005;0.009;0.009	T	0.33369	-0.9871	9	0.09084	T	0.74	.	5.6607	0.17667	0.0957:0.0:0.4834:0.4208	.	33;105;33;105	B4DGW5;Q9HAT1-3;B4DU67;Q9HAT1	.;.;.;LMA1L_HUMAN	L	105;33;105	ENSP00000310431:R105L;ENSP00000369031:R105L	ENSP00000310431:R105L	R	+	2	0	LMAN1L	72895689	0.021000	0.18746	0.983000	0.44433	0.639000	0.38242	-0.077000	0.11394	0.687000	0.31509	0.484000	0.47621	CGG			0.677	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286397.4			
IQGAP1	8826	hgsc.bcm.edu;broad.mit.edu	37	15	91037943	91037944	+	Splice_Site	DEL	AG	AG	-			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr15:91037943_91037944delAG	ENST00000268182.5	+	36	4752		c.e36-1		IQGAP1_ENST00000560738.1_Splice_Site	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1						cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGATTTTTACAGAGTCTCCAAA	0.356																																					.													.	IQGAP1	140		0			.																																									SO:0001630	splice_region_variant	8826	.			TTTTACAGAGTCT	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.4629-1AG>-	15.37:g.91037945_91037946delAG			Somatic	189	0	0		WXS	Illumina HiSeq	.	162	0.07	12	.	0		0	A7MBM3	Splice_Site	DEL	ENST00000268182.5	37	CCDS10362.1																																																																																					0.356	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313493.1		NM_003870	Intron
ZNF646	9726	mdanderson.org	37	16	31087875	31087875	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr16:31087875G>T	ENST00000394979.2	+	1	653	c.230G>T	c.(229-231)tGt>tTt	p.C77F	ZNF646_ENST00000300850.5_Missense_Mutation_p.C77F|ZNF668_ENST00000300849.4_5'Flank|ZNF668_ENST00000564456.1_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	77					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CTTTTCCCCTGTACCACCTGT	0.642																																					p.C77F													.	.			0			c.G230T												94.0	58.0	70.0					16																	31087875		2197	4300	6497	SO:0001583	missense	9726	exon2			TCCCCTGTACCAC	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.230G>T	16.37:g.31087875G>T	ENSP00000378429:p.Cys77Phe		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_014699	2	0.00	0	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	G	21.2	4.105951	0.77096	.	.	ENSG00000167395	ENST00000428260;ENST00000300850;ENST00000394979	D;D;D	0.99974	-10.2;-10.2;-10.2	5.9	5.9	0.94986	.	.	.	.	.	D	0.99975	0.9992	M	0.86097	2.795	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	D	0.95816	0.8845	9	0.87932	D	0	-3.3593	19.0437	0.93011	0.0:0.0:1.0:0.0	.	77	O15015-2	.	F	77	ENSP00000391271:C77F;ENSP00000300850:C77F;ENSP00000378429:C77F	ENSP00000300850:C77F	C	+	2	0	ZNF646	30995376	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.500000	0.97977	2.793000	0.96121	0.563000	0.77884	TGT			0.642	ZNF646-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000108510.2		NM_014699	
TNFSF12	8742	mdanderson.org	37	17	7460571	7460571	+	Silent	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr17:7460571G>T	ENST00000293825.6	+	7	917	c.654G>T	c.(652-654)ctG>ctT	p.L218L	TNFSF13_ENST00000380535.4_5'Flank|TNFSF13_ENST00000338784.4_5'Flank|TNFSF13_ENST00000396545.4_5'Flank|TNFSF13_ENST00000349228.4_5'Flank|TNFSF13_ENST00000483039.1_5'Flank|TNFSF13_ENST00000396542.1_5'Flank|TNFSF12-TNFSF13_ENST00000293826.4_Intron|TNFSF12_ENST00000557233.1_Intron|TNFSF12_ENST00000462811.1_3'UTR	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	218					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				TGTTGGCCCTGCGGCCAGGGT	0.677																																					p.L218L													.	.			0			c.G654T												50.0	45.0	47.0					17																	7460571		2203	4299	6502	SO:0001819	synonymous_variant	8742	exon7			GGCCCTGCGGCCA	AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.654G>T	17.37:g.7460571G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_003809	56	0.00	0	Q8IZK7|Q8WUZ7	Silent	SNP	ENST00000293825.6	37	CCDS11109.1																																																																																					0.677	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226951.2		NM_003809	
TEKT3	64518	broad.mit.edu	37	17	15217536	15217536	+	Missense_Mutation	SNP	G	G	T	rs143711449		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr17:15217536G>T	ENST00000395930.1	-	6	932	c.746C>A	c.(745-747)gCg>gAg	p.A249E	TEKT3_ENST00000338696.2_Missense_Mutation_p.A249E|RNU6-799P_ENST00000363567.1_RNA	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	249					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		ATGCTGGGACGCTCTGTTGGC	0.547																																					p.A249E													TEKT3,NS,adenocarcinoma,+1,1	TEKT3	64	1	0			c.C746A												164.0	105.0	125.0					17																	15217536		2203	4300	6503	SO:0001583	missense	64518	exon6			TGGGACGCTCTGT	AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.746C>A	17.37:g.15217536G>T	ENSP00000379263:p.Ala249Glu		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	98	0.05	5	NM_031898	0		0	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	ENST00000395930.1	37	CCDS11169.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752704	0.49362	.	.	ENSG00000125409	ENST00000395930;ENST00000338696;ENST00000539245	T;T;T	0.02301	4.35;4.35;4.35	5.43	5.43	0.79202	.	0.092996	0.64402	D	0.000001	T	0.03871	0.0109	L	0.35288	1.05	0.45791	D	0.998677	B	0.25235	0.121	B	0.37833	0.259	T	0.58255	-0.7668	10	0.30078	T	0.28	-13.9888	15.5813	0.76445	0.0:0.0:0.8618:0.1382	.	249	Q9BXF9	TEKT3_HUMAN	E	249;249;83	ENSP00000379263:A249E;ENSP00000343995:A249E;ENSP00000443280:A83E	ENSP00000343995:A249E	A	-	2	0	TEKT3	15158261	1.000000	0.71417	0.947000	0.38551	0.750000	0.42670	3.759000	0.55227	2.549000	0.85964	0.655000	0.94253	GCG			0.547	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130385.2		NM_031898	
FMNL1	752	mdanderson.org	37	17	43321261	43321261	+	Missense_Mutation	SNP	C	C	T	rs371426654		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr17:43321261C>T	ENST00000331495.3	+	18	2653	c.2317C>T	c.(2317-2319)Cgg>Tgg	p.R773W	CTD-2020K17.4_ENST00000420431.2_RNA|FMNL1_ENST00000328118.3_Missense_Mutation_p.R773W|FMNL1_ENST00000587489.1_Missense_Mutation_p.R351W|CTD-2020K17.3_ENST00000393507.2_RNA|CTD-2020K17.3_ENST00000587534.1_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	773	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						GCGGGAGCAGCGGCCAATGGA	0.637																																					p.R773W	GBM(164;1247 1997 8702 11086 51972)												.	.			0			c.C2317T							C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	58.0	58.0	58.0		2317	1.9	1.0	17		58	0,8600		0,0,4300	no	missense	FMNL1	NM_005892.3	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	773/1101	43321261	1,13005	2203	4300	6503	SO:0001583	missense	752	exon18			GAGCAGCGGCCAA	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.2317C>T	17.37:g.43321261C>T	ENSP00000329219:p.Arg773Trp		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_005892	42	0.00	0	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Missense_Mutation	SNP	ENST00000331495.3	37	CCDS11497.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886197	0.51908	2.27E-4	0.0	ENSG00000184922	ENST00000328118;ENST00000331495;ENST00000539884	T;T	0.63913	-0.07;-0.07	4.19	1.94	0.25998	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.189522	0.41194	D	0.000922	T	0.75715	0.3887	M	0.79475	2.455	0.44295	D	0.997166	D	0.89917	1.0	D	0.74348	0.983	T	0.78378	-0.2227	10	0.87932	D	0	.	10.9357	0.47243	0.4418:0.5582:0.0:0.0	.	773	O95466	FMNL_HUMAN	W	773;773;428	ENSP00000327442:R773W;ENSP00000329219:R773W	ENSP00000327442:R773W	R	+	1	2	FMNL1	40677044	0.090000	0.21635	0.998000	0.56505	0.456000	0.32438	-0.169000	0.09911	1.065000	0.40693	0.462000	0.41574	CGG			0.637	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450198.1		NM_005892	
UBE2Z	65264	mdanderson.org	37	17	46985927	46985927	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr17:46985927C>T	ENST00000360943.5	+	1	197	c.62C>T	c.(61-63)gCg>gTg	p.A21V	RP11-463M16.4_ENST00000508743.1_RNA	NM_023079.4	NP_075567.2	Q9H832	UBE2Z_HUMAN	ubiquitin-conjugating enzyme E2Z	21					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)										ggccccggggcgagcagcgtt	0.761																																					p.A21V													.	.			0			c.C62T												1.0	3.0	2.0					17																	46985927		805	1798	2603	SO:0001583	missense	65264	exon1			CCGGGGCGAGCAG	BC015890	CCDS11540.2	17q21.32	2010-01-14	2007-07-18		ENSG00000159202	ENSG00000159202		"""Ubiquitin-conjugating enzymes E2"""	25847	protein-coding gene	gene with protein product	"""UBA6-specific enzyme E2"""	611362				17597759	Standard	NM_023079		Approved	FLJ13855, USE1	uc002ioi.3	Q9H832	OTTHUMG00000150521	ENST00000360943.5:c.62C>T	17.37:g.46985927C>T	ENSP00000354201:p.Ala21Val		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_023079	2	0.00	0	A6N8M6|A6NC60|Q7L354|Q8TCM4|Q9H893	Missense_Mutation	SNP	ENST00000360943.5	37	CCDS11540.2	.	.	.	.	.	.	.	.	.	.	c	15.51	2.855386	0.51376	.	.	ENSG00000159202	ENST00000360943;ENST00000508468	T	0.74002	-0.8	1.76	1.76	0.24704	.	.	.	.	.	T	0.51210	0.1661	N	0.19112	0.55	0.24389	N	0.994753	B	0.28801	0.223	B	0.11329	0.006	T	0.31052	-0.9957	9	0.07325	T	0.83	.	9.0348	0.36280	0.0:1.0:0.0:0.0	.	21	Q9H832	UBE2Z_HUMAN	V	21	ENSP00000354201:A21V	ENSP00000354201:A21V	A	+	2	0	UBE2Z	44340926	0.996000	0.38824	0.940000	0.37924	0.573000	0.36030	1.503000	0.35715	1.327000	0.45338	0.282000	0.19409	GCG			0.761	UBE2Z-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318724.2		NM_023079	
SMCHD1	23347	mdanderson.org	37	18	2705754	2705754	+	Silent	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr18:2705754C>T	ENST00000320876.6	+	14	2243	c.1905C>T	c.(1903-1905)ggC>ggT	p.G635G	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Silent_p.G635G	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	635					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TTCTTTATGGCGATCATGATG	0.323																																					p.G635G													SMCHD1,NS,carcinoma,0,3	SMCHD1	0	3	0			c.C1905T												78.0	76.0	77.0					18																	2705754		1850	4079	5929	SO:0001819	synonymous_variant	23347	exon14			TTATGGCGATCAT	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.1905C>T	18.37:g.2705754C>T			Somatic	49	0.0204081633	1		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_015295	2	0.00	0	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	ENST00000320876.6	37	CCDS45822.1																																																																																					0.323	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441082.2			
INO80C	125476	broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	33060445	33060445	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr18:33060445G>T	ENST00000334598.7	-	2	355	c.239C>A	c.(238-240)cCt>cAt	p.P80H	RP11-322E11.6_ENST00000589258.1_Intron|INO80C_ENST00000441607.2_Missense_Mutation_p.P116H|INO80C_ENST00000586489.1_Missense_Mutation_p.P25H|INO80C_ENST00000590757.1_Intron|INO80C_ENST00000592173.1_Missense_Mutation_p.P80H	NM_194281.3	NP_919257.2	Q6PI98	IN80C_HUMAN	INO80 complex subunit C	80					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)				central_nervous_system(1)|endometrium(1)|lung(3)|prostate(2)|skin(1)	8						AAATGGCAAAGGTTTGGCAGC	0.433																																					p.P116H													.	INO80C	18		0			c.C347A												172.0	157.0	162.0					18																	33060445		2203	4300	6503	SO:0001583	missense	125476	exon4			GGCAAAGGTTTGG		CCDS11914.1, CCDS45853.1	18q12.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000153391	ENSG00000153391		"""INO80 complex subunits"""	26994	protein-coding gene	gene with protein product	"""IES6 homolog (S. cerevisiae)"""		"""chromosome 18 open reading frame 37"""	C18orf37		16230350	Standard	NM_001098817		Approved	FLJ38183, hIes6, IES6	uc010dmt.3	Q6PI98	OTTHUMG00000132564	ENST00000334598.7:c.239C>A	18.37:g.33060445G>T	ENSP00000334473:p.Pro80His		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	107	0.06	6	NM_001098817	23	0.00	0	B4DUI4|E9PCS7|Q86WR1|Q8N994	Missense_Mutation	SNP	ENST00000334598.7	37	CCDS11914.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116733	0.77323	.	.	ENSG00000153391	ENST00000283410;ENST00000441607;ENST00000334598	.	.	.	6.02	6.02	0.97574	.	0.125407	0.56097	D	0.000040	T	0.69940	0.3167	L	0.46157	1.445	0.41265	D	0.986803	D;D;D	0.89917	0.999;0.997;1.0	D;P;D	0.69479	0.921;0.846;0.964	T	0.70945	-0.4734	9	0.72032	D	0.01	.	16.0374	0.80640	0.0:0.0:1.0:0.0	.	116;80;80	E9PCS7;Q6PI98;Q6PI98-3	.;IN80C_HUMAN;.	H	80;116;80	.	ENSP00000283410:P80H	P	-	2	0	INO80C	31314443	1.000000	0.71417	0.961000	0.40146	0.932000	0.56968	5.028000	0.64115	2.857000	0.98124	0.650000	0.86243	CCT			0.433	INO80C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255768.1		NM_194281	
DNMT1	1786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10291231	10291231	+	Silent	SNP	A	A	G			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:10291231A>G	ENST00000340748.4	-	4	475	c.240T>C	c.(238-240)gcT>gcC	p.A80A	DNMT1_ENST00000359526.4_Silent_p.A80A|DNMT1_ENST00000540357.1_Silent_p.A80A			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	80	DMAP-interaction.|Interaction with DMAP1.|Interaction with DNMT3A.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	ATTTGACTTTAGCCAGGTAGC	0.418																																					p.A80A													.	.			0			c.T240C												90.0	93.0	92.0					19																	10291231		2203	4300	6503	SO:0001819	synonymous_variant	1786	exon4			GACTTTAGCCAGG	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.240T>C	19.37:g.10291231A>G			Somatic	90	0	0		WXS	Illumina HiSeq	.	61	0.13	8	NM_001130823	0		0	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	37	CCDS12228.1																																																																																					0.418	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451166.1		NM_001379	
SMARCA4	6597	mdanderson.org	37	19	11097625	11097625	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:11097625C>T	ENST00000429416.3	+	6	1086	c.805C>T	c.(805-807)Ccc>Tcc	p.P269S	SMARCA4_ENST00000450717.3_Missense_Mutation_p.P269S|SMARCA4_ENST00000444061.3_Missense_Mutation_p.P269S|SMARCA4_ENST00000413806.3_Missense_Mutation_p.P269S|SMARCA4_ENST00000358026.2_Missense_Mutation_p.P269S|SMARCA4_ENST00000541122.2_Missense_Mutation_p.P269S|SMARCA4_ENST00000344626.4_Missense_Mutation_p.P269S|SMARCA4_ENST00000590574.1_Missense_Mutation_p.P269S|SMARCA4_ENST00000589677.1_Missense_Mutation_p.P269S	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	269	Necessary for interaction with SS18L1/CREST. {ECO:0000250}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.P270fs*16(1)|p.M272fs*31(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTCGGGCGTGCCCCCCGGGAT	0.632			"""F, N, Mis"""		NSCLC																																p.P269S				Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	.			3	Deletion - Frameshift(2)|Unknown(1)	lung(3)	c.C805T												44.0	47.0	46.0					19																	11097625		2203	4299	6502	SO:0001583	missense	6597	exon5			GGCGTGCCCCCCG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.805C>T	19.37:g.11097625C>T	ENSP00000395654:p.Pro269Ser		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_003072	0		0	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.901060	0.72754	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	D	0.89684	0.6786	L	0.40543	1.245	0.54753	D	0.999986	P;P;P;D;P;P;P	0.63880	0.516;0.516;0.516;0.993;0.516;0.759;0.516	B;B;B;D;B;B;B	0.70227	0.245;0.245;0.245;0.968;0.245;0.245;0.245	D	0.88742	0.3244	10	0.35671	T	0.21	-29.135	15.5536	0.76173	0.0:1.0:0.0:0.0	.	269;269;269;269;269;269;269	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	S	269	ENSP00000395654:P269S;ENSP00000350720:P269S;ENSP00000343896:P269S;ENSP00000445036:P269S;ENSP00000392837:P269S;ENSP00000397783:P269S;ENSP00000414727:P269S	ENSP00000343896:P269S	P	+	1	0	SMARCA4	10958625	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.750000	0.55157	2.195000	0.70347	0.462000	0.41574	CCC			0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000452638.2		NM_003072	
INSL3	3640	mdanderson.org	37	19	17927833	17927833	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:17927833G>T	ENST00000317306.7	-	2	242	c.226C>A	c.(226-228)Ctc>Atc	p.L76I	INSL3_ENST00000379695.5_Nonsense_Mutation_p.C107*	NM_005543.3	NP_005534.2	P51460	INSL3_HUMAN	insulin-like 3 (Leydig cell)	76					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)	insulin receptor binding (GO:0005158)|protease binding (GO:0002020)|receptor binding (GO:0005102)			breast(1)|lung(1)	2						AGCCCATGGAGCAGATGTCGT	0.612																																					p.C107X													.	.			0			c.C321A												72.0	56.0	61.0					19																	17927833		2203	4300	6503	SO:0001583	missense	3640	exon3			CATGGAGCAGATG		CCDS12365.1, CCDS58655.1	19p13.2-p12	2013-02-26	2003-05-13			ENSG00000248099		"""Endogenous ligands"""	6086	protein-coding gene	gene with protein product	"""prepro-INSL3"""	146738	"""relaxin-like factor"""	RLNL		8020942	Standard	NM_001265587		Approved	RLF, MGC119818, MGC119819	uc010ebf.2	P51460		ENST00000317306.7:c.226C>A	19.37:g.17927833G>T	ENSP00000321724:p.Leu76Ile		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001265587	8	0.00	0	B4DZ72|G3XAG0|Q3KPI5|Q3KPI6|Q6YNB5|Q9UEA2|Q9UPH6	Nonsense_Mutation	SNP	ENST00000317306.7	37	CCDS12365.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.02|10.02	1.235430|1.235430	0.22626|0.22626	.|.	.|.	ENSG00000248099|ENSG00000248099	ENST00000379695|ENST00000317306	.|T	.|0.69561	.|-0.41	3.73|3.73	2.69|2.69	0.31865|0.31865	.|Insulin-like (3);	5.026540|.	0.02089|.	N|.	0.053016|.	.|T	.|0.66636	.|0.2809	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999995|0.999995	.|P	.|0.43352	.|0.804	.|P	.|0.50136	.|0.632	.|T	.|0.65100	.|-0.6250	.|9	0.45353|0.56958	T|D	0.12|0.05	.|.	6.9744|6.9744	0.24666|0.24666	0.128:0.0:0.872:0.0|0.128:0.0:0.872:0.0	.|.	.|76	.|P51460	.|INSL3_HUMAN	X|I	107|76	.|ENSP00000321724:L76I	ENSP00000369017:C107X|ENSP00000321724:L76I	C|L	-|-	3|1	2|0	INSL3|INSL3	17788833|17788833	0.941000|0.941000	0.31946|0.31946	0.170000|0.170000	0.22879|0.22879	0.020000|0.020000	0.10135|0.10135	0.338000|0.338000	0.19858|0.19858	0.806000|0.806000	0.34183|0.34183	0.449000|0.449000	0.29647|0.29647	TGC|CTC			0.612	INSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466836.1		NM_005543	
CPT1C	126129	mdanderson.org	37	19	50215119	50215119	+	Silent	SNP	G	G	A	rs375017702		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:50215119G>A	ENST00000392518.4	+	17	2292	c.1920G>A	c.(1918-1920)ctG>ctA	p.L640L	CPT1C_ENST00000354199.5_Intron|CPT1C_ENST00000598293.1_Silent_p.L640L|CPT1C_ENST00000405931.2_Silent_p.L629L|CPT1C_ENST00000323446.5_Silent_p.L640L	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	640					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		ACCAGGCTCTGCTGAAGGCAG	0.627																																					p.L640L													.	.			0			c.G1920A												95.0	79.0	85.0					19																	50215119		2203	4300	6503	SO:0001819	synonymous_variant	126129	exon17			GGCTCTGCTGAAG	AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.1920G>A	19.37:g.50215119G>A			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_001199752	4	0.00	0	A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Silent	SNP	ENST00000392518.4	37	CCDS12779.1																																																																																					0.627	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465873.1		NM_152359	
CLEC11A	6320	broad.mit.edu;mdanderson.org	37	19	51227265	51227265	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:51227265A>G	ENST00000250340.4	+	2	448	c.251A>G	c.(250-252)gAg>gGg	p.E84G	CLEC11A_ENST00000599973.1_Missense_Mutation_p.E84G	NM_002975.2	NP_002966.1	Q9Y240	CLC11_HUMAN	C-type lectin domain family 11, member A	84					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	7		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		gaccagggggaggaagaggag	0.617											OREG0025643	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E84G													.	CLEC11A	23		0			c.A251G												42.0	46.0	45.0					19																	51227265		2203	4300	6503	SO:0001583	missense	6320	exon2			AGGGGGAGGAAGA	AF087658	CCDS12800.1	19q13.3	2010-04-27	2005-02-09	2005-02-11		ENSG00000105472		"""C-type lectin domain containing"""	10576	protein-coding gene	gene with protein product		604713	"""stem cell growth factor; lymphocyte secreted C-type lectin"""	SCGF		9207134, 9442024	Standard	NM_002975		Approved	P47, LSLCL, CLECSF3	uc002psy.3	Q9Y240		ENST00000250340.4:c.251A>G	19.37:g.51227265A>G	ENSP00000250340:p.Glu84Gly		Somatic	119	0	0	975	WXS	Illumina HiSeq	Phase_I	89	0.06	5	NM_002975	2	0.00	0	B2RAD4	Missense_Mutation	SNP	ENST00000250340.4	37	CCDS12800.1	.	.	.	.	.	.	.	.	.	.	A	11.60	1.685735	0.29962	.	.	ENSG00000105472	ENST00000250340;ENST00000445858	T	0.51071	0.72	3.78	2.76	0.32466	.	1.255300	0.05554	N	0.568047	T	0.27134	0.0665	N	0.08118	0	0.09310	N	1	B	0.26635	0.155	B	0.21360	0.034	T	0.20806	-1.0264	10	0.33141	T	0.24	-4.4817	5.5834	0.17262	0.8723:0.0:0.1277:0.0	.	84	Q9Y240	CLC11_HUMAN	G	84	ENSP00000250340:E84G	ENSP00000250340:E84G	E	+	2	0	CLEC11A	55919077	1.000000	0.71417	0.039000	0.18376	0.285000	0.27093	2.023000	0.41040	0.649000	0.30751	0.379000	0.24179	GAG			0.617	CLEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464062.1		NM_002975	
ZNF616	90317	broad.mit.edu	37	19	52646132	52646133	+	5'Flank	INS	-	-	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:52646132_52646133insT	ENST00000600228.1	-	0	0				CTC-471J1.8_ENST00000594362.1_RNA|CTC-471J1.9_ENST00000597886.1_lincRNA|ZNF616_ENST00000596290.1_5'Flank|ZNF616_ENST00000597013.1_5'Flank	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		gcctgggagAAttttttttttt	0.45																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			GGGAGAATTTTTT	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1			19.37:g.52646143_52646143dupT	Exception_encountered		Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	3	0.00	0	B3KRV1|Q0P658|Q658V7	RNA	INS	ENST00000600228.1	37	CCDS33090.1																																																																																					0.450	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462451.1		XM_030892	
ZNF525	170958	broad.mit.edu	37	19	53879109	53879109	+	Silent	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:53879109G>A	ENST00000475179.1	+	3	216	c.102G>A	c.(100-102)agG>agA	p.R34R	ZNF525_ENST00000474037.1_Silent_p.R34R|ZNF525_ENST00000467003.1_5'UTR|ZNF525_ENST00000593918.1_Silent_p.R34R|ZNF525_ENST00000491101.1_Silent_p.R34R			Q8N782	ZN525_HUMAN	zinc finger protein 525	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R34R(6)		endometrium(3)|kidney(3)|lung(3)	9						CTCTATACAGGGACGTGATGC	0.473																																					.													.	ZNF525	35		6	Substitution - coding silent(6)	kidney(6)	.																																									SO:0001819	synonymous_variant	170958	.			ATACAGGGACGTG	AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000475179.1:c.102G>A	19.37:g.53879109G>A			Somatic	50	0.02	1		WXS	Illumina HiSeq	Phase_I	50	0.10	5	.	8	0.00	0	Q8TF23	Silent	SNP	ENST00000475179.1	37																																																																																						0.473	ZNF525-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000350553.1		NR_003699	
IL11	3589	mdanderson.org	37	19	55879667	55879667	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:55879667C>A	ENST00000264563.2	-	4	402	c.340G>T	c.(340-342)Gca>Tca	p.A114S	IL11_ENST00000585513.1_Missense_Mutation_p.A114S|IL11_ENST00000590625.1_Missense_Mutation_p.A35S	NM_000641.3	NP_000632.1	P20809	IL11_HUMAN	interleukin 11	114					B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|fat cell differentiation (GO:0045444)|megakaryocyte differentiation (GO:0030219)|negative regulation of hormone secretion (GO:0046888)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-11 receptor binding (GO:0005142)			large_intestine(1)|skin(1)	2	Breast(117;0.191)	Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GAGCCACCTGCCCGGCGCAGC	0.677																																					p.A114S													.	.			0			c.G340T												13.0	15.0	14.0					19																	55879667		2185	4281	6466	SO:0001583	missense	3589	exon4			CACCTGCCCGGCG	X58377	CCDS12923.1, CCDS59423.1	19q13.3-q13.4	2014-01-30			ENSG00000095752	ENSG00000095752		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5966	protein-coding gene	gene with protein product	"""adipogenesis inhibitory factor"", ""oprelvekin"""	147681				1386338	Standard	NM_001267718		Approved	IL-11, AGIF	uc002qks.2	P20809		ENST00000264563.2:c.340G>T	19.37:g.55879667C>A	ENSP00000264563:p.Ala114Ser		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_000641	0		0	B4DQV5|Q96EB4	Missense_Mutation	SNP	ENST00000264563.2	37	CCDS12923.1	.	.	.	.	.	.	.	.	.	.	c	8.408	0.843546	0.16963	.	.	ENSG00000095752	ENST00000264563	T	0.38560	1.13	4.0	1.76	0.24704	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.226029	0.36555	N	0.002524	T	0.21227	0.0511	N	0.19112	0.55	0.09310	N	1	B	0.15930	0.015	B	0.15484	0.013	T	0.21793	-1.0235	10	0.10111	T	0.7	-28.8478	6.9079	0.24319	0.172:0.7314:0.0:0.0966	.	114	P20809	IL11_HUMAN	S	114	ENSP00000264563:A114S	ENSP00000264563:A114S	A	-	1	0	IL11	60571479	0.001000	0.12720	0.073000	0.20177	0.045000	0.14185	0.199000	0.17237	0.451000	0.26802	0.650000	0.86243	GCA			0.677	IL11-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453027.1		NM_000641	
RPS5	6193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58904766	58904766	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr19:58904766G>T	ENST00000596046.1	+	3	1208	c.359G>T	c.(358-360)gGt>gTt	p.G120V	RPS5_ENST00000598495.1_Missense_Mutation_p.G141V|RPS5_ENST00000601521.1_Missense_Mutation_p.G120V|RPS5_ENST00000598098.1_Missense_Mutation_p.G50V|AC012313.1_ENST00000601382.1_5'Flank|RPS5_ENST00000196551.3_Missense_Mutation_p.G120V			P46782	RS5_HUMAN	ribosomal protein S5	120					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational fidelity (GO:0006450)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4		all_cancers(17;1.71e-22)|all_epithelial(17;1.69e-16)|Lung NSC(17;2.25e-06)|all_lung(17;9.97e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Breast(46;0.0194)|Ovarian(87;0.0443)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.171)|GBM - Glioblastoma multiforme(193;0.0323)|Lung(386;0.0543)|LUSC - Lung squamous cell carcinoma(496;0.176)		ATCAACAGTGGTCCCCGGGAG	0.622																																					p.G120V													.	.			0			c.G359T												107.0	88.0	95.0					19																	58904766		2203	4300	6503	SO:0001583	missense	6193	exon4			ACAGTGGTCCCCG	U14970	CCDS12978.1	19q13.4	2011-04-05				ENSG00000083845		"""S ribosomal proteins"""	10426	protein-coding gene	gene with protein product	"""40S ribosomal protein S5"""	603630				7772601, 9582194	Standard	NM_001009		Approved	S5	uc002qsn.3	P46782		ENST00000596046.1:c.359G>T	19.37:g.58904766G>T	ENSP00000472985:p.Gly120Val		Somatic	51	0	0		WXS	Illumina HiSeq	.	33	0.24	8	NM_001009	1930	0.29	568	B2R4T2|Q96BN0	Missense_Mutation	SNP	ENST00000596046.1	37	CCDS12978.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495169	0.64186	.	.	ENSG00000083845	ENST00000196551	.	.	.	4.78	4.78	0.61160	Ribosomal protein S7 domain (3);	0.000000	0.85682	D	0.000000	D	0.87672	0.6236	H	0.96805	3.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91805	0.5455	9	0.87932	D	0	-25.5175	15.6905	0.77446	0.0:0.0:1.0:0.0	.	120	P46782	RS5_HUMAN	V	120	.	ENSP00000196551:G120V	G	+	2	0	RPS5	63596578	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.383000	0.90157	2.389000	0.81357	0.655000	0.94253	GGT			0.622	RPS5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467016.1		NM_001009	
CEP68	23177	mdanderson.org	37	2	65299480	65299480	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr2:65299480C>A	ENST00000377990.2	+	3	1453	c.1250C>A	c.(1249-1251)gCc>gAc	p.A417D	CEP68_ENST00000546106.1_Missense_Mutation_p.A417D|CEP68_ENST00000260569.4_Missense_Mutation_p.A417D|CEP68_ENST00000537589.1_Missense_Mutation_p.A29D|CEP68_ENST00000497039.1_3'UTR|RAB1A_ENST00000494188.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	417					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						AGAGAGCCAGCCCTGAGGGGT	0.627																																					p.A417D													.	.			0			c.C1250A												63.0	62.0	62.0					2																	65299480		2203	4300	6503	SO:0001583	missense	23177	exon3			AGCCAGCCCTGAG	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1250C>A	2.37:g.65299480C>A	ENSP00000367229:p.Ala417Asp		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_015147	5	0.00	0	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	37	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048567	0.55110	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000537589;ENST00000260569;ENST00000545501	T;T;T;T	0.31247	2.1;2.15;1.5;2.16	5.26	3.46	0.39613	.	0.762984	0.12228	N	0.487759	T	0.49949	0.1587	M	0.72118	2.19	0.19575	N	0.999968	P;P;P;D;P	0.71674	0.919;0.815;0.919;0.998;0.919	P;B;P;D;P	0.64237	0.587;0.413;0.59;0.923;0.587	T	0.31138	-0.9954	10	0.62326	D	0.03	-2.4937	9.207	0.37296	0.0:0.8346:0.0:0.1654	.	405;417;417;417;417	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	D	417;417;29;417;405	ENSP00000367229:A417D;ENSP00000438306:A417D;ENSP00000443357:A29D;ENSP00000260569:A417D	ENSP00000260569:A417D	A	+	2	0	CEP68	65152984	0.000000	0.05858	0.053000	0.19242	0.711000	0.40976	0.136000	0.15974	0.789000	0.33779	0.591000	0.81541	GCC			0.627	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251727.2		NM_015147	
IGKV3D-11	28876	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	90212209	90212209	+	RNA	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr2:90212209G>A	ENST00000390277.2	+	0	398									immunoglobulin kappa variable 3D-11																		CCTAGAGCCTGAAGATTTTGC	0.502																																					.													.	.			0			.												75.0	79.0	78.0					2																	90212209		1911	4125	6036			0	.			GAGCCTGAAGATT	X17264		2p11.2	2012-02-08			ENSG00000211632	ENSG00000211632		"""Immunoglobulins / IGK locus"""	5823	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151563		2.37:g.90212209G>A			Somatic	227	0.0044052863	1		WXS	Illumina HiSeq	Phase_I	225	0.11	25	.	29	0.00	0		RNA	SNP	ENST00000390277.2	37																																																																																						0.502	IGKV3D-11-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000323138.2		NG_000833	
NCKAP5	344148	mdanderson.org	37	2	133543187	133543187	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr2:133543187G>T	ENST00000409261.1	-	14	1570	c.1197C>A	c.(1195-1197)agC>agA	p.S399R	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.S399R	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	399										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CCAAAATGTGGCTTTCCTTGA	0.418																																					p.S399R													NCKAP5,caecum,carcinoma,0,1	NCKAP5	0	1	0			c.C1197A												96.0	89.0	91.0					2																	133543187		1854	4099	5953	SO:0001583	missense	344148	exon14			AATGTGGCTTTCC	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1197C>A	2.37:g.133543187G>T	ENSP00000387128:p.Ser399Arg		Somatic	124	0.0080645161	1		WXS	Illumina HiSeq	Phase_I	85	0.05	4	NM_207363	0		0	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337445	0.60963	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.14766	2.48;2.48	5.24	1.51	0.23008	.	0.174998	0.26251	U	0.025441	T	0.19327	0.0464	L	0.29908	0.895	0.80722	D	1	D	0.63046	0.992	P	0.62813	0.907	T	0.00920	-1.1514	10	0.72032	D	0.01	.	8.7211	0.34441	0.2898:0.0:0.7102:0.0	.	399	O14513	NCKP5_HUMAN	R	399	ENSP00000387128:S399R;ENSP00000380603:S399R	ENSP00000380603:S399R	S	-	3	2	NCKAP5	133259657	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.483000	0.45233	0.098000	0.17522	0.650000	0.86243	AGC			0.418	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000331663.1		NM_207481	
CCDC173	129881	broad.mit.edu	37	2	170518895	170518895	+	Silent	SNP	T	T	C			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr2:170518895T>C	ENST00000447353.1	-	5	819	c.714A>G	c.(712-714)aaA>aaG	p.K238K		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	238																	CCTCAGCATCTTTTTCTTCAT	0.308																																					p.K238K													.	.			0			c.A714G												104.0	102.0	103.0					2																	170518895		1798	4061	5859	SO:0001819	synonymous_variant	129881	exon5			AGCATCTTTTTCT	BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.714A>G	2.37:g.170518895T>C			Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	143	0.03	4	NM_001085447	0		0	Q6PJF6	Silent	SNP	ENST00000447353.1	37	CCDS46445.1																																																																																					0.308	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333954.2		NM_001085447	
AOX1	316	broad.mit.edu;mdanderson.org	37	2	201467017	201467017	+	Silent	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr2:201467017C>T	ENST00000374700.2	+	6	688	c.447C>T	c.(445-447)tgC>tgT	p.C149C		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	149					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GTAACCTGTGCCGTTGCACTG	0.458																																					p.C149C													.	AOX1	152		0			c.C447T												185.0	162.0	170.0					2																	201467017		2203	4300	6503	SO:0001819	synonymous_variant	316	exon6			CCTGTGCCGTTGC	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.447C>T	2.37:g.201467017C>T			Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	109	0.05	5	NM_001159	0		0	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Silent	SNP	ENST00000374700.2	37	CCDS33360.1																																																																																					0.458	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335844.1		NM_001159	
VSTM2L	128434	mdanderson.org	37	20	36560151	36560151	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr20:36560151G>T	ENST00000373461.4	+	2	483	c.236G>T	c.(235-237)tGg>tTg	p.W79L	VSTM2L_ENST00000373458.3_Missense_Mutation_p.W79L|VSTM2L_ENST00000373459.4_Intron	NM_080607.2	NP_542174.1	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like	79	Ig-like.									central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(1)|skin(1)	8		Myeloproliferative disorder(115;0.00878)				ATCCAGTGGTGGTATGTACGG	0.657																																					p.W79L													VSTM2L,NS,carcinoma,0,1	VSTM2L	0	1	0			c.G236T												88.0	75.0	80.0					20																	36560151		2203	4300	6503	SO:0001583	missense	128434	exon2			AGTGGTGGTATGT	AL109964	CCDS13299.1	20q11.23	2013-01-11	2007-08-10	2007-08-10	ENSG00000132821	ENSG00000132821		"""Immunoglobulin superfamily / V-set domain containing"""	16096	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 102"""	C20orf102			Standard	NM_080607		Approved	dJ1118M15.2	uc002xhk.4	Q96N03	OTTHUMG00000032430	ENST00000373461.4:c.236G>T	20.37:g.36560151G>T	ENSP00000362560:p.Trp79Leu		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_080607	0		0	E1P5V7|Q5JWZ4|Q5JWZ5|Q8ND45|Q9BR37	Missense_Mutation	SNP	ENST00000373461.4	37	CCDS13299.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163013	0.78226	.	.	ENSG00000132821	ENST00000373458;ENST00000373461;ENST00000448944	T;T;T	0.63096	1.84;-0.02;1.84	4.66	4.66	0.58398	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.058540	0.64402	D	0.000001	T	0.79713	0.4493	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.80353	-0.1418	10	0.39692	T	0.17	-22.0236	16.8866	0.86077	0.0:0.0:1.0:0.0	.	79	Q96N03	VTM2L_HUMAN	L	79	ENSP00000362557:W79L;ENSP00000362560:W79L;ENSP00000406537:W79L	ENSP00000362557:W79L	W	+	2	0	VSTM2L	35993565	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.564000	0.98151	2.294000	0.77228	0.484000	0.47621	TGG			0.657	VSTM2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079133.1			
WISP2	8839	mdanderson.org	37	20	43348565	43348565	+	Missense_Mutation	SNP	T	T	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr20:43348565T>A	ENST00000372868.2	+	3	431	c.88T>A	c.(88-90)Tgt>Agt	p.C30S	WISP2_ENST00000372865.4_Missense_Mutation_p.C30S|RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000190983.4_Missense_Mutation_p.C30S|RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	30	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				CCCGACACCATGTACCTGCCC	0.662																																					p.C30S													.	.			0			c.T88A												51.0	39.0	43.0					20																	43348565		2202	4298	6500	SO:0001583	missense	8839	exon2			ACACCATGTACCT	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.88T>A	20.37:g.43348565T>A	ENSP00000361959:p.Cys30Ser		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_003881	0		0	B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	ENST00000372868.2	37	CCDS13336.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.269278	0.59540	.	.	ENSG00000064205	ENST00000372868;ENST00000372865;ENST00000190983	D;D;D	0.83163	-1.69;-1.69;-1.69	5.41	5.41	0.78517	Insulin-like growth factor-binding protein, IGFBP (3);	0.000000	0.85682	D	0.000000	D	0.92554	0.7635	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94061	0.7326	10	0.87932	D	0	-20.8964	15.5109	0.75782	0.0:0.0:0.0:1.0	.	30;30	Q6PEG3;O76076	.;WISP2_HUMAN	S	30	ENSP00000361959:C30S;ENSP00000361956:C30S;ENSP00000190983:C30S	ENSP00000190983:C30S	C	+	1	0	WISP2	42781979	1.000000	0.71417	0.053000	0.19242	0.002000	0.02628	6.069000	0.71209	2.057000	0.61298	0.524000	0.50904	TGT			0.662	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127824.1		NM_003881	
ZNF217	7764	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	52194891	52194891	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr20:52194891G>A	ENST00000371471.2	-	3	1890	c.1465C>T	c.(1465-1467)Cat>Tat	p.H489Y	ZNF217_ENST00000302342.3_Missense_Mutation_p.H489Y			O75362	ZN217_HUMAN	zinc finger protein 217	489					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GTTCTGAGATGAATATTGAGG	0.274																																					p.H489Y													.	.			0			c.C1465T												78.0	76.0	77.0					20																	52194891		2200	4295	6495	SO:0001583	missense	7764	exon2			TGAGATGAATATT	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1465C>T	20.37:g.52194891G>A	ENSP00000360526:p.His489Tyr		Somatic	548	0	0		WXS	Illumina HiSeq	.	471	0.08	39	NM_006526	8	0.13	1	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347946	0.82022	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	D;D	0.86769	-2.17;-2.17	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95683	0.8596	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96986	0.9718	10	0.87932	D	0	-33.4442	18.2919	0.90133	0.0:0.0:1.0:0.0	.	489	O75362	ZN217_HUMAN	Y	489	ENSP00000360526:H489Y;ENSP00000304308:H489Y	ENSP00000304308:H489Y	H	-	1	0	ZNF217	51628298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.232000	0.95325	2.482000	0.83794	0.655000	0.94253	CAT			0.274	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079757.2		NM_006526	
RRP1	8568	ucsc.edu;bcgsc.ca	37	21	45222243	45222243	+	Silent	SNP	T	T	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr21:45222243T>A	ENST00000497547.1	+	12	1215	c.1098T>A	c.(1096-1098)cgT>cgA	p.R366R	RRP1_ENST00000471909.1_3'UTR	NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		AGCAGAAGCGTCTGCTCAGGT	0.587																																					p.R366R													.	RRP1	23		0			c.T1098A												93.0	115.0	108.0					21																	45222243		2025	4158	6183	SO:0001819	synonymous_variant	8568	exon12			GAAGCGTCTGCTC	U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.1098T>A	21.37:g.45222243T>A			Somatic	80	0	0		WXS	Illumina HiSeq		42	0.10	4	NM_003683	245	0.00	0	A6NIB2	Silent	SNP	ENST00000497547.1	37	CCDS42951.1																																																																																					0.587	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195680.1		NM_003683	
KRTAP10-10	353333	mdanderson.org	37	21	46058034	46058034	+	Missense_Mutation	SNP	G	G	A	rs142158982	byFrequency	TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr21:46058034G>A	ENST00000380095.1	+	1	762	c.700G>A	c.(700-702)Gtg>Atg	p.V234M	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	234						keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CTGCCGCCCCGTGTGCTCCCG	0.692																																					p.V234M													.	.			0			c.G700A							G	,MET/VAL	54,4352		0,54,2149	54.0	58.0	57.0		,700	-2.9	0.0	21	dbSNP_134	57	16,8582		0,16,4283	no	intron,missense	TSPEAR,KRTAP10-10	NM_144991.2,NM_181688.1	,21	0,70,6432	AA,AG,GG		0.1861,1.2256,0.5383	,possibly-damaging	,234/252	46058034	70,12934	2203	4299	6502	SO:0001583	missense	353333	exon1			CGCCCCGTGTGCT	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.700G>A	21.37:g.46058034G>A	ENSP00000369438:p.Val234Met		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	62	0.06	4	NM_181688	0		0		Missense_Mutation	SNP	ENST00000380095.1	37	CCDS33585.1	94	0.04304029304029304	28	0.056910569105691054	7	0.019337016574585635	29	0.050699300699300696	30	0.0395778364116095	g	0.883	-0.728095	0.03135	0.012256	0.001861	ENSG00000221859	ENST00000380095	T	0.01215	5.16	3.52	-2.88	0.05682	.	.	.	.	.	T	0.00241	0.0007	M	0.71206	2.165	0.09310	N	1	B	0.20459	0.045	B	0.20955	0.032	T	0.38178	-0.9673	9	0.42905	T	0.14	.	5.1831	0.15171	0.3582:0.0:0.4952:0.1466	.	234	P60014	KR10A_HUMAN	M	234	ENSP00000369438:V234M	ENSP00000369438:V234M	V	+	1	0	KRTAP10-10	44882462	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.581000	0.02119	-0.564000	0.06070	-1.314000	0.01303	GTG			0.692	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128034.1		NM_181688	
CACNA1I	8911	mdanderson.org	37	22	40061521	40061521	+	Silent	SNP	G	G	T	rs374991740		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr22:40061521G>T	ENST00000402142.3	+	22	3870	c.3870G>T	c.(3868-3870)ccG>ccT	p.P1290P	CACNA1I_ENST00000336649.4_Silent_p.P1296P|CACNA1I_ENST00000401624.1_Silent_p.P1290P|CACNA1I_ENST00000400164.3_Silent_p.P1255P|CACNA1I_ENST00000407673.1_Silent_p.P1255P|CACNA1I_ENST00000404898.1_Silent_p.P1255P	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1290					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GCCGGGCGCCGGGCCTGAAGC	0.617																																					p.P1290P													CACNA1I_ENST00000402142,NS,carcinoma,+1,2	CACNA1I_ENST00000402142	1	2	0			c.G3870T												79.0	81.0	80.0					22																	40061521		2159	4242	6401	SO:0001819	synonymous_variant	8911	exon22			GGCGCCGGGCCTG	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.3870G>T	22.37:g.40061521G>T			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_021096	0		0	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	CCDS46710.1																																																																																					0.617	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000321290.1		NM_001003406	
PTPRG	5793	mdanderson.org	37	3	62263331	62263331	+	Missense_Mutation	SNP	A	A	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr3:62263331A>T	ENST00000474889.1	+	26	4119	c.3742A>T	c.(3742-3744)Atg>Ttg	p.M1248L	PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000475371.1_RNA|PTPRG_ENST00000295874.10_Missense_Mutation_p.M1219L|PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000466893.1_RNA|PTPRG-AS1_ENST00000479018.1_RNA|PTPRG-AS1_ENST00000462497.1_RNA	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1248	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GATCATTGTCATGCTGCCAGA	0.388																																					p.M1248L													.	.			0			c.A3742T												106.0	103.0	104.0					3																	62263331		2203	4299	6502	SO:0001583	missense	5793	exon26			ATTGTCATGCTGC	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.3742A>T	3.37:g.62263331A>T	ENSP00000418112:p.Met1248Leu		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_002841	1	0.00	0	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.910497	0.72983	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.15834	2.39;2.39	5.8	5.8	0.92144	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.52451	0.1735	M	0.92317	3.295	0.80722	D	1	P;D;D	0.65815	0.942;0.995;0.969	D;D;P	0.74674	0.96;0.984;0.898	T	0.64719	-0.6341	10	0.87932	D	0	.	16.1435	0.81544	1.0:0.0:0.0:0.0	.	494;1219;1248	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	L	1248;1219	ENSP00000418112:M1248L;ENSP00000295874:M1219L	ENSP00000295874:M1219L	M	+	1	0	PTPRG	62238371	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.296000	0.96104	2.212000	0.71576	0.528000	0.53228	ATG			0.388	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351674.1		NM_002841	
COPG1	22820	mdanderson.org	37	3	128982812	128982812	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr3:128982812G>T	ENST00000314797.6	+	13	1298	c.1194G>T	c.(1192-1194)atG>atT	p.M398I		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	398					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										CCGTCCTTATGAACTTCCTGT	0.557																																					p.M398I													.	.			0			c.G1194T												114.0	92.0	99.0					3																	128982812		2203	4300	6503	SO:0001583	missense	22820	exon13			CCTTATGAACTTC	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.1194G>T	3.37:g.128982812G>T	ENSP00000325002:p.Met398Ile		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	73	0.05	4	NM_016128	10	0.00	0	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	37	CCDS33851.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339600	0.60963	.	.	ENSG00000181789	ENST00000314797	T	0.21932	1.98	5.95	5.95	0.96441	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.44456	0.1294	M	0.72479	2.2	0.80722	D	1	P	0.40180	0.705	P	0.55824	0.785	T	0.03157	-1.1066	10	0.36615	T	0.2	-19.8852	17.887	0.88858	0.0:0.0:1.0:0.0	.	398	Q9Y678	COPG_HUMAN	I	398	ENSP00000325002:M398I	ENSP00000325002:M398I	M	+	3	0	COPG	130465502	1.000000	0.71417	0.999000	0.59377	0.006000	0.05464	9.576000	0.98192	2.824000	0.97209	0.655000	0.94253	ATG			0.557	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355456.1		NM_016128	
GPR125	166647	mdanderson.org	37	4	22404358	22404358	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr4:22404358G>T	ENST00000334304.5	-	15	2566	c.2297C>A	c.(2296-2298)aCc>aAc	p.T766N	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	766					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				AATGATAGCGGTAGTATAAAC	0.443																																					p.T766N													.	.			0			c.C2297A												112.0	113.0	113.0					4																	22404358		2203	4300	6503	SO:0001583	missense	166647	exon15			ATAGCGGTAGTAT	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2297C>A	4.37:g.22404358G>T	ENSP00000334952:p.Thr766Asn		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	60	0.07	4	NM_145290	4	0.00	0	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166777	0.57476	.	.	ENSG00000152990	ENST00000334304	T	0.44482	0.92	4.62	4.62	0.57501	GPCR, family 2-like (1);	0.053581	0.64402	D	0.000001	T	0.44008	0.1273	L	0.58101	1.795	0.80722	D	1	P;P	0.43231	0.552;0.801	B;B	0.41374	0.142;0.355	T	0.44283	-0.9338	10	0.37606	T	0.19	-23.755	17.8048	0.88599	0.0:0.0:1.0:0.0	.	623;766	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	N	766	ENSP00000334952:T766N	ENSP00000334952:T766N	T	-	2	0	GPR125	22013456	1.000000	0.71417	0.052000	0.19188	0.623000	0.37688	9.035000	0.93752	2.288000	0.76882	0.591000	0.81541	ACC			0.443	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362960.3			
N4BP2	55728	mdanderson.org	37	4	40122253	40122253	+	Missense_Mutation	SNP	G	G	T	rs149362796	byFrequency	TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr4:40122253G>T	ENST00000261435.6	+	9	2938	c.2522G>T	c.(2521-2523)cGa>cTa	p.R841L		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	841					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						GTCCAGCAACGAGGATCTCCA	0.368																																					p.R841L													.	.			0			c.G2522T												66.0	63.0	64.0					4																	40122253		2203	4300	6503	SO:0001583	missense	55728	exon9			AGCAACGAGGATC	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2522G>T	4.37:g.40122253G>T	ENSP00000261435:p.Arg841Leu		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_018177	0		0	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	G	8.226	0.803618	0.16467	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.17528	2.27	5.12	-6.17	0.02091	.	1.765290	0.02932	N	0.139289	T	0.11623	0.0283	L	0.36672	1.1	0.09310	N	1	B;B	0.12630	0.006;0.004	B;B	0.10450	0.005;0.002	T	0.23297	-1.0192	10	0.22109	T	0.4	6.4769	5.7476	0.18128	0.2075:0.1202:0.5543:0.1179	.	841;841	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	L	841;761	ENSP00000261435:R841L	ENSP00000261435:R841L	R	+	2	0	N4BP2	39798648	0.000000	0.05858	0.000000	0.03702	0.573000	0.36030	-1.457000	0.02374	-1.111000	0.02988	-0.367000	0.07326	CGA			0.368	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250458.2		NM_018177	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	55593661	55593661	+	Missense_Mutation	SNP	T	T	C	rs121913513		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr4:55593661T>C	ENST00000288135.5	+	11	1824	c.1727T>C	c.(1726-1728)cTt>cCt	p.L576P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	576					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L576P(63)|p.Y570_L576del(9)|p.L576del(6)|p.V560_L576del(4)|p.N564_L576del(2)|p.I571_L576del(2)|p.I563_L576del(2)|p.Q556_L576del(2)|p.Q575_P577>T(2)|p.N564_Y578del(2)|p.V569_L576del(1)|p.N567_L576>E(1)|p.E561_P577del(1)|p.N564_P577del(1)|p.V559_L576del(1)|p.I571_N587del(1)|p.V569_L576>G(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCAACACAACTTCCTTATGAT	0.408		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.L576P			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,0,86	KIT	0	86	101	Substitution - Missense(63)|Deletion - In frame(34)|Complex - deletion inframe(4)	soft_tissue(52)|skin(43)|testis(2)|NS(2)|haematopoietic_and_lymphoid_tissue(1)|thymus(1)	c.T1727C												74.0	74.0	74.0					4																	55593661		2203	4300	6503	SO:0001583	missense	3815	exon11	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	CACAACTTCCTTA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1727T>C	4.37:g.55593661T>C	ENSP00000288135:p.Leu576Pro		Somatic	104	0	0		WXS	Illumina HiSeq	.	92	0.05	5	NM_000222	3	0.67	2	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.479382	0.63849	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.97553	-4.43;-4.43	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.56097	D	0.000031	D	0.97216	0.9090	M	0.87617	2.895	0.80722	D	1	P;D;B	0.54772	0.837;0.968;0.256	B;B;B	0.43783	0.139;0.431;0.082	D	0.97709	1.0189	10	0.87932	D	0	.	16.6003	0.84812	0.0:0.0:0.0:1.0	.	83;572;576	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	P	576;572	ENSP00000288135:L576P;ENSP00000390987:L572P	ENSP00000288135:L576P	L	+	2	0	KIT	55288418	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.880000	0.87243	2.319000	0.78375	0.533000	0.62120	CTT			0.408	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
RP11-25H12.1	0	broad.mit.edu	37	4	66960408	66960411	+	lincRNA	DEL	AAAT	AAAT	-	rs142153899	byFrequency	TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	AAAT	AAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr4:66960408_66960411delAAAT	ENST00000508572.1	+	0	463																											TTCTGGtaaaaaataaataaataa	0.353														2196	0.438498	0.3623	0.4323	5008	,	,		11076	0.6935		0.3728	False		,,,				2504	0.3507				.													.	.			0			.																																											0	.			GGTAAAAAATAAA																													4.37:g.66960416_66960419delAAAT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	3	0.00	0		RNA	DEL	ENST00000508572.1	37																																																																																						0.353	RP11-25H12.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000361859.1			
TLR2	7097	mdanderson.org	37	4	154625737	154625737	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr4:154625737G>A	ENST00000260010.6	+	1	3086	c.1678G>A	c.(1678-1680)Gca>Aca	p.A560T		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	560	LRRCT.				apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	TGATTGGCCAGCAAATTACCT	0.527																																					p.A560T													.	.			0			c.G1678A												91.0	83.0	85.0					4																	154625737		2203	4300	6503	SO:0001583	missense	7097	exon3			TGGCCAGCAAATT	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.1678G>A	4.37:g.154625737G>A	ENSP00000260010:p.Ala560Thr		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	47	0.09	4	NM_003264	13	0.00	0	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	ENST00000260010.6	37	CCDS3784.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.525970	0.27299	.	.	ENSG00000137462	ENST00000260010	T	0.23754	1.89	5.16	5.16	0.70880	Cysteine-rich flanking region, C-terminal (1);	0.669740	0.14613	N	0.308892	T	0.20577	0.0495	L	0.27053	0.805	0.21355	N	0.999711	B	0.02656	0.0	B	0.04013	0.001	T	0.11518	-1.0584	10	0.59425	D	0.04	.	13.0103	0.58727	0.0772:0.0:0.9228:0.0	.	560	O60603	TLR2_HUMAN	T	560	ENSP00000260010:A560T	ENSP00000260010:A560T	A	+	1	0	TLR2	154845187	0.021000	0.18746	0.344000	0.25628	0.231000	0.25187	1.362000	0.34148	2.405000	0.81733	0.655000	0.94253	GCA			0.527	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365205.1			
TMEM174	134288	broad.mit.edu	37	5	72469939	72469939	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr5:72469939T>C	ENST00000296776.5	+	2	728	c.679T>C	c.(679-681)Tgt>Cgt	p.C227R	TMEM174_ENST00000511737.1_Intron	NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	227						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		AGAGGAGGCCTGTGCCTGCTT	0.478																																					p.C227R													.	TMEM174	22		0			c.T679C												118.0	114.0	115.0					5																	72469939		2203	4300	6503	SO:0001583	missense	134288	exon2			GAGGCCTGTGCCT	BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.679T>C	5.37:g.72469939T>C	ENSP00000296776:p.Cys227Arg		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	124	0.02	3	NM_153217	0		0	B2RDA0|Q96N81	Missense_Mutation	SNP	ENST00000296776.5	37	CCDS4018.1	.	.	.	.	.	.	.	.	.	.	T	8.309	0.821704	0.16678	.	.	ENSG00000164325	ENST00000296776	.	.	.	5.14	2.62	0.31277	.	0.744461	0.13379	N	0.392303	T	0.16981	0.0408	N	0.04508	-0.205	0.20307	N	0.999911	B	0.06786	0.001	B	0.06405	0.002	T	0.17107	-1.0380	9	0.40728	T	0.16	-6.5503	8.1883	0.31352	0.0:0.2361:0.0:0.7639	.	227	Q8WUU8	TM174_HUMAN	R	227	.	ENSP00000296776:C227R	C	+	1	0	TMEM174	72505695	0.000000	0.05858	0.071000	0.20095	0.914000	0.54420	0.344000	0.19962	0.928000	0.37168	0.533000	0.62120	TGT			0.478	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254036.1		NM_153217	
DIAPH1	1729	mdanderson.org	37	5	140953625	140953625	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr5:140953625G>T	ENST00000398557.4	-	16	1932	c.1792C>A	c.(1792-1794)Cca>Aca	p.P598T	DIAPH1_ENST00000253811.6_Missense_Mutation_p.P598T|DIAPH1_ENST00000398566.3_Missense_Mutation_p.P589T|DIAPH1_ENST00000518047.1_Missense_Mutation_p.P589T|DIAPH1_ENST00000389057.5_Missense_Mutation_p.P589T|DIAPH1_ENST00000520569.1_Missense_Mutation_p.P544T|DIAPH1_ENST00000389054.3_Missense_Mutation_p.P598T|DIAPH1_ENST00000398562.2_Missense_Mutation_p.P589T	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	598	FH1.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGGTGGTGGTGGAATAATA	0.587																																					p.P598T													.	.			0			c.C1792A												46.0	49.0	48.0					5																	140953625		2077	4198	6275	SO:0001583	missense	1729	exon16			GTGGTGGTGGAAT	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1792C>A	5.37:g.140953625G>T	ENSP00000381565:p.Pro598Thr		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_005219	12	0.00	0	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	37	CCDS43374.1	.	.	.	.	.	.	.	.	.	.	g	2.057	-0.416401	0.04766	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047;ENST00000546094	T;T;T;T;T;T;T;T	0.32988	1.89;1.89;1.43;1.89;1.89;1.89;1.89;1.89	4.53	2.75	0.32379	.	0.590209	0.15836	N	0.242293	T	0.32793	0.0841	M	0.79123	2.44	0.36110	D	0.844729	B;B;B	0.27823	0.19;0.084;0.084	B;B;B	0.24155	0.051;0.031;0.031	T	0.27054	-1.0085	10	0.33940	T	0.23	.	9.9617	0.41699	0.171:0.0:0.829:0.0	.	544;589;598	E7ERW8;E9PEZ2;O60610	.;.;DIAP1_HUMAN	T	598;544;589;589;589;598;598;589;37	ENSP00000373706:P598T;ENSP00000429282:P544T;ENSP00000381570:P589T;ENSP00000373709:P589T;ENSP00000381572:P589T;ENSP00000381565:P598T;ENSP00000253811:P598T;ENSP00000428268:P589T	ENSP00000253811:P598T	P	-	1	0	DIAPH1	140933809	0.286000	0.24305	0.026000	0.17262	0.080000	0.17528	1.065000	0.30592	0.553000	0.29044	-0.261000	0.10672	CCA			0.587	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_005219	
DBN1	1627	mdanderson.org	37	5	176885163	176885163	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr5:176885163G>T	ENST00000309007.5	-	12	1891	c.1672C>A	c.(1672-1674)Cag>Aag	p.Q558K	DBN1_ENST00000292385.5_Missense_Mutation_p.Q560K|DBN1_ENST00000512501.1_Missense_Mutation_p.Q290K|DBN1_ENST00000393565.1_Missense_Mutation_p.Q604K|DBN1_ENST00000393563.4_Missense_Mutation_p.Q290K	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	558					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTGGGGTCTGGGGGGCAGCC	0.637																																					p.Q560K													.	.			0			c.C1678A												31.0	37.0	35.0					5																	176885163		2201	4294	6495	SO:0001583	missense	1627	exon13			GGGTCTGGGGGGC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1672C>A	5.37:g.176885163G>T	ENSP00000308532:p.Gln558Lys		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	78	0.05	4	NM_080881	225	0.00	0	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	G	6.723	0.502049	0.12822	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000512501;ENST00000393563	T;T;T;T;T	0.31769	1.52;1.52;1.51;1.48;1.54	4.71	3.77	0.43336	.	4.412020	0.00628	N	0.000466	T	0.32224	0.0822	N	0.08118	0	0.25794	N	0.98458	B;P;P;P	0.52061	0.123;0.95;0.596;0.898	B;P;B;P	0.55011	0.023;0.766;0.088;0.525	T	0.46498	-0.9187	10	0.49607	T	0.09	-27.1584	9.5977	0.39584	0.0:0.1506:0.6948:0.1546	.	508;604;558;560	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	K	558;560;604;290;290	ENSP00000308532:Q558K;ENSP00000292385:Q560K;ENSP00000377195:Q604K;ENSP00000423208:Q290K;ENSP00000377193:Q290K	ENSP00000292385:Q560K	Q	-	1	0	DBN1	176817769	0.998000	0.40836	0.767000	0.31495	0.231000	0.25187	0.514000	0.22786	2.618000	0.88619	0.462000	0.41574	CAG			0.637	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000253429.2		NM_080881	
PMS2P4	5382	broad.mit.edu	37	7	66767610	66767611	+	RNA	INS	-	-	G	rs71293166|rs12531701	byFrequency	TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr7:66767610_66767611insG	ENST00000414507.1	-	0	0				STAG3L4_ENST00000416602.2_RNA					postmeiotic segregation increased 2 pseudogene 4																		CACCGGACTGCTTTTTTTTTTT	0.545																																					.													.	.			0			.																																											0	.			GGACTGCTTTTTT	D38438		7q11.22	2010-10-26	2010-10-26	2010-10-26	ENSG00000067601	ENSG00000067601			9129	pseudogene	pseudogene	"""PMS2 pseudogene"""		"""postmeiotic segregation increased 2-like 4"", ""postmeiotic segregation increased 2-like 4 pseudogene"""	PMS2L4		8586419	Standard	NR_046297		Approved	PMS6	uc003tvo.3		OTTHUMG00000156923		7.37:g.66767610_66767611insG			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	13	0.31	4	.	0		0		RNA	INS	ENST00000414507.1	37																																																																																						0.545	PMS2P4-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000346632.1		NR_022007	
TYW1B	441250	broad.mit.edu	37	7	72093938	72093938	+	RNA	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr7:72093938G>A	ENST00000435769.2	-	0	1674				TYW1B_ENST00000438125.1_RNA|TYW1B_ENST00000343721.5_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										GCTCGTCCACGTTCCATGCTT	0.522																																					.													.	.			0			.												79.0	93.0	89.0					7																	72093938		692	1589	2281			441250	.			GTCCACGTTCCAT	BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72093938G>A			Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	74	0.05	4	.	2	0.00	0	A6NG09|B4DFY2|Q3KQX2	RNA	SNP	ENST00000435769.2	37																																																																																						0.522	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347346.2		NM_001145440	
TRRAP	8295	mdanderson.org	37	7	98507792	98507792	+	Silent	SNP	C	C	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr7:98507792C>A	ENST00000359863.4	+	15	1673	c.1464C>A	c.(1462-1464)ccC>ccA	p.P488P	TRRAP_ENST00000446306.3_Silent_p.P488P|TRRAP_ENST00000355540.3_Silent_p.P488P	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	488	Pro-rich.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTGGGGTGCCCACTGCCCCTG	0.647																																					p.P488P													.	.			0			c.C1464A												69.0	77.0	74.0					7																	98507792		2203	4300	6503	SO:0001819	synonymous_variant	8295	exon15			GGTGCCCACTGCC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.1464C>A	7.37:g.98507792C>A			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_003496	1	0.00	0	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	7.022	0.558914	0.13436	.	.	ENSG00000196367	ENST00000456197	T	0.25912	1.77	5.91	-3.5	0.04710	.	0.127395	0.53938	D	0.000058	T	0.12646	0.0307	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.15838	-1.0423	7	0.12766	T	0.61	.	3.537	0.07798	0.0801:0.3427:0.2216:0.3556	.	.	.	.	Q	203	ENSP00000394645:P203Q	ENSP00000394645:P203Q	P	+	2	0	TRRAP	98345728	0.101000	0.21875	0.071000	0.20095	0.968000	0.65278	-0.011000	0.12721	-0.298000	0.08921	-0.181000	0.13052	CCA			0.647	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317978.1		NM_003496	
MUC17	140453	hgsc.bcm.edu	37	7	100682117	100682117	+	Missense_Mutation	SNP	G	G	A	rs555953599	byFrequency	TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr7:100682117G>A	ENST00000306151.4	+	3	7484	c.7420G>A	c.(7420-7422)Ggc>Agc	p.G2474S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2474	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCTGAGGCTGGCACCCTTTC	0.522													N|||	3	0.000599042	0.0	0.0	5008	,	,		27478	0.0		0.0	False		,,,				2504	0.0031				p.G2474S													MUC17,right_upper_lobe,carcinoma,-2,1	MUC17	-2	1	0			c.G7420A																																									SO:0001583	missense	140453	exon3			GAGGCTGGCACCC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7420G>A	7.37:g.100682117G>A	ENSP00000302716:p.Gly2474Ser		Somatic	125	0.008	1		WXS	Illumina HiSeq	.	99	0.05	5	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	2.617	-0.289370	0.05605	.	.	ENSG00000169876	ENST00000306151	T	0.03468	3.92	0.869	-0.297	0.12820	.	.	.	.	.	T	0.01254	0.0041	N	0.02916	-0.46	0.09310	N	1	B	0.27286	0.174	B	0.19148	0.024	T	0.45131	-0.9282	9	0.02654	T	1	.	5.8185	0.18514	0.4085:0.0:0.5915:0.0	.	2474	Q685J3	MUC17_HUMAN	S	2474	ENSP00000302716:G2474S	ENSP00000302716:G2474S	G	+	1	0	MUC17	100468837	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.476000	0.06591	-0.655000	0.05387	-1.616000	0.00795	GGC			0.522	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
EN2	2020	mdanderson.org	37	7	155251298	155251298	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr7:155251298C>T	ENST00000297375.4	+	1	475	c.226C>T	c.(226-228)Cgg>Tgg	p.R76W	AC008060.8_ENST00000419225.1_lincRNA	NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	76					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAACATCCTGCGGCCCGAGTT	0.746																																					p.R76W													.	.			0			c.C226T												8.0	6.0	7.0					7																	155251298		2009	3919	5928	SO:0001583	missense	2020	exon1			ATCCTGCGGCCCG		CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.226C>T	7.37:g.155251298C>T	ENSP00000297375:p.Arg76Trp		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_001427	0		0	A4D252|Q549U3|Q9UD58	Missense_Mutation	SNP	ENST00000297375.4	37	CCDS5940.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080391	0.36662	.	.	ENSG00000164778	ENST00000297375	D	0.96491	-4.03	3.72	1.81	0.25067	.	0.000000	0.64402	D	0.000001	D	0.96015	0.8702	L	0.32530	0.975	0.51482	D	0.999922	D	0.89917	1.0	D	0.77004	0.989	D	0.94791	0.7962	10	0.87932	D	0	-15.9842	11.5638	0.50794	0.4597:0.5403:0.0:0.0	.	76	P19622	HME2_HUMAN	W	76	ENSP00000297375:R76W	ENSP00000297375:R76W	R	+	1	2	EN2	154944059	0.990000	0.36364	0.963000	0.40424	0.042000	0.13812	0.283000	0.18846	0.235000	0.21160	-0.532000	0.04303	CGG			0.746	EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322337.1		NM_001427	
NPM2	10361	mdanderson.org	37	8	21891643	21891643	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr8:21891643G>T	ENST00000397940.1	+	6	1403	c.388G>T	c.(388-390)Gag>Tag	p.E130*	NPM2_ENST00000289820.6_Nonsense_Mutation_p.E130*|snoU13_ENST00000459495.1_RNA|NPM2_ENST00000521157.1_Nonsense_Mutation_p.E130*|NPM2_ENST00000381530.5_Intron|NPM2_ENST00000518119.1_Nonsense_Mutation_p.E130*|NPM2_ENST00000520180.1_3'UTR			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2	130	Acidic tract A2.|Poly-Glu.				chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		AACCTGggaggaggaggagga	0.507																																					p.E130X													.	.			0			c.G388T												72.0	73.0	73.0					8																	21891643		2203	4300	6503	SO:0001587	stop_gained	10361	exon6			TGGGAGGAGGAGG	AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.388G>T	8.37:g.21891643G>T	ENSP00000381032:p.Glu130*		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_182795	1	0.00	0	B3KSU0|D3DSQ8|Q6NVH6	Nonsense_Mutation	SNP	ENST00000397940.1	37	CCDS6018.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205892	0.79127	.	.	ENSG00000158806	ENST00000521157;ENST00000397940;ENST00000522813;ENST00000518119;ENST00000289820	.	.	.	4.76	3.88	0.44766	.	0.069465	0.53938	D	0.000047	.	.	.	.	.	.	0.24520	N	0.994165	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-3.4837	9.5444	0.39271	0.1:0.0:0.9:0.0	.	.	.	.	X	130	.	ENSP00000289820:E130X	E	+	1	0	NPM2	21947589	0.998000	0.40836	0.007000	0.13788	0.001000	0.01503	4.145000	0.58065	1.319000	0.45190	-0.136000	0.14681	GAG			0.507	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253810.2		NM_182795	
PCMTD1	115294	bcgsc.ca	37	8	52733143	52733143	+	Missense_Mutation	SNP	A	A	G	rs111785933		TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr8:52733143A>G	ENST00000360540.5	-	7	1248	c.842T>C	c.(841-843)gTt>gCt	p.V281A	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Missense_Mutation_p.V205A|PCMTD1_ENST00000522514.1_Missense_Mutation_p.V281A	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	281						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTCTGTTTAACTCTCTTTCT	0.393																																					p.V281A													.	PCMTD1	73		0			c.T842C												172.0	174.0	174.0					8																	52733143		2203	4300	6503	SO:0001583	missense	115294	exon6			TGTTTAACTCTCT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.842T>C	8.37:g.52733143A>G	ENSP00000353739:p.Val281Ala		Somatic	156	0.0192307692	3		WXS	Illumina HiSeq	Phase_1	158	0.05	8	NM_052937	54	0.00	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	4.043	0.005592	0.07866	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.46063	0.88;0.88;0.88	5.97	4.75	0.60458	.	0.260164	0.36972	N	0.002316	T	0.32556	0.0833	L	0.42245	1.32	0.29355	N	0.865105	B;B;B	0.18863	0.009;0.008;0.031	B;B;B	0.18263	0.015;0.005;0.021	T	0.15780	-1.0425	10	0.15066	T	0.55	-33.7683	11.4736	0.50284	0.6809:0.3191:0.0:0.0	.	151;205;281	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	A	281;205;281	ENSP00000353739:V281A;ENSP00000444026:V205A;ENSP00000428099:V281A	ENSP00000353739:V281A	V	-	2	0	PCMTD1	52895696	1.000000	0.71417	0.992000	0.48379	0.981000	0.71138	5.794000	0.69067	2.281000	0.76405	0.533000	0.62120	GTT			0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377909.2		NM_052937	
LY6E	4061	ucsc.edu	37	8	144103183	144103183	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr8:144103183G>A	ENST00000520466.1	+	5	776	c.373G>A	c.(373-375)Gcc>Acc	p.A125T	LY6E_ENST00000429120.2_Missense_Mutation_p.A125T|LY6E_ENST00000521003.1_Missense_Mutation_p.A125T|LY6E_ENST00000517503.1_3'UTR|LY6E_ENST00000522024.1_Missense_Mutation_p.A125T|LY6E_ENST00000522971.1_Missense_Mutation_p.A125T|LY6E_ENST00000519546.1_3'UTR|LY6E_ENST00000522528.1_3'UTR|LY6E_ENST00000521182.1_3'UTR|LY6E_ENST00000519611.1_3'UTR|LY6E_ENST00000521699.1_Missense_Mutation_p.A125T|LY6E_ENST00000292494.6_Missense_Mutation_p.A125T|LY6E_ENST00000523847.1_Intron			Q16553	LY6E_HUMAN	lymphocyte antigen 6 complex, locus E	125					adrenal gland development (GO:0030325)|cell surface receptor signaling pathway (GO:0007166)|epinephrine secretion (GO:0048242)|in utero embryonic development (GO:0001701)|norepinephrine metabolic process (GO:0042415)|organ growth (GO:0035265)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	7	all_cancers(97;1.94e-10)|all_epithelial(106;1.22e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CCTGCTGCCGGCCCTGCTGCG	0.667																																					p.A125T													.	LY6E	10		0			c.G373A												28.0	31.0	30.0					8																	144103183		2200	4298	6498	SO:0001583	missense	4061	exon4			CTGCCGGCCCTGC	U42376	CCDS6394.1	8q24	2008-08-07				ENSG00000160932			6727	protein-coding gene	gene with protein product	"""retinoic acid induced gene E"""	601384				8757598, 8650192	Standard	NM_001127213		Approved	TSA-1, RIG-E, SCA-2	uc003yxm.2	Q16553		ENST00000520466.1:c.373G>A	8.37:g.144103183G>A	ENSP00000428572:p.Ala125Thr		Somatic	46	0	0		RNA-Seq	Illumina HiSeq		36	0.06	2	NM_002346	137	0.18	24	B2R4X5|D3DWJ2|Q0VDE5	Missense_Mutation	SNP	ENST00000520466.1	37	CCDS6394.1	.	.	.	.	.	.	.	.	.	.	g	6.695	0.496850	0.12762	.	.	ENSG00000160932	ENST00000292494;ENST00000429120;ENST00000521699;ENST00000520466;ENST00000521003;ENST00000522971;ENST00000522024	D;D;D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61	3.49	2.56	0.30785	.	0.598977	0.14973	N	0.287684	T	0.72819	0.3508	L	0.44542	1.39	0.09310	N	1	P	0.37061	0.58	B	0.32090	0.14	T	0.62835	-0.6770	10	0.44086	T	0.13	-9.0173	8.1657	0.31226	0.0:0.0:0.5633:0.4367	.	125	Q16553	LY6E_HUMAN	T	125	ENSP00000292494:A125T;ENSP00000414307:A125T;ENSP00000427915:A125T;ENSP00000428572:A125T;ENSP00000428169:A125T;ENSP00000428159:A125T;ENSP00000428442:A125T	ENSP00000292494:A125T	A	+	1	0	LY6E	144174558	0.735000	0.28153	0.008000	0.14137	0.020000	0.10135	0.214000	0.17541	0.988000	0.38734	0.655000	0.94253	GCC			0.667	LY6E-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380125.1		NM_001127213	
GSDMD	79792	mdanderson.org	37	8	144643588	144643588	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr8:144643588C>T	ENST00000526406.1	+	9	1614	c.731C>T	c.(730-732)gCg>gTg	p.A244V	GSDMD_ENST00000262580.4_Missense_Mutation_p.A244V|GSDMD_ENST00000533063.1_Missense_Mutation_p.A292V	NM_001166237.1	NP_001159709.1	P57764	GSDMD_HUMAN	gasdermin D	244					cellular response to extracellular stimulus (GO:0031668)					breast(1)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	12						CAGCCACCCGCGACAGGTGAG	0.622																																					p.A244V													.	.			0			c.C731T												36.0	37.0	37.0					8																	144643588		2199	4295	6494	SO:0001583	missense	79792	exon9			CACCCGCGACAGG	AK096216	CCDS34956.1	8q24.3	2008-07-31	2008-07-31	2008-07-31		ENSG00000104518			25697	protein-coding gene	gene with protein product			"""gasdermin domain containing 1"""	GSDMDC1		15289881, 17350798	Standard	NM_024736		Approved	FLJ12150, DF5L	uc003yyg.3	P57764		ENST00000526406.1:c.731C>T	8.37:g.144643588C>T	ENSP00000433209:p.Ala244Val		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001166237	117	0.00	0	D3DWJ9|Q96Q98	Missense_Mutation	SNP	ENST00000526406.1	37	CCDS34956.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536911	0.27475	.	.	ENSG00000104518	ENST00000526406;ENST00000533063;ENST00000262580;ENST00000534018	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	3.73	-1.68	0.08212	.	2.264960	0.01535	N	0.018947	T	0.11110	0.0271	N	0.08118	0	0.09310	N	1	B;B;B	0.26258	0.145;0.145;0.119	B;B;B	0.10450	0.005;0.005;0.004	T	0.09271	-1.0682	10	0.30854	T	0.27	-1.5455	1.0472	0.01572	0.2921:0.3912:0.1399:0.1768	.	244;244;292	A8K702;P57764;G3V1A6	.;GSDMD_HUMAN;.	V	244;292;244;260	ENSP00000433209:A244V;ENSP00000433958:A292V;ENSP00000262580:A244V;ENSP00000436684:A260V	ENSP00000262580:A244V	A	+	2	0	GSDMD	144714731	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.291000	0.08343	-0.348000	0.08286	0.637000	0.83480	GCG			0.622	GSDMD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382046.3		NM_024736	
CNTLN	54875	mdanderson.org	37	9	17135090	17135090	+	Silent	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr9:17135090G>A	ENST00000380647.3	+	1	111	c.27G>A	c.(25-27)ccG>ccA	p.P9P	CNTLN_ENST00000380641.4_Silent_p.P9P|CNTLN_ENST00000262360.5_Silent_p.P9P|CNTLN_ENST00000484374.1_3'UTR|CNTLN_ENST00000425824.1_Silent_p.P9P			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	9					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		CTCCCTCACCGCACCCTTCGC	0.682																																					p.P9P													.	.			0			c.G27A												9.0	12.0	11.0					9																	17135090		1949	4120	6069	SO:0001819	synonymous_variant	54875	exon1			CTCACCGCACCCT	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.27G>A	9.37:g.17135090G>A			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_017738	0		0	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	ENST00000380647.3	37	CCDS43789.1																																																																																					0.682	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051793.3		NM_017738	
LCN10	414332	mdanderson.org	37	9	139635320	139635320	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chr9:139635320G>A	ENST00000474369.1	-	3	403	c.404C>T	c.(403-405)gCa>gTa	p.A135V	LCN6_ENST00000480584.1_5'Flank|LCN10_ENST00000527229.1_Intron|LCN10_ENST00000497771.1_Missense_Mutation_p.A148V|LCN6_ENST00000435202.1_3'UTR			Q6JVE6	LCN10_HUMAN	lipocalin 10	135					transport (GO:0006810)	extracellular region (GO:0005576)				breast(2)|cervix(1)|large_intestine(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		GTTTTGGGTTGCACGCCCCAG	0.607																																					p.A148V													.	.			0			c.C443T												93.0	80.0	85.0					9																	139635320		2203	4300	6503	SO:0001583	missense	414332	exon4			TGGGTTGCACGCC	AY301271	CCDS35182.2	9q34.3	2011-10-24			ENSG00000187922	ENSG00000187922		"""Lipocalins"""	20892	protein-coding gene	gene with protein product		612904				15363845	Standard	NM_001001712		Approved		uc004civ.3	Q6JVE6	OTTHUMG00000150428	ENST00000474369.1:c.404C>T	9.37:g.139635320G>A	ENSP00000420564:p.Ala135Val		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001001712	2	0.00	0	A2RUU3|B0QZ79	Missense_Mutation	SNP	ENST00000474369.1	37	CCDS35182.2	.	.	.	.	.	.	.	.	.	.	G	10.11	1.261477	0.23051	.	.	ENSG00000187922	ENST00000497771;ENST00000474369	T;T	0.11821	2.74;2.74	3.56	1.62	0.23740	Calycin-like (1);Calycin (1);	0.509065	0.16327	N	0.219268	T	0.09555	0.0235	.	.	.	0.09310	N	1	P;P	0.46784	0.884;0.884	B;B	0.42282	0.382;0.382	T	0.21280	-1.0250	9	0.30854	T	0.27	.	5.4003	0.16293	0.1233:0.2069:0.6698:0.0	.	135;148	Q6JVE6;Q6JVE6-2	LCN10_HUMAN;.	V	148;135	ENSP00000418491:A148V;ENSP00000420564:A135V	ENSP00000420564:A135V	A	-	2	0	LCN10	138755141	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.359000	0.20233	0.261000	0.21753	0.552000	0.68991	GCA			0.607	LCN10-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318062.2		NM_001001712	
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	2333	2333	+	5'Flank	SNP	G	G	A			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chrM:2333G>A	ENST00000361453.3	+	0	0				MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						ACATTCTCCTCCGCATAAGCC	0.388																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6053	.			TCCTCCGCATAAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2333G>A	Exception_encountered		Somatic	11	0	0		WXS	Illumina HiSeq	.	31	0.32	10	.	0		0	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																						0.388	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024027	
MAGEE2	139599	mdanderson.org	37	X	75004549	75004549	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0E-01A-12D-A435-10	TCGA-ZM-AA0E-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbb79a24-d11f-4205-b2b6-a9cd8d31a869	22c71019-10f2-4bec-b3a6-2640f303435e	g.chrX:75004549T>C	ENST00000373359.2	-	1	530	c.338A>G	c.(337-339)gAg>gGg	p.E113G		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	113	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTCCAGCATCTCGGACTGCTG	0.527																																					p.E113G													.	.			0			c.A338G												35.0	31.0	32.0					X																	75004549		2203	4300	6503	SO:0001583	missense	139599	exon1			AGCATCTCGGACT	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.338A>G	X.37:g.75004549T>C	ENSP00000362457:p.Glu113Gly		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_138703	0		0	Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	T	9.697	1.153322	0.21371	.	.	ENSG00000186675	ENST00000373359	T	0.06849	3.25	3.02	3.02	0.34903	.	.	.	.	.	T	0.23688	0.0573	M	0.71920	2.185	0.27839	N	0.941184	D	0.76494	0.999	D	0.83275	0.996	T	0.02625	-1.1132	9	0.62326	D	0.03	.	6.8651	0.24088	0.0:0.0:0.0:1.0	.	113	Q8TD90	MAGE2_HUMAN	G	113	ENSP00000362457:E113G	ENSP00000362457:E113G	E	-	2	0	MAGEE2	74921274	0.999000	0.42202	0.930000	0.37139	0.568000	0.35870	2.458000	0.45014	1.425000	0.47237	0.303000	0.19852	GAG			0.527	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057288.1		NM_138703	
