#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ATAD3B	83858	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	1431185	1431185	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:1431185C>A	ENST00000308647.7	+	16	2051	c.1935C>A	c.(1933-1935)caC>caA	p.H645Q		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	645						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCCCAGGGCACCCCCTGTTGT	0.642																																					p.H645Q													.	ATAD3B	68		0			c.C1935A												26.0	27.0	26.0					1																	1431185		2200	4294	6494	SO:0001583	missense	83858	exon16			AGGGCACCCCCTG	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1935C>A	1.37:g.1431185C>A	ENSP00000311766:p.His645Gln		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	34	0.15	5	NM_031921	438	0.23	100	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	ENST00000308647.7	37	CCDS30.1	.	.	.	.	.	.	.	.	.	.	c	5.288	0.238450	0.10023	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.93604	-3.25	1.17	-1.87	0.07737	.	.	.	.	.	T	0.81664	0.4870	N	0.08118	0	0.09310	N	0.999997	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.68981	-0.5266	9	0.87932	D	0	.	2.5746	0.04803	0.0:0.4473:0.3112:0.2414	.	599;645	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	Q	479;645	ENSP00000311766:H645Q	ENSP00000311766:H645Q	H	+	3	2	ATAD3B	1421048	0.001000	0.12720	0.000000	0.03702	0.034000	0.12701	0.477000	0.22196	-0.491000	0.06697	0.194000	0.17425	CAC			0.642	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001369.2		NM_031921	
PRDM16	63976	mdanderson.org	37	1	3328826	3328826	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:3328826G>T	ENST00000270722.5	+	9	2114	c.2065G>T	c.(2065-2067)Gcc>Tcc	p.A689S	PRDM16_ENST00000378398.3_Missense_Mutation_p.A690S|PRDM16_ENST00000378391.2_Missense_Mutation_p.A689S|PRDM16_ENST00000442529.2_Missense_Mutation_p.A689S|PRDM16_ENST00000511072.1_Missense_Mutation_p.A690S|PRDM16_ENST00000514189.1_Missense_Mutation_p.A690S|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000441472.2_Missense_Mutation_p.A689S			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	689	Interaction with CTBP1 and CTBP2. {ECO:0000250}.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AACGGGCGCCGCCGGGGACTC	0.647			T	EVI1	"""MDS, AML"""																																p.A689S				Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	.			0			c.G2065T												51.0	62.0	58.0					1																	3328826		2015	4163	6178	SO:0001583	missense	63976	exon9			GGCGCCGCCGGGG	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2065G>T	1.37:g.3328826G>T	ENSP00000270722:p.Ala689Ser		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_022114	0		0	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	37	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	G	4.046	0.006155	0.07866	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.05258	3.49;3.51;3.52;3.51;3.5;3.51;3.52;3.47;3.47	4.73	2.81	0.32909	.	0.119832	0.35436	N	0.003214	T	0.06096	0.0158	L	0.50919	1.6	0.28265	N	0.924655	B;P;B;P	0.40638	0.053;0.725;0.131;0.605	B;B;B;B	0.36134	0.01;0.218;0.052;0.108	T	0.25328	-1.0135	10	0.20519	T	0.43	.	9.8707	0.41172	0.0765:0.1399:0.7836:0.0	.	689;689;689;689	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	S	690;690;689;689;689;690;689;505;505;498	ENSP00000426975:A690S;ENSP00000367651:A690S;ENSP00000407968:A689S;ENSP00000405253:A689S;ENSP00000367643:A689S;ENSP00000421400:A690S;ENSP00000270722:A689S;ENSP00000422504:A505S;ENSP00000425796:A498S	ENSP00000270722:A689S	A	+	1	0	PRDM16	3318686	0.996000	0.38824	0.015000	0.15790	0.039000	0.13416	3.450000	0.52957	0.576000	0.29452	0.603000	0.83216	GCC			0.647	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000001382.3		NM_022114	
TARDBP	23435	bcgsc.ca	37	1	11082189	11082189	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:11082189G>T	ENST00000240185.3	+	6	837	c.723G>T	c.(721-723)caG>caT	p.Q241H	TARDBP_ENST00000439080.2_Missense_Mutation_p.Q125H|TARDBP_ENST00000315091.3_Missense_Mutation_p.Q241H	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	241	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		AGATTGCGCAGTCTCTTTGTG	0.333																																					p.Q241H													.	TARDBP	31		0			c.G723T												81.0	79.0	80.0					1																	11082189		2203	4300	6503	SO:0001583	missense	23435	exon6			TGCGCAGTCTCTT	U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.723G>T	1.37:g.11082189G>T	ENSP00000240185:p.Gln241His		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_1	62	0.06	4	NM_007375	29	0.00	0	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Missense_Mutation	SNP	ENST00000240185.3	37	CCDS122.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010377	0.54361	.	.	ENSG00000120948	ENST00000240185;ENST00000439080;ENST00000315091	D;D;T	0.85861	-2.04;-2.04;2.3	5.81	-0.346	0.12620	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.107947	0.64402	D	0.000003	D	0.88009	0.6322	L	0.60957	1.885	0.80722	D	1	D;D	0.64830	0.994;0.984	D;D	0.66196	0.942;0.926	D	0.86025	0.1509	10	0.66056	D	0.02	-12.4509	10.7796	0.46369	0.3776:0.0:0.6224:0.0	.	125;241	B4DJ45;Q13148	.;TADBP_HUMAN	H	241;125;241	ENSP00000240185:Q241H;ENSP00000404666:Q125H;ENSP00000313129:Q241H	ENSP00000240185:Q241H	Q	+	3	2	TARDBP	11004776	1.000000	0.71417	0.997000	0.53966	0.723000	0.41478	0.821000	0.27338	-0.061000	0.13110	-1.105000	0.02106	CAG			0.333	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006063.1		NM_007375	
Unknown	0	bcgsc.ca	37	1	17077216	17077216	+	IGR	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:17077216G>T								RNU1-4 (10042 upstream) : MST1L (4188 downstream)																							CTGGCTGGAGGAGGAGCAGCA	0.672																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100421113	.			CTGGAGGAGGAGC																													1.37:g.17077216G>T			Somatic	60	0.0166666667	1		WXS	Illumina HiSeq	Phase_1	52	0.17	9	.	0		0		RNA	SNP		37																																																																																					0	0.672										
WASF2	10163	broad.mit.edu	37	1	27736326	27736328	+	In_Frame_Del	DEL	GGA	GGA	-	rs150974534		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:27736326_27736328delGGA	ENST00000430629.2	-	8	1412_1414	c.1197_1199delTCC	c.(1195-1200)cctccg>ccg	p.399_400PP>P	WASF2_ENST00000536657.1_Intron	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	399	Poly-Pro.				actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		AGGGGGCCCCggaggaggaggag	0.64																																					p.399_400del													.	WASF2	41		0			c.1197_1199del																																									SO:0001651	inframe_deletion	10163	exon8			GGCCCCGGAGGAG	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.1197_1199delTCC	1.37:g.27736335_27736337delGGA	ENSP00000396211:p.Pro400del		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	164	0.00	0	NM_006990	6	0.00	0	B4DZN0|O60794|Q9UDY7	In_Frame_Del	DEL	ENST00000430629.2	37	CCDS304.1																																																																																					0.640	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009516.1		NM_006990	
WASF2	10163	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27736390	27736390	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:27736390G>A	ENST00000430629.2	-	8	1350	c.1135C>T	c.(1135-1137)Cca>Tca	p.P379S	WASF2_ENST00000536657.1_Intron	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	379	Poly-Pro.				actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		GGAGGTGGTGGCAGAGTTGGG	0.652																																					p.P379S													.	WASF2	41		0			c.C1135T												74.0	74.0	74.0					1																	27736390		2203	4300	6503	SO:0001583	missense	10163	exon8			GTGGTGGCAGAGT	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.1135C>T	1.37:g.27736390G>A	ENSP00000396211:p.Pro379Ser		Somatic	127	0.0078740157	1		WXS	Illumina HiSeq	Phase_I	183	0.14	25	NM_006990	7	0.14	1	B4DZN0|O60794|Q9UDY7	Missense_Mutation	SNP	ENST00000430629.2	37	CCDS304.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759213	0.49468	.	.	ENSG00000158195	ENST00000430629	T	0.52526	0.66	4.58	4.58	0.56647	.	0.669159	0.14181	N	0.336016	T	0.38241	0.1033	L	0.39245	1.2	0.80722	D	1	B	0.18013	0.025	B	0.19666	0.026	T	0.31613	-0.9937	10	0.51188	T	0.08	-4.0246	7.7598	0.28946	0.0902:0.1659:0.7439:0.0	.	379	Q9Y6W5	WASF2_HUMAN	S	379	ENSP00000396211:P379S	ENSP00000396211:P379S	P	-	1	0	WASF2	27608977	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	3.591000	0.53986	2.095000	0.63458	0.551000	0.68910	CCA			0.652	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009516.1		NM_006990	
AK2	204	bcgsc.ca	37	1	33476435	33476435	+	Splice_Site	SNP	C	C	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:33476435C>A	ENST00000373449.2	-	7	736		c.e7-1		AK2_ENST00000491241.1_Splice_Site|AK2_ENST00000467905.1_Splice_Site|AK2_ENST00000548033.1_Splice_Site|RP1-117O3.2_ENST00000427524.1_RNA	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGATACTAGGCTGAAATAGAG	0.507																																					.													.	AK2	27		0			c.695-1G>T												88.0	81.0	83.0					1																	33476435		2203	4300	6503	SO:0001630	splice_region_variant	204	exon8			ACTAGGCTGAAAT	U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.695-1G>T	1.37:g.33476435C>A			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_1	32	0.19	6	NM_013411	5	0.00	0		Splice_Site	SNP	ENST00000373449.2	37	CCDS373.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798466	0.70567	.	.	ENSG00000004455	ENST00000373449;ENST00000548033	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8504	0.70292	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AK2	33249022	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.652000	0.54439	2.780000	0.95670	0.655000	0.94253	.			0.507	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000011884.1		NM_001625	Intron
SNIP1	79753	broad.mit.edu	37	1	38019751	38019751	+	Missense_Mutation	SNP	A	A	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:38019751A>C	ENST00000296215.6	-	1	152	c.80T>G	c.(79-81)gTg>gGg	p.V27G	SNIP1_ENST00000468040.1_Intron|DNALI1_ENST00000541606.1_5'Flank|DNALI1_ENST00000296218.7_5'Flank	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	27					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				CTTCACCACCACCCCCGCCGG	0.697																																					p.V27G													.	SNIP1	44		0			c.T80G												34.0	32.0	33.0					1																	38019751		2197	4296	6493	SO:0001583	missense	79753	exon1			ACCACCACCCCCG		CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.80T>G	1.37:g.38019751A>C	ENSP00000296215:p.Val27Gly		Somatic	73	0.1917808219	14		WXS	Illumina HiSeq	Phase_I	72	0.31	22	NM_024700	4	0.00	0	Q96SP9|Q9H9T7	Missense_Mutation	SNP	ENST00000296215.6	37	CCDS419.1	.	.	.	.	.	.	.	.	.	.	A	17.26	3.343721	0.61073	.	.	ENSG00000163877	ENST00000296215;ENST00000436196	T	0.15256	2.44	5.59	2.02	0.26589	.	0.337134	0.28067	N	0.016739	T	0.10078	0.0247	L	0.29908	0.895	0.44918	D	0.997938	B	0.30793	0.295	B	0.27608	0.081	T	0.22906	-1.0203	10	0.23302	T	0.38	-5.6612	7.4008	0.26962	0.7353:0.0:0.2647:0.0	.	27	Q8TAD8	SNIP1_HUMAN	G	27;11	ENSP00000296215:V27G	ENSP00000296215:V27G	V	-	2	0	SNIP1	37792338	0.803000	0.28956	0.902000	0.35471	0.301000	0.27625	1.885000	0.39678	0.505000	0.28104	-0.326000	0.08463	GTG			0.697	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012169.2		NM_024700	
PTGER3	5733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	71512740	71512740	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:71512740G>A	ENST00000306666.5	-	1	731	c.521C>T	c.(520-522)aCc>aTc	p.T174I	PTGER3_ENST00000370932.2_Missense_Mutation_p.T174I|PTGER3_ENST00000351052.5_Missense_Mutation_p.T174I|PTGER3_ENST00000370931.3_Missense_Mutation_p.T174I|PTGER3_ENST00000414819.1_Missense_Mutation_p.T174I|PTGER3_ENST00000354608.5_Missense_Mutation_p.T174I|PTGER3_ENST00000370924.4_Missense_Mutation_p.T174I|PTGER3_ENST00000460330.1_Missense_Mutation_p.T174I|PTGER3_ENST00000356595.4_Missense_Mutation_p.T174I|ZRANB2-AS1_ENST00000450461.1_RNA	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	174					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CACAGCGCGGGTGGCACGCGT	0.716																																					p.T174I													.	.			0			c.C521T												16.0	17.0	17.0					1																	71512740		2196	4286	6482	SO:0001583	missense	5733	exon1			GCGCGGGTGGCAC	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.521C>T	1.37:g.71512740G>A	ENSP00000302313:p.Thr174Ile		Somatic	45	0	0		WXS	Illumina HiSeq	.	59	0.15	9	NM_001126044	0		0	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	37	CCDS657.1	.	.	.	.	.	.	.	.	.	.	G	32	5.111544	0.94339	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.047399	0.85682	D	0.000000	T	0.42245	0.1194	L	0.45137	1.4	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.79784	0.993;0.983;0.989;0.993;0.993;0.971;0.984;0.993	T	0.05209	-1.0899	10	0.20046	T	0.44	-35.3647	18.6995	0.91615	0.0:0.0:1.0:0.0	.	174;174;174;174;174;174;174;174	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	I	174	ENSP00000359969:T174I;ENSP00000359970:T174I;ENSP00000280208:T174I;ENSP00000418073:T174I;ENSP00000346624:T174I;ENSP00000349003:T174I;ENSP00000401423:T174I;ENSP00000302313:T174I;ENSP00000359962:T174I	ENSP00000302313:T174I	T	-	2	0	PTGER3	71285328	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.603000	0.82811	2.643000	0.89663	0.462000	0.41574	ACC			0.716	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000026076.1		NM_000957	
AMY2A	279	broad.mit.edu	37	1	104160107	104160107	+	Silent	SNP	T	T	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:104160107T>C	ENST00000414303.2	+	1	109	c.45T>C	c.(43-45)gcT>gcC	p.A15A		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	15					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	TCTGCTGGGCTCAGTATTCCC	0.398																																					p.A15A													.	AMY2A	36		0			c.T45C												92.0	78.0	83.0					1																	104160107		2200	4258	6458	SO:0001819	synonymous_variant	279	exon1			CTGGGCTCAGTAT	BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.45T>C	1.37:g.104160107T>C			Somatic	468	0	0		WXS	Illumina HiSeq	Phase_I	668	0.01	8	NM_000699	1	0.00	0	B9EJG1|Q9UBH3	Silent	SNP	ENST00000414303.2	37	CCDS783.1	.	.	.	.	.	.	.	.	.	.	t	2.822	-0.244482	0.05906	.	.	ENSG00000243480	ENST00000423678	.	.	.	3.22	-1.05	0.10036	.	.	.	.	.	T	0.21761	0.0524	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32666	-0.9898	4	.	.	.	.	0.0536	0.00013	0.2919:0.2275:0.2249:0.2557	.	.	.	.	P	14	.	.	S	+	1	0	AMY2A	103961630	0.144000	0.22641	0.997000	0.53966	0.220000	0.24768	-0.636000	0.05465	0.019000	0.15079	0.374000	0.22700	TCA			0.398	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030315.1		NM_000699	
NTNG1	22854	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	107866930	107866930	+	Silent	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:107866930G>A	ENST00000370068.1	+	3	1119	c.273G>A	c.(271-273)gaG>gaA	p.E91E	NTNG1_ENST00000370070.2_Silent_p.E91E|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370066.1_Silent_p.E91E|NTNG1_ENST00000370071.2_Silent_p.E91E|NTNG1_ENST00000370065.1_Silent_p.E91E|NTNG1_ENST00000370072.3_Silent_p.E91E|NTNG1_ENST00000542803.1_Silent_p.E91E|NTNG1_ENST00000370074.4_Silent_p.E91E|NTNG1_ENST00000370061.3_Silent_p.E91E|NTNG1_ENST00000370067.1_Silent_p.E91E|NTNG1_ENST00000370073.2_Silent_p.E91E			Q9Y2I2	NTNG1_HUMAN	netrin G1	91	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.|NGL discriminant loop I.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GCAATAATGAGTGTGATGCGA	0.483																																					p.E91E													.	.			0			c.G273A												252.0	254.0	254.0					1																	107866930		2203	4300	6503	SO:0001819	synonymous_variant	22854	exon3			TAATGAGTGTGAT	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.273G>A	1.37:g.107866930G>A			Somatic	140	0	0		WXS	Illumina HiSeq	.	184	0.07	12	NM_014917	7	0.00	0	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Silent	SNP	ENST00000370068.1	37	CCDS44180.1																																																																																					0.483	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000030340.1		NM_014917	
MAB21L3	126868	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	116670202	116670202	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:116670202G>T	ENST00000369500.3	+	5	862	c.597G>T	c.(595-597)aaG>aaT	p.K199N	MAB21L3_ENST00000464946.1_3'UTR	NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	199										breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						CCTGGTCCAAGAAAGCCCGGT	0.587																																					p.K199N													.	.			0			c.G597T												80.0	73.0	75.0					1																	116670202		2203	4300	6503	SO:0001583	missense	126868	exon5			GTCCAAGAAAGCC	AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.597G>T	1.37:g.116670202G>T	ENSP00000358512:p.Lys199Asn		Somatic	125	0	0		WXS	Illumina HiSeq	.	186	0.09	16	NM_152367	0		0	Q5TDL7	Missense_Mutation	SNP	ENST00000369500.3	37	CCDS886.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680300	0.47886	.	.	ENSG00000173212	ENST00000369500	T	0.09350	2.99	5.92	2.87	0.33458	.	1.727610	0.02771	N	0.119682	T	0.05273	0.0140	L	0.57536	1.79	0.25333	N	0.989016	B	0.27316	0.175	B	0.27608	0.081	T	0.41413	-0.9510	10	0.27785	T	0.31	-15.2362	9.8614	0.41116	0.0698:0.2623:0.6679:0.0	.	199	Q8N8X9	MB213_HUMAN	N	199	ENSP00000358512:K199N	ENSP00000358512:K199N	K	+	3	2	MAB21L3	116471725	0.965000	0.33210	0.670000	0.29842	0.739000	0.42172	1.465000	0.35299	0.807000	0.34208	0.650000	0.86243	AAG			0.587	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033486.1		NM_152367	
RP11-344P13.4	0	broad.mit.edu	37	1	121245721	121245721	+	lincRNA	DEL	A	A	-			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:121245721delA	ENST00000437523.2	-	0	92																											ATAACAAaacaaaaaaaaaag	0.279																																					.													.	.			0			.																																											0	.			CAAAACAAAAAAA																													1.37:g.121245721delA			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	1	0.00	0		RNA	DEL	ENST00000437523.2	37																																																																																						0.279	RP11-344P13.4-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000472360.1			
PAQR6	79957	broad.mit.edu;mdanderson.org	37	1	156216033	156216033	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:156216033C>A	ENST00000292291.5	-	3	218	c.60G>T	c.(58-60)tgG>tgT	p.W20C	PAQR6_ENST00000540423.1_Missense_Mutation_p.W17C|PAQR6_ENST00000356983.2_5'UTR|PAQR6_ENST00000335852.1_5'UTR|PAQR6_ENST00000368270.1_5'UTR|PAQR6_ENST00000492619.1_5'UTR	NM_001272104.1|NM_001272105.1|NM_198406.2	NP_001259033.1|NP_001259034.1|NP_940798.1	Q6TCH4	PAQR6_HUMAN	progestin and adipoQ receptor family member VI	20						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			lung(4)|ovary(1)	5	Hepatocellular(266;0.158)					TGCCATCTTCCCAGAACACCT	0.592																																					p.W20C	GBM(16;219 398 12385 32425 38531)												.	PAQR6	23		0			c.G60T												82.0	79.0	80.0					1																	156216033		2203	4300	6503	SO:0001583	missense	79957	exon3			ATCTTCCCAGAAC	AF455045	CCDS1135.1, CCDS1136.1, CCDS60301.1, CCDS72945.1, CCDS72946.1	1q23	2008-02-05			ENSG00000160781	ENSG00000160781			30132	protein-coding gene	gene with protein product		614579				12477932	Standard	NM_024897		Approved	FLJ22672	uc010phh.2	Q6TCH4	OTTHUMG00000017490	ENST00000292291.5:c.60G>T	1.37:g.156216033C>A	ENSP00000292291:p.Trp20Cys		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	66	0.06	4	NM_001272104	7	0.14	1	B7Z9R9|D3DVB4|D3DVB6|Q5TCK9|Q6PDU0|Q7Z4Q7|Q7Z4Q9|Q8N121|Q8N3M2|Q9H621	Missense_Mutation	SNP	ENST00000292291.5	37	CCDS1136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.0|29.0	4.972744|4.972744	0.92919|0.92919	.|.	.|.	ENSG00000160781|ENSG00000160781	ENST00000340183|ENST00000292291;ENST00000540423	.|T;T	.|0.23754	.|1.91;1.89	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.454930|.	0.23191|.	N|.	0.050911|.	.|T	.|0.28499	.|0.0705	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D;D	.|0.56968	.|0.978;0.978	.|P;P	.|0.57776	.|0.827;0.827	.|T	.|0.02457	.|-1.1156	.|9	0.87932|0.72032	D|D	0|0.01	-18.1781|-18.1781	18.2012|18.2012	0.89839|0.89839	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|17;20	.|B7Z9R9;Q6TCH4	.|.;PAQR6_HUMAN	X|C	37|20;17	.|ENSP00000292291:W20C;ENSP00000443167:W17C	ENSP00000341926:G37X|ENSP00000292291:W20C	G|W	-|-	1|3	0|0	PAQR6|PAQR6	154482657|154482657	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	2.139000|2.139000	0.42149|0.42149	2.643000|2.643000	0.89663|0.89663	0.462000|0.462000	0.41574|0.41574	GGA|TGG			0.592	PAQR6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000046297.2		NM_024897	
LOC101928372	101928372	bcgsc.ca	37	1	160905610	160905610	+	lincRNA	SNP	G	G	A	rs557853130		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:160905610G>A	ENST00000427339.1	-	0	0				RP11-544M22.1_ENST00000356006.3_RNA																							CAAAGAGCTGGCACAGCAGGC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		21514	0.0		0.0	False		,,,				2504	0.001				.													.	.			0			.																																											0	.			GAGCTGGCACAGC																													1.37:g.160905610G>A			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_1	62	0.10	6	.	0		0		RNA	SNP	ENST00000427339.1	37																																																																																						0.547	RP11-312J18.6-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000071456.1			
DARS2	55157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	173802622	173802622	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:173802622C>A	ENST00000361951.4	+	6	1328	c.601C>A	c.(601-603)Ctc>Atc	p.L201I	DARS2_ENST00000239457.5_5'UTR	NM_018122.4	NP_060592.2	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	201					gene expression (GO:0010467)|mitochondrial asparaginyl-tRNA aminoacylation (GO:0070145)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aspartate-tRNA ligase activity (GO:0004815)|aspartate-tRNA(Asn) ligase activity (GO:0050560)|ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(4)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	30					L-Aspartic Acid(DB00128)	GCGGGAATATCTCTGTAATCT	0.428																																					p.L201I													.	.			0			c.C601A												109.0	101.0	104.0					1																	173802622		2203	4300	6503	SO:0001583	missense	55157	exon6			GAATATCTCTGTA	AK022754	CCDS1311.1	1q25.1	2011-07-01	2007-02-23		ENSG00000117593	ENSG00000117593	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	25538	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 2, mitochondrial"""	610956				15779907	Standard	NM_018122		Approved	FLJ10514	uc001gjh.2	Q6PI48	OTTHUMG00000034803	ENST00000361951.4:c.601C>A	1.37:g.173802622C>A	ENSP00000355086:p.Leu201Ile		Somatic	56	0	0		WXS	Illumina HiSeq	.	66	0.11	7	NM_018122	0		0		Missense_Mutation	SNP	ENST00000361951.4	37	CCDS1311.1	.	.	.	.	.	.	.	.	.	.	C	35	5.471421	0.96274	.	.	ENSG00000117593	ENST00000361951	D	0.84800	-1.9	5.94	5.94	0.96194	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	T	0.73410	0.3583	N	0.02345	-0.59	0.80722	D	1	D	0.54397	0.966	P	0.52909	0.713	T	0.83357	-0.0000	10	0.87932	D	0	-8.7424	19.1306	0.93404	0.0:1.0:0.0:0.0	.	201	Q6PI48	SYDM_HUMAN	I	201	ENSP00000355086:L201I	ENSP00000355086:L201I	L	+	1	0	DARS2	172069245	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.065000	0.71176	2.816000	0.96949	0.561000	0.74099	CTC			0.428	DARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084220.1		NM_018122	
TOR1AIP1	26092	broad.mit.edu	37	1	179851685	179851685	+	Silent	SNP	T	T	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:179851685T>G	ENST00000606911.2	+	1	239	c.48T>G	c.(46-48)ggT>ggG	p.G16G	TOR1AIP1_ENST00000271583.3_Silent_p.G16G|RP11-533E19.7_ENST00000610272.1_lincRNA|TOR1AIP1_ENST00000528443.2_Silent_p.G16G|TOR1AIP1_ENST00000435319.4_5'Flank			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	16					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						AAGGATGGGGTGTGTACGTCA	0.647																																					p.G16G													.	TOR1AIP1	58		0			c.T48G												10.0	9.0	10.0					1																	179851685		2175	4267	6442	SO:0001819	synonymous_variant	26092	exon1			ATGGGGTGTGTAC		CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.48T>G	1.37:g.179851685T>G			Somatic	39	0.2307692308	9		WXS	Illumina HiSeq	Phase_I	46	0.37	17	NM_001267578	2	0.50	1	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Silent	SNP	ENST00000606911.2	37	CCDS1335.1																																																																																					0.647	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000100313.4		NM_015602	
OR2L3	391192	hgsc.bcm.edu	37	1	248224864	248224864	+	Missense_Mutation	SNP	A	A	G	rs543066146		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr1:248224864A>G	ENST00000359959.3	+	1	881	c.881A>G	c.(880-882)aAg>aGg	p.K294R	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTGAGGAACAAGGAGGTGATG	0.502													a|||	1	0.000199681	0.0	0.0	5008	,	,		18589	0.001		0.0	False		,,,				2504	0.0				p.K294R													OR2L3,NS,carcinoma,+1,1	OR2L3	1	1	0			c.A881G												56.0	57.0	57.0					1																	248224864		2203	4300	6503	SO:0001583	missense	391192	exon1			GGAACAAGGAGGT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.881A>G	1.37:g.248224864A>G	ENSP00000353044:p.Lys294Arg		Somatic	53	0.0188679245	1		WXS	Illumina HiSeq	.	66	0.06	4	NM_001004687	0		0	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	A	9.463	1.093601	0.20471	.	.	ENSG00000198128	ENST00000359959	T	0.41065	1.01	2.01	-0.867	0.10655	.	.	.	.	.	T	0.36054	0.0953	M	0.63169	1.94	0.23762	N	0.996914	B	0.21821	0.061	B	0.23852	0.049	T	0.32348	-0.9910	9	0.37606	T	0.19	.	6.329	0.21259	0.7597:0.0:0.2403:0.0	.	294	Q8NG85	OR2L3_HUMAN	R	294	ENSP00000353044:K294R	ENSP00000353044:K294R	K	+	2	0	OR2L3	246291487	0.000000	0.05858	0.908000	0.35775	0.606000	0.37113	0.414000	0.21164	-0.373000	0.07979	-0.475000	0.04921	AAG			0.502	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096852.1		NM_001004687	
ASCC1	51008	broad.mit.edu	37	10	73956741	73956741	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr10:73956741G>T	ENST00000342444.4	-	6	502	c.401C>A	c.(400-402)aCt>aAt	p.T134N	ASCC1_ENST00000394915.3_Missense_Mutation_p.T134N|ASCC1_ENST00000394919.1_Missense_Mutation_p.T106N|ASCC1_ENST00000317126.4_Missense_Mutation_p.T106N|ASCC1_ENST00000317168.6_Missense_Mutation_p.T106N|ASCC1_ENST00000545550.1_Missense_Mutation_p.T128N	NM_001198799.2	NP_001185728.1	Q8N9N2	ASCC1_HUMAN	activating signal cointegrator 1 complex subunit 1	134	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|transcription factor complex (GO:0005667)	catalytic activity (GO:0003824)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	7						ATGCTGGCCAGTGATTACTGT	0.443																																					p.T134N													.	ASCC1	18		0			c.C401A												71.0	68.0	69.0					10																	73956741		2202	4299	6501	SO:0001583	missense	51008	exon6			TGGCCAGTGATTA	AY013290	CCDS31219.1, CCDS55713.1	10q22.1	2012-09-20			ENSG00000138303	ENSG00000138303			24268	protein-coding gene	gene with protein product		614215				10810093, 12077347	Standard	NM_001198799		Approved	CGI-18, ASC1p50, Em:AC022392.3	uc001jst.2	Q8N9N2	OTTHUMG00000018434	ENST00000342444.4:c.401C>A	10.37:g.73956741G>T	ENSP00000339404:p.Thr134Asn		Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_I	61	0.07	4	NM_001198799	9	0.00	0	Q5SW06|Q5SW07|Q96EI8|Q9Y307	Missense_Mutation	SNP	ENST00000342444.4	37	CCDS55713.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	25.3|25.3|25.3	4.619869|4.619869|4.619869	0.87460|0.87460|0.87460	.|.|.	.|.|.	ENSG00000138303|ENSG00000138303|ENSG00000138303	ENST00000486689|ENST00000525286|ENST00000394919;ENST00000342444;ENST00000317168;ENST00000373101;ENST00000503308;ENST00000317126;ENST00000545550;ENST00000394915;ENST00000530431;ENST00000531048;ENST00000530461;ENST00000527593;ENST00000524829	.|.|T;T;T;T;T;T;T;T;T;T	.|.|0.48522	.|.|1.42;1.42;1.42;1.42;1.42;1.42;0.81;1.42;1.42;1.42	5.64|5.64|5.64	4.73|4.73|4.73	0.59995|0.59995|0.59995	.|.|K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	.|.|0.045076	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.73466|0.73466|0.73466	0.3590|0.3590|0.3590	M|M|M	0.88570|0.88570|0.88570	2.965|2.965|2.965	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D	.|.|0.71674	.|.|0.995;0.998;0.994	.|.|P;D;P	.|.|0.72982	.|.|0.872;0.979;0.875	T|T|T	0.79727|0.79727|0.79727	-0.1682|-0.1682|-0.1682	5|5|10	.|.|0.56958	.|.|D	.|.|0.05	-7.7372|-7.7372|-7.7372	16.8709|16.8709|16.8709	0.86040|0.86040|0.86040	0.0:0.1284:0.8716:0.0|0.0:0.1284:0.8716:0.0|0.0:0.1284:0.8716:0.0	.|.|.	.|.|128;134;21	.|.|F5H874;Q8N9N2;B3KU20	.|.|.;ASCC1_HUMAN;.	Q|M|N	37|3|106;134;106;106;21;106;128;134;21;40;67;106;106	.|.|ENSP00000378377:T106N;ENSP00000339404:T134N;ENSP00000320810:T106N;ENSP00000320461:T106N;ENSP00000442121:T128N;ENSP00000378373:T134N;ENSP00000436098:T40N;ENSP00000431255:T67N;ENSP00000432418:T106N;ENSP00000431573:T106N	.|.|ENSP00000320461:T106N	H|L|T	-|-|-	3|1|2	2|2|0	ASCC1|ASCC1|ASCC1	73626747|73626747|73626747	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.979000|0.979000|0.979000	0.70002|0.70002|0.70002	9.052000|9.052000|9.052000	0.93855|0.93855|0.93855	1.505000|1.505000|1.505000	0.48720|0.48720|0.48720	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	CAC|CTG|ACT			0.443	ASCC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000048573.2		NM_015947	
GRK5	2869	mdanderson.org	37	10	121086116	121086116	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr10:121086116G>T	ENST00000392870.2	+	2	470	c.141G>T	c.(139-141)agG>agT	p.R47S		NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	47	N-terminal.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		ACCTCCGAAGGACCATAGGTA	0.557																																					p.R47S													.	.			0			c.G141T												59.0	55.0	57.0					10																	121086116		2203	4300	6503	SO:0001583	missense	2869	exon2			CCGAAGGACCATA	L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.141G>T	10.37:g.121086116G>T	ENSP00000376609:p.Arg47Ser		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_005308	0		0	D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	G	8.279	0.815162	0.16607	.	.	ENSG00000198873	ENST00000369106;ENST00000392870	T	0.02258	4.37	5.02	2.09	0.27110	Regulator of G protein signalling superfamily (1);	0.216753	0.30667	U	0.009139	T	0.01592	0.0051	N	0.24115	0.695	0.58432	D	0.999999	B	0.13594	0.008	B	0.14023	0.01	T	0.51647	-0.8679	10	0.10902	T	0.67	-20.3397	8.1281	0.31012	0.3618:0.0:0.6382:0.0	.	47	P34947	GRK5_HUMAN	S	47	ENSP00000376609:R47S	ENSP00000358102:R47S	R	+	3	2	GRK5	121076106	0.960000	0.32886	0.994000	0.49952	0.993000	0.82548	0.329000	0.19698	0.608000	0.30000	0.655000	0.94253	AGG			0.557	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050652.2		NM_005308	
RNASEH2C	84153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65487762	65487762	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr11:65487762C>A	ENST00000308418.4	-	2	487	c.299G>T	c.(298-300)cGg>cTg	p.R100L	RNASEH2C_ENST00000528220.1_Missense_Mutation_p.R17L|RNASEH2C_ENST00000527610.1_Missense_Mutation_p.R100L	NM_032193.3	NP_115569.2	Q8TDP1	RNH2C_HUMAN	ribonuclease H2, subunit C	100					RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)				cervix(1)	1						CCCGGAATCCCGCAAGGGGTC	0.632																																					p.R100L													.	.			0			c.G299T												81.0	90.0	87.0					11																	65487762		2201	4297	6498	SO:0001583	missense	84153	exon2			GAATCCCGCAAGG	AF312034	CCDS8111.1	11q13.1	2014-09-17							24116	protein-coding gene	gene with protein product	"""Aicardi-Goutieres syndrome 3"""	610330				8244390, 16845400	Standard	NM_032193		Approved	AYP1, AGS3	uc001ofn.3	Q8TDP1		ENST00000308418.4:c.299G>T	11.37:g.65487762C>A	ENSP00000308193:p.Arg100Leu		Somatic	67	0	0		WXS	Illumina HiSeq	.	53	0.17	9	NM_032193	181	0.18	33	Q9H7F5	Missense_Mutation	SNP	ENST00000308418.4	37	CCDS8111.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.835337	0.32421	.	.	ENSG00000172922	ENST00000308418;ENST00000528220;ENST00000527610	D;D;D	0.91464	-2.85;-2.85;-2.85	4.62	-3.3	0.05003	.	1.706710	0.03395	N	0.202498	D	0.87370	0.6160	L	0.56769	1.78	0.09310	N	1	B	0.30914	0.3	B	0.28916	0.096	T	0.72786	-0.4188	10	0.28530	T	0.3	-2.721	9.6269	0.39757	0.0:0.382:0.0:0.618	.	100	Q8TDP1	RNH2C_HUMAN	L	100;17;100	ENSP00000308193:R100L;ENSP00000431555:R17L;ENSP00000432897:R100L	ENSP00000308193:R100L	R	-	2	0	RNASEH2C	65244338	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.857000	0.01660	-0.853000	0.04136	-0.139000	0.14373	CGG			0.632	RNASEH2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390693.2		NM_032193	
TENM4	26011	mdanderson.org	37	11	78614378	78614378	+	Silent	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr11:78614378G>T	ENST00000278550.7	-	7	1146	c.684C>A	c.(682-684)ggC>ggA	p.G228G		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	228	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GCTCCTGGGCGCCGCCGGCAG	0.701																																					p.G228G													.	.			0			c.C684A												9.0	13.0	12.0					11																	78614378		688	1587	2275	SO:0001819	synonymous_variant	26011	exon7			CTGGGCGCCGCCG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.684C>A	11.37:g.78614378G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001098816	0		0	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																					0.701	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391406.2			
ARHGAP32	9743	mdanderson.org	37	11	128844779	128844779	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr11:128844779G>T	ENST00000310343.9	-	20	2270	c.2271C>A	c.(2269-2271)gaC>gaA	p.D757E	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.D683E|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.D408E|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.D408E	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	757					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CACTCTCATTGTCATGAGGCA	0.498																																					p.D757E													.	.			0			c.C2271A												73.0	66.0	69.0					11																	128844779		2201	4297	6498	SO:0001583	missense	9743	exon20			CTCATTGTCATGA	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2271C>A	11.37:g.128844779G>T	ENSP00000310561:p.Asp757Glu		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001142685	0		0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	G	6.413	0.444233	0.12164	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	5.59	3.7	0.42460	.	0.350015	0.33110	N	0.005275	T	0.15782	0.0380	L	0.29908	0.895	0.25435	N	0.98815	B;P	0.50369	0.349;0.934	B;P	0.46885	0.142;0.53	T	0.07309	-1.0779	10	0.06494	T	0.89	.	10.2681	0.43466	0.0749:0.1366:0.7885:0.0	.	691;757	Q86T64;A7KAX9	.;RHG32_HUMAN	E	757;408;683;691;408	ENSP00000310561:D757E;ENSP00000376425:D408E;ENSP00000432468:D683E;ENSP00000432862:D408E	ENSP00000310561:D757E	D	-	3	2	ARHGAP32	128349989	1.000000	0.71417	0.325000	0.25375	0.881000	0.50899	3.054000	0.49908	0.704000	0.31869	0.650000	0.86243	GAC			0.498	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386151.3		NM_014715	
KIF5A	3798	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	57965876	57965876	+	Silent	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr12:57965876G>A	ENST00000455537.2	+	14	1669	c.1395G>A	c.(1393-1395)aaG>aaA	p.K465K	KIF5A_ENST00000286452.5_Silent_p.K376K	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	465					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						ACAACGAGAAGGTCCAGCGGG	0.572																																					p.K465K													.	KIF5A	143		0			c.G1395A												70.0	63.0	66.0					12																	57965876		2202	4300	6502	SO:0001819	synonymous_variant	3798	exon14			CGAGAAGGTCCAG	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1395G>A	12.37:g.57965876G>A			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	60	0.08	5	NM_004984	1	0.00	0	A6H8M5|Q4LE26	Silent	SNP	ENST00000455537.2	37	CCDS8945.1																																																																																					0.572	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407634.1		NM_004984	
PPM1H	57460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	63225974	63225974	+	Missense_Mutation	SNP	T	T	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr12:63225974T>A	ENST00000228705.6	-	2	631	c.331A>T	c.(331-333)Acc>Tcc	p.T111S		NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	111							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		GGGGTTGAGGTCACGGCCCCT	0.557																																					p.T111S													.	.			0			c.A331T												97.0	94.0	95.0					12																	63225974		1969	4146	6115	SO:0001583	missense	57460	exon2			TTGAGGTCACGGC	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.331A>T	12.37:g.63225974T>A	ENSP00000228705:p.Thr111Ser		Somatic	92	0	0		WXS	Illumina HiSeq	.	131	0.17	22	NM_020700	0		0	B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	ENST00000228705.6	37	CCDS44934.1	.	.	.	.	.	.	.	.	.	.	T	0.022	-1.408249	0.01155	.	.	ENSG00000111110	ENST00000228705	T	0.41065	1.01	5.64	1.95	0.26073	Protein phosphatase 2C-like (2);	0.604741	0.16953	N	0.192799	T	0.23133	0.0559	N	0.17082	0.46	0.21105	N	0.999787	B	0.02656	0.0	B	0.04013	0.001	T	0.20672	-1.0268	9	.	.	.	.	8.1225	0.30980	0.0:0.235:0.0:0.765	.	111	Q9ULR3	PPM1H_HUMAN	S	111	ENSP00000228705:T111S	.	T	-	1	0	PPM1H	61512241	0.282000	0.24268	0.196000	0.23383	0.040000	0.13550	1.052000	0.30429	0.089000	0.17243	-0.263000	0.10527	ACC			0.557	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406760.2		NM_020700	
NAV3	89795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	78591111	78591111	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr12:78591111G>C	ENST00000397909.2	+	35	6549	c.6376G>C	c.(6376-6378)Gat>Cat	p.D2126H	NAV3_ENST00000536525.2_Missense_Mutation_p.D2104H|NAV3_ENST00000266692.7_Missense_Mutation_p.D1927H|NAV3_ENST00000228327.6_Missense_Mutation_p.D2104H|NAV3_ENST00000541270.1_5'Flank			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2126						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AATAATTCTTGATAATCTTCA	0.338										HNSCC(70;0.22)																											p.D2104H													.	.			0			c.G6310C												125.0	114.0	118.0					12																	78591111		1838	4083	5921	SO:0001583	missense	89795	exon34			ATTCTTGATAATC	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6376G>C	12.37:g.78591111G>C	ENSP00000381007:p.Asp2126His		Somatic	50	0	0		WXS	Illumina HiSeq	.	76	0.14	11	NM_014903	0		0	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.640548|4.640548	0.87859|0.87859	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.96041|.	-3.89;-3.89;-3.89;-3.89;-3.89|.	5.35|5.35	5.35|5.35	0.76521|0.76521	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.41294|.	U|.	0.000913|.	D|.	0.91019|.	0.7175|.	H|H	0.98487|0.98487	4.245|4.245	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.998;1.0;0.999|.	D|.	0.94245|.	0.7488|.	10|.	0.87932|.	D|.	0|.	-22.1732|-22.1732	19.4322|19.4322	0.94775|0.94775	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2104;1927;2126;2104|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	H|S	2104;2126;2104;1927;718;726|998	ENSP00000446132:D2104H;ENSP00000381007:D2126H;ENSP00000228327:D2104H;ENSP00000266692:D1927H;ENSP00000448303:D726H|.	ENSP00000228327:D2104H|.	D|X	+|+	1|2	0|2	NAV3|NAV3	77115242|77115242	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.979000|0.979000	0.70002|0.70002	9.813000|9.813000	0.99286|0.99286	2.649000|2.649000	0.89929|0.89929	0.655000|0.655000	0.94253|0.94253	GAT|TGA			0.338	NAV3-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000406812.1		NM_001024383	
SRSF9	8683	mdanderson.org	37	12	120907259	120907259	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr12:120907259C>T	ENST00000229390.3	-	1	337	c.154G>A	c.(154-156)Gtg>Atg	p.V52M	DYNLL1_ENST00000548342.1_5'Flank|DYNLL1_ENST00000392509.2_5'Flank	NM_003769.2	NP_003760.1	Q13242	SRSF9_HUMAN	serine/arginine-rich splicing factor 9	52	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	9						GCGAAGGGCACGAGGCCGTGC	0.692																																					p.V52M													.	.			0			c.G154A												51.0	54.0	53.0					12																	120907259		2203	4300	6503	SO:0001583	missense	8683	exon1			AGGGCACGAGGCC	U30825	CCDS9199.1	12q24.31	2013-02-12	2010-06-22	2010-06-22	ENSG00000111786	ENSG00000111786		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10791	protein-coding gene	gene with protein product	"""SR splicing factor 9"""	601943	"""splicing factor, arginine/serine-rich 9"""	SFRS9		7556075, 20516191	Standard	NM_003769		Approved	SRp30c	uc001tyi.3	Q13242	OTTHUMG00000047790	ENST00000229390.3:c.154G>A	12.37:g.120907259C>T	ENSP00000229390:p.Val52Met		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_003769	85	0.00	0	Q52LD1	Missense_Mutation	SNP	ENST00000229390.3	37	CCDS9199.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.959165|3.959165	0.74016|0.74016	.|.	.|.	ENSG00000111786|ENSG00000111786	ENST00000550458|ENST00000229390	.|T	.|0.05996	.|3.36	4.53|4.53	4.53|4.53	0.55603|0.55603	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.356857	.|0.25777	.|N	.|0.028368	T|T	0.08980|0.08980	0.0222|0.0222	N|N	0.19112|0.19112	0.55|0.55	0.25986|0.25986	N|N	0.982313|0.982313	.|D;P	.|0.58970	.|0.984;0.953	.|P;P	.|0.50860	.|0.639;0.652	T|T	0.08166|0.08166	-1.0735|-1.0735	5|10	.|0.87932	.|D	.|0	.|.	16.2483|16.2483	0.82460|0.82460	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|52;52	.|B4DFT9;Q13242	.|.;SRSF9_HUMAN	H|M	39|52	.|ENSP00000229390:V52M	.|ENSP00000229390:V52M	R|V	-|-	2|1	0|0	SRSF9|SRSF9	119391642|119391642	0.002000|0.002000	0.14202|0.14202	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.339000|0.339000	0.19875|0.19875	2.362000|2.362000	0.80069|0.80069	0.499000|0.499000	0.49734|0.49734	CGT|GTG			0.692	SRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000108983.2		NM_003769	
HSPH1	10808	mdanderson.org	37	13	31727058	31727058	+	Silent	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr13:31727058G>T	ENST00000320027.5	-	5	804	c.460C>A	c.(460-462)Cga>Aga	p.R154R	HSPH1_ENST00000445273.2_Silent_p.R156R|HSPH1_ENST00000380405.4_Silent_p.R154R|HSPH1_ENST00000429785.2_Intron|HSPH1_ENST00000380406.5_Silent_p.R113R	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	154					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		AACACAGATCGCCTCTCAGCA	0.373																																					p.R154R													HSPH1,NS,carcinoma,0,1	HSPH1	0	1	0			c.C460A												180.0	174.0	176.0					13																	31727058		2203	4299	6502	SO:0001819	synonymous_variant	10808	exon5			CAGATCGCCTCTC	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.460C>A	13.37:g.31727058G>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_006644	5	0.00	0	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Silent	SNP	ENST00000320027.5	37	CCDS9340.1																																																																																					0.373	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044384.1			
ABHD12B	145447	mdanderson.org	37	14	51371075	51371075	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr14:51371075G>T	ENST00000337334.2	+	13	1095	c.1080G>T	c.(1078-1080)caG>caT	p.Q360H	PYGL_ENST00000532462.1_Intron|ABHD12B_ENST00000395752.1_Missense_Mutation_p.Q253H|ABHD12B_ENST00000353130.1_Missense_Mutation_p.Q283H	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B	360							hydrolase activity (GO:0016787)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					TGAGCAAGCAGTGGTCATGAG	0.418																																					p.Q360H													.	.			0			c.G1080T												177.0	181.0	179.0					14																	51371075		2203	4300	6503	SO:0001583	missense	145447	exon13			CAAGCAGTGGTCA	BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.1080G>T	14.37:g.51371075G>T	ENSP00000336693:p.Gln360His		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001206673	31	0.00	0	Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	Missense_Mutation	SNP	ENST00000337334.2	37	CCDS55916.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107286	0.37145	.	.	ENSG00000131969	ENST00000353130;ENST00000337334;ENST00000395752	T;T;T	0.36699	2.23;1.24;2.25	4.94	3.11	0.35812	.	0.324668	0.28618	N	0.014701	T	0.27933	0.0688	L	0.44542	1.39	0.30960	N	0.723774	B;B	0.22414	0.069;0.043	B;B	0.21917	0.037;0.018	T	0.19451	-1.0305	10	0.33940	T	0.23	-11.7539	8.3627	0.32367	0.1871:0.0:0.8129:0.0	.	360;283	Q7Z5M8;Q7Z5M8-2	AB12B_HUMAN;.	H	283;360;253	ENSP00000343951:Q283H;ENSP00000336693:Q360H;ENSP00000379101:Q253H	ENSP00000336693:Q360H	Q	+	3	2	ABHD12B	50440825	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	0.885000	0.28227	0.762000	0.33152	-0.126000	0.14955	CAG			0.418	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000411030.1			
ACOT6	641372	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	74086215	74086215	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr14:74086215A>G	ENST00000381139.1	+	2	627	c.296A>G	c.(295-297)aAg>aGg	p.K99R	RP3-414A15.10_ENST00000555011.1_RNA|RP3-414A15.10_ENST00000555500.1_RNA	NM_001037162.1	NP_001032239.1	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6	99						cytosol (GO:0005829)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00331)		CCATTGGAAAAGGCGCAGGTG	0.433																																					p.K99R													.	ACOT6	12		0			c.A296G												85.0	83.0	84.0					14																	74086215		2203	4300	6503	SO:0001583	missense	641372	exon2			TGGAAAAGGCGCA	DQ082756, BF109853	CCDS32118.1	14q24.3	2011-02-16			ENSG00000205669	ENSG00000205669		"""Acyl CoA thioesterases"""	33159	protein-coding gene	gene with protein product		614267	"""chromosome 14 open reading frame 42"""	C14orf42		16940157	Standard	NM_001037162		Approved		uc001xop.3	Q3I5F7		ENST00000381139.1:c.296A>G	14.37:g.74086215A>G	ENSP00000370531:p.Lys99Arg		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	86	0.06	5	NM_001037162	0		0		Missense_Mutation	SNP	ENST00000381139.1	37	CCDS32118.1	.	.	.	.	.	.	.	.	.	.	A	4.112	0.019001	0.08006	.	.	ENSG00000205669	ENST00000554229;ENST00000381139	T;T	0.28895	1.59;1.59	5.8	4.64	0.57946	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.167275	0.49305	N	0.000141	T	0.17577	0.0422	N	0.25060	0.705	0.29670	N	0.842511	B	0.14012	0.009	B	0.19946	0.027	T	0.24905	-1.0147	10	0.10111	T	0.7	4.6851	7.8009	0.29174	0.7674:0.0:0.2326:0.0	.	99	Q3I5F7	ACOT6_HUMAN	R	99	ENSP00000451464:K99R;ENSP00000370531:K99R	ENSP00000370531:K99R	K	+	2	0	ACOT6	73155968	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	1.978000	0.40598	1.002000	0.39104	0.459000	0.35465	AAG			0.433	ACOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414437.1		NM_001037162	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96761397	96761397	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr14:96761397G>C	ENST00000359933.4	-	36	6219	c.5326C>G	c.(5326-5328)Caa>Gaa	p.Q1776E	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1776					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CTATCATTTTGGGAAGGCTGT	0.448																																					p.Q1776E													.	.			0			c.C5326G												93.0	87.0	89.0					14																	96761397		2203	4300	6503	SO:0001583	missense	55102	exon36			CATTTTGGGAAGG	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.5326C>G	14.37:g.96761397G>C	ENSP00000353010:p.Gln1776Glu		Somatic	150	0	0		WXS	Illumina HiSeq	.	152	0.13	19	NM_018036	4	0.25	1	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	G	5.786	0.329443	0.10956	.	.	ENSG00000066739	ENST00000359933	T	0.08984	3.03	5.12	4.23	0.50019	.	0.469944	0.23782	N	0.044617	T	0.03651	0.0104	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45234	-0.9275	10	0.02654	T	1	.	5.7247	0.18006	0.078:0.1453:0.6441:0.1326	.	1776	Q96BY7	ATG2B_HUMAN	E	1776	ENSP00000353010:Q1776E	ENSP00000261834:Q420E	Q	-	1	0	ATG2B	95831150	0.972000	0.33761	0.020000	0.16555	0.849000	0.48306	1.989000	0.40707	1.305000	0.44909	0.561000	0.74099	CAA			0.448	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314037.1		NM_018036	
FAM98B	283742	broad.mit.edu	37	15	38762579	38762579	+	Silent	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr15:38762579G>A	ENST00000491535.1	+	4	512	c.504G>A	c.(502-504)ccG>ccA	p.P168P	FAM98B_ENST00000397609.2_Silent_p.P168P	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B	168						cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		CTGACATTCCGCATATGCTAA	0.303																																					p.P168P													.	FAM98B	53		0			c.G504A												53.0	54.0	54.0					15																	38762579		2200	4293	6493	SO:0001819	synonymous_variant	283742	exon4			CATTCCGCATATG		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831	ENST00000491535.1:c.504G>A	15.37:g.38762579G>A			Somatic	371	0	0		WXS	Illumina HiSeq	Phase_I	443	0.01	6	NM_001042429	9	0.00	0	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	37	CCDS42015.1																																																																																					0.303	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252071.2		NM_173611	
INO80	54617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41308347	41308347	+	Missense_Mutation	SNP	T	T	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr15:41308347T>G	ENST00000361937.3	-	27	3765	c.3341A>C	c.(3340-3342)aAg>aCg	p.K1114T	RP11-540O11.7_ENST00000558101.1_RNA|RP11-540O11.4_ENST00000558967.1_RNA|INO80_ENST00000401393.3_Missense_Mutation_p.K1114T			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1114	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CCCTTGAGACTTGAGCCGAGT	0.532																																					p.K1114T													.	.			0			c.A3341C												103.0	82.0	89.0					15																	41308347		2203	4300	6503	SO:0001583	missense	54617	exon27			TGAGACTTGAGCC	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3341A>C	15.37:g.41308347T>G	ENSP00000355205:p.Lys1114Thr		Somatic	66	0	0		WXS	Illumina HiSeq	.	58	0.14	8	NM_017553	8	0.25	2	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	T	32	5.110567	0.94292	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.81579	-1.51;-1.51	6.03	6.03	0.97812	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89104	0.6620	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.89817	0.3986	10	0.66056	D	0.02	.	16.5594	0.84535	0.0:0.0:0.0:1.0	.	1114	Q9ULG1	INO80_HUMAN	T	1114	ENSP00000355205:K1114T;ENSP00000384686:K1114T	ENSP00000355205:K1114T	K	-	2	0	INO80	39095639	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.021000	0.88750	2.313000	0.78055	0.519000	0.50382	AAG			0.532	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252527.2		NM_017553	
SLC9A3R2	9351	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	2086857	2086857	+	Silent	SNP	C	C	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:2086857C>G	ENST00000424542.2	+	4	861	c.723C>G	c.(721-723)gtC>gtG	p.V241V	SLC9A3R2_ENST00000566198.1_Silent_p.V130V|SLC9A3R2_ENST00000563587.1_Silent_p.V135V|SLC9A3R2_ENST00000432365.2_Silent_p.V241V|NTHL1_ENST00000562951.1_5'Flank	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2	241					negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)	2						GGCTTCGGGTCACACCCACCG	0.672																																					p.V241V	Ovarian(69;105 1552 17724 23473)												.	.			0			c.C723G												29.0	41.0	37.0					16																	2086857		2125	4222	6347	SO:0001819	synonymous_variant	9351	exon4			TCGGGTCACACCC	AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956	ENST00000424542.2:c.723C>G	16.37:g.2086857C>G			Somatic	84	0	0		WXS	Illumina HiSeq	.	96	0.07	7	NM_004785	40	0.08	3	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Silent	SNP	ENST00000424542.2	37	CCDS45382.1																																																																																					0.672	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434448.1			
RNPS1	10921	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2312409	2312409	+	Silent	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:2312409G>T	ENST00000565678.1	-	6	1091	c.546C>A	c.(544-546)tcC>tcA	p.S182S	RNPS1_ENST00000567147.1_Silent_p.S159S|RNPS1_ENST00000320225.5_Silent_p.S182S|RNPS1_ENST00000566397.1_Silent_p.S5S|RNPS1_ENST00000301730.8_Silent_p.S182S|RNPS1_ENST00000397086.2_Silent_p.S182S|RNPS1_ENST00000568631.1_Silent_p.S182S|RNPS1_ENST00000569598.2_Silent_p.S88S|RNPS1_ENST00000566458.1_Silent_p.S159S|RNPS1_ENST00000561718.1_Silent_p.S5S			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	182	Interaction with SAP18 and ACIN1.|Necessary for interaction with PNN and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						TCCCATAGGTGGAAAATATCT	0.483																																					p.S182S													.	RNPS1	18		0			c.C546A												80.0	76.0	77.0					16																	2312409		2198	4300	6498	SO:0001819	synonymous_variant	10921	exon6			ATAGGTGGAAAAT	AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.546C>A	16.37:g.2312409G>T			Somatic	58	0.0172413793	1		WXS	Illumina HiSeq	Phase_I	64	0.22	14	NM_006711	46	0.33	15	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Silent	SNP	ENST00000565678.1	37	CCDS10465.1																																																																																					0.483	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435415.1		NM_080594	
RNPS1	10921	mdanderson.org	37	16	2312754	2312754	+	Missense_Mutation	SNP	C	C	T	rs562706355		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:2312754C>T	ENST00000565678.1	-	5	1054	c.509G>A	c.(508-510)cGg>cAg	p.R170Q	RNPS1_ENST00000567147.1_Missense_Mutation_p.R147Q|RNPS1_ENST00000320225.5_Missense_Mutation_p.R170Q|RNPS1_ENST00000566397.1_5'UTR|RNPS1_ENST00000301730.8_Missense_Mutation_p.R170Q|RNPS1_ENST00000397086.2_Missense_Mutation_p.R170Q|RNPS1_ENST00000568631.1_Missense_Mutation_p.R170Q|RNPS1_ENST00000569598.2_Missense_Mutation_p.R76Q|RNPS1_ENST00000566458.1_Missense_Mutation_p.R147Q|RNPS1_ENST00000561718.1_5'UTR			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	170	Interaction with SAP18 and ACIN1.|Necessary for interaction with PNN and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						TGTCACATTCCGGGTGAGTCT	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		20183	0.0		0.0	False		,,,				2504	0.001				p.R170Q													.	.			0			c.G509A												120.0	101.0	108.0					16																	2312754		2198	4300	6498	SO:0001583	missense	10921	exon5			ACATTCCGGGTGA	AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.509G>A	16.37:g.2312754C>T	ENSP00000457723:p.Arg170Gln		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_006711	53	0.00	0	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Missense_Mutation	SNP	ENST00000565678.1	37	CCDS10465.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995431	0.74703	.	.	ENSG00000205937	ENST00000320225;ENST00000397086;ENST00000301730	T;T;T	0.15952	2.38;2.38;2.38	5.95	4.99	0.66335	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.194894	0.53938	D	0.000048	T	0.32102	0.0818	L	0.39397	1.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.00800	-1.1561	10	0.62326	D	0.03	-18.9283	13.2902	0.60267	0.0:0.9219:0.0:0.0781	.	147;170	Q15287-2;Q15287	.;RNPS1_HUMAN	Q	170	ENSP00000315859:R170Q;ENSP00000380275:R170Q;ENSP00000301730:R170Q	ENSP00000301730:R170Q	R	-	2	0	RNPS1	2252755	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	5.667000	0.68067	2.826000	0.97356	0.579000	0.79373	CGG			0.507	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435415.1		NM_080594	
CCNF	899	mdanderson.org	37	16	2487271	2487271	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:2487271G>T	ENST00000397066.4	+	5	576	c.488G>T	c.(487-489)tGc>tTc	p.C163F		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	163					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				AGCGGAAGCTGCTGCAAGGCC	0.652																																					p.C163F													.	.			0			c.G488T												43.0	39.0	41.0					16																	2487271		2198	4300	6498	SO:0001583	missense	899	exon5			GAAGCTGCTGCAA	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.488G>T	16.37:g.2487271G>T	ENSP00000380256:p.Cys163Phe		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_001761	1	0.00	0	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914680	0.92178	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.61742	0.08	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.77177	0.4092	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78989	-0.1986	10	0.87932	D	0	-28.7559	18.3739	0.90428	0.0:0.0:1.0:0.0	.	163	P41002	CCNF_HUMAN	F	163;78	ENSP00000380256:C163F	ENSP00000293968:C78F	C	+	2	0	CCNF	2427272	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.597000	0.98273	2.689000	0.91719	0.655000	0.94253	TGC			0.652	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250801.1		NM_001761	
GTF3C1	2975	mdanderson.org	37	16	27544702	27544702	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:27544702G>T	ENST00000356183.4	-	5	774	c.759C>A	c.(757-759)agC>agA	p.S253R	GTF3C1_ENST00000561623.1_Missense_Mutation_p.S253R	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	253					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TGTCGTATTTGCTCCTCCTGC	0.468																																					p.S253R													.	.			0			c.C759A												124.0	102.0	110.0					16																	27544702		2197	4300	6497	SO:0001583	missense	2975	exon5			GTATTTGCTCCTC	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.759C>A	16.37:g.27544702G>T	ENSP00000348510:p.Ser253Arg		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001520	2	0.00	0	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513254	0.64522	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.26373	1.74	5.96	3.57	0.40892	.	0.224065	0.48767	D	0.000171	T	0.33527	0.0866	L	0.29908	0.895	0.39123	D	0.961698	D;D	0.76494	0.999;0.997	D;D	0.68621	0.959;0.939	T	0.13764	-1.0497	10	0.52906	T	0.07	-4.2526	9.3473	0.38115	0.2831:0.0:0.7169:0.0	.	253;253	Q12789;Q12789-3	TF3C1_HUMAN;.	R	253;251	ENSP00000348510:S253R	ENSP00000348510:S253R	S	-	3	2	GTF3C1	27452203	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	0.719000	0.25881	1.369000	0.46134	0.650000	0.86243	AGC			0.468	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433856.1		NM_001520	
APOBR	55911	mdanderson.org	37	16	28509769	28509769	+	Silent	SNP	G	G	A	rs368617607		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:28509769G>A	ENST00000431282.1	+	5	3220	c.3210G>A	c.(3208-3210)gcG>gcA	p.A1070A	CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Silent_p.A1079A|APOBR_ENST00000328423.5_Intron			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	1070					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						TTGGCCTCGCGCACCCTGGCA	0.677																																					p.A1079A													APOBR,NS,carcinoma,+2,1	APOBR	2	1	0			c.G3237A							G		0,4062		0,0,2031	23.0	29.0	27.0		3210	-6.4	0.0	16		27	1,8305		0,1,4152	no	coding-synonymous	APOBR	NM_018690.3		0,1,6183	AA,AG,GG		0.012,0.0,0.0081		1070/1089	28509769	1,12367	2031	4153	6184	SO:0001819	synonymous_variant	55911	exon4			CCTCGCGCACCCT	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.3210G>A	16.37:g.28509769G>A			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_018690	154	0.00	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	37																																																																																						0.677	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_182804	
RNF40	9810	broad.mit.edu	37	16	30783266	30783266	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:30783266A>G	ENST00000324685.6	+	18	3134	c.2699A>G	c.(2698-2700)aAa>aGa	p.K900R	RNF40_ENST00000402121.3_Missense_Mutation_p.K592R|RNF40_ENST00000563683.1_Missense_Mutation_p.K860R|RNF40_ENST00000567365.1_3'UTR|RNF40_ENST00000357890.5_Missense_Mutation_p.K800R	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	900					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GCTCGTGAGAAAGAGAGCTTC	0.667																																					p.K900R													.	RNF40	83		0			c.A2699G												35.0	35.0	35.0					16																	30783266		2197	4298	6495	SO:0001583	missense	9810	exon18			GTGAGAAAGAGAG	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.2699A>G	16.37:g.30783266A>G	ENSP00000325677:p.Lys900Arg		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	134	0.04	5	NM_014771	31	0.00	0	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	37	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	a	14.70	2.612450	0.46631	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121;ENST00000538323	T;T;T	0.33865	1.39;1.41;1.4	5.72	5.72	0.89469	.	0.052214	0.85682	D	0.000000	T	0.31979	0.0814	L	0.31845	0.965	0.41235	D	0.986605	B;B;P;B;B	0.39071	0.003;0.005;0.658;0.187;0.114	B;B;B;B;B	0.40506	0.011;0.012;0.331;0.063;0.035	T	0.06698	-1.0812	10	0.30854	T	0.27	-24.8752	14.9927	0.71401	1.0:0.0:0.0:0.0	.	232;592;800;900;900	F6SYU7;F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;.;BRE1B_HUMAN	R	900;800;592;232	ENSP00000325677:K900R;ENSP00000350563:K800R;ENSP00000384942:K592R	ENSP00000325677:K900R	K	+	2	0	RNF40	30690767	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	5.910000	0.69931	2.195000	0.70347	0.529000	0.55759	AAA			0.667	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255524.2		NM_014771	
AC012322.1	0	bcgsc.ca	37	16	64294526	64294526	+	lincRNA	SNP	C	C	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:64294526C>G	ENST00000561657.1	-	0	584																											TTGAGTTCTACCCATGACTGC	0.428																																					.													.	.			0			.																																											0	.			GTTCTACCCATGA																													16.37:g.64294526C>G			Somatic	88	0.0113636364	1		WXS	Illumina HiSeq	Phase_1	82	0.06	5	.	0		0		RNA	SNP	ENST00000561657.1	37																																																																																						0.428	AC012322.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000420578.1			
ZNF276	92822	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	89789843	89789843	+	Silent	SNP	C	C	G	rs200666334		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr16:89789843C>G	ENST00000443381.2	+	4	829	c.732C>G	c.(730-732)acC>acG	p.T244T	ZNF276_ENST00000568064.1_Missense_Mutation_p.P163R|ZNF276_ENST00000289816.5_Silent_p.T169T|ZNF276_ENST00000446326.2_Missense_Mutation_p.P41R|VPS9D1_ENST00000389386.3_5'Flank	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	244					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CCATGGATACCAGCTCCAGCT	0.652																																					p.T244T													.	ZNF276	70		0			c.C732G												53.0	43.0	46.0					16																	89789843		2197	4298	6495	SO:0001819	synonymous_variant	92822	exon4			GGATACCAGCTCC	AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.732C>G	16.37:g.89789843C>G			Somatic	114	0.0087719298	1		WXS	Illumina HiSeq	Phase_I	133	0.08	11	NM_001113525	15	0.13	2	Q0VGA1|Q2TBE8|Q3B7H7	Missense_Mutation	SNP	ENST00000443381.2	37	CCDS45554.1	.	.	.	.	.	.	.	.	.	.	C	5.267	0.234786	0.09969	.	.	ENSG00000158805	ENST00000446326	T	0.06142	3.34	5.32	-10.3	0.00346	.	.	.	.	.	T	0.03178	0.0093	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44982	-0.9292	8	0.72032	D	0.01	-2.1199	1.9835	0.03431	0.3247:0.0924:0.3541:0.2289	.	41	A8K186	.	R	41	ENSP00000415999:P41R	ENSP00000415999:P41R	P	+	2	0	ZNF276	88317344	0.000000	0.05858	0.000000	0.03702	0.205000	0.24178	-3.382000	0.00490	-1.962000	0.01014	0.561000	0.74099	CCA			0.652	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000422517.1		NM_152287	
FLJ36000	284124	hgsc.bcm.edu	37	17	21904900	21904900	+	lincRNA	SNP	T	T	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr17:21904900T>A	ENST00000581223.2	+	0	0					NR_027084.1																						CTGGCCTCTCTGGACAAGCCA	0.622																																					.													.	.			0			.																																											0	.			CCTCTCTGGACAA																													17.37:g.21904900T>A			Somatic	63	0	0		WXS	Illumina HiSeq	.	56	0.11	6	.	9	0.00	0		RNA	SNP	ENST00000581223.2	37																																																																																						0.622	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000451067.1			
KRT18P55	284085	broad.mit.edu	37	17	26633347	26633348	+	RNA	INS	-	-	G	rs35679432|rs6505076	byFrequency	TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr17:26633347_26633348insG	ENST00000577198.1	-	0	407					NR_028334.1				keratin 18 pseudogene 55																		ttgttgttgttttttttttttt	0.262													|||unknown(HR)	1257	0.250998	0.1861	0.3343	5008	,	,		18973	0.0665		0.4294	False		,,,				2504	0.2863				.													.	.			0			.																																											0	.			TGTTGTTTTTTTT			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26633347_26633348insG			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	10	0.70	7	.	0		0		RNA	INS	ENST00000577198.1	37																																																																																						0.262	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000446194.1		NR_028334	
MLLT6	4302	broad.mit.edu	37	17	36861701	36861703	+	5'Flank	DEL	GAG	GAG	-			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr17:36861701_36861703delGAG	ENST00000325718.7	+	0	0				CTB-58E17.3_ENST00000583409.1_RNA|MLLT6_ENST00000378137.5_5'Flank|CTB-58E17.1_ENST00000563897.1_lincRNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					CAGAGCGAGCgaggaggaggagg	0.734			T	MLL	AL																																.				Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	80		0			.																																									SO:0001631	upstream_gene_variant	0	.			GCGAGCGAGGAGG		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498		17.37:g.36861710_36861712delGAG	Exception_encountered		Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	Q59F28|Q96IU3|Q9H5F6|Q9UF49	RNA	DEL	ENST00000325718.7	37	CCDS11327.1																																																																																					0.734	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256799.1		NM_005937	
MRPL45P2	653479	broad.mit.edu	37	17	45559947	45559947	+	RNA	DEL	A	A	-	rs200451643	byFrequency	TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr17:45559947delA	ENST00000575291.1	-	0	606									mitochondrial ribosomal protein L45 pseudogene 2																		aataaaaaataaaaaaaaaaa	0.403																																					.													.	.			0			.																																											0	.			AAAAATAAAAAAA			17q21.32	2010-09-29				ENSG00000228782			29716	pseudogene	pseudogene						12706105	Standard	NR_033934		Approved		uc002ilq.3				17.37:g.45559947delA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	1	0.00	0		RNA	DEL	ENST00000575291.1	37																																																																																						0.403	MRPL45P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000441112.1		NR_033934	
SKAP1	8631	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	46507464	46507464	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr17:46507464G>A	ENST00000336915.6	-	1	88	c.19C>T	c.(19-21)Cct>Tct	p.P7S	SKAP1_ENST00000584924.1_Missense_Mutation_p.P7S	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	7					positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						ATCTCCTCAGGGAGGGCGGCG	0.736																																					p.P7S													.	SKAP1	41		0			c.C19T												12.0	12.0	12.0					17																	46507464		2099	4169	6268	SO:0001583	missense	8631	exon1			CCTCAGGGAGGGC	Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.19C>T	17.37:g.46507464G>A	ENSP00000338171:p.Pro7Ser		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	67	0.09	6	NM_003726	0		0	D3DTV1|O15268	Missense_Mutation	SNP	ENST00000336915.6	37	CCDS32674.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833653	0.32421	.	.	ENSG00000141293	ENST00000336915	T	0.32272	1.46	2.8	2.8	0.32819	.	0.304354	0.26106	U	0.026318	T	0.33614	0.0869	M	0.66939	2.045	0.35700	D	0.815568	B;P	0.47034	0.033;0.889	B;B	0.44224	0.018;0.444	T	0.51818	-0.8657	10	0.54805	T	0.06	.	10.3114	0.43710	0.0:0.0:1.0:0.0	.	7;7	Q86WV1-2;Q86WV1	.;SKAP1_HUMAN	S	7	ENSP00000338171:P7S	ENSP00000338171:P7S	P	-	1	0	SKAP1	43862463	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	4.552000	0.60747	1.408000	0.46895	0.185000	0.17295	CCT			0.736	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443432.1		NM_003726	
CASKIN2	57513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73509845	73509845	+	Missense_Mutation	SNP	C	C	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr17:73509845C>G	ENST00000321617.3	-	2	627	c.41G>C	c.(40-42)gGa>gCa	p.G14A	CASKIN2_ENST00000581870.1_Missense_Mutation_p.G14A|TSEN54_ENST00000333213.6_5'Flank	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	14						cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGTCACATCTCCATTCTTGAC	0.602																																					p.S14S													.	.			0			c.C41C												166.0	119.0	135.0					17																	73509845		2203	4300	6503	SO:0001583	missense	57513	exon2			ACATCTCCATTCT	AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.41G>C	17.37:g.73509845C>G	ENSP00000325355:p.Gly14Ala		Somatic	65	0	0		WXS	Illumina HiSeq	.	82	0.17	14	NM_020753	0		0	B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Silent	SNP	ENST00000321617.3	37	CCDS11723.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975707	0.53720	.	.	ENSG00000177303	ENST00000321617	T	0.60424	0.19	5.01	5.01	0.66863	Ankyrin repeat-containing domain (3);	0.000000	0.41001	D	0.000966	T	0.66790	0.2825	M	0.79011	2.435	0.42632	D	0.99338	P	0.42735	0.788	P	0.46758	0.526	T	0.72494	-0.4276	10	0.59425	D	0.04	.	15.2515	0.73549	0.0:1.0:0.0:0.0	.	14	Q8WXE0	CSKI2_HUMAN	A	14	ENSP00000325355:G14A	ENSP00000325355:G14A	G	-	2	0	CASKIN2	71021440	1.000000	0.71417	0.989000	0.46669	0.823000	0.46562	3.216000	0.51176	2.332000	0.79248	0.462000	0.41574	GGA			0.602	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447609.1		NM_020753	
NPC1	4864	broad.mit.edu;bcgsc.ca	37	18	21119403	21119403	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr18:21119403T>C	ENST00000269228.5	-	19	3381	c.2827A>G	c.(2827-2829)Atc>Gtc	p.I943V	NPC1_ENST00000540608.1_5'Flank|NPC1_ENST00000412552.2_Missense_Mutation_p.I625V	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	943			I -> M (in NPC1). {ECO:0000269|PubMed:11333381}.		adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TAATCGTCGATCCAGGACGAG	0.498																																					p.I943V													.	NPC1	114		0			c.A2827G												66.0	56.0	60.0					18																	21119403		2203	4300	6503	SO:0001583	missense	4864	exon19			CGTCGATCCAGGA	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2827A>G	18.37:g.21119403T>C	ENSP00000269228:p.Ile943Val		Somatic	115	0.0086956522	1		WXS	Illumina HiSeq	Phase_I	95	0.06	6	NM_000271	17	0.00	0	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.306005	0.40795	.	.	ENSG00000141458	ENST00000269228;ENST00000412552	D;D	0.93189	-3.18;-3.18	5.25	4.07	0.47477	.	0.051907	0.85682	D	0.000000	D	0.90283	0.6961	L	0.55103	1.725	0.54753	D	0.99998	B;B	0.10296	0.003;0.003	B;B	0.16289	0.015;0.01	D	0.85305	0.1075	10	0.31617	T	0.26	-22.3348	11.8656	0.52490	0.0:0.0:0.2767:0.7233	.	954;943	Q59GR1;O15118	.;NPC1_HUMAN	V	943;625	ENSP00000269228:I943V;ENSP00000408606:I625V	ENSP00000269228:I943V	I	-	1	0	NPC1	19373401	1.000000	0.71417	0.945000	0.38365	0.669000	0.39330	2.091000	0.41691	0.914000	0.36822	-0.313000	0.08912	ATC			0.498	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254823.2		NM_000271	
ZNF271	10778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	32888830	32888830	+	RNA	SNP	T	T	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr18:32888830T>G	ENST00000399070.3	+	0	3224					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(9)	12						TATCTATTTTTAAATTCCACG	0.308																																					.													.	.			0			.																																											10778	.			TATTTTTAAATTC	X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32888830T>G			Somatic	165	0	0		WXS	Illumina HiSeq	.	184	0.13	24	.	32	0.09	3	B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	RNA	SNP	ENST00000399070.3	37																																																																																						0.308	ZNF271-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000255767.2		NR_024565	
SLC39A6	25800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	33696734	33696734	+	Silent	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr18:33696734C>T	ENST00000590986.1	-	6	1657	c.1368G>A	c.(1366-1368)aaG>aaA	p.K456K	SLC39A6_ENST00000269187.5_Silent_p.K456K|SLC39A6_ENST00000440549.2_Silent_p.K181K			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	456					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						TTTCAGGTTTCTTCTGATTCT	0.323																																					p.K456K													.	.			0			c.G1368A												136.0	119.0	125.0					18																	33696734		1847	4092	5939	SO:0001819	synonymous_variant	25800	exon6			AGGTTTCTTCTGA	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.1368G>A	18.37:g.33696734C>T			Somatic	50	0	0		WXS	Illumina HiSeq	.	73	0.18	13	NM_012319	1	0.00	0	B4DR49|B4E224|Q8IXR3|Q96HP5	Silent	SNP	ENST00000590986.1	37	CCDS42428.1																																																																																					0.323	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000444136.1			
VPS4B	9525	broad.mit.edu	37	18	61067303	61067303	+	Silent	SNP	C	C	T	rs146071226		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr18:61067303C>T	ENST00000238497.5	-	7	971	c.768G>A	c.(766-768)acG>acA	p.T256T	VPS4B_ENST00000591383.1_5'UTR	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	256					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						CTAGGAACTCCGTCTTAATTC	0.438																																					p.T256T													.	VPS4B	33		0			c.G768A							C		3,4403	6.2+/-15.9	0,3,2200	71.0	74.0	73.0		768	-11.9	0.3	18	dbSNP_134	73	0,8600		0,0,4300	no	coding-synonymous	VPS4B	NM_004869.3		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231		256/445	61067303	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	9525	exon7			GAACTCCGTCTTA	AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.768G>A	18.37:g.61067303C>T			Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	146	0.02	3	NM_004869	1	0.00	0	Q69HW4|Q9GZS7	Silent	SNP	ENST00000238497.5	37	CCDS11983.1																																																																																					0.438	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256198.2		NM_004869	
CD226	10666	mdanderson.org	37	18	67563188	67563188	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr18:67563188G>T	ENST00000280200.4	-	4	744	c.476C>A	c.(475-477)cCt>cAt	p.P159H	CD226_ENST00000577287.1_Missense_Mutation_p.P4H|CD226_ENST00000581982.1_Missense_Mutation_p.P4H|CD226_ENST00000582621.1_Missense_Mutation_p.P159H	NM_006566.2	NP_006557.2	Q15762	CD226_HUMAN	CD226 molecule	159	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)|cytokine production (GO:0001816)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	24		Esophageal squamous(42;0.129)				TGCCTGCACAGGCCACGTCAT	0.488																																					p.P159H	NSCLC(184;838 2130 8673 21498 50749)												.	.			0			c.C476A												109.0	92.0	97.0					18																	67563188		2203	4300	6503	SO:0001583	missense	10666	exon4			TGCACAGGCCACG	U56102	CCDS11997.1	18q22.3	2013-01-11	2006-03-28		ENSG00000150637	ENSG00000150637		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	16961	protein-coding gene	gene with protein product		605397	"""CD226 antigen"""			8673704	Standard	NM_006566		Approved	DNAM-1, DNAM1, PTA1, TLiSA1	uc002lkm.4	Q15762	OTTHUMG00000132809	ENST00000280200.4:c.476C>A	18.37:g.67563188G>T	ENSP00000280200:p.Pro159His		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_006566	2	0.00	0	B2R818	Missense_Mutation	SNP	ENST00000280200.4	37	CCDS11997.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.733590	0.48939	.	.	ENSG00000150637	ENST00000280200	T	0.19394	2.15	5.09	-3.97	0.04094	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.316600	0.04774	N	0.428611	T	0.31827	0.0809	L	0.56769	1.78	0.09310	N	1	D	0.71674	0.998	D	0.64042	0.921	T	0.37957	-0.9683	10	0.66056	D	0.02	.	0.5455	0.00653	0.3499:0.1234:0.2753:0.2514	.	159	Q15762	CD226_HUMAN	H	159	ENSP00000280200:P159H	ENSP00000280200:P159H	P	-	2	0	CD226	65714168	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.017000	0.13399	-0.924000	0.03780	0.650000	0.86243	CCT			0.488	CD226-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256226.3		NM_006566	
MCOLN1	57192	mdanderson.org	37	19	7594053	7594053	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:7594053G>A	ENST00000264079.6	+	10	1326	c.1201G>A	c.(1201-1203)Gtg>Atg	p.V401M		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	401					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTGGGTGGGCGTGATCCGCTA	0.572																																					p.V401M													.	.			0			c.G1201A												108.0	98.0	101.0					19																	7594053		2203	4300	6503	SO:0001583	missense	57192	exon10			GTGGGCGTGATCC	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.1201G>A	19.37:g.7594053G>A	ENSP00000264079:p.Val401Met		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_020533	33	0.00	0	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Missense_Mutation	SNP	ENST00000264079.6	37	CCDS12180.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668544	0.88348	.	.	ENSG00000090674	ENST00000264079;ENST00000394321	T	0.71934	-0.61	5.27	5.27	0.74061	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	T	0.81460	0.4827	M	0.69248	2.105	0.80722	D	1	D;D	0.69078	0.969;0.997	P;D	0.64237	0.713;0.923	T	0.82374	-0.0489	10	0.52906	T	0.07	.	16.364	0.83307	0.0:0.0:1.0:0.0	.	366;401	Q9GZU1-2;Q9GZU1	.;MCLN1_HUMAN	M	401;366	ENSP00000264079:V401M	ENSP00000264079:V401M	V	+	1	0	MCOLN1	7500053	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.473000	0.97714	2.459000	0.83118	0.561000	0.74099	GTG			0.572	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458974.2		NM_020533	
MUC16	94025	mdanderson.org	37	19	9057408	9057408	+	Missense_Mutation	SNP	A	A	T	rs1423051	byFrequency	TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:9057408A>T	ENST00000397910.4	-	3	30241	c.30038T>A	c.(30037-30039)cTc>cAc	p.L10013H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10015	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCCACAAAGAGAGAGCTCTT	0.448																																					p.L10013H													.	.			0			c.T30038A												73.0	72.0	72.0					19																	9057408		1937	4135	6072	SO:0001583	missense	94025	exon3			ACAAAGAGAGAGC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30038T>A	19.37:g.9057408A>T	ENSP00000381008:p.Leu10013His		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	66	0.05	3	NM_024690	0		0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.060	0.008952	0.07912	.	.	ENSG00000181143	ENST00000397910	T	0.22336	1.96	2.32	-1.88	0.07713	.	.	.	.	.	T	0.11623	0.0283	N	0.08118	0	.	.	.	P	0.42620	0.785	B	0.43950	0.437	T	0.25950	-1.0117	8	0.87932	D	0	.	7.239	0.26086	0.6911:0.0:0.3089:0.0	.	10013	B5ME49	.	H	10013	ENSP00000381008:L10013H	ENSP00000381008:L10013H	L	-	2	0	MUC16	8918408	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.002000	0.12924	-0.777000	0.04572	-0.349000	0.07799	CTC			0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402806.1		NM_024690	
CCDC151	115948	broad.mit.edu;mdanderson.org	37	19	11534699	11534699	+	Splice_Site	SNP	C	C	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:11534699C>G	ENST00000356392.4	-	8	1051		c.e8-1		CCDC151_ENST00000591179.1_Splice_Site|CCDC151_ENST00000586836.1_Splice_Site|CCDC151_ENST00000545100.1_Splice_Site	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151											endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						CGCGGTGGGTCTGCTCGTGGG	0.662																																					.													.	CCDC151	44		0			c.964-1G>C												98.0	107.0	104.0					19																	11534699		2135	4253	6388	SO:0001630	splice_region_variant	115948	exon9			GTGGGTCTGCTCG		CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.964-1G>C	19.37:g.11534699C>G			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_145045	0		0	B4DXT0|Q96CG5	Splice_Site	SNP	ENST00000356392.4	37	CCDS42501.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269635	0.40095	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	.	.	.	3.83	3.83	0.44106	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3955	0.49838	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC151	11395699	1.000000	0.71417	0.980000	0.43619	0.073000	0.16967	3.381000	0.52455	2.126000	0.65437	0.491000	0.48974	.			0.662	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458800.1		NM_145045	Intron
NFIX	4784	mdanderson.org	37	19	13192670	13192670	+	Splice_Site	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:13192670G>T	ENST00000592199.1	+	8	1254		c.e8+1		NFIX_ENST00000358552.3_Splice_Site|NFIX_ENST00000588228.1_Splice_Site|NFIX_ENST00000360105.4_Splice_Site|NFIX_ENST00000397661.2_Splice_Site|NFIX_ENST00000587760.1_Splice_Site|NFIX_ENST00000585575.1_Splice_Site|NFIX_ENST00000587260.1_Splice_Site			Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription factor)						astrocyte differentiation (GO:0048708)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell layer development (GO:0021680)|DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CACCGGACAGGTGAGTCCAGA	0.632											OREG0025286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	.			0			c.1254+1G>T												33.0	35.0	35.0					19																	13192670		1964	4132	6096	SO:0001630	splice_region_variant	4784	exon8			GGACAGGTGAGTC	U18761	CCDS45996.1, CCDS59359.1	19p13.3	2008-02-05				ENSG00000008441			7788	protein-coding gene	gene with protein product		164005				8340106, 7590749	Standard	NM_001271043		Approved	NF1A	uc010xmx.2	Q14938		ENST00000592199.1:c.1254+1G>T	19.37:g.13192670G>T			Somatic	39	0	0	685	WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_002501	0		0	B4DM25|O60413|Q0VG09|Q12859|Q13050|Q13052|Q5U094|Q9UPH1|Q9Y6R8	Splice_Site	SNP	ENST00000592199.1	37		.	.	.	.	.	.	.	.	.	.	G	29.2	4.987342	0.93106	.	.	ENSG00000008441	ENST00000397661;ENST00000360105;ENST00000264825;ENST00000358552	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8323	0.92145	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NFIX	13053670	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.079000	0.94032	2.755000	0.94549	0.655000	0.94253	.			0.632	NFIX-013	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000452763.1		NM_002501	Intron
SPINT2	10653	bcgsc.ca	37	19	38779803	38779807	+	Frame_Shift_Del	DEL	CCACT	CCACT	-			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	CCACT	CCACT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:38779803_38779807delCCACT	ENST00000301244.7	+	4	798_802	c.363_367delCCACT	c.(361-369)gaccactccfs	p.HS122fs	SPINT2_ENST00000454580.3_Frame_Shift_Del_p.HS65fs|SPINT2_ENST00000587090.1_Frame_Shift_Del_p.HS72fs|CTB-102L5.4_ENST00000591889.1_5'Flank	NM_021102.3	NP_066925.1	O43291	SPIT2_HUMAN	serine peptidase inhibitor, Kunitz type, 2	122					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(2)|lung(1)|ovary(1)	4	all_cancers(60;6.83e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ATTCTGAAGACCACTCCAGCGATAT	0.556																																					p.121_123del													.	SPINT2	17		0			c.363_367del																																									SO:0001589	frameshift_variant	10653	exon4			TGAAGACCACTCC	U78095	CCDS12510.1, CCDS54261.1	19q13.2	2010-05-12	2005-08-17		ENSG00000167642	ENSG00000167642			11247	protein-coding gene	gene with protein product	"""placental bikunin"""	605124	"""serine protease inhibitor, Kunitz type, 2"""			9115294, 9346890	Standard	NM_021102		Approved	Kop, HAI-2	uc002ohr.2	O43291		ENST00000301244.7:c.363_367delCCACT	19.37:g.38779803_38779807delCCACT	ENSP00000301244:p.His122fs		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_1	59	0.08	5	NM_021102	135	0.00	0	A8K667|B4DLU1|O00271|O14895|Q5TZQ3|Q969E0	Frame_Shift_Del	DEL	ENST00000301244.7	37	CCDS12510.1																																																																																					0.556	SPINT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458151.2			
GMFG	9535	mdanderson.org	37	19	39819174	39819174	+	Silent	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:39819174G>T	ENST00000597595.1	-	7	580	c.372C>A	c.(370-372)cgC>cgA	p.R124R	GMFG_ENST00000253054.8_Silent_p.R91R|GMFG_ENST00000595636.1_3'UTR|GMFG_ENST00000600322.1_Silent_p.R91R|GMFG_ENST00000594700.1_Silent_p.R55R|GMFG_ENST00000602185.1_Silent_p.R75R|GMFG_ENST00000598034.1_3'UTR|GMFG_ENST00000601387.1_Silent_p.R83R	NM_004877.2	NP_004868.1	O60234	GMFG_HUMAN	glia maturation factor, gamma	124	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				negative regulation of protein kinase activity (GO:0006469)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)			breast(1)|large_intestine(2)|liver(2)|lung(3)|skin(1)|stomach(1)	10	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.15e-27)|all cancers(26;1.3e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CATCAGTGGTGCGGATTTCGA	0.522																																					p.R124R													.	.			0			c.C372A												107.0	95.0	99.0					19																	39819174		2203	4300	6503	SO:0001819	synonymous_variant	9535	exon7			AGTGGTGCGGATT	AB001993	CCDS12532.1, CCDS74364.1	19q13.2	2014-08-12			ENSG00000130755	ENSG00000130755			4374	protein-coding gene	gene with protein product		604104				9545571, 9653160, 17127212	Standard	XM_005259440		Approved		uc002okz.4	O60234	OTTHUMG00000182811	ENST00000597595.1:c.372C>A	19.37:g.39819174G>T			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_004877	491	0.00	0	Q6IB37	Silent	SNP	ENST00000597595.1	37	CCDS12532.1																																																																																					0.522	GMFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463839.1			
POU2F2	5452	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42599534	42599534	+	Silent	SNP	G	G	A	rs369799078		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:42599534G>A	ENST00000526816.2	-	11	1050	c.1035C>T	c.(1033-1035)ttC>ttT	p.F345F	POU2F2_ENST00000529952.1_Silent_p.F345F|POU2F2_ENST00000529067.1_Silent_p.F329F|POU2F2_ENST00000389341.5_Silent_p.F329F|POU2F2_ENST00000560398.1_Silent_p.F351F|POU2F2_ENST00000533720.1_Silent_p.F329F|POU2F2_ENST00000560558.1_Silent_p.F290F|POU2F2_ENST00000342301.4_Silent_p.F345F			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	345					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	GCCGGTTGCAGAACCAGACGC	0.622																																					p.F345F													.	POU2F2	106		0			c.C1035T							G	,,	1,4405	2.1+/-5.4	0,1,2202	58.0	54.0	55.0		1035,1035,987	4.0	1.0	19		55	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	POU2F2	NM_001207025.1,NM_001207026.1,NM_002698.3	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	345/480,345/468,329/464	42599534	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5452	exon11			GTTGCAGAACCAG		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.1035C>T	19.37:g.42599534G>A			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	44	0.16	7	NM_001207025	3	0.00	0	Q16648|Q7M4M8|Q9BRS4	Silent	SNP	ENST00000526816.2	37	CCDS56095.1																																																																																					0.622	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000387329.3			
ZNF283	284349	mdanderson.org	37	19	44352551	44352551	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:44352551G>T	ENST00000324461.7	+	7	2095	c.1798G>T	c.(1798-1800)Gaa>Taa	p.E600*	ZNF283_ENST00000588797.1_Nonsense_Mutation_p.E461*	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	600					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				GAAGTCTTATGAATGTAAAGA	0.423																																					p.E600X													.	.			0			c.G1798T												89.0	98.0	95.0					19																	44352551		2156	4281	6437	SO:0001587	stop_gained	284349	exon7			TCTTATGAATGTA	AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.1798G>T	19.37:g.44352551G>T	ENSP00000327314:p.Glu600*		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	81	0.06	5	NM_181845	6	0.00	0	B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Nonsense_Mutation	SNP	ENST00000324461.7	37	CCDS46097.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575881	0.65878	.	.	ENSG00000167637	ENST00000324461	.	.	.	2.2	1.08	0.20341	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	6.5247	0.22295	0.2724:0.0:0.7276:0.0	.	.	.	.	X	600	.	ENSP00000327314:E600X	E	+	1	0	ZNF283	49044391	0.000000	0.05858	0.232000	0.24009	0.127000	0.20565	-1.677000	0.01944	0.439000	0.26476	0.563000	0.77884	GAA			0.423	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459909.1		NM_181845	
RPS7	6201	broad.mit.edu;bcgsc.ca	37	2	3627893	3627894	+	Intron	DEL	GA	GA	-			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:3627893_3627894delGA	ENST00000304921.5	+	6	671				RPS7_ENST00000406376.1_Intron|RPS7_ENST00000403564.1_Intron|RPS7_ENST00000407445.3_Frame_Shift_Del_p.E184fs|SNORA73_ENST00000516722.1_RNA	NM_001011.3	NP_001002.1	P62081	RS7_HUMAN	ribosomal protein S7						cellular protein metabolic process (GO:0044267)|cytoplasmic translation (GO:0002181)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(2)|urinary_tract(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0963)|Epithelial(75;0.208)		CAGCCACAGTGAGAGTGGATTT	0.45																																					.													.	RPS7	13		0			.																																									SO:0001627	intron_variant	6201	.			CACAGTGAGAGTG		CCDS1648.1	2p25	2011-04-05			ENSG00000171863	ENSG00000171863		"""S ribosomal proteins"""	10440	protein-coding gene	gene with protein product		603658				8522193, 10625621	Standard	NM_001011		Approved	S7	uc002qxw.3	P62081	OTTHUMG00000090305	ENST00000304921.5:c.507+43GA>-	2.37:g.3627895_3627896delGA			Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	68	0.12	8	.	22	0.00	0	P23821|P24818|Q57Z92|Q6IPH1	Frame_Shift_Del	DEL	ENST00000304921.5	37	CCDS1648.1																																																																																					0.450	RPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206667.1		NM_001011	
YWHAQ	10971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	9727624	9727624	+	Silent	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:9727624G>A	ENST00000381844.4	-	4	760	c.597C>T	c.(595-597)gcC>gcT	p.A199A	YWHAQ_ENST00000474715.1_5'UTR|YWHAQ_ENST00000238081.3_Silent_p.A199A			P27348	1433T_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta	199					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|protein complex (GO:0043234)	protein N-terminus binding (GO:0047485)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		GTTCAGCAATGGCCTCATCAA	0.343																																					p.A199A													.	.			0			c.C597T												102.0	93.0	96.0					2																	9727624		2203	4300	6503	SO:0001819	synonymous_variant	10971	exon5			AGCAATGGCCTCA	AF070556	CCDS1666.1	2p25.2-p25.1	2013-12-03	2013-12-03		ENSG00000134308	ENSG00000134308			12854	protein-coding gene	gene with protein product	"""protein tau"""	609009	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide"""			11080204	Standard	NM_006826		Approved	HS1, 14-3-3	uc002qzx.3	P27348	OTTHUMG00000013848	ENST00000381844.4:c.597C>T	2.37:g.9727624G>A			Somatic	145	0	0		WXS	Illumina HiSeq	.	166	0.12	20	NM_006826	117	0.12	14	D6W4Z5|Q567U5|Q5TZU8|Q9UP48	Silent	SNP	ENST00000381844.4	37	CCDS1666.1																																																																																					0.343	YWHAQ-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039014.4		NM_006826	
HEATR5B	54497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37235845	37235845	+	Silent	SNP	T	T	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:37235845T>C	ENST00000233099.5	-	28	4526	c.4431A>G	c.(4429-4431)ctA>ctG	p.L1477L	HEATR5B_ENST00000354531.2_Silent_p.L1477L	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1477						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TGAGTGTTGGTAGTTCAGGTT	0.413																																					p.L1477L													.	.			0			c.A4431G												243.0	203.0	217.0					2																	37235845		2203	4300	6503	SO:0001819	synonymous_variant	54497	exon28			TGTTGGTAGTTCA	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.4431A>G	2.37:g.37235845T>C			Somatic	93	0	0		WXS	Illumina HiSeq	.	81	0.10	8	NM_019024	41	0.20	8	B5MDU8|Q7Z3B2|Q9NVL7	Silent	SNP	ENST00000233099.5	37	CCDS33181.1																																																																																					0.413	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325492.1		NM_019024	
MTIF2	4528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55479643	55479643	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:55479643C>T	ENST00000263629.4	-	8	1126	c.811G>A	c.(811-813)Gaa>Aaa	p.E271K	MTIF2_ENST00000403721.1_Missense_Mutation_p.E271K|MTIF2_ENST00000446660.1_5'Flank|MTIF2_ENST00000394600.3_Missense_Mutation_p.E271K	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	271	tr-type G.				formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						TGAATAGATTCTACAGTTTGT	0.438																																					p.E271K													.	.			0			c.G811A												156.0	135.0	142.0					2																	55479643		2203	4300	6503	SO:0001583	missense	4528	exon8			TAGATTCTACAGT	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.811G>A	2.37:g.55479643C>T	ENSP00000263629:p.Glu271Lys		Somatic	160	0	0		WXS	Illumina HiSeq	.	171	0.18	30	NM_002453	17	0.06	1	D6W5D0	Missense_Mutation	SNP	ENST00000263629.4	37	CCDS1853.1	.	.	.	.	.	.	.	.	.	.	C	37	6.004867	0.97195	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000535023	T;T;T	0.73258	-0.73;-0.73;-0.73	6.07	6.07	0.98685	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.91088	0.7195	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93344	0.6712	10	0.87932	D	0	-32.098	20.6593	0.99626	0.0:1.0:0.0:0.0	.	271	P46199	IF2M_HUMAN	K	271	ENSP00000384481:E271K;ENSP00000263629:E271K;ENSP00000378099:E271K	ENSP00000263629:E271K	E	-	1	0	MTIF2	55333147	1.000000	0.71417	0.981000	0.43875	0.998000	0.95712	7.346000	0.79347	2.885000	0.99019	0.655000	0.94253	GAA			0.438	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251486.4		NM_002453	
POTEE	445582	broad.mit.edu	37	2	132021542	132021542	+	Silent	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:132021542C>T	ENST00000356920.5	+	15	2608	c.2514C>T	c.(2512-2514)gcC>gcT	p.A838A	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	838	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CCATCCAGGCCGTGCCGTCCC	0.607																																					p.A838A													.	.			0			c.C2514T												153.0	155.0	154.0					2																	132021542		2203	4300	6503	SO:0001819	synonymous_variant	445582	exon15			CCAGGCCGTGCCG	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2514C>T	2.37:g.132021542C>T			Somatic	113	0.0088495575	1		WXS	Illumina HiSeq	Phase_I	128	0.04	5	NM_001083538	0		0	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	ENST00000356920.5	37	CCDS46414.1																																																																																					0.607	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001083538	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141093382	141093382	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:141093382T>C	ENST00000389484.3	-	78	12889	c.11918A>G	c.(11917-11919)gAc>gGc	p.D3973G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3973					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AACTGCAATGTCCCTGGGCCT	0.418										TSP Lung(27;0.18)																											p.D3973G	Colon(99;50 2074 2507 20106)												.	.			0			c.A11918G												104.0	101.0	102.0					2																	141093382		2203	4300	6503	SO:0001583	missense	53353	exon78			GCAATGTCCCTGG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11918A>G	2.37:g.141093382T>C	ENSP00000374135:p.Asp3973Gly		Somatic	144	0	0		WXS	Illumina HiSeq	.	117	0.11	13	NM_018557	0		0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.665|9.665	1.145257|1.145257	0.21288|0.21288	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977	D|.	0.87729|.	-2.29|.	5.43|5.43	5.43|5.43	0.79202|0.79202	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);|.	0.062850|.	0.64402|.	D|.	0.000009|.	T|T	0.32912|0.32912	0.0845|0.0845	N|N	0.05330|0.05330	-0.07|-0.07	0.42144|0.42144	D|D	0.991524|0.991524	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.23226|0.23226	-1.0194|-1.0194	10|5	0.02654|.	T|.	1|.	.|.	8.0279|8.0279	0.30448|0.30448	0.0:0.1574:0.0:0.8426|0.0:0.1574:0.0:0.8426	.|.	3973|.	Q9NZR2|.	LRP1B_HUMAN|.	G|A	3973;3911|205	ENSP00000374135:D3973G|.	ENSP00000374135:D3973G|.	D|T	-|-	2|1	0|0	LRP1B|LRP1B	140809852|140809852	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.731000|4.731000	0.62022|0.62022	2.180000|2.180000	0.69256|0.69256	0.528000|0.528000	0.53228|0.53228	GAC|ACA			0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254736.2		NM_018557	
DNAJC10	54431	mdanderson.org	37	2	183583004	183583004	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:183583004C>A	ENST00000264065.7	+	3	606	c.191C>A	c.(190-192)cCt>cAt	p.P64H	DNAJC10_ENST00000537515.1_Missense_Mutation_p.P64H|DNAJC10_ENST00000469118.1_3'UTR	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	64	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AAGTTACATCCTGATAAAAAC	0.303																																					p.P64H	Pancreas(56;860 1183 25669 35822 48585)												.	.			0			c.C191A												64.0	66.0	66.0					2																	183583004		2200	4300	6500	SO:0001583	missense	54431	exon3			TACATCCTGATAA		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.191C>A	2.37:g.183583004C>A	ENSP00000264065:p.Pro64His		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001271581	3	0.00	0	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	ENST00000264065.7	37	CCDS33345.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999946	0.74818	.	.	ENSG00000077232	ENST00000264065;ENST00000392392;ENST00000537410;ENST00000537515	D;D	0.89875	-2.58;-2.58	5.37	4.49	0.54785	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	D	0.96975	0.9012	H	0.99475	4.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97953	1.0333	10	0.87932	D	0	.	13.4426	0.61123	0.0:0.9244:0.0:0.0756	.	64;64	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	H	64	ENSP00000264065:P64H;ENSP00000441560:P64H	ENSP00000264065:P64H	P	+	2	0	DNAJC10	183291249	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.715000	0.84713	1.408000	0.46895	-0.142000	0.14014	CCT			0.303	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334418.2		NM_018981	
PECR	55825	mdanderson.org	37	2	216930061	216930061	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr2:216930061G>A	ENST00000265322.7	-	3	472	c.398C>T	c.(397-399)aCg>aTg	p.T133M	PECR_ENST00000497889.1_5'UTR	NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	133					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	GAAGGTACCCGTCAGGTTGGT	0.453																																					p.T133M													.	.			0			c.C398T												141.0	134.0	136.0					2																	216930061		2203	4300	6503	SO:0001583	missense	55825	exon3			GTACCCGTCAGGT	AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.398C>T	2.37:g.216930061G>A	ENSP00000265322:p.Thr133Met		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	61	0.07	4	NM_018441	1	0.00	0	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Missense_Mutation	SNP	ENST00000265322.7	37	CCDS33375.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493912	0.84962	.	.	ENSG00000115425	ENST00000265322	T	0.42513	0.97	5.8	5.8	0.92144	Apoptosis regulator, Bcl-2, BH (1);NAD(P)-binding domain (1);	0.045311	0.85682	D	0.000000	T	0.60625	0.2283	L	0.52364	1.645	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.58634	-0.7602	10	0.54805	T	0.06	.	17.5644	0.87916	0.0:0.0:1.0:0.0	.	133;133	B4DJS2;Q9BY49	.;PECR_HUMAN	M	133	ENSP00000265322:T133M	ENSP00000265322:T133M	T	-	2	0	PECR	216638306	1.000000	0.71417	0.960000	0.40013	0.968000	0.65278	4.944000	0.63561	2.744000	0.94065	0.655000	0.94253	ACG			0.453	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337277.1		NM_018441	
CDC25B	994	mdanderson.org	37	20	3785522	3785522	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr20:3785522G>T	ENST00000245960.5	+	16	2354	c.1657G>T	c.(1657-1659)Gag>Tag	p.E553*	CDC25B_ENST00000379598.5_Nonsense_Mutation_p.E462*|CDC25B_ENST00000439880.2_Nonsense_Mutation_p.E539*|CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000344256.6_Nonsense_Mutation_p.E489*|CDC25B_ENST00000340833.4_Nonsense_Mutation_p.E512*	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	553					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						CTTCAAGGATGAGCTAAAGAC	0.622																																					p.E553X													.	.			0			c.G1657T												88.0	84.0	85.0					20																	3785522		2203	4300	6503	SO:0001587	stop_gained	994	exon16			AAGGATGAGCTAA		CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1657G>T	20.37:g.3785522G>T	ENSP00000245960:p.Glu553*		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_021873	50	0.00	0	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Nonsense_Mutation	SNP	ENST00000245960.5	37	CCDS13067.1	.	.	.	.	.	.	.	.	.	.	G	37	6.089292	0.97271	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	.	.	.	5.2	4.24	0.50183	.	0.266265	0.34002	N	0.004358	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	0.0759	12.5559	0.56252	0.0:0.321:0.6789:0.0	.	.	.	.	X	489;462;553;539;512	.	ENSP00000245960:E553X	E	+	1	0	CDC25B	3733522	1.000000	0.71417	0.489000	0.27452	0.770000	0.43624	3.814000	0.55643	1.303000	0.44873	0.563000	0.77884	GAG			0.622	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077779.2		NM_021874	
UCKL1	54963	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	20	62573996	62573996	+	Intron	SNP	G	G	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr20:62573996G>C	ENST00000354216.6	-	8	966				UCKL1_ENST00000358711.3_Intron|UCKL1_ENST00000369892.3_Intron|UCKL1_ENST00000369908.5_Intron|MIR1914_ENST00000607800.1_RNA|MIR647_ENST00000384823.1_RNA	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1						CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CAGGCCCCCAGCCCTGCCTGA	0.627																																					.													.	.			0			.												18.0	21.0	20.0					20																	62573996		1534	3563	5097	SO:0001627	intron_variant	693232	.			CCCCCAGCCCTGC	AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.923+1009C>G	20.37:g.62573996G>C			Somatic	54	0	0		WXS	Illumina HiSeq	.	58	0.12	7	.	4	0.00	0	B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	RNA	SNP	ENST00000354216.6	37	CCDS13547.1																																																																																					0.627	UCKL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000080236.1		NM_017859	
GART	2618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34889725	34889725	+	Silent	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr21:34889725C>T	ENST00000381831.3	-	15	2156	c.1893G>A	c.(1891-1893)gtG>gtA	p.V631V	GART_ENST00000381839.3_Silent_p.V631V|GART_ENST00000381815.4_Silent_p.V631V|GART_ENST00000543717.1_Silent_p.V183V	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	631	AIRS.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	AAGATTTTGCCACGATTTTCC	0.453																																					p.V631V													.	.			0			c.G1893A												163.0	155.0	158.0					21																	34889725		2203	4300	6503	SO:0001819	synonymous_variant	2618	exon15			TTTTGCCACGATT	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.1893G>A	21.37:g.34889725C>T			Somatic	73	0	0		WXS	Illumina HiSeq	.	65	0.08	5	NM_001136005	26	0.15	4	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Silent	SNP	ENST00000381831.3	37	CCDS13627.1																																																																																					0.453	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000140626.3		NM_000819	
TTC3	7267	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	38468893	38468893	+	Silent	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr21:38468893C>T	ENST00000399017.2	+	10	3542	c.795C>T	c.(793-795)taC>taT	p.Y265Y	TTC3_ENST00000355666.1_Silent_p.Y265Y|TTC3_ENST00000354749.2_Silent_p.Y265Y|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000399010.1_Silent_p.Y265Y|TTC3_ENST00000540756.1_Intron	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	265					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				CTGAAAACTACCTTCTTTATG	0.323																																					p.Y265Y	Ovarian(38;194 1649 35661)												.	.			0			c.C795T												129.0	118.0	122.0					21																	38468893		2202	4299	6501	SO:0001819	synonymous_variant	7267	exon10			AAACTACCTTCTT	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.795C>T	21.37:g.38468893C>T			Somatic	108	0	0		WXS	Illumina HiSeq	.	168	0.10	16	NM_001001894	17	0.12	2	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Silent	SNP	ENST00000399017.2	37	CCDS13651.1																																																																																					0.323	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000194776.1			
MYO18B	84700	mdanderson.org	37	22	26173563	26173563	+	Missense_Mutation	SNP	G	G	A	rs574569033	byFrequency	TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr22:26173563G>A	ENST00000407587.2	+	8	2052	c.1883G>A	c.(1882-1884)cGc>cAc	p.R628H	MYO18B_ENST00000335473.7_Missense_Mutation_p.R628H|MYO18B_ENST00000536101.1_Missense_Mutation_p.R628H			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	628	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCCAAGGGCCGCCGGGATGGC	0.652													G|||	3	0.000599042	0.0	0.0	5008	,	,		20127	0.003		0.0	False		,,,				2504	0.0				p.R628H													.	.			0			c.G1883A												24.0	28.0	27.0					22																	26173563		2025	4194	6219	SO:0001583	missense	84700	exon8			AGGGCCGCCGGGA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1883G>A	22.37:g.26173563G>A	ENSP00000386096:p.Arg628His		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_032608	0		0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	G	17.34	3.364596	0.61513	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87571	-2.27;-2.27;-2.27	5.38	3.2	0.36748	Myosin head, motor domain (2);	0.327175	0.28273	N	0.015952	D	0.89164	0.6637	M	0.64404	1.975	0.09310	N	1	D;D;D;D	0.89917	0.983;1.0;0.997;0.999	P;D;P;P	0.66351	0.584;0.943;0.862;0.905	T	0.80046	-0.1546	10	0.72032	D	0.01	.	3.3544	0.07164	0.1449:0.1415:0.5676:0.146	.	141;628;628;628	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	H	628	ENSP00000441229:R628H;ENSP00000334563:R628H;ENSP00000386096:R628H	ENSP00000334563:R628H	R	+	2	0	MYO18B	24503563	0.004000	0.15560	0.032000	0.17829	0.078000	0.17371	1.011000	0.29911	0.577000	0.29470	0.655000	0.94253	CGC			0.652	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000400691.1		NM_032608	
CCDC157	550631	hgsc.bcm.edu	37	22	30766163	30766163	+	Intron	SNP	T	T	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr22:30766163T>A	ENST00000405659.1	+	5	1129				CCDC157_ENST00000338306.3_Intron			Q569K6	CC157_HUMAN	coiled-coil domain containing 157											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						GGGAGAAAGTTCTCTCTTATT	0.532																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			GAAAGTTCTCTCT	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.421-152T>A	22.37:g.30766163T>A			Somatic	16	0	0		WXS	Illumina HiSeq	.	14	0.36	5	.	0		0	Q0VD76|Q9BYA4	RNA	SNP	ENST00000405659.1	37	CCDS33632.2																																																																																					0.532	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000320936.1		NM_001017437	
LMF2	91289	mdanderson.org	37	22	50944795	50944795	+	Silent	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr22:50944795G>T	ENST00000474879.2	-	4	529	c.514C>A	c.(514-516)Cga>Aga	p.R172R	LMF2_ENST00000380796.3_Silent_p.R172R|LMF2_ENST00000505981.1_5'UTR|LMF2_ENST00000216080.5_Silent_p.R147R|NCAPH2_ENST00000420993.2_5'Flank|NCAPH2_ENST00000395698.3_5'Flank|NCAPH2_ENST00000299821.11_5'Flank|NCAPH2_ENST00000395701.3_5'Flank	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	172						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGCAGCCATCGCACCAGCCAG	0.716																																					p.R172R													.	.			0			c.C514A												15.0	13.0	14.0					22																	50944795		2060	4072	6132	SO:0001819	synonymous_variant	91289	exon4			GCCATCGCACCAG	BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.514C>A	22.37:g.50944795G>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_033200	18	0.00	0	A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Silent	SNP	ENST00000474879.2	37	CCDS14093.2	.	.	.	.	.	.	.	.	.	.	g	11.60	1.686350	0.29962	.	.	ENSG00000100258	ENST00000487499	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	T	0.72020	0.3409	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71771	-0.4492	4	.	.	.	-1.7379	16.5741	0.84632	0.0:0.0:1.0:0.0	.	.	.	.	E	178	.	.	A	-	2	0	LMF2	49291661	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.380000	0.59581	2.331000	0.79229	0.651000	0.88453	GCG			0.716	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316833.2		NM_033200	
ATP2B2	491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10417235	10417235	+	Missense_Mutation	SNP	C	C	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr3:10417235C>G	ENST00000352432.4	-	10	1364	c.1295G>C	c.(1294-1296)tGc>tCc	p.C432S	ATP2B2_ENST00000397077.1_Missense_Mutation_p.C387S|ATP2B2_ENST00000383800.4_Missense_Mutation_p.C387S|ATP2B2_ENST00000360273.2_Missense_Mutation_p.C432S|ATP2B2_ENST00000343816.4_Missense_Mutation_p.C418S			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	432					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GACGGGCGTGCACTCAGGCAG	0.582																																					p.C432S	Ovarian(125;1619 1709 15675 19819 38835)												.	.			0			c.G1295C												88.0	76.0	80.0					3																	10417235		2203	4300	6503	SO:0001583	missense	491	exon11			GGCGTGCACTCAG	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1295G>C	3.37:g.10417235C>G	ENSP00000324172:p.Cys432Ser		Somatic	116	0	0		WXS	Illumina HiSeq	.	120	0.12	14	NM_001001331	0		0	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415270	0.83449	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89;-2.88;-2.88	4.48	4.48	0.54585	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.93207	0.7836	L	0.31845	0.965	0.80722	D	1	D;B;P	0.60160	0.987;0.198;0.798	D;B;P	0.73708	0.981;0.222;0.45	D	0.92372	0.5906	10	0.33141	T	0.24	-19.6971	17.3813	0.87405	0.0:1.0:0.0:0.0	.	367;399;432	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	S	432;387;387;432;418;367;288;432	ENSP00000324172:C432S;ENSP00000373311:C387S;ENSP00000380267:C387S;ENSP00000353414:C432S;ENSP00000344677:C418S;ENSP00000414854:C288S	ENSP00000342954:C432S	C	-	2	0	ATP2B2	10392235	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	7.651000	0.83577	2.323000	0.78572	0.561000	0.74099	TGC			0.582	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000250576.2		NM_001683	
SLITRK3	22865	broad.mit.edu	37	3	164905991	164905991	+	Silent	SNP	T	T	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr3:164905991T>C	ENST00000475390.1	-	2	3071	c.2628A>G	c.(2626-2628)ggA>ggG	p.G876G	SLITRK3_ENST00000241274.3_Silent_p.G876G			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	876					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TACCACAGCCTCCCCCAGGAG	0.567										HNSCC(40;0.11)																											p.G876G													SLITRK3,NS,carcinoma,-1,1	SLITRK3	263	1	0			c.A2628G												56.0	53.0	54.0					3																	164905991		2203	4300	6503	SO:0001819	synonymous_variant	22865	exon2			ACAGCCTCCCCCA	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2628A>G	3.37:g.164905991T>C			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	93	0.04	4	NM_014926	0		0	Q1RMY6	Silent	SNP	ENST00000475390.1	37	CCDS3197.1																																																																																					0.567	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350126.1		NM_014926	
FAM157A	728262	hgsc.bcm.edu	37	3	197880169	197880169	+	lincRNA	SNP	A	A	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr3:197880169A>T	ENST00000437428.2	+	0	49							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						cagcagcagcagcaACTGGAT	0.517																																					p.Q83L													.	.			0			c.A248T												2.0	6.0	5.0					3																	197880169		391	1090	1481			728262	exon2			AGCAGCAGCAACT			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880169A>T			Somatic	258	0	0		WXS	Illumina HiSeq	.	228	0.05	11	NM_001145248	0		0		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	0.093	-1.163277	0.01673	.	.	ENSG00000236438	ENST00000431569	.	.	.	.	.	.	.	.	.	.	.	T	0.15305	0.0369	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29243	-1.0018	5	.	.	.	.	.	.	.	.	83	C9JC47	F157A_HUMAN	L	83	.	.	Q	+	2	0	FAM157A	199364566	0.015000	0.18098	0.006000	0.13384	0.006000	0.05464	0.370000	0.20433	0.056000	0.16144	0.055000	0.15244	CAG			0.517	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA		OTTHUMT00000340078.2		NM_001145248	
HTT	3064	broad.mit.edu	37	4	3076603	3076604	+	In_Frame_Ins	INS	-	-	CAG	rs71180116|rs374076986	byFrequency	TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr4:3076603_3076604insCAG	ENST00000355072.5	+	1	196_197	c.51_52insCAG	c.(52-54)cag>CAGcag	p.18_18Q>QQ	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	18	Poly-Gln.		Q -> QQQ.		anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TCAAGTCCTTCcagcagcagca	0.708																																					p.F17delinsFQ													.	HTT	221		0			c.51_52insCAG																																									SO:0001652	inframe_insertion	3064	exon1			GTCCTTCCAGCAG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.106_108dupCAG	4.37:g.3076610_3076612dupCAG	ENSP00000347184:p.Gln38dup		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	NM_002111	0		0	Q9UQB7	In_Frame_Ins	INS	ENST00000355072.5	37	CCDS43206.1																																																																																					0.708	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358234.2		NM_002111	
LIMCH1	22998	broad.mit.edu	37	4	41615586	41615586	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr4:41615586G>T	ENST00000313860.7	+	7	644	c.590G>T	c.(589-591)gGc>gTc	p.G197V	LIMCH1_ENST00000514096.1_Missense_Mutation_p.G50V|LIMCH1_ENST00000509454.1_Missense_Mutation_p.G45V|LIMCH1_ENST00000396595.3_Missense_Mutation_p.G43V|LIMCH1_ENST00000513024.1_Missense_Mutation_p.G38V|LIMCH1_ENST00000509277.1_Missense_Mutation_p.G43V|LIMCH1_ENST00000512632.1_Missense_Mutation_p.G197V|LIMCH1_ENST00000508501.1_Missense_Mutation_p.G197V|LIMCH1_ENST00000511496.1_Missense_Mutation_p.G38V|LIMCH1_ENST00000503057.1_Missense_Mutation_p.G38V|LIMCH1_ENST00000512820.1_Missense_Mutation_p.G197V|LIMCH1_ENST00000512946.1_Missense_Mutation_p.G197V|LIMCH1_ENST00000509638.1_Missense_Mutation_p.G38V|LIMCH1_ENST00000381753.4_Missense_Mutation_p.G43V	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	197					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						CCTCGCCACGGCAGAGATGAT	0.562																																					p.G197V													.	LIMCH1	233		0			c.G590T												84.0	77.0	80.0					4																	41615586		2203	4300	6503	SO:0001583	missense	22998	exon7			GCCACGGCAGAGA	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.590G>T	4.37:g.41615586G>T	ENSP00000316891:p.Gly197Val		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	108	0.04	4	NM_014988	0		0	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	CCDS33977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.419620|4.419620	0.83559|0.83559	.|.	.|.	ENSG00000064042|ENSG00000064042	ENST00000508466|ENST00000513024;ENST00000509638;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000446625;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000509454;ENST00000396595;ENST00000381753	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.47528	.|0.87;1.46;1.46;1.47;0.89;1.48;0.84;0.85;0.87;0.88;0.85;0.88	5.59|5.59	4.69|4.69	0.59074|0.59074	.|.	.|0.151764	.|0.64402	.|D	.|0.000017	T|T	0.59307|0.59307	0.2184|0.2184	L|L	0.36672|0.36672	1.1|1.1	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;P;D;D;D;D;D;D	.|0.89917	.|0.972;0.996;0.984;0.984;0.617;0.992;0.964;1.0;0.999;0.997;1.0	.|P;D;D;P;B;P;P;D;D;D;D	.|0.97110	.|0.825;0.937;0.915;0.885;0.173;0.864;0.79;1.0;0.986;0.97;0.999	T|T	0.60291|0.60291	-0.7292|-0.7292	5|10	.|0.54805	.|T	.|0.06	-21.2087|-21.2087	15.9486|15.9486	0.79813|0.79813	0.0:0.1349:0.8651:0.0|0.0:0.1349:0.8651:0.0	.|.	.|43;197;43;43;45;38;38;197;197;197;197	.|E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;Q6NVB9;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0	.|.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN	S|V	32|38;38;197;197;197;197;197;38;38;38;37;50;43;45;43;43	.|ENSP00000425222:G38V;ENSP00000424825:G197V;ENSP00000424645:G197V;ENSP00000316891:G197V;ENSP00000427045:G197V;ENSP00000424437:G197V;ENSP00000425631:G38V;ENSP00000421242:G38V;ENSP00000426334:G50V;ENSP00000422864:G43V;ENSP00000379840:G43V;ENSP00000371172:G43V	.|ENSP00000316891:G197V	A|G	+|+	1|2	0|0	LIMCH1|LIMCH1	41310343|41310343	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.953000|0.953000	0.61014|0.61014	4.977000|4.977000	0.63792|0.63792	2.622000|2.622000	0.88805|0.88805	0.561000|0.561000	0.74099|0.74099	GCA|GGC			0.562	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000361249.2		NM_014988	
BEND4	389206	broad.mit.edu;mdanderson.org	37	4	42145560	42145560	+	Silent	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr4:42145560C>T	ENST00000502486.1	-	3	1518	c.939G>A	c.(937-939)gaG>gaA	p.E313E	BEND4_ENST00000504360.1_Silent_p.E309E	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	313										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						cctcctcctcctcttcTGGCA	0.512																																					p.E313E													.	BEND4	67		0			c.G939A												44.0	40.0	41.0					4																	42145560		2021	4172	6193	SO:0001819	synonymous_variant	389206	exon3			CTCCTCCTCTTCT	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.939G>A	4.37:g.42145560C>T			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	79	0.05	4	NM_001159547	3	0.00	0	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Silent	SNP	ENST00000502486.1	37	CCDS47048.1																																																																																					0.512	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000360975.2		NM_207406	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55602664	55602664	+	Splice_Site	SNP	G	G	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr4:55602664G>C	ENST00000288135.5	+	18	2582	c.2485G>C	c.(2485-2487)Gct>Cct	p.A829P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	829	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		A -> P (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A829P(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTATTACAGGCTCGACTACC	0.398		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.A829P			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,caecum,carcinoma,0,3	KIT	0	3	1	Substitution - Missense(1)	testis(1)	c.G2485C												106.0	104.0	105.0					4																	55602664		2203	4300	6503	SO:0001630	splice_region_variant	3815	exon18	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TTACAGGCTCGAC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2485-1G>C	4.37:g.55602664G>C			Somatic	72	0	0		WXS	Illumina HiSeq	.	74	0.24	18	NM_000222	11	0.82	9	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.811778	0.70797	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.89343	-2.5;-2.5	5.7	5.7	0.88788	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.105093	0.41823	D	0.000804	D	0.88407	0.6428	N	0.12961	0.28	0.80722	D	1	D;D	0.63046	0.992;0.988	P;P	0.60117	0.808;0.869	D	0.87132	0.2197	9	.	.	.	.	19.4515	0.94869	0.0:0.0:1.0:0.0	.	825;829	P10721-2;P10721	.;KIT_HUMAN	P	829;825	ENSP00000288135:A829P;ENSP00000390987:A825P	.	A	+	1	0	KIT	55297421	1.000000	0.71417	0.991000	0.47740	0.020000	0.10135	7.910000	0.87451	2.683000	0.91414	0.655000	0.94253	GCT			0.398	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			Missense_Mutation
LARP7	51574	mdanderson.org	37	4	113575239	113575239	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr4:113575239G>T	ENST00000344442.5	+	12	1870	c.1592G>T	c.(1591-1593)aGg>aTg	p.R531M	LARP7_ENST00000324052.6_Missense_Mutation_p.R531M|LARP7_ENST00000509061.1_Missense_Mutation_p.R538M	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	531					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CACGAACAAAGGTATTGGCAG	0.333																																					p.R538M													.	.			0			c.G1613T												150.0	154.0	153.0					4																	113575239		2203	4300	6503	SO:0001583	missense	51574	exon14			AACAAAGGTATTG	AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1592G>T	4.37:g.113575239G>T	ENSP00000344950:p.Arg531Met		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	85	0.05	4	NM_001267039	343	0.00	0	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	ENST00000344442.5	37	CCDS3701.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.679763|4.679763	0.88542|0.88542	.|.	.|.	ENSG00000174720|ENSG00000174720	ENST00000511529|ENST00000344442;ENST00000509061;ENST00000324052	.|T;T;T	.|0.47869	.|0.83;0.83;0.83	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Nucleotide-binding, alpha-beta plait (1);RNA-binding motif (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69287|0.69287	0.3094|0.3094	M|M	0.72479|0.72479	2.2|2.2	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.72625	.|0.978	T|T	0.72250|0.72250	-0.4348|-0.4348	5|10	.|0.72032	.|D	.|0.01	-37.1209|-37.1209	19.075|19.075	0.93158|0.93158	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|531	.|Q4G0J3	.|LARP7_HUMAN	C|M	325|531;538;531	.|ENSP00000344950:R531M;ENSP00000422626:R538M;ENSP00000314311:R531M	.|ENSP00000314311:R531M	G|R	+|+	1|2	0|0	LARP7|LARP7	113794688|113794688	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.971000|0.971000	0.66376|0.66376	9.301000|9.301000	0.96167|0.96167	2.502000|2.502000	0.84385|0.84385	0.591000|0.591000	0.81541|0.81541	GGT|AGG			0.333	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256417.2		NM_016648	
PCDH18	54510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	138452613	138452613	+	Silent	SNP	T	T	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr4:138452613T>G	ENST00000344876.4	-	1	1016	c.630A>C	c.(628-630)tcA>tcC	p.S210S	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Silent_p.S210S|PCDH18_ENST00000507846.1_5'UTR|PCDH18_ENST00000510305.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GCTCGTAGCTTGACTTCAGCT	0.468																																					p.S210S													.	.			0			c.A630C												67.0	66.0	67.0					4																	138452613		2203	4300	6503	SO:0001819	synonymous_variant	54510	exon1			GTAGCTTGACTTC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.630A>C	4.37:g.138452613T>G			Somatic	69	0	0		WXS	Illumina HiSeq	.	62	0.10	6	NM_019035	0		0	A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	ENST00000344876.4	37	CCDS34064.1																																																																																					0.468	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000364614.1		NM_019035	
TENM3	55714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	183664532	183664532	+	Missense_Mutation	SNP	A	A	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr4:183664532A>T	ENST00000511685.1	+	19	3712	c.3589A>T	c.(3589-3591)Ata>Tta	p.I1197L	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.I1197L			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1197					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGTGCGGCGGATATTCCCTTC	0.443																																					p.I1197L													.	.			0			c.A3589T												97.0	99.0	98.0					4																	183664532		1929	4140	6069	SO:0001583	missense	55714	exon18			CGGCGGATATTCC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3589A>T	4.37:g.183664532A>T	ENSP00000424226:p.Ile1197Leu		Somatic	113	0	0		WXS	Illumina HiSeq	.	138	0.21	29	NM_001080477	1	0.00	0	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.993357	0.54041	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.89875	-2.58;-2.58	5.49	5.49	0.81192	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	D	0.92224	0.7534	M	0.65498	2.005	0.80722	D	1	P	0.48016	0.904	P	0.55824	0.785	D	0.92130	0.5711	9	0.48119	T	0.1	.	15.7488	0.77967	1.0:0.0:0.0:0.0	.	1197	Q9P273	TEN3_HUMAN	L	1197	ENSP00000424226:I1197L;ENSP00000385276:I1197L	ENSP00000385276:I1197L	I	+	1	0	ODZ3	183901526	1.000000	0.71417	0.994000	0.49952	0.108000	0.19459	9.120000	0.94369	2.306000	0.77630	0.482000	0.46254	ATA			0.443	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361734.1			
CHD1	1105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	98234123	98234123	+	Missense_Mutation	SNP	T	T	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr5:98234123T>A	ENST00000284049.3	-	9	1351	c.1202A>T	c.(1201-1203)aAg>aTg	p.K401M		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	401	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	AGCTGCTGACTTTTGATTGGA	0.363																																					p.K401M													.	.			0			c.A1202T												63.0	62.0	62.0					5																	98234123		2203	4300	6503	SO:0001583	missense	1105	exon9			GCTGACTTTTGAT	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.1202A>T	5.37:g.98234123T>A	ENSP00000284049:p.Lys401Met		Somatic	71	0	0		WXS	Illumina HiSeq	.	56	0.18	10	NM_001270	0		0	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635151	0.87760	.	.	ENSG00000153922	ENST00000284049	T	0.77098	-1.07	5.91	5.91	0.95273	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.34932	U	0.003564	D	0.82815	0.5119	M	0.82823	2.61	0.80722	D	1	B	0.30664	0.289	B	0.37346	0.247	D	0.83462	0.0054	10	0.87932	D	0	.	16.3407	0.83081	0.0:0.0:0.0:1.0	.	401	O14646	CHD1_HUMAN	M	401	ENSP00000284049:K401M	ENSP00000284049:K401M	K	-	2	0	CHD1	98262023	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.669000	0.83911	2.260000	0.74910	0.533000	0.62120	AAG			0.363	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370295.1		NM_001270	
RUFY1	80230	mdanderson.org	37	5	179036460	179036460	+	Silent	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr5:179036460G>T	ENST00000319449.4	+	18	2079	c.2067G>T	c.(2065-2067)gtG>gtT	p.V689V	RUFY1_ENST00000377001.2_3'UTR|RUFY1_ENST00000393438.2_Silent_p.V581V|RUFY1_ENST00000508797.1_3'UTR|RUFY1_ENST00000437570.2_Silent_p.V581V	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	689					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCAAGCCGGTGCGAGTGTGCG	0.642										HNSCC(44;0.11)																											p.V689V													.	.			0			c.G2067T												54.0	41.0	45.0					5																	179036460		2203	4300	6503	SO:0001819	synonymous_variant	80230	exon18			GCCGGTGCGAGTG	AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.2067G>T	5.37:g.179036460G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_025158	99	0.00	0	Q59FF3|Q71S93|Q9H6I3	Silent	SNP	ENST00000319449.4	37	CCDS4445.2																																																																																					0.642	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000253505.2		NM_001040451	
HIST1H3C	8352	broad.mit.edu	37	6	26045967	26045968	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:26045967_26045968delTG	ENST00000540144.1	+	1	329_330	c.329_330delTG	c.(328-330)ctgfs	p.L110fs	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	110					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GACACCAATCTGTGCGCTATTC	0.564																																					p.110_110del													.	HIST1H3C	34		0			c.329_330del																																									SO:0001589	frameshift_variant	8352	exon1			CCAATCTGTGCGC	X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.329_330delTG	6.37:g.26045969_26045970delTG	ENSP00000439493:p.Leu110fs		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	63	0.11	7	NM_003531	4	0.00	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Frame_Shift_Del	DEL	ENST00000540144.1	37	CCDS4576.1																																																																																					0.564	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040078.1		NM_003531	
ZNF184	7738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27419641	27419641	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:27419641G>A	ENST00000211936.6	-	6	1981	c.1697C>T	c.(1696-1698)aCc>aTc	p.T566I	ZNF184_ENST00000377419.1_Missense_Mutation_p.T566I	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	566					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						ATAACTGAAGGTTTTCCCACA	0.403																																					p.T566I													.	.			0			c.C1697T												102.0	96.0	98.0					6																	27419641		2203	4300	6503	SO:0001583	missense	7738	exon6			CTGAAGGTTTTCC	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1697C>T	6.37:g.27419641G>A	ENSP00000211936:p.Thr566Ile		Somatic	53	0	0		WXS	Illumina HiSeq	.	65	0.14	9	NM_007149	9	0.33	3	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354490	0.41700	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	T;T	0.36157	1.27;1.27	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.264843	0.27388	N	0.019598	T	0.19127	0.0459	L	0.49571	1.57	0.09310	N	0.999999	B	0.34290	0.447	B	0.33196	0.159	T	0.08411	-1.0723	10	0.72032	D	0.01	.	11.8196	0.52230	0.0:0.1766:0.8234:0.0	.	566	Q99676	ZN184_HUMAN	I	566;566;482	ENSP00000211936:T566I;ENSP00000366636:T566I	ENSP00000211936:T566I	T	-	2	0	ZNF184	27527620	0.000000	0.05858	1.000000	0.80357	0.935000	0.57460	0.560000	0.23500	2.696000	0.92011	0.591000	0.81541	ACC			0.403	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040146.1		NM_007149	
MICB	4277	ucsc.edu;mdanderson.org	37	6	31474930	31474930	+	Missense_Mutation	SNP	A	A	G	rs201701343		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:31474930A>G	ENST00000252229.6	+	4	824	c.745A>G	c.(745-747)Aac>Gac	p.N249D	MICB_ENST00000538442.1_Missense_Mutation_p.N217D|MICB_ENST00000399150.3_Missense_Mutation_p.N206D	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B											NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						TTTGAGCCACAACACCCAGCA	0.582																																					p.N249D													.	MICB	26		0			c.A745G												53.0	58.0	56.0					6																	31474930		1375	2618	3993	SO:0001583	missense	4277	exon4			AGCCACAACACCC		CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	ENST00000252229.6:c.745A>G	6.37:g.31474930A>G	ENSP00000252229:p.Asn249Asp		Somatic	119	0.0504201681	6		WXS	Illumina HiSeq		123	0.15	18	NM_005931	8	0.25	2		Missense_Mutation	SNP	ENST00000252229.6	37	CCDS43449.1	.	.	.	.	.	.	.	.	.	.	-	0.007	-1.938337	0.00484	.	.	ENSG00000204516	ENST00000538442;ENST00000399150;ENST00000252229	T;T;T	0.12039	2.72;2.72;2.72	2.73	-5.47	0.02600	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.715426	0.11401	N	0.567833	T	0.00440	0.0014	N	0.00157	-1.96	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.36696	-0.9737	10	0.02654	T	1	.	4.674	0.12703	0.4675:0.3197:0.2128:0.0	.	217;206;249	F5H7Q8;A2AC57;Q29980	.;.;MICB_HUMAN	D	217;206;249	ENSP00000442345:N217D;ENSP00000382103:N206D;ENSP00000252229:N249D	ENSP00000252229:N249D	N	+	1	0	MICB	31582909	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.105000	0.10907	-1.388000	0.02092	-2.557000	0.00176	AAC			0.582	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076102.3		NM_005931	
PBX2	5089	broad.mit.edu	37	6	32155509	32155509	+	Missense_Mutation	SNP	T	T	A	rs202223627		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:32155509T>A	ENST00000375050.4	-	5	1055	c.785A>T	c.(784-786)tAt>tTt	p.Y262F	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	262					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Y262F(3)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GGAGTAGAAATACTCATTTAG	0.517																																					p.Y262F													PBX2,NS,carcinoma,0,4	PBX2	29	4	3	Substitution - Missense(3)	lung(3)	c.A785T																																									SO:0001583	missense	5089	exon5			TAGAAATACTCAT		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.785A>T	6.37:g.32155509T>A	ENSP00000364190:p.Tyr262Phe		Somatic	86	0.011627907	1		WXS	Illumina HiSeq	Phase_I	86	0.06	5	NM_002586	46	0.00	0	A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	CCDS4748.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.841111	0.71488	.	.	ENSG00000204304	ENST00000375050	D	0.83673	-1.75	4.63	4.63	0.57726	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.201957	0.34435	N	0.003969	T	0.61837	0.2379	N	0.10629	0.01	0.80722	D	1	P;P	0.42337	0.776;0.502	P;P	0.45232	0.474;0.458	T	0.71314	-0.4630	10	0.49607	T	0.09	-0.8351	12.0363	0.53427	0.0:0.0:0.0:1.0	.	262;262	Q7KZE5;P40425	.;PBX2_HUMAN	F	262	ENSP00000364190:Y262F	ENSP00000364190:Y262F	Y	-	2	0	PBX2	32263487	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.505000	0.81655	1.943000	0.56356	0.459000	0.35465	TAT			0.517	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076194.4			
COL11A2	1302	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	33139321	33139321	+	Silent	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:33139321G>T	ENST00000374708.4	-	41	3181	c.2923C>A	c.(2923-2925)Cga>Aga	p.R975R	COL11A2_ENST00000361917.1_Silent_p.R954R|COL11A2_ENST00000357486.1_Silent_p.R1040R|COL11A2_ENST00000374714.1_Silent_p.R1035R|COL11A2_ENST00000374713.1_Silent_p.R1014R|COL11A2_ENST00000395197.1_Silent_p.R1001R|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000341947.2_Silent_p.R1061R|COL11A2_ENST00000374712.1_Silent_p.R980R	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1061	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						ACTCCATCTCGGCCAGTCGGG	0.642																																					p.R1061R	Melanoma(1;90 116 3946 5341 17093)												.	.			0			c.C3181A												33.0	35.0	34.0					6																	33139321		2203	4300	6503	SO:0001819	synonymous_variant	1302	exon43			CATCTCGGCCAGT	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2923C>A	6.37:g.33139321G>T			Somatic	81	0	0		WXS	Illumina HiSeq	.	81	0.07	6	NM_080680	0		0	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	37	CCDS43452.1																																																																																					0.642	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076032.2			
EZR	7430	mdanderson.org	37	6	159188482	159188482	+	Silent	SNP	T	T	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:159188482T>G	ENST00000367075.3	-	13	1575	c.1407A>C	c.(1405-1407)gcA>gcC	p.A469A	MIR3918_ENST00000581555.1_RNA|EZR_ENST00000337147.7_Silent_p.A469A|EZR_ENST00000392177.4_Silent_p.A437A	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	469	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GGGGCGGGGGTGCTGTCATCA	0.607			T	ROS1	NSCLC																																p.A469A				Dom	yes		6	6q25.3	7430	ezrin		E	.	.			0			c.A1407C												50.0	53.0	52.0					6																	159188482		2203	4300	6503	SO:0001819	synonymous_variant	7430	exon12			CGGGGGTGCTGTC	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1407A>C	6.37:g.159188482T>G			Somatic	35	0.0571428571	2		WXS	Illumina HiSeq	Phase_I	48	0.29	14	NM_003379	67	0.04	3	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	ENST00000367075.3	37	CCDS5258.1																																																																																					0.607	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042878.1		NM_003379	
C6orf99	100130967	mdanderson.org	37	6	159316338	159316338	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:159316338G>T	ENST00000608817.1	+	3	302	c.302G>T	c.(301-303)cGt>cTt	p.R101L	C6orf99_ENST00000367073.4_Missense_Mutation_p.R55L|C6orf99_ENST00000367072.1_Missense_Mutation_p.R24L			Q4VX62	CF099_HUMAN	chromosome 6 open reading frame 99	101																	ctgaattaccgtttccagctc	0.468																																					p.R24L													.	.			0			c.G71T																																									SO:0001583	missense	100130967	exon2			ATTACCGTTTCCA		CCDS55073.1	6q25.3	2011-12-14			ENSG00000203711	ENSG00000203711			21179	protein-coding gene	gene with protein product							Standard	NM_001195032		Approved	yR211F11.1	uc021zhp.1	Q4VX62	OTTHUMG00000015921	ENST00000608817.1:c.302G>T	6.37:g.159316338G>T	ENSP00000476986:p.Arg101Leu		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	36	0.11	4	NM_001195032	1	0.00	0	Q4VX61	Missense_Mutation	SNP	ENST00000608817.1	37		.	.	.	.	.	.	.	.	.	.	G	7.117	0.577171	0.13686	.	.	ENSG00000203711	ENST00000367073;ENST00000367072	.	.	.	2.96	-1.17	0.09648	.	.	.	.	.	T	0.06508	0.0167	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.32693	-0.9897	6	0.87932	D	0	.	3.5908	0.07987	0.4105:0.0:0.1966:0.3929	.	.	.	.	L	101;24	.	ENSP00000356039:R24L	R	+	2	0	C6orf99	159236326	0.013000	0.17824	0.001000	0.08648	0.002000	0.02628	0.249000	0.18216	-0.221000	0.09973	-1.790000	0.00627	CGT			0.468	C6orf99-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_001195032	
IGF2R	3482	broad.mit.edu	37	6	160445736	160445736	+	Splice_Site	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:160445736G>T	ENST00000356956.1	+	5	794	c.646G>T	c.(646-648)Gac>Tac	p.D216Y		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	216					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TAGAGACATAGGTATGAATCT	0.438																																					p.D216Y													.	IGF2R	251		0			c.G646T												118.0	107.0	111.0					6																	160445736		2203	4300	6503	SO:0001630	splice_region_variant	3482	exon5			GACATAGGTATGA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.646+1G>T	6.37:g.160445736G>T			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	63	0.05	3	NM_000876	1	0.00	0	Q7Z7G9|Q96PT5	Splice_Site	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700523	0.68501	.	.	ENSG00000197081	ENST00000356956	T	0.02085	4.46	5.62	5.62	0.85841	Mannose-6-phosphate receptor, binding (1);	0.412810	0.30464	N	0.009562	T	0.06005	0.0156	M	0.78223	2.4	0.50813	D	0.999896	P	0.48503	0.911	P	0.52267	0.694	T	0.11717	-1.0576	10	0.56958	D	0.05	-4.0139	19.6574	0.95849	0.0:0.0:1.0:0.0	.	216	P11717	MPRI_HUMAN	Y	216	ENSP00000349437:D216Y	ENSP00000349437:D216Y	D	+	1	0	IGF2R	160365726	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	5.372000	0.66156	2.645000	0.89757	0.462000	0.41574	GAC			0.438	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042931.1		NM_000876	Missense_Mutation
MLLT4	4301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168276034	168276034	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr6:168276034G>A	ENST00000447894.2	+	5	598	c.598G>A	c.(598-600)Gct>Act	p.A200T	MLLT4_ENST00000400822.3_Missense_Mutation_p.A199T|MLLT4_ENST00000366806.2_Missense_Mutation_p.A200T|MLLT4_ENST00000392112.1_Missense_Mutation_p.A199T|MLLT4_ENST00000351017.4_Missense_Mutation_p.A200T|MLLT4_ENST00000344191.4_Missense_Mutation_p.A200T|MLLT4_ENST00000392108.3_Missense_Mutation_p.A200T			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	200					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCGACTGGCTGCTGAGGTTTA	0.368			T	MLL	AL																																p.A200T				Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	.			0			c.G598A												123.0	134.0	130.0					6																	168276034		2203	4296	6499	SO:0001583	missense	4301	exon5			CTGGCTGCTGAGG	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.598G>A	6.37:g.168276034G>A	ENSP00000404595:p.Ala200Thr		Somatic	77	0	0		WXS	Illumina HiSeq	.	68	0.10	7	NM_001040000	1	0.00	0	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.	.	.	.	.	.	.	.	.	.	G	13.67	2.306793	0.40795	.	.	ENSG00000130396	ENST00000400825;ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400824;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04502	3.81;3.71;3.81;3.8;3.61;3.71;3.71	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.02533	0.0077	L	0.36672	1.1	0.47407	D	0.999418	P;P;P	0.47762	0.9;0.551;0.551	P;B;B	0.44990	0.466;0.333;0.275	T	0.59920	-0.7363	10	0.26408	T	0.33	0.033	10.9201	0.47158	0.0867:0.0:0.9133:0.0	.	199;200;199	P55196-5;P55196-6;P55196-2	.;.;.	T	200;200;200;200;200;199;200;201;199;200	ENSP00000341118:A200T;ENSP00000252692:A200T;ENSP00000375956:A200T;ENSP00000355771:A200T;ENSP00000375960:A199T;ENSP00000383623:A199T;ENSP00000404595:A200T	ENSP00000345834:A200T	A	+	1	0	MLLT4	168018883	1.000000	0.71417	0.987000	0.45799	0.995000	0.86356	7.619000	0.83057	2.333000	0.79357	0.460000	0.39030	GCT			0.368	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000372077.1		NM_005936	
GS1-124K5.2	0	broad.mit.edu	37	7	65888170	65888170	+	RNA	DEL	A	A	-	rs398047695|rs58186454		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr7:65888170delA	ENST00000442578.1	-	0	826																											TATTCAGAGCAAAAAAAAAAA	0.343																																					.													.	.			0			.																																											0	.			CAGAGCAAAAAAA																													7.37:g.65888170delA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	5	0.60	3	.	19	0.00	0		RNA	DEL	ENST00000442578.1	37																																																																																						0.343	GS1-124K5.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	pseudogene		OTTHUMT00000344730.1			
LRCH4	4034	mdanderson.org	37	7	100179705	100179705	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr7:100179705G>T	ENST00000310300.6	-	3	503	c.451C>A	c.(451-453)Ctg>Atg	p.L151M	LRCH4_ENST00000497245.1_De_novo_Start_InFrame	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	151					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCAGGGGGCAGGGCTCCCAGC	0.637																																					p.L151M													.	.			0			c.C451A												64.0	66.0	66.0					7																	100179705		2203	4300	6503	SO:0001583	missense	4034	exon3			GGGGCAGGGCTCC	AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.451C>A	7.37:g.100179705G>T	ENSP00000309689:p.Leu151Met		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_002319	30	0.00	0	A4D2D5|Q8WV85|Q96ID0	Missense_Mutation	SNP	ENST00000310300.6	37	CCDS34706.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101914	0.56183	.	.	ENSG00000077454	ENST00000310300	T	0.64991	-0.13	4.71	2.91	0.33838	.	0.000000	0.64402	D	0.000004	T	0.78761	0.4334	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79512	-0.1773	10	0.87932	D	0	-11.7495	9.1714	0.37083	0.1794:0.0:0.8206:0.0	.	151	O75427	LRCH4_HUMAN	M	151	ENSP00000309689:L151M	ENSP00000309689:L151M	L	-	1	2	LRCH4	100017641	1.000000	0.71417	0.998000	0.56505	0.430000	0.31655	4.046000	0.57376	0.731000	0.32448	-0.156000	0.13503	CTG			0.637	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356110.1		NM_002319	
TUBBP1	92755	broad.mit.edu;bcgsc.ca	37	8	30209831	30209831	+	RNA	SNP	A	A	C			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr8:30209831A>C	ENST00000518096.1	+	0	443									tubulin, beta pseudogene 1																		AACTGGGCCAAAGGCCACTAC	0.562																																					.													.	.			0			.																																											0	.			GGGCCAAAGGCCA	J00317		8p12	2012-10-16	2005-11-15		ENSG00000127589	ENSG00000127589			12414	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 1"""			7070533	Standard	NG_001206		Approved				OTTHUMG00000163834		8.37:g.30209831A>C			Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	131	0.05	7	.	63	0.00	0		RNA	SNP	ENST00000518096.1	37																																																																																						0.562	TUBBP1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000375880.1		NG_001206	
NRG1	3084	bcgsc.ca	37	8	32617775	32617775	+	Missense_Mutation	SNP	G	G	T	rs373062517		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr8:32617775G>T	ENST00000405005.3	+	11	1119	c.1119G>T	c.(1117-1119)atG>atT	p.M373I	NRG1_ENST00000356819.4_Missense_Mutation_p.M378I|NRG1_ENST00000523079.1_Missense_Mutation_p.M370I|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000519301.1_Missense_Mutation_p.M323I|NRG1_ENST00000521670.1_Missense_Mutation_p.M373I|NRG1_ENST00000287842.3_Missense_Mutation_p.M370I|NRG1_ENST00000539990.1_Missense_Mutation_p.M216I|NRG1_ENST00000338921.4_Missense_Mutation_p.M381I|NRG1_ENST00000287845.5_Missense_Mutation_p.M344I			Q02297	NRG1_HUMAN	neuregulin 1	373					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TAATCGTGATGTCATCCGTAG	0.517																																					p.M378I													.	NRG1	260		0			c.G1134T							G	ILE/MET,ILE/MET,ILE/MET,ILE/MET,ILE/MET,ILE/MET,ILE/MET,ILE/MET,ILE/MET,ILE/MET	0,4406		0,0,2203	118.0	120.0	119.0		1119,1119,1110,1134,1110,1110,969,1071,657,1020	4.0	1.0	8		119	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	NRG1	NM_013964.3,NM_013960.3,NM_013957.3,NM_013956.3,NM_001160008.1,NM_001160004.1,NM_001160001.1,NM_001159999.1,NM_001159996.1,NM_001159995.1	10,10,10,10,10,10,10,10,10,10	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	373/641,373/463,370/638,378/646,370/421,370/460,323/591,357/625,219/309,340/608	32617775	1,13005	2203	4300	6503	SO:0001583	missense	3084	exon12			CGTGATGTCATCC	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1119G>T	8.37:g.32617775G>T	ENSP00000384620:p.Met373Ile		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_1	128	0.05	6	NM_013956	0		0	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947460	0.34377	0.0	1.16E-4	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000521670;ENST00000539990	T;T;T;T;T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.92	3.98	0.46160	Neuregulin 1-related, C-terminal (1);	0.326457	0.38005	N	0.001857	T	0.24275	0.0588	N	0.04959	-0.14	0.31372	N	0.680075	B;B;B;B;B;B;B;B;B;B;B	0.26708	0.0;0.002;0.001;0.001;0.001;0.001;0.157;0.001;0.001;0.001;0.002	B;B;B;B;B;B;B;B;B;B;B	0.22386	0.003;0.01;0.004;0.002;0.004;0.006;0.039;0.002;0.004;0.002;0.006	T	0.07947	-1.0746	10	0.46703	T	0.11	-3.6799	2.1763	0.03863	0.1669:0.1902:0.498:0.1449	.	216;219;370;344;378;369;381;370;373;378;373	B7Z1E3;B7Z1D7;E9PHH4;F8W9E3;Q7RTW4;B0FYA9;Q02297-2;Q02297-7;Q02297;Q02297-6;Q02297-3	.;.;.;.;.;.;.;.;NRG1_HUMAN;.;.	I	340;323;446;370;381;378;373;344;370;373;373;216	ENSP00000430053:M340I;ENSP00000429582:M323I;ENSP00000429067:M446I;ENSP00000430120:M370I;ENSP00000343395:M381I;ENSP00000349275:M378I;ENSP00000287840:M373I;ENSP00000287845:M344I;ENSP00000287842:M370I;ENSP00000384620:M373I;ENSP00000428828:M373I;ENSP00000439276:M216I	ENSP00000287840:M373I	M	+	3	0	NRG1	32737317	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	0.812000	0.27211	2.804000	0.96469	0.655000	0.94253	ATG			0.517	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000472504.1			
RAB11FIP1	80223	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	37756869	37756869	+	Missense_Mutation	SNP	G	G	A	rs372489374		TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr8:37756869G>A	ENST00000330843.4	-	1	103	c.91C>T	c.(91-93)Cgg>Tgg	p.R31W	RAB11FIP1_ENST00000522727.1_5'UTR|RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.R31W	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	31	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CCCTTGGCCCGCAGGCCCCGC	0.721																																					p.R31W													.	RAB11FIP1	105		0			c.C91T								TRP/ARG,TRP/ARG	1,4345		0,1,2172	12.0	16.0	15.0		91,91	3.1	1.0	8		15	0,8486		0,0,4243	no	missense,missense	RAB11FIP1	NM_001002814.2,NM_025151.4	101,101	0,1,6415	AA,AG,GG		0.0,0.023,0.0078	probably-damaging,probably-damaging	31/1284,31/650	37756869	1,12831	2173	4243	6416	SO:0001583	missense	80223	exon1			TGGCCCGCAGGCC	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.91C>T	8.37:g.37756869G>A	ENSP00000331342:p.Arg31Trp		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	31	0.13	4	NM_025151	0		0	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	37	CCDS34882.1	.	.	.	.	.	.	.	.	.	.	g	23.6	4.440042	0.83993	2.3E-4	0.0	ENSG00000156675	ENST00000287263;ENST00000330843;ENST00000343853	T;T	0.69685	-0.42;-0.42	4.98	3.13	0.36017	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.108361	0.41097	D	0.000959	D	0.83899	0.5354	M	0.91561	3.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.977;0.999	D	0.85663	0.1290	10	0.72032	D	0.01	-13.8699	12.4643	0.55749	0.0:0.0:0.5603:0.4397	.	31;31	Q6WKZ4-3;Q6WKZ4	.;RFIP1_HUMAN	W	31	ENSP00000287263:R31W;ENSP00000331342:R31W	ENSP00000287263:R31W	R	-	1	2	RAB11FIP1	37876027	0.000000	0.05858	0.982000	0.44146	0.979000	0.70002	0.031000	0.13710	0.476000	0.27440	0.645000	0.84053	CGG			0.721	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000376816.1		NM_025151	
HOOK3	84376	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	42798490	42798490	+	Missense_Mutation	SNP	C	C	G			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr8:42798490C>G	ENST00000307602.4	+	5	502	c.302C>G	c.(301-303)cCt>cGt	p.P101R		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	101	Sufficient for interaction with microtubules.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			TTTACCCTTCCTGATGTGAAC	0.373			T	RET	papillary thyroid																																p.P101R				Dom	yes		8	8p11.21	84376	hook homolog 3		E	.	.			0			c.C302G												100.0	94.0	96.0					8																	42798490		2203	4300	6503	SO:0001583	missense	84376	exon5			CCCTTCCTGATGT	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.302C>G	8.37:g.42798490C>G	ENSP00000305699:p.Pro101Arg		Somatic	79	0	0		WXS	Illumina HiSeq	.	118	0.09	11	NM_032410	3	0.00	0	D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	ENST00000307602.4	37	CCDS6139.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687443	0.88639	.	.	ENSG00000168172	ENST00000307602	T	0.48836	0.8	5.67	5.67	0.87782	.	0.113136	0.64402	D	0.000009	T	0.74238	0.3690	M	0.85041	2.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77713	-0.2485	10	0.87932	D	0	-14.9162	19.8436	0.96701	0.0:1.0:0.0:0.0	.	101;101	Q2VJ45;Q86VS8	.;HOOK3_HUMAN	R	101	ENSP00000305699:P101R	ENSP00000305699:P101R	P	+	2	0	HOOK3	42917647	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.260000	0.78391	2.690000	0.91761	0.644000	0.83932	CCT			0.373	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383172.2		NM_032410	
ABCD1	215	mdanderson.org	37	X	153008788	153008788	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chrX:153008788G>A	ENST00000218104.3	+	9	2378	c.1979G>A	c.(1978-1980)cGg>cAg	p.R660Q	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	660	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> P (in ALD; CALD-type). {ECO:0000269|PubMed:11438993}.|R -> Q (in ALD). {ECO:0000269|PubMed:21889498}.|R -> W (in ALD; CALD, ALMD and AS-types).		alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATCACCCACCGGCCCTCCCTG	0.692																																					p.R660Q													.	.			0			c.G1979A	GRCh37	CM012042	ABCD1	M								19.0	16.0	17.0					X																	153008788		2189	4274	6463	SO:0001583	missense	215	exon9			CCCACCGGCCCTC	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1979G>A	X.37:g.153008788G>A	ENSP00000218104:p.Arg660Gln		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_000033	43	0.00	0	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839976	0.91117	.	.	ENSG00000101986	ENST00000218104	D	0.99855	-7.2	4.69	4.69	0.59074	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.64402	D	0.000017	D	0.99862	0.9935	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96260	0.9190	10	0.87932	D	0	-33.9595	15.8397	0.78835	0.0:0.0:1.0:0.0	.	660	P33897	ABCD1_HUMAN	Q	660	ENSP00000218104:R660Q	ENSP00000218104:R660Q	R	+	2	0	ABCD1	152661982	1.000000	0.71417	0.994000	0.49952	0.613000	0.37349	9.349000	0.97066	2.073000	0.62155	0.523000	0.50628	CGG			0.692	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061041.1		NM_000033	
LTBP4	8425	mdanderson.org	37	19	41128450	41128450	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0H-01A-11D-A435-10	TCGA-ZM-AA0H-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4d6bc81-a99b-4529-bdcc-1b06b8a0cb17	279b58a7-0a6f-44f8-bf5c-d16e07ee0dfb	g.chr19:41128450C>T	ENST00000308370.7	+	27	3560	c.3560C>T	c.(3559-3561)gCg>gTg	p.A1187V	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000396819.3_Missense_Mutation_p.A1120V|LTBP4_ENST00000243562.9_3'UTR|LTBP4_ENST00000545697.1_Missense_Mutation_p.A555V|LTBP4_ENST00000204005.9_Missense_Mutation_p.A1150V	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1188	TB 3.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTTGACACAGCGGCCCCGGAT	0.687																																					.													.	.			0			.												36.0	39.0	38.0					19																	41128450		2037	4188	6225	SO:0001583	missense	8425	.			ACACAGCGGCCCC	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3560C>T	19.37:g.41128450C>T	ENSP00000311905:p.Ala1187Val		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	.	41	0.00	0	O00508|O75412|O75413	Missense_Mutation	SNP	ENST00000308370.7	37		.	.	.	.	.	.	.	.	.	.	C	14.45	2.538627	0.45176	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819	D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98	3.89	2.75	0.32379	Matrix fibril-associated (2);TGF-beta binding (1);	0.225320	0.22602	N	0.057948	D	0.85902	0.5805	.	.	.	0.21220	N	0.999758	P;D;D;D;D	0.69078	0.458;0.981;0.997;0.995;0.995	B;B;P;P;B	0.47430	0.042;0.318;0.547;0.507;0.41	T	0.76091	-0.3086	9	0.17369	T	0.5	.	6.2016	0.20579	0.3266:0.5029:0.1705:0.0	.	200;408;1120;1188;1150	Q8N2S1-4;B3KXY6;E7EUU1;Q8N2S1;E7ENG9	.;.;.;LTBP4_HUMAN;.	V	1150;555;1187;1120	ENSP00000204005:A1150V;ENSP00000441054:A555V;ENSP00000311905:A1187V;ENSP00000380031:A1120V	ENSP00000204005:A1150V	A	+	2	0	LTBP4	45820290	0.000000	0.05858	0.164000	0.22755	0.928000	0.56348	-0.063000	0.11655	2.168000	0.68352	0.462000	0.41574	GCG			0.687	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_003573	
