#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
EVA1B	55194	mdanderson.org	37	1	36788207	36788207	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr1:36788207C>T	ENST00000270824.1	-	3	478	c.187G>A	c.(187-189)Gct>Act	p.A63T	RP11-268J15.5_ENST00000373137.2_5'Flank|EVA1B_ENST00000490466.1_5'UTR|SH3D21_ENST00000474766.1_3'UTR	NM_018166.1	NP_060636.1	Q9NVM1	EVA1B_HUMAN	eva-1 homolog B (C. elegans)	63						integral component of membrane (GO:0016021)											CGGCGCTGAgccgggccccgg	0.736																																					p.A63T													.	.			0			c.G187A												3.0	4.0	4.0					1																	36788207		1707	3492	5199	SO:0001583	missense	55194	exon3			GCTGAGCCGGGCC	AK001509	CCDS406.1	1p34.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000142694	ENSG00000142694			25558	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 78"", ""family with sequence similarity 176, member B"""	C1orf78, FAM176B		14702039	Standard	XM_005270998		Approved	FLJ10647	uc001caj.1	Q9NVM1	OTTHUMG00000007867	ENST00000270824.1:c.187G>A	1.37:g.36788207C>T	ENSP00000270824:p.Ala63Thr		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_018166	28	0.00	0	D3DPS7	Missense_Mutation	SNP	ENST00000270824.1	37	CCDS406.1	.	.	.	.	.	.	.	.	.	.	C	8.861	0.946913	0.18356	.	.	ENSG00000142694	ENST00000270824	T	0.42513	0.97	4.79	1.78	0.24846	.	2.913430	0.01316	N	0.010782	T	0.25680	0.0625	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11567	-1.0582	10	0.18276	T	0.48	-0.6156	3.8753	0.09054	0.1437:0.4246:0.3402:0.0915	.	63	Q9NVM1	F176B_HUMAN	T	63	ENSP00000270824:A63T	ENSP00000270824:A63T	A	-	1	0	FAM176B	36560794	0.016000	0.18221	0.002000	0.10522	0.393000	0.30537	1.328000	0.33758	0.076000	0.16826	-0.521000	0.04368	GCT			0.736	EVA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021689.1		NM_018166	
EPS8L3	79574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	110300454	110300454	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr1:110300454G>T	ENST00000361965.4	-	10	970	c.864C>A	c.(862-864)ttC>ttA	p.F288L	RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000494151.1_5'Flank|EPS8L3_ENST00000361852.4_Missense_Mutation_p.F288L|EPS8L3_ENST00000369805.3_Missense_Mutation_p.F289L	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	288						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		TGATCTTCTGGAAGCAGTCAA	0.587																																					p.F289L													.	.			0			c.C867A												142.0	139.0	140.0					1																	110300454		2203	4300	6503	SO:0001583	missense	79574	exon10			CTTCTGGAAGCAG	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.864C>A	1.37:g.110300454G>T	ENSP00000355255:p.Phe288Leu		Somatic	124	0	0		WXS	Illumina HiSeq	.	164	0.16	27	NM_139053	0		0	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.257649	0.39896	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.58940	2.74;0.31;0.3	5.42	3.54	0.40534	.	0.118422	0.56097	N	0.000035	T	0.18087	0.0434	N	0.25031	0.7	0.40633	D	0.981871	B;B;B;B	0.27997	0.001;0.008;0.003;0.197	B;B;B;B	0.30716	0.007;0.015;0.01;0.119	T	0.08493	-1.0719	10	0.07325	T	0.83	-15.4928	7.8941	0.29695	0.0825:0.0:0.7577:0.1599	.	288;288;288;289	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	L	288;289;288	ENSP00000354551:F288L;ENSP00000358820:F289L;ENSP00000355255:F288L	ENSP00000354551:F288L	F	-	3	2	EPS8L3	110101977	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	1.112000	0.31172	0.657000	0.30906	-0.175000	0.13238	TTC			0.587	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000032234.1		NM_024526	
PRG4	10216	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	186276725	186276725	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr1:186276725C>T	ENST00000445192.2	+	7	1919	c.1874C>T	c.(1873-1875)aCg>aTg	p.T625M	PRG4_ENST00000367486.3_Missense_Mutation_p.T582M|PRG4_ENST00000367485.4_Missense_Mutation_p.T532M|PRG4_ENST00000367483.4_Missense_Mutation_p.T584M|PRG4_ENST00000367484.3_Intron	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	625	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AAGAAGCTCACGCCCACCACC	0.677																																					p.T625M													.	PRG4	259		0			c.C1874T												48.0	45.0	46.0					1																	186276725		2203	4294	6497	SO:0001583	missense	10216	exon7			AGCTCACGCCCAC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1874C>T	1.37:g.186276725C>T	ENSP00000399679:p.Thr625Met		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	58	0.12	7	NM_005807	0		0	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	C	5.758	0.324196	0.10900	.	.	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.05382	3.46;3.6;3.45;3.6	3.23	-1.82	0.07857	.	1.111380	0.07330	U	0.879101	T	0.03520	0.0101	N	0.14661	0.345	0.09310	N	1	D;D;P;D	0.52996	0.957;0.957;0.928;0.957	B;B;B;B	0.42245	0.381;0.381;0.211;0.381	T	0.35822	-0.9773	9	.	.	.	.	3.6019	0.08028	0.3324:0.4493:0.0:0.2184	.	491;532;625;584	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	M	582;491;584;532;625	ENSP00000356456:T582M;ENSP00000356453:T584M;ENSP00000356455:T532M;ENSP00000399679:T625M	.	T	+	2	0	PRG4	184543348	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.084000	0.14891	-0.345000	0.08325	0.449000	0.29647	ACG			0.677	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000086346.1		NM_005807	
ANXA11	311	mdanderson.org	37	10	81921708	81921708	+	Missense_Mutation	SNP	C	C	T	rs372196644		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr10:81921708C>T	ENST00000438331.1	-	13	1645	c.1163G>A	c.(1162-1164)cGg>cAg	p.R388Q	ANXA11_ENST00000535999.1_Missense_Mutation_p.R388Q|ANXA11_ENST00000360615.4_Missense_Mutation_p.R388Q|ANXA11_ENST00000265447.4_Missense_Mutation_p.R388Q|ANXA11_ENST00000372231.3_Missense_Mutation_p.R388Q|ANXA11_ENST00000422982.3_Missense_Mutation_p.R388Q|ANXA11_ENST00000537102.1_Missense_Mutation_p.R355Q	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	388					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			CAGGTGGGCCCGGCTCCGGGA	0.597											OREG0020322	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	c|||	1	0.000199681	0.0	0.0	5008	,	,		16362	0.0		0.0	False		,,,				2504	0.001				p.R388Q													.	.			0			c.G1163A							C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	53.0	55.0	54.0		1163,1163,1163	4.2	1.0	10		54	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ANXA11	NM_001157.2,NM_145868.1,NM_145869.1	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	388/506,388/506,388/506	81921708	1,13005	2203	4300	6503	SO:0001583	missense	311	exon12			TGGGCCCGGCTCC	L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.1163G>A	10.37:g.81921708C>T	ENSP00000398610:p.Arg388Gln		Somatic	27	0	0	1210	WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_145868	37	0.03	1	B4DVE7	Missense_Mutation	SNP	ENST00000438331.1	37	CCDS7364.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.53|15.53	2.860141|2.860141	0.51482|0.51482	0.0|0.0	1.16E-4|1.16E-4	ENSG00000122359|ENSG00000122359	ENST00000447489|ENST00000372231;ENST00000422982;ENST00000438331;ENST00000372234;ENST00000360615;ENST00000265447;ENST00000535999;ENST00000424188;ENST00000537102;ENST00000372219	.|T;T;T;T;T;T;T	.|0.03242	.|4.0;4.0;4.0;4.0;4.0;4.0;4.0	5.07|5.07	4.17|4.17	0.49024|0.49024	.|Annexin repeat, conserved site (1);	.|0.053759	.|0.64402	.|D	.|0.000001	T|T	0.04543|0.04543	0.0124|0.0124	N|N	0.21508|0.21508	0.67|0.67	0.39234|0.39234	D|D	0.963723|0.963723	.|D;P;P	.|0.61697	.|0.99;0.681;0.681	.|P;B;B	.|0.48334	.|0.574;0.135;0.135	T|T	0.54629|0.54629	-0.8265|-0.8265	5|10	.|0.42905	.|T	.|0.14	.|.	11.7065|11.7065	0.51599|0.51599	0.0:0.9128:0.0:0.0872|0.0:0.9128:0.0:0.0872	.|.	.|488;388;388	.|B7Z6L0;Q5T0G8;P50995	.|.;.;ANX11_HUMAN	R|Q	21|388;388;388;388;388;388;388;295;355;35	.|ENSP00000361305:R388Q;ENSP00000404412:R388Q;ENSP00000398610:R388Q;ENSP00000353827:R388Q;ENSP00000265447:R388Q;ENSP00000441748:R388Q;ENSP00000441400:R355Q	.|ENSP00000265447:R388Q	G|R	-|-	1|2	0|0	ANXA11|ANXA11	81911688|81911688	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	3.809000|3.809000	0.55606|0.55606	1.302000|1.302000	0.44855|0.44855	0.558000|0.558000	0.71614|0.71614	GGG|CGG			0.597	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049044.1		NM_145869	
MAT1A	4143	mdanderson.org	37	10	82036264	82036264	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr10:82036264G>T	ENST00000372213.3	-	6	896	c.636C>A	c.(634-636)gaC>gaA	p.D212E	MAT1A_ENST00000485270.1_5'Flank	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	212					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CCAGCGTGATGTCTTCGTTGT	0.582																																					p.D212E													MAT1A,NS,carcinoma,0,1	MAT1A	0	1	0			c.C636A												183.0	148.0	159.0					10																	82036264		2203	4300	6503	SO:0001583	missense	4143	exon6			CGTGATGTCTTCG		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.636C>A	10.37:g.82036264G>T	ENSP00000361287:p.Asp212Glu		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_000429	0		0	D3DWD5|Q5QP09	Missense_Mutation	SNP	ENST00000372213.3	37	CCDS7365.1	.	.	.	.	.	.	.	.	.	.	G	7.402	0.632903	0.14322	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.82526	-1.62	4.84	2.97	0.34412	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.439740	0.26407	N	0.024541	T	0.63355	0.2504	N	0.15975	0.35	0.34276	D	0.681606	B	0.02656	0.0	B	0.01281	0.0	T	0.58109	-0.7694	10	0.02654	T	1	-40.9148	9.6309	0.39778	0.173:0.0:0.827:0.0	.	212	Q00266	METK1_HUMAN	E	212	ENSP00000361287:D212E	ENSP00000361280:D212E	D	-	3	2	MAT1A	82026244	0.000000	0.05858	0.347000	0.25668	0.974000	0.67602	0.081000	0.14823	0.746000	0.32786	0.655000	0.94253	GAC			0.582	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049070.1		NM_000429	
CFAP46	54777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134663865	134663865	+	Silent	SNP	G	G	A	rs368842765		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr10:134663865G>A	ENST00000368586.5	-	41	5935	c.5835C>T	c.(5833-5835)agC>agT	p.S1945S	TTC40_ENST00000263170.5_Silent_p.S106S	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CACAGCCCACGCTCAGCGGCT	0.647																																					p.S1945S													.	.			0			c.C5835T							A		0,4374		0,0,2187	19.0	15.0	17.0		771	-8.3	0.0	10		17	1,8557		0,1,4278	no	coding-synonymous	C10orf92	NM_001200049.1		0,1,6465	AA,AG,GG		0.0117,0.0,0.0077		257/1028	134663865	1,12931	2187	4279	6466	SO:0001819	synonymous_variant	54777	exon41			GCCCACGCTCAGC																												ENST00000368586.5:c.5835C>T	10.37:g.134663865G>A			Somatic	116	0	0		WXS	Illumina HiSeq	.	101	0.12	12	NM_001200049	0		0		Silent	SNP	ENST00000368586.5	37	CCDS58101.1																																																																																					0.647	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000051095.3			
KNDC1	85442	mdanderson.org	37	10	135012548	135012548	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr10:135012548G>T	ENST00000304613.3	+	14	2557	c.2536G>T	c.(2536-2538)Ggc>Tgc	p.G846C	KNDC1_ENST00000368572.2_Missense_Mutation_p.G846C|KNDC1_ENST00000368571.2_Missense_Mutation_p.G781C			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	846	Pro-rich.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GGAGCCAGAGGGCCCCGGGGC	0.756																																					p.G846C													.	.			0			c.G2536T												5.0	7.0	6.0					10																	135012548		1995	4003	5998	SO:0001583	missense	85442	exon14			CCAGAGGGCCCCG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2536G>T	10.37:g.135012548G>T	ENSP00000304437:p.Gly846Cys		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_152643	0		0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.471939	0.43942	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.23348	2.4;2.4;1.91	3.01	0.783	0.18572	.	0.905027	0.08582	U	0.924408	T	0.33760	0.0874	L	0.36672	1.1	0.09310	N	1	D;B;B	0.67145	0.996;0.206;0.131	D;B;B	0.69654	0.965;0.058;0.016	T	0.19614	-1.0300	10	0.39692	T	0.17	.	4.5104	0.11908	0.4556:0.0:0.5444:0.0	.	846;781;846	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	C	846;846;781	ENSP00000304437:G846C;ENSP00000357561:G846C;ENSP00000357560:G781C	ENSP00000304437:G846C	G	+	1	0	KNDC1	134862538	0.083000	0.21467	0.001000	0.08648	0.071000	0.16799	1.292000	0.33342	0.031000	0.15407	0.306000	0.20318	GGC			0.756	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000277044.3		NM_152643	
NRXN2	9379	mdanderson.org	37	11	64374979	64374979	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr11:64374979G>A	ENST00000377551.1	-	22	5039	c.4828C>T	c.(4828-4830)Ccc>Tcc	p.P1610S	NRXN2_ENST00000265459.6_Missense_Mutation_p.P1610S|NRXN2_ENST00000377559.3_Missense_Mutation_p.P1540S|NRXN2_ENST00000409571.1_Missense_Mutation_p.P1603S|NRXN2_ENST00000301894.2_Missense_Mutation_p.P564S			Q9P2S2	NRX2A_HUMAN	neurexin 2	1610					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TTGGCTGTGGGCAGATGGGGG	0.751																																					p.P1610S													.	.			0			c.C4828T												7.0	8.0	8.0					11																	64374979		2140	4179	6319	SO:0001583	missense	9379	exon23			CTGTGGGCAGATG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.4828C>T	11.37:g.64374979G>A	ENSP00000366774:p.Pro1610Ser		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_015080	23	0.00	0	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.915677	0.73098	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T;T	0.65732	0.4;-0.17;-0.16;-0.17;-0.07	3.78	3.78	0.43462	.	0.000000	0.43110	U	0.000620	T	0.75953	0.3920	M	0.69823	2.125	0.80722	D	1	P;B;D;D	0.89917	0.592;0.059;0.995;1.0	B;B;D;D	0.91635	0.191;0.029;0.957;0.999	T	0.77054	-0.2730	10	0.45353	T	0.12	.	13.1391	0.59424	0.0:0.0:1.0:0.0	.	1540;1610;1356;564	Q9P2S2-2;Q9P2S2;E7EV67;P58401	.;NRX2A_HUMAN;.;NRX2B_HUMAN	S	564;1610;1540;1610;1540;1603	ENSP00000301894:P564S;ENSP00000366774:P1610S;ENSP00000366782:P1540S;ENSP00000265459:P1610S;ENSP00000386416:P1603S	ENSP00000265459:P1610S	P	-	1	0	NRXN2	64131555	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.885000	0.92439	1.954000	0.56735	0.313000	0.20887	CCC			0.751	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000104967.3		NM_015080	
ARL2	402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64786160	64786160	+	Silent	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr11:64786160C>T	ENST00000246747.4	+	3	389	c.294C>T	c.(292-294)cgC>cgT	p.R98R	ARL2_ENST00000533729.1_Silent_p.R98R|RP11-399J13.3_ENST00000301886.3_Silent_p.R98R|ARL2_ENST00000529384.1_Silent_p.R98R	NM_001667.3	NP_001658.2	P36404	ARL2_HUMAN	ADP-ribosylation factor-like 2	98					cell cycle (GO:0007049)|centrosome organization (GO:0051297)|GTP catabolic process (GO:0006184)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of GTPase activity (GO:0034260)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of microtubule polymerization (GO:0031116)|regulation of microtubule polymerization (GO:0031113)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|tubulin complex assembly (GO:0007021)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|GTPase inhibitor activity (GO:0005095)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	5						ACCGCCAGCGCATGCAGGACT	0.622																																					p.R98R													ARL2,NS,carcinoma,+1,1	ARL2	1	1	0			c.C294T												51.0	52.0	52.0					11																	64786160		2200	4297	6497	SO:0001819	synonymous_variant	402	exon3			CCAGCGCATGCAG	AF493888	CCDS8088.1, CCDS55770.1	11q13	2014-05-09			ENSG00000213465	ENSG00000213465		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	693	protein-coding gene	gene with protein product		601175				8415637, 9253601	Standard	NM_001667		Approved	ARFL2	uc001och.4	P36404	OTTHUMG00000165728	ENST00000246747.4:c.294C>T	11.37:g.64786160C>T			Somatic	53	0	0		WXS	Illumina HiSeq	.	43	0.16	7	NM_001667	89	0.43	38	G3V184|Q9BUK8	Silent	SNP	ENST00000246747.4	37	CCDS8088.1																																																																																					0.622	ARL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385963.1		NM_001667	
CHRDL2	25884	ucsc.edu	37	11	74424504	74424504	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr11:74424504G>T	ENST00000376332.3	-	3	712	c.216C>A	c.(214-216)taC>taA	p.Y72*	CHRDL2_ENST00000534159.1_5'UTR|CHRDL2_ENST00000263671.5_Nonsense_Mutation_p.Y72*	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	72	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					AGTGGAGGCGGTAACAACTCA	0.587																																					p.Y72X													.	CHRDL2	47		0			c.C216A												100.0	89.0	92.0					11																	74424504		2200	4293	6493	SO:0001587	stop_gained	25884	exon3			GAGGCGGTAACAA	AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.216C>A	11.37:g.74424504G>T	ENSP00000365510:p.Tyr72*		Somatic	61	0	0		WXS	Illumina HiSeq		38	0.11	4	NM_015424	0		0	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Nonsense_Mutation	SNP	ENST00000376332.3	37		.	.	.	.	.	.	.	.	.	.	G	38	7.016659	0.98006	.	.	ENSG00000054938	ENST00000263671;ENST00000376332;ENST00000528789	.	.	.	5.12	3.21	0.36854	.	0.277119	0.34025	N	0.004337	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.8395	10.3498	0.43927	0.174:0.0:0.826:0.0	.	.	.	.	X	72	.	ENSP00000263671:Y72X	Y	-	3	2	CHRDL2	74102152	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.603000	0.54074	1.298000	0.44778	0.563000	0.77884	TAC			0.587	CHRDL2-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000385391.1			
ACER3	55331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	76726118	76726118	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr11:76726118T>C	ENST00000532485.1	+	8	660	c.556T>C	c.(556-558)Ttt>Ctt	p.F186L	ACER3_ENST00000538157.1_Missense_Mutation_p.F144L|ACER3_ENST00000526597.1_Missense_Mutation_p.F91L|ACER3_ENST00000533873.1_Missense_Mutation_p.F149L|ACER3_ENST00000544113.1_Missense_Mutation_p.F53L	NM_018367.5	NP_060837.3	Q9NUN7	ACER3_HUMAN	alkaline ceramidase 3	186					ceramide metabolic process (GO:0006672)|phytosphingosine biosynthetic process (GO:0071602)|positive regulation of cell proliferation (GO:0008284)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of Golgi membrane (GO:0030173)	phytoceramidase activity (GO:0070774)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	9						TTTATTGGGATTTTTATTTTG	0.308																																					p.F186L													.	.			0			c.T556C												74.0	78.0	77.0					11																	76726118		2200	4292	6492	SO:0001583	missense	55331	exon8			TTGGGATTTTTAT	AF214454	CCDS8247.1, CCDS73352.1	11q13.5	2013-01-25	2008-12-19	2008-12-19	ENSG00000078124	ENSG00000078124	3.5.1.23	"""Alkaline ceramidase"""	16066	protein-coding gene	gene with protein product	"""alkaline phytoceramidase"""		"""phytoceramidase, alkaline"""	PHCA		11356846, 18619555	Standard	XM_005274090		Approved	FLJ11238, APHC	uc009yum.1	Q9NUN7	OTTHUMG00000165225	ENST00000532485.1:c.556T>C	11.37:g.76726118T>C	ENSP00000434480:p.Phe186Leu		Somatic	51	0	0		WXS	Illumina HiSeq	.	38	0.18	7	NM_018367	1	0.00	0	B2RC99	Missense_Mutation	SNP	ENST00000532485.1	37	CCDS8247.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.332734	0.81801	.	.	ENSG00000078124	ENST00000534206;ENST00000532485;ENST00000526597;ENST00000533873;ENST00000538157;ENST00000530243;ENST00000544113	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.47	4.31	0.51392	.	0.054018	0.64402	D	0.000001	T	0.63896	0.2550	M	0.82323	2.585	0.44677	D	0.997668	D;D	0.89917	0.957;1.0	P;D	0.72982	0.752;0.979	T	0.66428	-0.5926	10	0.72032	D	0.01	-15.4842	9.8357	0.40968	0.1537:0.0:0.0:0.8463	.	149;186	B7Z2Q2;Q9NUN7	.;ACER3_HUMAN	L	144;186;91;149;144;144;53	ENSP00000435733:F144L;ENSP00000434480:F186L;ENSP00000431149:F91L;ENSP00000436252:F149L;ENSP00000440916:F144L;ENSP00000440663:F53L	ENSP00000431149:F91L	F	+	1	0	ACER3	76403766	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.327000	0.72910	0.867000	0.35654	0.402000	0.26972	TTT			0.308	ACER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382770.2		NM_018367	
GRM5	2915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	88338026	88338026	+	Silent	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr11:88338026G>A	ENST00000305447.4	-	4	1403	c.1254C>T	c.(1252-1254)ctC>ctT	p.L418L	GRM5_ENST00000393297.1_Silent_p.L418L|GRM5_ENST00000418177.2_Silent_p.L418L|GRM5_ENST00000455756.2_Silent_p.L418L|GRM5_ENST00000305432.5_Silent_p.L418L	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	418					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	AGCCTGGGCAGAGGGACATCT	0.468																																					p.L418L													.	.			0			c.C1254T												93.0	81.0	85.0					11																	88338026		2201	4299	6500	SO:0001819	synonymous_variant	2915	exon5			TGGGCAGAGGGAC	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1254C>T	11.37:g.88338026G>A			Somatic	110	0	0		WXS	Illumina HiSeq	.	110	0.16	18	NM_000842	0		0	Q6J164	Silent	SNP	ENST00000305447.4	37	CCDS44694.1																																																																																					0.468	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000259226.1		NM_000842	
MAML2	84441	broad.mit.edu;mdanderson.org	37	11	95825263	95825263	+	Silent	SNP	C	C	T	rs537179849	byFrequency	TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr11:95825263C>T	ENST00000524717.1	-	2	3216	c.1932G>A	c.(1930-1932)caG>caA	p.Q644Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	644					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgttgctgctgctgct	0.522			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q644Q				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2	94		0			c.G1932A												41.0	45.0	43.0					11																	95825263		2087	4093	6180	SO:0001819	synonymous_variant	84441	exon2			TTGTTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1932G>A	11.37:g.95825263C>T			Somatic	55	0.0181818182	1		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_032427	1	0.00	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																					0.522	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395540.1			
PLXNC1	10154	bcgsc.ca;mdanderson.org	37	12	94637739	94637739	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr12:94637739G>T	ENST00000258526.4	+	12	2575	c.2326G>T	c.(2326-2328)Ggc>Tgc	p.G776C		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	776					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						AACCATGATGGGCAGAAATTT	0.323																																					p.G776C													.	PLXNC1	135		0			c.G2326T												141.0	132.0	135.0					12																	94637739		2202	4299	6501	SO:0001583	missense	10154	exon12			ATGATGGGCAGAA	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2326G>T	12.37:g.94637739G>T	ENSP00000258526:p.Gly776Cys		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_1	98	0.05	5	NM_005761	0		0	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037140	0.75617	.	.	ENSG00000136040	ENST00000258526	D	0.98164	-4.76	5.56	5.56	0.83823	Cell surface receptor IPT/TIG (2);Immunoglobulin-like fold (1);	0.106858	0.64402	D	0.000006	D	0.98207	0.9407	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99727	1.1011	10	0.87932	D	0	.	17.6616	0.88193	0.0:0.0:1.0:0.0	.	776	O60486	PLXC1_HUMAN	C	776	ENSP00000258526:G776C	ENSP00000258526:G776C	G	+	1	0	PLXNC1	93161870	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.526000	0.67116	2.777000	0.95525	0.591000	0.81541	GGC			0.323	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408126.2			
OXA1L	5018	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	23239418	23239418	+	Silent	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr14:23239418G>A	ENST00000604262.1	+	5	623	c.600G>A	c.(598-600)tcG>tcA	p.S200S	OXA1L_ENST00000285848.5_Silent_p.S260S|OXA1L_ENST00000358043.5_Silent_p.S184S|OXA1L_ENST00000412791.1_Silent_p.S200S			Q15070	OXA1L_HUMAN	oxidase (cytochrome c) assembly 1-like	200					aerobic respiration (GO:0009060)|mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex I biogenesis (GO:0097031)|negative regulation of ATPase activity (GO:0032780)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|protein complex assembly (GO:0006461)|protein insertion into membrane (GO:0051205)|protein tetramerization (GO:0051262)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	mitochondrial ribosome binding (GO:0097177)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|skin(2)	19	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.0096)		AGGCTTCCTCGGAGATGGCAC	0.418																																					p.S260S													.	.			0			c.G780A												90.0	86.0	87.0					14																	23239418		2203	4300	6503	SO:0001819	synonymous_variant	5018	exon5			TTCCTCGGAGATG		CCDS9573.1	14q11.2	2009-05-26			ENSG00000155463	ENSG00000155463			8526	protein-coding gene	gene with protein product		601066				8586451, 19349278	Standard	NM_005015		Approved	MGC133129, OXA1	uc001wgn.2	Q15070	OTTHUMG00000028691	ENST00000604262.1:c.600G>A	14.37:g.23239418G>A			Somatic	98	0	0		WXS	Illumina HiSeq	.	117	0.08	9	NM_005015	41	0.15	6	B4DPA2	Silent	SNP	ENST00000604262.1	37																																																																																						0.418	OXA1L-012	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000468876.1		NM_005015	
TRMT61A	115708	broad.mit.edu	37	14	104001019	104001019	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr14:104001019G>T	ENST00000389749.4	+	4	838	c.731G>T	c.(730-732)aGc>aTc	p.S244I		NM_152307.2	NP_689520.2	Q96FX7	TRM61_HUMAN	tRNA methyltransferase 61 homolog A (S. cerevisiae)	244						nucleus (GO:0005634)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			skin(1)	1						CGCACTGTCAGCCTGCCACCG	0.697																																					p.S244I													.	TRMT61A	15		0			c.G731T												15.0	22.0	20.0					14																	104001019		2135	4223	6358	SO:0001583	missense	115708	exon4			CTGTCAGCCTGCC	AK097771	CCDS41994.1	14q32	2009-01-09	2009-01-09	2009-01-09		ENSG00000166166			23790	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 172"""	C14orf172		16043508	Standard	NM_152307		Approved	FLJ40452, GCD14, Gcd14p, hTRM61	uc010aws.3	Q96FX7		ENST00000389749.4:c.731G>T	14.37:g.104001019G>T	ENSP00000374399:p.Ser244Ile		Somatic	40	0.025	1		WXS	Illumina HiSeq	Phase_I	47	0.13	6	NM_152307	24	0.00	0	A6NN78|Q8N7Q9	Missense_Mutation	SNP	ENST00000389749.4	37	CCDS41994.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.78|11.78	1.740375|1.740375	0.30865|0.30865	.|.	.|.	ENSG00000166166|ENSG00000166166	ENST00000299202|ENST00000389749;ENST00000299201	.|T	.|0.45668	.|0.89	4.67|4.67	3.63|3.63	0.41609|0.41609	.|.	.|0.658034	.|0.15514	.|N	.|0.258391	T|T	0.26774|0.26774	0.0655|0.0655	N|N	0.20483|0.20483	0.58|0.58	0.41995|0.41995	D|D	0.990869|0.990869	.|B	.|0.24132	.|0.098	.|B	.|0.23716	.|0.048	T|T	0.11179|0.11179	-1.0598|-1.0598	5|10	.|0.42905	.|T	.|0.14	-4.0183|-4.0183	8.2926|8.2926	0.31967|0.31967	0.2251:0.0:0.7749:0.0|0.2251:0.0:0.7749:0.0	.|.	.|244	.|Q96FX7	.|TRM61_HUMAN	S|I	146|244	.|ENSP00000374399:S244I	.|ENSP00000299201:S244I	A|S	+|+	1|2	0|0	TRMT61A|TRMT61A	103070772|103070772	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.671000|0.671000	0.39405|0.39405	2.535000|2.535000	0.45685|0.45685	2.140000|2.140000	0.66376|0.66376	0.313000|0.313000	0.20887|0.20887	GCC|AGC			0.697	TRMT61A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414988.1		NM_152307	
FBN1	2200	broad.mit.edu	37	15	48703418	48703418	+	Silent	SNP	G	G	T	rs397515862|rs138574576	byFrequency	TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr15:48703418G>T	ENST00000316623.5	-	66	8840	c.8385C>A	c.(8383-8385)atC>atA	p.I2795I	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2795					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTCCAGATTCGATCAAGTATC	0.418																																					p.I2795I													.	FBN1	310		0			c.C8385A												151.0	145.0	147.0					15																	48703418		2198	4297	6495	SO:0001819	synonymous_variant	2200	exon66			AGATTCGATCAAG	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8385C>A	15.37:g.48703418G>T			Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	124	0.04	5	NM_000138	2	0.00	0	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1																																																																																					0.418	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000417355.1			
WDR90	197335	mdanderson.org	37	16	717551	717551	+	Missense_Mutation	SNP	C	C	T	rs370037118		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr16:717551C>T	ENST00000293879.4	+	41	5209	c.5209C>T	c.(5209-5211)Cgc>Tgc	p.R1737C	WDR90_ENST00000315764.4_Missense_Mutation_p.R288C|RHOT2_ENST00000315082.4_5'Flank|WDR90_ENST00000549091.1_Missense_Mutation_p.R1739C|WDR90_ENST00000547944.1_Missense_Mutation_p.R336C			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1737										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CACGGCCGCCCGCAACGAGAT	0.642																																					p.R1737C													WDR90,NS,carcinoma,0,1	WDR90	0	1	0			c.C5209T							C	CYS/ARG	1,4203		0,1,2101	44.0	51.0	49.0		5209	1.4	0.0	16		49	0,8424		0,0,4212	no	missense	WDR90	NM_145294.4	180	0,1,6313	TT,TC,CC		0.0,0.0238,0.0079	benign	1737/1749	717551	1,12627	2102	4212	6314	SO:0001583	missense	197335	exon41			GCCGCCCGCAACG	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.5209C>T	16.37:g.717551C>T	ENSP00000293879:p.Arg1737Cys		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_145294	144	0.00	0	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	C	3.664	-0.068866	0.07228	2.38E-4	0.0	ENSG00000161996	ENST00000549091;ENST00000293879;ENST00000547944;ENST00000315764	T;T;T;T	0.66460	3.38;1.54;-0.21;1.55	4.9	1.38	0.22167	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.549075	0.18134	N	0.150655	T	0.40645	0.1125	N	0.04203	-0.255	0.21652	N	0.999609	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.27123	-1.0083	10	0.39692	T	0.17	.	9.4268	0.38586	0.0:0.6123:0.0:0.3877	.	288;336;1737	Q96KV7-7;G3V201;Q96KV7	.;.;WDR90_HUMAN	C	1739;1737;336;288	ENSP00000448122:R1739C;ENSP00000293879:R1737C;ENSP00000449576:R336C;ENSP00000322808:R288C	ENSP00000293879:R1737C	R	+	1	0	WDR90	657552	0.030000	0.19436	0.026000	0.17262	0.001000	0.01503	0.495000	0.22483	0.155000	0.19261	-1.821000	0.00599	CGC			0.642	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000404335.1		NM_145294	
UNKL	64718	mdanderson.org	37	16	1417324	1417324	+	Silent	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr16:1417324C>T	ENST00000389221.4	-	14	1805	c.1806G>A	c.(1804-1806)gcG>gcA	p.A602A	UNKL_ENST00000402641.2_Silent_p.A104A|UNKL_ENST00000508903.2_Silent_p.A605A|UNKL_ENST00000391893.2_Silent_p.A101A|UNKL_ENST00000248104.7_Silent_p.A101A|UNKL_ENST00000397464.1_Silent_p.A104A|UNKL_ENST00000403703.1_Silent_p.A104A	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	602					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				TGGCCTCCTGCGCCTCTCGCT	0.667																																					p.A605A													.	.			0			c.G1815A												13.0	11.0	11.0					16																	1417324		2143	4218	6361	SO:0001819	synonymous_variant	64718	exon14			CTCCTGCGCCTCT	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1806G>A	16.37:g.1417324C>T			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001193388	5	0.00	0	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Silent	SNP	ENST00000389221.4	37	CCDS53981.1																																																																																					0.667	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_001037125	
KLHL36	79786	mdanderson.org	37	16	84690889	84690889	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr16:84690889G>T	ENST00000564996.1	+	3	617	c.476G>T	c.(475-477)aGc>aTc	p.S159I	KLHL36_ENST00000258157.5_Missense_Mutation_p.S159I	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	159	BACK.				protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TCCATCTACAGCCTCAAGCGG	0.567																																					p.S159I													.	.			0			c.G476T												95.0	82.0	86.0					16																	84690889		2199	4300	6499	SO:0001583	missense	79786	exon3			TCTACAGCCTCAA	AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.476G>T	16.37:g.84690889G>T	ENSP00000456743:p.Ser159Ile		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_024731	1	0.00	0	Q8N5G6|Q9H9U6	Missense_Mutation	SNP	ENST00000564996.1	37	CCDS10948.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.930044	0.52759	.	.	ENSG00000135686	ENST00000325279;ENST00000258157	T	0.70282	-0.47	5.79	4.84	0.62591	BTB/Kelch-associated (2);	0.116858	0.85682	D	0.000000	T	0.71409	0.3336	M	0.64404	1.975	0.49299	D	0.999777	P;P	0.47962	0.903;0.459	P;B	0.48400	0.576;0.206	T	0.72620	-0.4238	10	0.51188	T	0.08	.	9.7482	0.40459	0.1423:0.0:0.8577:0.0	.	159;159	Q8N4N3-2;Q8N4N3	.;KLH36_HUMAN	I	159	ENSP00000258157:S159I	ENSP00000258157:S159I	S	+	2	0	KLHL36	83248390	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.005000	0.57075	2.722000	0.93159	0.655000	0.94253	AGC			0.567	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269084.2			
TP53	7157	broad.mit.edu	37	17	7574024	7574024	+	Missense_Mutation	SNP	G	G	T	rs375444154		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr17:7574024G>T	ENST00000269305.4	-	10	1192	c.1003C>A	c.(1003-1005)Cgt>Agt	p.R335S	TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R335S|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	335	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> G (in a sporadic cancer; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R335fs*2(2)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAGCGCTCACGCCCACGGATC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R335S	Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000269305,colon,carcinoma,+2,3	TP53	33396	3	12	Whole gene deletion(8)|Insertion - Frameshift(2)|Unknown(1)|Deletion - Frameshift(1)	bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(2)|central_nervous_system(2)|stomach(1)	c.C1003A												51.0	40.0	44.0					17																	7574024		2203	4300	6503	SO:0001583	missense	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCTCACGCCCACG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1003C>A	17.37:g.7574024G>T	ENSP00000269305:p.Arg335Ser		Somatic	126	0.0079365079	1		WXS	Illumina HiSeq	Phase_I	102	0.03	3	NM_000546	0		0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141134	0.56936	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.97752	-4.52;-4.52	5.43	3.45	0.39498	p53, tetramerisation domain (3);	0.118365	0.53938	D	0.000050	D	0.98201	0.9405	M	0.85859	2.78	0.45129	D	0.998142	D	0.59357	0.985	P	0.59761	0.863	D	0.97925	1.0317	10	0.87932	D	0	-4.1804	10.0263	0.42074	0.1655:0.0:0.8345:0.0	.	335	P04637	P53_HUMAN	S	335;335;324	ENSP00000269305:R335S;ENSP00000391478:R335S	ENSP00000269305:R335S	R	-	1	0	TP53	7514749	0.988000	0.35896	0.692000	0.30179	0.276000	0.26787	4.236000	0.58675	0.675000	0.31264	0.561000	0.74099	CGT			0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367397.1		NM_000546	
WNK4	65266	mdanderson.org	37	17	40936077	40936077	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr17:40936077G>T	ENST00000246914.5	+	3	935	c.914G>T	c.(913-915)tGc>tTc	p.C305F		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	305	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GATCTCAAGTGCGACAATGTC	0.597																																					p.C305F	Esophageal Squamous(6;201 374 4964 23855 42828)												.	.			0			c.G914T												132.0	126.0	128.0					17																	40936077		2203	4300	6503	SO:0001583	missense	65266	exon3			TCAAGTGCGACAA	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.914G>T	17.37:g.40936077G>T	ENSP00000246914:p.Cys305Phe		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_032387	3	0.00	0	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	CCDS11439.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765444	0.90020	.	.	ENSG00000126562	ENST00000246914;ENST00000316085	T	0.24350	1.86	4.22	4.22	0.49857	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45867	D	0.000324	T	0.55081	0.1898	M	0.82323	2.585	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.64664	-0.6354	10	0.87932	D	0	-15.1362	16.7705	0.85536	0.0:0.0:1.0:0.0	.	305;305	B0LPI0;Q96J92	.;WNK4_HUMAN	F	305;77	ENSP00000246914:C305F	ENSP00000246914:C305F	C	+	2	0	WNK4	38189603	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.657000	0.98554	2.174000	0.68829	0.591000	0.81541	TGC			0.597	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452389.1			
LRRC37A4P	55073	broad.mit.edu	37	17	43587323	43587326	+	RNA	DEL	GTAA	GTAA	-	rs201216464		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	GTAA	GTAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr17:43587323_43587326delGTAA	ENST00000579913.1	-	0	1444				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		AAGCATTAGGGtaagtaagtattt	0.475																																					.													.	.			0			.																																											0	.			ATTAGGGTAAGTA	AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43587327_43587330delGTAA			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	1	0.00	0		RNA	DEL	ENST00000579913.1	37																																																																																						0.475	LRRC37A4P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000445300.1		NR_002940	
RGS9	8787	mdanderson.org	37	17	63186321	63186321	+	Missense_Mutation	SNP	G	G	T	rs565154999		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr17:63186321G>T	ENST00000262406.9	+	11	780	c.713G>T	c.(712-714)aGg>aTg	p.R238M	RGS9_ENST00000443584.3_Missense_Mutation_p.R235M|RGS9_ENST00000449996.3_Missense_Mutation_p.R235M	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	238	G protein gamma.				dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						GCCTTGATGAGGTCCACAGTG	0.478																																					p.R238M													.	.			0			c.G713T												337.0	336.0	336.0					17																	63186321		1961	4155	6116	SO:0001583	missense	8787	exon11			TGATGAGGTCCAC	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.713G>T	17.37:g.63186321G>T	ENSP00000262406:p.Arg238Met		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_003835	0		0	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.985872	0.35036	.	.	ENSG00000108370	ENST00000262406;ENST00000449996;ENST00000443584	T;T	0.28895	1.59;1.59	5.72	4.76	0.60689	G-protein gamma domain (4);	0.090834	0.85682	D	0.000000	T	0.57710	0.2072	M	0.88450	2.955	0.44890	D	0.997905	D;D;P	0.76494	0.996;0.999;0.7	P;D;B	0.66084	0.722;0.941;0.251	T	0.65207	-0.6224	10	0.87932	D	0	.	10.7336	0.46111	0.1534:0.0:0.8466:0.0	.	238;238;235	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	M	238;235;238	ENSP00000262406:R238M;ENSP00000396329:R235M	ENSP00000262406:R238M	R	+	2	0	RGS9	60616783	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.979000	0.56888	1.431000	0.47355	0.650000	0.86243	AGG			0.478	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000445885.1		NM_003835	
BPTF	2186	ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65890179	65890179	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr17:65890179G>T	ENST00000321892.4	+	9	2880	c.2819G>T	c.(2818-2820)tGt>tTt	p.C940F	BPTF_ENST00000424123.3_Missense_Mutation_p.C801F|BPTF_ENST00000306378.6_Missense_Mutation_p.C814F|BPTF_ENST00000335221.5_Missense_Mutation_p.C940F			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	940					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.C940F(1)|p.C814F(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTTCAGATGTGTAGCAAACCC	0.378																																					p.C940F													BPTF_ENST00000335221,NS,carcinoma,0,2	BPTF	415	2	2	Substitution - Missense(2)	prostate(2)	c.G2819T												143.0	135.0	138.0					17																	65890179		2203	4300	6503	SO:0001583	missense	2186	exon9			AGATGTGTAGCAA	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.2819G>T	17.37:g.65890179G>T	ENSP00000315454:p.Cys940Phe		Somatic	65	0	0		WXS	Illumina HiSeq		52	0.10	5	NM_004459	2	0.00	0	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	G	19.09	3.760463	0.69763	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	T;T;T	0.72725	-0.63;-0.68;-0.65	5.42	5.42	0.78866	.	.	.	.	.	D	0.85699	0.5757	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.994;0.999;0.996	D	0.86970	0.2097	9	0.87932	D	0	-7.8387	19.5998	0.95557	0.0:0.0:1.0:0.0	.	940;814;940	Q12830;Q12830-2;Q12830-4	BPTF_HUMAN;.;.	F	814;940;940;738	ENSP00000307208:C814F;ENSP00000334351:C940F;ENSP00000315454:C940F	ENSP00000307208:C814F	C	+	2	0	BPTF	63320641	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.725000	0.98778	2.717000	0.92951	0.655000	0.94253	TGT			0.378	BPTF-201	KNOWN	basic	protein_coding	protein_coding				NM_182641, NM_004459	
FSCN2	25794	mdanderson.org	37	17	79496002	79496002	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr17:79496002C>T	ENST00000417245.2	+	1	581	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	RP13-766D20.2_ENST00000442532.1_RNA|RP13-766D20.2_ENST00000430912.1_RNA|FSCN2_ENST00000334850.7_Missense_Mutation_p.R149W	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	149					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CGTGAGCCGGCGGCGCTACGT	0.711																																					p.R149W													.	.			0			c.C445T												8.0	11.0	10.0					17																	79496002		2111	4183	6294	SO:0001583	missense	25794	exon1			AGCCGGCGGCGCT	AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.445C>T	17.37:g.79496002C>T	ENSP00000388716:p.Arg149Trp		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_012418	0		0	A0AVC4|A8MRA6	Missense_Mutation	SNP	ENST00000417245.2	37	CCDS45811.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939826	0.73557	.	.	ENSG00000186765	ENST00000417245;ENST00000334850	T;T	0.33216	1.43;1.42	4.77	2.63	0.31362	Fascin domain (1);Actin cross-linking (1);	0.059606	0.64402	D	0.000005	T	0.48607	0.1509	L	0.59436	1.845	0.46241	D	0.998942	D;D	0.89917	1.0;1.0	D;D	0.76575	0.975;0.988	T	0.51148	-0.8742	10	0.87932	D	0	-19.6468	12.0111	0.53289	0.548:0.452:0.0:0.0	.	149;149	O14926;A8MRA6	FSCN2_HUMAN;.	W	149	ENSP00000388716:R149W;ENSP00000334665:R149W	ENSP00000334665:R149W	R	+	1	2	FSCN2	77110597	0.812000	0.29077	1.000000	0.80357	0.979000	0.70002	1.027000	0.30115	0.956000	0.37904	0.404000	0.27445	CGG			0.711	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394746.1		NM_012418	
MKNK2	2872	mdanderson.org	37	19	2039711	2039711	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr19:2039711G>T	ENST00000591601.1	-	13	1334	c.1299C>A	c.(1297-1299)tgC>tgA	p.C433*	MKNK2_ENST00000309340.7_Intron|MKNK2_ENST00000250896.3_Nonsense_Mutation_p.C433*|MKNK2_ENST00000591142.1_Intron|MKNK2_ENST00000541165.1_Nonsense_Mutation_p.C302*			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	433					cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGCTGCAGGCAGCGTGAGG	0.701																																					p.C433X													.	.			0			c.C1299A												36.0	34.0	35.0					19																	2039711		2203	4299	6502	SO:0001587	stop_gained	2872	exon14			CTGCAGGCAGCGT	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.1299C>A	19.37:g.2039711G>T	ENSP00000467811:p.Cys433*		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_199054	9	0.00	0	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Nonsense_Mutation	SNP	ENST00000591601.1	37	CCDS12080.1	.	.	.	.	.	.	.	.	.	.	G	38	7.122303	0.98077	.	.	ENSG00000099875	ENST00000250896;ENST00000541165;ENST00000545627	.	.	.	3.77	2.72	0.32119	.	0.165068	0.56097	D	0.000037	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-7.7666	10.7835	0.46393	0.0951:0.0:0.9049:0.0	.	.	.	.	X	433;302;373	.	ENSP00000250896:C433X	C	-	3	2	MKNK2	1990711	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.687000	0.46976	0.921000	0.36994	0.561000	0.74099	TGC			0.701	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000449312.1		NM_199054	
NFIC	4782	broad.mit.edu	37	19	3453852	3453852	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr19:3453852T>C	ENST00000443272.2	+	9	1412	c.1361T>C	c.(1360-1362)cTc>cCc	p.L454P	NFIC_ENST00000589123.1_Missense_Mutation_p.L445P|NFIC_ENST00000341919.3_Intron|NFIC_ENST00000346156.5_Intron|NFIC_ENST00000395111.3_Intron|NFIC_ENST00000590282.1_Intron|NFIC_ENST00000586919.1_Intron	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	454					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CGGCTGGCGCTCCCCCCTGCC	0.672																																					p.L454P													.	NFIC	36		0			c.T1361C																																									SO:0001583	missense	4782	exon9			TGGCGCTCCCCCC	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.1361T>C	19.37:g.3453852T>C	ENSP00000396843:p.Leu454Pro		Somatic	83	0.1084337349	9		WXS	Illumina HiSeq	Phase_I	116	0.19	22	NM_001245002	0		0	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	ENST00000443272.2	37	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.954504	0.53293	.	.	ENSG00000141905	ENST00000443272;ENST00000343825	.	.	.	3.11	2.08	0.27032	.	0.365106	0.25238	N	0.032106	T	0.45094	0.1325	L	0.27053	0.805	0.80722	D	1	P;P	0.47484	0.896;0.873	P;P	0.51101	0.659;0.528	T	0.28870	-1.0030	9	0.51188	T	0.08	.	6.9531	0.24556	0.0:0.119:0.0:0.881	.	454;445	P08651;P08651-2	NFIC_HUMAN;.	P	445;454	.	ENSP00000342859:L454P	L	+	2	0	NFIC	3404852	1.000000	0.71417	0.997000	0.53966	0.907000	0.53573	4.811000	0.62606	0.157000	0.19338	-0.464000	0.05259	CTC			0.672	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452834.1		NM_005597	
HSH2D	84941	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	16263920	16263920	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr19:16263920G>A	ENST00000253680.6	+	6	814	c.283G>A	c.(283-285)Gag>Aag	p.E95K	HSH2D_ENST00000397372.4_Intron|HSH2D_ENST00000588246.1_Missense_Mutation_p.E95K|HSH2D_ENST00000593154.2_Missense_Mutation_p.E95K			Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	95	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of mitochondrial depolarization (GO:0051902)|positive regulation of signal transduction (GO:0009967)|T cell activation (GO:0042110)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(2)	4						GATCCCCGGGGAGAAGGTGGC	0.617																																					p.E95K													.	.			0			c.G283A												32.0	38.0	36.0					19																	16263920		2054	4181	6235	SO:0001583	missense	84941	exon6			CCCGGGGAGAAGG	AK027792	CCDS74304.1	19p13.12	2013-02-14				ENSG00000196684		"""SH2 domain containing"""	24920	protein-coding gene	gene with protein product		608349				11700021	Standard	NM_032855		Approved	ALX, HSH2, FLJ14886	uc002ndp.4	Q96JZ2		ENST00000253680.6:c.283G>A	19.37:g.16263920G>A	ENSP00000253680:p.Glu95Lys		Somatic	47	0	0		WXS	Illumina HiSeq	.	74	0.20	15	NM_032855	6	0.00	0	B5ME72|Q6ZNG7	Missense_Mutation	SNP	ENST00000253680.6	37		.	.	.	.	.	.	.	.	.	.	G	19.10	3.761686	0.69763	.	.	ENSG00000196684	ENST00000253680	D	0.88509	-2.39	4.63	0.648	0.17801	SH2 motif (4);	0.605357	0.13475	N	0.385150	D	0.90762	0.7100	L	0.52206	1.635	0.09310	N	1	P;P	0.48294	0.872;0.908	P;P	0.58620	0.578;0.842	D	0.83824	0.0248	10	0.72032	D	0.01	.	13.0228	0.58799	0.0:0.6009:0.3991:0.0	.	38;95	Q96JZ2-2;Q96JZ2	.;HSH2D_HUMAN	K	95	ENSP00000253680:E95K	ENSP00000253680:E95K	E	+	1	0	HSH2D	16124920	0.862000	0.29867	0.010000	0.14722	0.095000	0.18619	1.056000	0.30480	0.048000	0.15891	0.591000	0.81541	GAG			0.617	HSH2D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_032855	
DHDH	27294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49442835	49442835	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr19:49442835G>C	ENST00000221403.2	+	4	536	c.496G>C	c.(496-498)Gac>Cac	p.D166H	DHDH_ENST00000523250.1_Intron|DHDH_ENST00000522614.1_Missense_Mutation_p.D166H	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	166					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		CCGGGCCGTAGACCGGGCCCA	0.602																																					p.D166H													.	.			0			c.G496C												46.0	50.0	49.0					19																	49442835		2203	4300	6503	SO:0001583	missense	27294	exon4			GCCGTAGACCGGG	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.496G>C	19.37:g.49442835G>C	ENSP00000221403:p.Asp166His		Somatic	79	0	0		WXS	Illumina HiSeq	.	87	0.15	13	NM_014475	0		0		Missense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	G	8.423	0.846741	0.16963	.	.	ENSG00000104808	ENST00000221403;ENST00000522614	T;T	0.26223	1.75;1.75	5.12	5.12	0.69794	.	0.321128	0.36338	N	0.002650	T	0.26666	0.0652	M	0.76574	2.34	0.37230	D	0.905635	P	0.36753	0.568	B	0.27380	0.079	T	0.29761	-1.0001	10	0.56958	D	0.05	-44.8647	12.0369	0.53431	0.0:0.1736:0.8264:0.0	.	166	Q9UQ10	DHDH_HUMAN	H	166	ENSP00000221403:D166H;ENSP00000428672:D166H	ENSP00000221403:D166H	D	+	1	0	DHDH	54134647	0.801000	0.28930	0.975000	0.42487	0.051000	0.14879	0.816000	0.27267	2.838000	0.97847	0.561000	0.74099	GAC			0.602	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381477.1		NM_014475	
TTYH1	57348	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	54942000	54942000	+	Silent	SNP	C	C	T	rs199946983		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr19:54942000C>T	ENST00000376530.3	+	9	1052	c.949C>T	c.(949-951)Ctg>Ttg	p.L317L	TTYH1_ENST00000301194.4_Silent_p.L317L|TTYH1_ENST00000376531.3_Silent_p.L317L|TTYH1_ENST00000489425.1_3'UTR|TTYH1_ENST00000391739.3_Missense_Mutation_p.S347F|AC008746.3_ENST00000457113.1_RNA	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	317					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		GAGGCTGACTCTGTCCCAGCG	0.657													C|||	1	0.000199681	0.0008	0.0	5008	,	,		9261	0.0		0.0	False		,,,				2504	0.0				p.L317L													.	TTYH1	78		0			c.C949T												38.0	37.0	37.0					19																	54942000		2203	4300	6503	SO:0001819	synonymous_variant	57348	exon9			CTGACTCTGTCCC	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.949C>T	19.37:g.54942000C>T			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	64	0.08	5	NM_020659	29	0.10	3	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Missense_Mutation	SNP	ENST00000376530.3	37	CCDS12893.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	16.72	3.201203	0.58234	.	.	ENSG00000167614	ENST00000391739	T	0.20881	2.04	4.34	0.812	0.18744	.	.	.	.	.	T	0.08714	0.0216	.	.	.	0.21105	N	0.999784	B	0.23128	0.08	B	0.21917	0.037	T	0.40001	-0.9586	8	0.10111	T	0.7	-1.39	3.8973	0.09144	0.1514:0.461:0.2959:0.0917	.	347	B7Z1H9	.	F	347	ENSP00000375619:S347F	ENSP00000375619:S347F	S	+	2	0	TTYH1	59633812	0.018000	0.18449	0.999000	0.59377	0.946000	0.59487	0.056000	0.14256	0.376000	0.24707	0.491000	0.48974	TCT			0.657	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000140498.1			
VWA3B	200403	mdanderson.org	37	2	98810929	98810929	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr2:98810929G>T	ENST00000477737.1	+	12	1915	c.1711G>T	c.(1711-1713)Gct>Tct	p.A571S	VWA3B_ENST00000435344.1_Missense_Mutation_p.A571S|VWA3B_ENST00000451075.2_Missense_Mutation_p.A421S	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	571	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.									NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTTGGAACAGGCTCAGTCCTG	0.423																																					p.A571S													.	.			0			c.G1711T												178.0	177.0	177.0					2																	98810929		1887	4121	6008	SO:0001583	missense	200403	exon12			GAACAGGCTCAGT	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1711G>T	2.37:g.98810929G>T	ENSP00000417955:p.Ala571Ser		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_144992	0		0	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362493	0.82353	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.10668	2.85;2.85;2.85	5.13	5.13	0.70059	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000002	T	0.38348	0.1037	M	0.82193	2.58	0.33585	D	0.600388	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.994;0.998	T	0.55289	-0.8164	10	0.87932	D	0	.	17.7275	0.88369	0.0:0.0:1.0:0.0	.	421;571;571;571	B7Z7Q7;Q502W6;Q502W6-8;Q502W6-6	.;VWA3B_HUMAN;.;.	S	571;571;421	ENSP00000401959:A571S;ENSP00000417955:A571S;ENSP00000389463:A421S	ENSP00000388158:A571S	A	+	1	0	VWA3B	98177361	1.000000	0.71417	0.535000	0.28026	0.896000	0.52359	6.673000	0.74482	2.563000	0.86464	0.555000	0.69702	GCT			0.423	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353469.2		NM_144992	
IL18RAP	8807	broad.mit.edu	37	2	103067331	103067331	+	Missense_Mutation	SNP	G	G	A	rs552650320		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr2:103067331G>A	ENST00000264260.2	+	11	1823	c.1234G>A	c.(1234-1236)Gta>Ata	p.V412I	IL18RAP_ENST00000409369.1_Missense_Mutation_p.V270I	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	412	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						TGATGCTTTCGTATCCTATGC	0.338																																					p.V412I													.	IL18RAP	102		0			c.G1234A												93.0	102.0	99.0					2																	103067331		2203	4300	6503	SO:0001583	missense	8807	exon11			GCTTTCGTATCCT	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1234G>A	2.37:g.103067331G>A	ENSP00000264260:p.Val412Ile		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	72	0.04	3	NM_003853	4	0.00	0	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	9.096	1.002940	0.19121	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.01933	4.55;4.55	5.72	0.711	0.18162	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.704843	0.13115	N	0.412675	T	0.01976	0.0062	L	0.29908	0.895	0.31196	N	0.700381	P	0.38504	0.634	B	0.35312	0.2	T	0.45877	-0.9231	10	0.26408	T	0.33	.	9.9942	0.41889	0.3409:0.0:0.6591:0.0	.	412	O95256	I18RA_HUMAN	I	412;270	ENSP00000264260:V412I;ENSP00000387201:V270I	ENSP00000264260:V412I	V	+	1	0	IL18RAP	102433763	0.715000	0.27946	0.077000	0.20336	0.196000	0.23810	0.836000	0.27545	-0.156000	0.11079	-0.345000	0.07892	GTA			0.338	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253291.2		NM_003853	
ANKRD30BL	554226	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	132919171	132919171	+	Silent	SNP	A	A	G	rs199695856		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr2:132919171A>G	ENST00000409867.1	-	1	357	c.108T>C	c.(106-108)caT>caC	p.H36H	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	36										endometrium(1)|kidney(3)	4						TGAGATCCCCATGGTGAATCA	0.582																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			ATCCCCATGGTGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.108T>C	2.37:g.132919171A>G			Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	138	0.09	12	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
ANKRD30BL	554226	broad.mit.edu;mdanderson.org	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			AGAGTCGTTGTTG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A			Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	136	0.06	8	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
SPAG16	79582	mdanderson.org	37	2	214149325	214149325	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr2:214149325G>A	ENST00000331683.5	+	1	213	c.118G>A	c.(118-120)Ggc>Agc	p.G40S	SPAG16_ENST00000413312.1_5'UTR|SPAG16_ENST00000272898.7_Missense_Mutation_p.G40S|SPAG16_ENST00000447990.1_Missense_Mutation_p.G40S|AC079610.2_ENST00000360083.3_lincRNA|SPAG16_ENST00000432529.2_Missense_Mutation_p.G40S	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	40					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GGCGGCTGAGGGCGCCTACTA	0.711																																					p.G40S													.	.			0			c.G118A												16.0	18.0	17.0					2																	214149325		2198	4294	6492	SO:0001583	missense	79582	exon1			GCTGAGGGCGCCT	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.118G>A	2.37:g.214149325G>A	ENSP00000332592:p.Gly40Ser		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_024532	1	0.00	0	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820908	0.71028	.	.	ENSG00000144451	ENST00000331683;ENST00000432529;ENST00000272898;ENST00000447990	T	0.60548	0.18	4.34	3.41	0.39046	.	0.320217	0.24623	N	0.036950	T	0.53610	0.1807	L	0.50333	1.59	0.80722	D	1	B;P;B	0.46142	0.192;0.873;0.291	B;P;B	0.47299	0.033;0.543;0.125	T	0.52230	-0.8603	10	0.46703	T	0.11	.	7.0547	0.25093	0.1347:0.0:0.8653:0.0	.	40;40;40	Q8N0X2;E7EWV3;Q8N0X2-4	SPG16_HUMAN;.;.	S	40	ENSP00000332592:G40S	ENSP00000272898:G40S	G	+	1	0	SPAG16	213857570	1.000000	0.71417	0.997000	0.53966	0.950000	0.60333	2.524000	0.45589	1.102000	0.41551	0.591000	0.81541	GGC			0.711	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256601.2		NM_024532	
GPC1	2817	mdanderson.org	37	2	241404986	241404986	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr2:241404986G>T	ENST00000264039.2	+	8	1613	c.1365G>T	c.(1363-1365)caG>caT	p.Q455H	GPC1_ENST00000466624.1_3'UTR	NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1	455					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		CCATCCGGCAGCAGATCATGC	0.637																																					p.Q455H													.	.			0			c.G1365T												97.0	82.0	87.0					2																	241404986		2201	4300	6501	SO:0001583	missense	2817	exon8			CCGGCAGCAGATC	AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.1365G>T	2.37:g.241404986G>T	ENSP00000264039:p.Gln455His		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	73	0.05	4	NM_002081	41	0.00	0	B3KTD1|Q53QM4	Missense_Mutation	SNP	ENST00000264039.2	37	CCDS2534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.35|16.35	3.097247|3.097247	0.56075|0.56075	.|.	.|.	ENSG00000063660|ENSG00000063660	ENST00000420138;ENST00000455111|ENST00000264039	.|T	.|0.56103	.|0.48	3.56|3.56	2.32|2.32	0.28847|0.28847	.|.	.|0.125321	.|0.53938	.|U	.|0.000043	T|T	0.70736|0.70736	0.3258|0.3258	M|M	0.88181|0.88181	2.935|2.935	0.50632|0.50632	D|D	0.999881|0.999881	.|D	.|0.76494	.|0.999	.|D	.|0.74674	.|0.984	T|T	0.73360|0.73360	-0.4007|-0.4007	5|10	.|0.87932	.|D	.|0	-31.1114|-31.1114	6.727|6.727	0.23363|0.23363	0.2068:0.0:0.7932:0.0|0.2068:0.0:0.7932:0.0	.|.	.|455	.|P35052	.|GPC1_HUMAN	S|H	495;207|455	.|ENSP00000264039:Q455H	.|ENSP00000264039:Q455H	A|Q	+|+	1|3	0|2	GPC1|GPC1	241053659|241053659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.619000|1.619000	0.36965|0.36965	1.704000|1.704000	0.51252|0.51252	0.551000|0.551000	0.68910|0.68910	GCA|CAG			0.637	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257179.3		NM_002081	
SIRPG	55423	mdanderson.org	37	20	1610930	1610930	+	Silent	SNP	C	C	T	rs114055242	byFrequency	TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr20:1610930C>T	ENST00000303415.3	-	5	1168	c.1104G>A	c.(1102-1104)gcG>gcA	p.A368A	SIRPG_ENST00000381583.2_Silent_p.A257A|SIRPG_ENST00000216927.4_Silent_p.A257A|SIRPG_ENST00000381580.1_Silent_p.A335A|SIRPG_ENST00000478145.2_5'UTR|SIRPG_ENST00000344103.4_Silent_p.A151A	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	368					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						TGAGGAGCAGCGCAGTAAGGG	0.577													c|||	4	0.000798722	0.0008	0.0	5008	,	,		18765	0.0		0.0	False		,,,				2504	0.0031				p.A368A													.	.			0			c.G1104A												60.0	57.0	58.0					20																	1610930		2201	4297	6498	SO:0001819	synonymous_variant	55423	exon5			GAGCAGCGCAGTA	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.1104G>A	20.37:g.1610930C>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_018556	58	0.00	0	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000303415.3	37	CCDS13020.2																																																																																			0.001		0.577	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077566.2		NM_018556	
RBBP8NL	140893	mdanderson.org	37	20	60989122	60989122	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr20:60989122C>A	ENST00000252998.1	-	10	1441	c.1285G>T	c.(1285-1287)Gag>Tag	p.E429*		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	429						extracellular space (GO:0005615)											GCTGCAGCCTCTGTCCTCTGG	0.731																																					p.E429X													.	.			0			c.G1285T												7.0	9.0	8.0					20																	60989122		2151	4217	6368	SO:0001587	stop_gained	140893	exon10			CAGCCTCTGTCCT	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.1285G>T	20.37:g.60989122C>A	ENSP00000252998:p.Glu429*		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_080833	0		0	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Nonsense_Mutation	SNP	ENST00000252998.1	37	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	C	31	5.097134	0.94197	.	.	ENSG00000130701	ENST00000252998	.	.	.	4.36	2.24	0.28232	.	0.428919	0.22145	N	0.064000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-2.8549	5.0554	0.14529	0.0:0.6278:0.175:0.1972	.	.	.	.	X	429	.	ENSP00000252998:E429X	E	-	1	0	C20orf151	60422517	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.173000	0.16724	0.841000	0.35020	0.491000	0.48974	GAG			0.731	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080029.1		NM_080833	
BAGE2	85319	broad.mit.edu	37	21	11058613	11058614	+	RNA	INS	-	-	A	rs60445243|rs377480117	byFrequency	TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr21:11058613_11058614insA	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GATTTTTTTTTAAAGCAAATAG	0.248																																					.													.	.			0			.																																											85319	.			TTTTTTTAAAGCA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058616_11058616dupA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	0		0	A8K925|Q08ER0	RNA	INS	ENST00000470054.1	37																																																																																						0.248	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
MED15	51586	bcgsc.ca	37	22	20918767	20918767	+	Missense_Mutation	SNP	A	A	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr22:20918767A>T	ENST00000263205.7	+	6	551	c.482A>T	c.(481-483)cAg>cTg	p.Q161L	MED15_ENST00000542773.1_5'UTR|MED15_ENST00000292733.7_Missense_Mutation_p.Q161L|MED15_ENST00000425759.2_Missense_Mutation_p.Q50L|MED15_ENST00000541476.1_Missense_Mutation_p.Q135L|MED15_ENST00000382974.2_Missense_Mutation_p.Q90L|MED15_ENST00000406969.1_Missense_Mutation_p.Q135L	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	161	Poly-Gln.			Q -> R (in Ref. 3; BAB85034). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			GTGGCGCTgcagcagcagcag	0.627											OREG0026319	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q161L													.	MED15	68		0			c.A482T												25.0	26.0	26.0					22																	20918767		2184	4250	6434	SO:0001583	missense	51586	exon6			CGCTGCAGCAGCA	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.482A>T	22.37:g.20918767A>T	ENSP00000263205:p.Gln161Leu		Somatic	114	0	0	744	WXS	Illumina HiSeq	Phase_1	140	0.04	5	NM_015889	49	0.00	0	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	ENST00000263205.7	37	CCDS33602.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.102792	0.37145	.	.	ENSG00000099917	ENST00000414658;ENST00000432052;ENST00000425759;ENST00000292733;ENST00000263205;ENST00000406969;ENST00000382974;ENST00000541476;ENST00000542312;ENST00000457322;ENST00000428629;ENST00000424287	T;T;T;T;T;T;T;T	0.79940	0.97;-1.32;-0.85;-1.32;0.97;-1.32;1.28;1.24	4.43	4.43	0.53597	Mediator complex, subunit Med15, metazoa (1);	0.367176	0.28273	N	0.015944	D	0.83599	0.5289	L	0.52126	1.63	0.80722	D	1	P;P;P;P;P	0.49559	0.925;0.908;0.908;0.925;0.908	D;P;P;D;P	0.65140	0.932;0.888;0.888;0.932;0.888	T	0.79990	-0.1570	10	0.22706	T	0.39	.	10.2729	0.43493	1.0:0.0:0.0:0.0	.	180;135;161;161;90	Q6PKB8;G3V1P5;Q96RN5-2;Q96RN5;Q96RN5-3	.;.;.;MED15_HUMAN;.	L	135;64;50;161;161;135;90;135;135;122;43;114	ENSP00000416425:Q50L;ENSP00000292733:Q161L;ENSP00000263205:Q161L;ENSP00000384344:Q135L;ENSP00000372434:Q90L;ENSP00000443137:Q135L;ENSP00000415778:Q122L;ENSP00000396461:Q114L	ENSP00000263205:Q161L	Q	+	2	0	MED15	19248767	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	1.520000	0.35899	1.997000	0.58415	0.533000	0.62120	CAG			0.627	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000320177.2		NM_015889	
ADORA2A	135	mdanderson.org	37	22	24829692	24829692	+	Missense_Mutation	SNP	G	G	A	rs202185195		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr22:24829692G>A	ENST00000337539.7	+	2	779	c.320G>A	c.(319-321)cGc>cAc	p.R107H	ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A-AS1_ENST00000543438.1_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|ADORA2A_ENST00000496497.1_Intron	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	107					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	ATTGCCATCCGCATCCCGCTC	0.622																																					p.R107H													.	.			0			c.G320A												64.0	55.0	58.0					22																	24829692		2203	4300	6503	SO:0001583	missense	135	exon2			CCATCCGCATCCC	X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.320G>A	22.37:g.24829692G>A	ENSP00000336630:p.Arg107His		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_000675	2	0.00	0	B2R7E0	Missense_Mutation	SNP	ENST00000337539.7	37	CCDS13826.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721051	0.48728	.	.	ENSG00000128271	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596	T;T	0.19806	2.12;2.12	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.055200	0.64402	D	0.000001	T	0.17195	0.0413	L	0.31664	0.95	0.46927	D	0.999254	B	0.26041	0.14	B	0.14023	0.01	T	0.03969	-1.0988	10	0.49607	T	0.09	-31.8573	16.4299	0.83839	0.0:0.0:1.0:0.0	.	107	P29274	AA2AR_HUMAN	H	107	ENSP00000414802:R107H;ENSP00000336630:R107H	ENSP00000336630:R107H	R	+	2	0	ADORA2A	23159692	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	4.492000	0.60334	2.350000	0.79820	0.561000	0.74099	CGC			0.622	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319971.2		NM_000675	
RHBDD3	25807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29654850	29654850	+	IGR	SNP	C	C	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr22:29654850C>A	ENST00000216085.7	-	0	1794				EMID1_ENST00000404820.3_Missense_Mutation_p.P419T|CTA-984G1.5_ENST00000433125.1_RNA|EMID1_ENST00000404755.3_Missense_Mutation_p.P396T|EMID1_ENST00000334018.6_Missense_Mutation_p.P417T	NM_012265.1	NP_036397.1	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3						liver development (GO:0001889)|MAPK cascade (GO:0000165)|negative regulation of natural killer cell activation (GO:0032815)|positive regulation of protein catabolic process (GO:0045732)|regulation of acute inflammatory response (GO:0002673)|regulation of protein secretion (GO:0050708)|response to xenobiotic stimulus (GO:0009410)	integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			lung(1)|ovary(1)	2						CACAGGCACCCCCAGCCTCCT	0.682																																					p.P417T													.	.			0			c.C1249A												31.0	41.0	37.0					22																	29654850		2202	4297	6499	SO:0001628	intergenic_variant	129080	exon15			GGCACCCCCAGCC	AL050346	CCDS13850.1	22q12.2	2006-02-22	2006-02-22	2006-02-22	ENSG00000100263	ENSG00000100263			1308	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 3"""	C22orf3		10591208, 15105437	Standard	NM_012265		Approved	PTAG	uc003aeq.1	Q9Y3P4	OTTHUMG00000151032		22.37:g.29654850C>A			Somatic	58	0	0		WXS	Illumina HiSeq	.	81	0.11	9	NM_133455	1	0.00	0	Q6I9X3|Q9UGQ7	Missense_Mutation	SNP	ENST00000216085.7	37	CCDS13850.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.792963	0.70452	.	.	ENSG00000186998	ENST00000334018;ENST00000404755;ENST00000404820	D;D;D	0.89746	-2.53;-2.35;-2.56	5.03	3.99	0.46301	.	0.132676	0.35013	N	0.003520	D	0.92149	0.7511	M	0.68952	2.095	0.51767	D	0.999935	D;D;D;D	0.69078	0.995;0.997;0.979;0.997	P;P;P;D	0.64410	0.889;0.814;0.525;0.925	D	0.91984	0.5597	10	0.62326	D	0.03	-4.4227	11.6968	0.51548	0.0:0.911:0.0:0.089	.	396;419;415;417	B0QYK4;B0QYK5;Q96A84;Q96A84-3	.;.;EMID1_HUMAN;.	T	417;396;419	ENSP00000335481:P417T;ENSP00000385414:P396T;ENSP00000384452:P419T	ENSP00000335481:P417T	P	+	1	0	EMID1	27984850	0.999000	0.42202	1.000000	0.80357	0.783000	0.44284	3.097000	0.50251	2.612000	0.88384	0.561000	0.74099	CCC			0.682	RHBDD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321085.1		NM_012265	
FAM227A	646851	broad.mit.edu	37	22	39019280	39019280	+	Silent	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr22:39019280G>T	ENST00000535113.1	-	10	1458	c.855C>A	c.(853-855)acC>acA	p.T285T	FAM227A_ENST00000540952.1_5'UTR|FAM227A_ENST00000355830.6_Silent_p.T280T|FAM227A_ENST00000406767.2_Silent_p.T280T	NM_001013647.1	NP_001013669.1	F5H4B4	F227A_HUMAN	family with sequence similarity 227, member A	285																	GGCTAGGATAGGTGCCTAAGG	0.517																																					p.T285T													.	.			0			c.C855A												117.0	97.0	103.0					22																	39019280		692	1591	2283	SO:0001819	synonymous_variant	646851	exon10			AGGATAGGTGCCT			22q13.1	2012-07-04			ENSG00000184949	ENSG00000184949			44197	protein-coding gene	gene with protein product							Standard	NM_001013647		Approved		uc011anw.1	F5H4B4	OTTHUMG00000151133	ENST00000535113.1:c.855C>A	22.37:g.39019280G>T			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	84	0.04	3	NM_001013647	0		0	B0QY52|B7Z7C6|Q5TG08	Silent	SNP	ENST00000535113.1	37																																																																																						0.517	FAM227A-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001013647	
CELSR1	9620	broad.mit.edu;mdanderson.org	37	22	46931534	46931534	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr22:46931534G>T	ENST00000262738.3	-	1	1533	c.1534C>A	c.(1534-1536)Ctg>Atg	p.L512M	CELSR1_ENST00000395964.1_Missense_Mutation_p.L512M|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	512	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		ATCCCGCTCAGCGAGTGCAGG	0.627																																					p.L512M													.	CELSR1	242		0			c.C1534A												80.0	84.0	82.0					22																	46931534		2203	4300	6503	SO:0001583	missense	9620	exon1			CGCTCAGCGAGTG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1534C>A	22.37:g.46931534G>T	ENSP00000262738:p.Leu512Met		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	52	0.08	4	NM_014246	1	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	9.796	1.179294	0.21787	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.01787	4.64;4.64	4.89	3.86	0.44501	Cadherin (4);Cadherin-like (1);	0.199266	0.33401	U	0.004958	T	0.03783	0.0107	L	0.35854	1.095	0.21762	N	0.999556	D	0.58620	0.983	P	0.62649	0.905	T	0.44283	-0.9338	10	0.25751	T	0.34	.	6.6674	0.23050	0.3172:0.0:0.6828:0.0	.	512	Q9NYQ6	CELR1_HUMAN	M	512	ENSP00000262738:L512M;ENSP00000379293:L512M	ENSP00000262738:L512M	L	-	1	2	CELSR1	45310198	0.992000	0.36948	0.550000	0.28217	0.750000	0.42670	2.542000	0.45744	1.065000	0.40693	0.456000	0.33151	CTG			0.627	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
CLASP2	23122	mdanderson.org	37	3	33543150	33543150	+	Silent	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr3:33543150G>T	ENST00000468888.2	-	38	4498	c.4452C>A	c.(4450-4452)ggC>ggA	p.G1484G	CLASP2_ENST00000307312.7_Silent_p.G965G|CLASP2_ENST00000359576.5_Silent_p.G1475G|CLASP2_ENST00000539981.1_3'UTR|CLASP2_ENST00000461133.3_Silent_p.G1243G|CLASP2_ENST00000480013.1_Silent_p.G1263G|CLASP2_ENST00000399362.4_Silent_p.G1483G			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1264					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TTACTTTACTGCCAGTAAGTT	0.408																																					p.G1485G													.	.			0			c.C4455A												109.0	106.0	107.0					3																	33543150		1956	4155	6111	SO:0001819	synonymous_variant	23122	exon38			TTTACTGCCAGTA	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.4452C>A	3.37:g.33543150G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_015097	16	0.00	0	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	G	9.553	1.116491	0.20795	.	.	ENSG00000163539	ENST00000487553	.	.	.	5.7	3.85	0.44370	.	.	.	.	.	T	0.60340	0.2261	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57906	-0.7730	4	.	.	.	-15.6438	10.1851	0.42993	0.0841:0.1734:0.7425:0.0	.	.	.	.	K	190	.	.	Q	-	1	0	CLASP2	33518154	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.435000	0.59941	1.381000	0.46364	0.655000	0.94253	CAG			0.408	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000344320.4		NM_001207044	
KIF9	64147	hgsc.bcm.edu	37	3	47276935	47276935	+	Intron	SNP	G	G	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr3:47276935G>C	ENST00000265529.3	-	21	3003				KIF9_ENST00000452770.2_Intron|KIF9_ENST00000444589.2_Intron|KIF9-AS1_ENST00000429315.3_RNA|KIF9_ENST00000335044.2_Intron			Q9HAQ2	KIF9_HUMAN	kinesin family member 9						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CTAAAGTAGGGAATATGATCC	0.502																																					.	Colon(44;962 1147 15977 24541)												.	.			0			.																																									SO:0001627	intron_variant	285352	.			AGTAGGGAATATG	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.2322+67C>G	3.37:g.47276935G>C			Somatic	61	0	0		WXS	Illumina HiSeq	.	42	0.17	7	.	0		0	Q86Z28|Q9H8A4	RNA	SNP	ENST00000265529.3	37	CCDS2752.1																																																																																					0.502	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257475.2			
USP19	10869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49146542	49146542	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr3:49146542C>T	ENST00000398888.2	-	26	4124	c.3806G>A	c.(3805-3807)gGg>gAg	p.G1269E	USP19_ENST00000434032.2_Missense_Mutation_p.G1370E|USP19_ENST00000398898.2_Intron|USP19_ENST00000398896.1_Intron|USP19_ENST00000417901.1_Intron|USP19_ENST00000398892.3_Missense_Mutation_p.G1309E|USP19_ENST00000453664.1_Intron	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	1269					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTCTTGGGGCCCCCAGGGACC	0.677																																					p.G1370E													.	.			0			c.G4109A												13.0	17.0	15.0					3																	49146542		1956	4127	6083	SO:0001583	missense	10869	exon27			TGGGGCCCCCAGG	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.3806G>A	3.37:g.49146542C>T	ENSP00000381863:p.Gly1269Glu		Somatic	187	0	0		WXS	Illumina HiSeq	.	142	0.15	22	NM_001199160	4	0.75	3	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502027	0.64298	.	.	ENSG00000172046	ENST00000398892;ENST00000398888;ENST00000434032	T;T;T	0.19105	2.17;2.28;2.28	5.1	5.1	0.69264	.	4.112250	0.00508	N	0.000178	T	0.17577	0.0422	N	0.19112	0.55	0.36281	D	0.855781	P;P;B	0.45126	0.851;0.524;0.131	B;B;B	0.37550	0.253;0.095;0.026	T	0.20042	-1.0287	10	0.33141	T	0.24	-20.3339	12.0821	0.53677	0.0:0.922:0.0:0.078	.	1370;1269;1309	E9PEG8;O94966;B5MEG5	.;UBP19_HUMAN;.	E	1309;1269;1370	ENSP00000381867:G1309E;ENSP00000381863:G1269E;ENSP00000401197:G1370E	ENSP00000381863:G1269E	G	-	2	0	USP19	49121546	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.643000	0.61390	2.663000	0.90544	0.655000	0.94253	GGG			0.677	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000257721.1		NM_006677	
ARHGEF3	50650	mdanderson.org	37	3	56789110	56789110	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr3:56789110C>T	ENST00000296315.3	-	3	442	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	ARHGEF3_ENST00000338458.4_Missense_Mutation_p.A124T|ARHGEF3_ENST00000498517.1_5'UTR|ARHGEF3_ENST00000496106.1_Missense_Mutation_p.A98T|ARHGEF3_ENST00000495373.1_Missense_Mutation_p.A92T|ARHGEF3_ENST00000497267.1_Missense_Mutation_p.A63T|ARHGEF3_ENST00000413728.2_Missense_Mutation_p.A98T	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	92					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CTCGAGGGGGCGGCATTTCTG	0.542																																					p.A124T													ARHGEF3_ENST00000338458,colon,carcinoma,0,3	ARHGEF3_ENST00000338458	0	3	0			c.G370A												118.0	119.0	119.0					3																	56789110		2203	4300	6503	SO:0001583	missense	50650	exon6			AGGGGGCGGCATT	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.274G>A	3.37:g.56789110C>T	ENSP00000296315:p.Ala92Thr		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	34	0.12	4	NM_001128615	0		0	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	37	CCDS2878.1	.	.	.	.	.	.	.	.	.	.	C	6.597	0.478463	0.12521	.	.	ENSG00000163947	ENST00000296315;ENST00000338458;ENST00000413728;ENST00000496106;ENST00000497267;ENST00000495373;ENST00000468727;ENST00000473779	T;T;T;T;T;T	0.24350	1.99;1.86;1.88;1.87;1.91;1.99	5.2	-3.41	0.04839	.	0.682036	0.14577	N	0.311119	T	0.11367	0.0277	L	0.28192	0.835	0.09310	N	0.999996	B;B;B;B;B;B	0.30584	0.219;0.065;0.006;0.286;0.001;0.005	B;B;B;B;B;B	0.28638	0.043;0.01;0.006;0.092;0.001;0.008	T	0.14980	-1.0453	10	0.45353	T	0.12	-6.7208	0.1356	0.00078	0.2553:0.2073:0.1962:0.3411	.	98;63;92;124;92;98	E9PG37;E7EU49;C9J586;Q9NR81-2;Q9NR81;Q9NR81-3	.;.;.;.;ARHG3_HUMAN;.	T	92;124;98;98;63;92;93;110	ENSP00000296315:A92T;ENSP00000341071:A124T;ENSP00000410922:A98T;ENSP00000420420:A98T;ENSP00000418826:A63T;ENSP00000417986:A92T	ENSP00000296315:A92T	A	-	1	0	ARHGEF3	56764150	0.000000	0.05858	0.118000	0.21660	0.992000	0.81027	-0.895000	0.04118	-1.012000	0.03387	0.563000	0.77884	GCC			0.542	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352431.2		NM_019555	
DENND6A	201627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57631406	57631406	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr3:57631406G>C	ENST00000311128.5	-	11	1089	c.1019C>G	c.(1018-1020)aCt>aGt	p.T340S	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	340					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										GGTACGGGTAGTATATTCTTT	0.328																																					p.T340S													.	.			0			c.C1019G												99.0	100.0	100.0					3																	57631406		2203	4299	6502	SO:0001583	missense	201627	exon11			CGGGTAGTATATT	AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1019C>G	3.37:g.57631406G>C	ENSP00000311401:p.Thr340Ser		Somatic	44	0	0		WXS	Illumina HiSeq	.	55	0.22	12	NM_152678	1	0.00	0	Q7Z5T4|Q8N235|Q8TEG8	Missense_Mutation	SNP	ENST00000311128.5	37	CCDS33773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.235469|4.235469	0.79800|0.79800	.|.	.|.	ENSG00000174839|ENSG00000174839	ENST00000311128|ENST00000477344	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.69851|.	0.3157|.	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.72075|.	0.976|.	T|.	0.63646|.	-0.6590|.	9|.	0.32370|0.02654	T|T	0.25|1	-18.788|-18.788	20.2348|20.2348	0.98355|0.98355	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	340|.	Q8IWF6|.	F116A_HUMAN|.	S|X	340|108	.|.	ENSP00000311401:T340S|ENSP00000419334:Y108X	T|Y	-|-	2|3	0|2	FAM116A|FAM116A	57606446|57606446	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.651000|8.651000	0.91078|0.91078	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	ACT|TAC			0.328	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351594.1		NM_152678	
LINC00698	285401	broad.mit.edu	37	3	63082863	63082863	+	lincRNA	DEL	A	A	-			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr3:63082863delA	ENST00000468072.1	+	0	125					NR_027104.1				long intergenic non-protein coding RNA 698																		CCCTAGCTCTACCTTGTTCAT	0.473																																					.													.	.			0			.																																											0	.			AGCTCTACCTTGT	BC039502, BC043407		3p14.2	2012-11-23			ENSG00000244342	ENSG00000244342		"""Long non-coding RNAs"""	27720	non-coding RNA	RNA, long non-coding							Standard	NR_027104		Approved		uc003dlo.3		OTTHUMG00000158701		3.37:g.63082863delA			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0		RNA	DEL	ENST00000468072.1	37																																																																																						0.473	LINC00698-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000351800.1		NR_027104	
GABRG2	2566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	161528257	161528257	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr5:161528257G>A	ENST00000361925.4	+	5	785	c.565G>A	c.(565-567)Gag>Aag	p.E189K	GABRG2_ENST00000393933.4_Missense_Mutation_p.E94K|GABRG2_ENST00000356592.3_Missense_Mutation_p.E189K|GABRG2_ENST00000414552.2_Missense_Mutation_p.E189K			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	189					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AATTGATGCTGAGTGCCAATT	0.328																																					p.E189K													.	.			0			c.G565A												106.0	100.0	102.0					5																	161528257		2203	4300	6503	SO:0001583	missense	2566	exon5			GATGCTGAGTGCC		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.565G>A	5.37:g.161528257G>A	ENSP00000354651:p.Glu189Lys		Somatic	74	0	0		WXS	Illumina HiSeq	.	52	0.15	8	NM_198904	0		0	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	G	33	5.285198	0.95517	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23	5.45	5.45	0.79879	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.87350	0.6155	M	0.62209	1.925	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.99	D;D;D	0.83275	0.996;0.98;0.947	D	0.87734	0.2581	10	0.72032	D	0.01	.	19.6409	0.95757	0.0:0.0:1.0:0.0	.	189;189;189	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	K	189;189;189;94;94	ENSP00000349000:E189K;ENSP00000410732:E189K;ENSP00000354651:E189K;ENSP00000377510:E94K;ENSP00000430182:E94K	ENSP00000349000:E189K	E	+	1	0	GABRG2	161460835	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.695000	0.98691	2.711000	0.92665	0.655000	0.94253	GAG			0.328	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252706.1			
FAM83B	222584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	54806767	54806767	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr6:54806767A>G	ENST00000306858.7	+	5	3114	c.2998A>G	c.(2998-3000)Atg>Gtg	p.M1000V	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	1000										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TCGAGGATTTATGCAAAAGTT	0.343																																					p.M1000V													.	.			0			c.A2998G												43.0	43.0	43.0					6																	54806767		2203	4300	6503	SO:0001583	missense	222584	exon5			GGATTTATGCAAA	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2998A>G	6.37:g.54806767A>G	ENSP00000304078:p.Met1000Val		Somatic	127	0	0		WXS	Illumina HiSeq	.	137	0.15	21	NM_001010872	0		0	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469284	0.43839	.	.	ENSG00000168143	ENST00000306858	T	0.32272	1.46	5.76	4.51	0.55191	.	0.059554	0.64402	N	0.000002	T	0.18257	0.0438	M	0.69823	2.125	0.45852	D	0.998711	B	0.12630	0.006	B	0.06405	0.002	T	0.06041	-1.0849	10	0.72032	D	0.01	-11.8386	9.8753	0.41200	0.9021:0.0:0.0979:0.0	.	1000	Q5T0W9	FA83B_HUMAN	V	1000	ENSP00000304078:M1000V	ENSP00000304078:M1000V	M	+	1	0	FAM83B	54914726	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.231000	0.51294	0.881000	0.35993	0.533000	0.62120	ATG			0.343	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040994.1		XM_294139	
BEND3	57673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	107389963	107389963	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr6:107389963C>T	ENST00000369042.1	-	4	2622	c.2432G>A	c.(2431-2433)cGc>cAc	p.R811H	BEND3_ENST00000429433.2_Missense_Mutation_p.R811H			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	811	BEN 4. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CCTGTTGGGGCGGCGGCACCT	0.577																																					p.R811H													.	.			0			c.G2432A												62.0	64.0	64.0					6																	107389963		2202	4300	6502	SO:0001583	missense	57673	exon5			TTGGGGCGGCGGC	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.2432G>A	6.37:g.107389963C>T	ENSP00000358038:p.Arg811His		Somatic	69	0	0		WXS	Illumina HiSeq	.	73	0.18	13	NM_001080450	74	0.28	21	A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	37	CCDS34507.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.009369	0.75046	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	T;T	0.49720	0.77;0.77	5.02	5.02	0.67125	BEN domain (2);	0.132654	0.47455	D	0.000239	T	0.60444	0.2269	L	0.56769	1.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.64689	-0.6348	10	0.72032	D	0.01	-9.3388	18.3222	0.90242	0.0:1.0:0.0:0.0	.	811	Q5T5X7	BEND3_HUMAN	H	811	ENSP00000358038:R811H;ENSP00000411268:R811H	ENSP00000358038:R811H	R	-	2	0	BEND3	107496656	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.440000	0.80464	2.334000	0.79466	0.455000	0.32223	CGC			0.577	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041686.1		NM_020913	
RP3-470B24.5	0	mdanderson.org	37	6	168376840	168376840	+	lincRNA	SNP	T	T	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr6:168376840T>C	ENST00000538528.1	-	0	779																											AGTGTGTGTGTGGGGAGCAGG	0.602																																					p.T165A													.	.			0			c.A493G												31.0	29.0	30.0					6																	168376840		692	1591	2283			0	exon1			TGTGTGTGGGGAG																													6.37:g.168376840T>C			Somatic	173	0.0115606936	2		WXS	Illumina HiSeq	Phase_I	165	0.08	13	NM_001129895	38	0.03	1		Missense_Mutation	SNP	ENST00000538528.1	37																																																																																						0.602	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA					
IQCE	23288	bcgsc.ca	37	7	2627479	2627479	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr7:2627479C>T	ENST00000402050.2	+	13	1196	c.1012C>T	c.(1012-1014)Cgg>Tgg	p.R338W	IQCE_ENST00000404984.1_Missense_Mutation_p.R287W|IQCE_ENST00000325979.7_Missense_Mutation_p.R273W|IQCE_ENST00000438376.2_Missense_Mutation_p.R322W	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	338						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		GAGCAAGCCCCGGCTGCTGAG	0.622																																					p.R338W													.	IQCE	66		0			c.C1012T												102.0	116.0	111.0					7																	2627479		2126	4237	6363	SO:0001583	missense	23288	exon13			AAGCCCCGGCTGC	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1012C>T	7.37:g.2627479C>T	ENSP00000385597:p.Arg338Trp		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_1	72	0.06	4	NM_152558	3	0.00	0	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	ENST00000402050.2	37	CCDS43542.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.429500	0.62844	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000427817	T;T;T;T	0.18502	2.24;2.24;2.24;2.21	4.72	1.35	0.21983	.	0.063502	0.64402	D	0.000011	T	0.38348	0.1037	M	0.71581	2.175	0.38710	D	0.953194	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.998;0.998;0.999;0.998;0.999	T	0.32481	-0.9905	10	0.87932	D	0	-35.4961	12.8932	0.58084	0.3029:0.6971:0.0:0.0	.	273;322;273;338;338;322	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	W	338;287;322;273;145	ENSP00000385597:R338W;ENSP00000385945:R287W;ENSP00000396178:R322W;ENSP00000313772:R273W	ENSP00000313772:R273W	R	+	1	2	IQCE	2594005	1.000000	0.71417	0.997000	0.53966	0.840000	0.47671	1.564000	0.36375	0.046000	0.15833	-0.457000	0.05445	CGG			0.622	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325063.2		NM_152558	
ADAM22	53616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	87780609	87780609	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr7:87780609G>C	ENST00000265727.7	+	20	1734	c.1655G>C	c.(1654-1656)aGa>aCa	p.R552T	ADAM22_ENST00000315984.7_Missense_Mutation_p.R552T|ADAM22_ENST00000398209.3_Missense_Mutation_p.R552T|ADAM22_ENST00000398201.4_Missense_Mutation_p.R552T|ADAM22_ENST00000398204.4_Missense_Mutation_p.R552T			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	552	Cys-rich.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			ACCAGAGATAGACAATGCAAA	0.403																																					p.R552T													.	.			0			c.G1655C												127.0	120.0	122.0					7																	87780609		1895	4104	5999	SO:0001583	missense	53616	exon20			GAGATAGACAATG	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1655G>C	7.37:g.87780609G>C	ENSP00000265727:p.Arg552Thr		Somatic	110	0	0		WXS	Illumina HiSeq	.	110	0.06	7	NM_021722	0		0	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	37	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496354	0.85069	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98	5.07	5.07	0.68467	ADAM, cysteine-rich (2);	0.000000	0.85682	D	0.000000	T	0.39279	0.1072	L	0.41632	1.29	0.80722	D	1	D;D;D;D	0.89917	0.972;0.965;0.972;1.0	P;P;P;D	0.91635	0.768;0.584;0.708;0.999	T	0.10520	-1.0626	10	0.52906	T	0.07	.	17.5559	0.87889	0.0:0.0:1.0:0.0	.	604;552;552;552	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2	.;.;ADA22_HUMAN;.	T	552;552;552;552;552;519	ENSP00000381262:R552T;ENSP00000381260:R552T;ENSP00000265727:R552T;ENSP00000315900:R552T;ENSP00000381267:R552T;ENSP00000381261:R519T	ENSP00000265727:R552T	R	+	2	0	ADAM22	87618545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.882000	0.75589	2.491000	0.84063	0.591000	0.81541	AGA			0.403	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000268370.2		NM_021723	
SLC18A1	6570	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	20005148	20005148	+	Silent	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr8:20005148G>A	ENST00000276373.5	-	14	1562	c.1296C>T	c.(1294-1296)atC>atT	p.I432I	SLC18A1_ENST00000437980.1_Silent_p.I432I|SLC18A1_ENST00000519026.1_Silent_p.I400I|SLC18A1_ENST00000381608.4_Silent_p.I432I|SLC18A1_ENST00000265808.7_Silent_p.I400I|SLC18A1_ENST00000440926.1_Silent_p.I432I	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	432					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	CCACATCAGCGATGGCGTAGA	0.547																																					p.I432I													.	.			0			c.C1296T												118.0	105.0	110.0					8																	20005148		2203	4300	6503	SO:0001819	synonymous_variant	6570	exon14			ATCAGCGATGGCG		CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.1296C>T	8.37:g.20005148G>A			Somatic	133	0	0		WXS	Illumina HiSeq	.	172	0.07	12	NM_003053	0		0	E9PDJ5|Q9BRE4	Silent	SNP	ENST00000276373.5	37	CCDS6013.1																																																																																					0.547	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214106.1			
GDAP1	54332	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	75272458	75272458	+	Missense_Mutation	SNP	A	A	T	rs368695731		TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr8:75272458A>T	ENST00000220822.7	+	3	477	c.397A>T	c.(397-399)Atg>Ttg	p.M133L	GDAP1_ENST00000521096.1_3'UTR|GDAP1_ENST00000434412.2_Missense_Mutation_p.M65L	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	133				M -> I (in Ref. 3; BAF85261). {ECO:0000305}.	cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			CTCCTTGCCAATGGATGCCTA	0.423																																					p.M133L													.	.			0			c.A397T												168.0	143.0	151.0					8																	75272458		2203	4300	6503	SO:0001583	missense	54332	exon3			TTGCCAATGGATG		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.397A>T	8.37:g.75272458A>T	ENSP00000220822:p.Met133Leu		Somatic	86	0	0		WXS	Illumina HiSeq	.	79	0.10	8	NM_018972	0		0	A8K957|E7FJF3|E7FJF4	Missense_Mutation	SNP	ENST00000220822.7	37	CCDS34911.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274786	0.80580	.	.	ENSG00000104381	ENST00000220822;ENST00000434412	D;D	0.99070	-5.39;-5.37	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.97439	0.9162	L	0.54323	1.7	0.54753	D	0.999981	P	0.34462	0.454	B	0.34590	0.186	D	0.99094	1.0841	10	0.13470	T	0.59	-8.2554	15.8453	0.78883	1.0:0.0:0.0:0.0	.	133	Q8TB36	GDAP1_HUMAN	L	133;65	ENSP00000220822:M133L;ENSP00000417006:M65L	ENSP00000220822:M133L	M	+	1	0	GDAP1	75435013	1.000000	0.71417	0.967000	0.41034	0.981000	0.71138	8.710000	0.91388	2.330000	0.79161	0.528000	0.53228	ATG			0.423	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379061.1		NM_018972	
MT-ND2	4536	broad.mit.edu	37	M	1606	1606	+	5'Flank	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chrM:1606G>A	ENST00000361453.3	+	0	0				MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						GGACGAACCAGAGTGTAGCTT	0.423																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			ACCAGAGTGTAGC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1606G>A	Exception_encountered		Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	16	0.25	4	.	0		0	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																						0.423	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024027	
MT-ND4	4538	hgsc.bcm.edu;broad.mit.edu	37	M	11324	11324	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chrM:11324T>C	ENST00000361381.2	+	1	565	c.565T>C	c.(565-567)Tcc>Ccc	p.S189P	MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	189					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						AACTATCAAACTCCTGAGCCA	0.428																																					p.S189P													.	.			0			c.T565C																																									SO:0001583	missense	0	exon1			TCAAACTCCTGAG			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.565T>C	M.37:g.11324T>C	ENSP00000354961:p.Ser189Pro		Somatic	11	0	0		WXS	Illumina HiSeq	.	29	0.41	12	ENST00000361381	0		0	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	37																																																																																						0.428	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024035	
MT-CYB	4519	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	15831	15831	+	Missense_Mutation	SNP	T	T	C			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chrM:15831T>C	ENST00000361789.2	+	1	1085	c.1085T>C	c.(1084-1086)aTc>aCc	p.I362T	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	362					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CTTCACAACAATCCTAATCCT	0.413																																					p.I362T													.	.			0			c.T1085C																																									SO:0001583	missense	0	exon1			CAACAATCCTAAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.1085T>C	M.37:g.15831T>C	ENSP00000354554:p.Ile362Thr		Somatic	13	0	0		WXS	Illumina HiSeq	.	14	0.86	12	ENST00000361789	0		0	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																						0.413	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024038	
EIF2S3	1968	mdanderson.org	37	X	24078274	24078274	+	Silent	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chrX:24078274G>T	ENST00000253039.4	+	5	706	c.453G>T	c.(451-453)gtG>gtT	p.V151V		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	151	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						GTGCAGCAGTGATGGATGCAG	0.388																																					p.V151V													.	.			0			c.G453T												205.0	149.0	168.0					X																	24078274		2203	4300	6503	SO:0001819	synonymous_variant	1968	exon5			AGCAGTGATGGAT	L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.453G>T	X.37:g.24078274G>T			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	48	0.08	4	NM_001415	4	0.00	0	B5BTZ4	Silent	SNP	ENST00000253039.4	37	CCDS14210.1	.	.	.	.	.	.	.	.	.	.	G	9.716	1.158301	0.21454	.	.	ENSG00000130741	ENST00000423068	.	.	.	5.33	2.34	0.29019	.	.	.	.	.	T	0.42988	0.1227	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30060	-0.9991	4	.	.	.	.	1.1378	0.01758	0.3022:0.2518:0.3161:0.1299	.	.	.	.	Y	151	.	.	D	+	1	0	EIF2S3	23988195	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	0.835000	0.27531	0.569000	0.29329	-0.306000	0.09157	GAT			0.388	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056079.1		NM_001415	
BCAP31	10134	mdanderson.org	37	X	152981136	152981136	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chrX:152981136G>T	ENST00000345046.6	-	4	609	c.202C>A	c.(202-204)Cgc>Agc	p.R68S	BCAP31_ENST00000468947.1_5'UTR|BCAP31_ENST00000458587.2_Missense_Mutation_p.R135S|BCAP31_ENST00000441714.1_Missense_Mutation_p.R68S	NM_001256447.1	NP_001243376.1	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31	68					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein localization to endoplasmic reticulum exit site (GO:0070973)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(2)|prostate(1)	7	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGAATTTCGCGCACGGCATCT	0.552																																					p.R135S													.	.			0			c.C403A												166.0	131.0	143.0					X																	152981136		2203	4300	6503	SO:0001583	missense	10134	exon4			TTTCGCGCACGGC	X81109	CCDS14727.1, CCDS48191.1	Xq28	2005-10-11			ENSG00000185825	ENSG00000185825			16695	protein-coding gene	gene with protein product		300398					Standard	NM_001139441		Approved	DXS1357E, BAP31, 6C6-Ag, CDM	uc011mza.1	P51572	OTTHUMG00000024218	ENST00000345046.6:c.202C>A	X.37:g.152981136G>T	ENSP00000343458:p.Arg68Ser		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001139457	74	0.00	0	B3KQ79|D3DWV5|Q13836|Q96CF0	Missense_Mutation	SNP	ENST00000345046.6	37	CCDS14727.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959344	0.53400	.	.	ENSG00000185825	ENST00000441714;ENST00000345046;ENST00000426131;ENST00000458587;ENST00000442093;ENST00000429550;ENST00000416815;ENST00000423827;ENST00000430088	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.83362	0.5238	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.83237	-0.0060	9	0.30078	T	0.28	-5.6862	16.8984	0.86107	0.0:0.0:1.0:0.0	.	68;135	P51572;B3KQ79	BAP31_HUMAN;.	S	68;68;135;135;68;68;68;68;68	.	ENSP00000343458:R68S	R	-	1	0	BCAP31	152634330	1.000000	0.71417	0.136000	0.22124	0.063000	0.16089	5.376000	0.66178	2.252000	0.74401	0.468000	0.43344	CGC			0.552	BCAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061071.1		NM_005745	
BAHCC1	57597	mdanderson.org	37	17	79422408	79422408	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0N-01A-21D-A435-10	TCGA-ZM-AA0N-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a14779a4-7bb5-4393-bf69-2fb981af9662	d558f583-6c20-4f1d-a431-dda54d4d3f05	g.chr17:79422408G>A	ENST00000307745.7	+	19	4561	c.4561G>A	c.(4561-4563)Gcc>Acc	p.A1521T																								CCTGCAGACTGCCTCCGTGGT	0.682																																					.													.	.			0			.												23.0	36.0	31.0					17																	79422408		1833	3564	5397	SO:0001583	missense	57597	.			CAGACTGCCTCCG																												ENST00000307745.7:c.4561G>A	17.37:g.79422408G>A	ENSP00000303486:p.Ala1521Thr		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	.	0		0		Missense_Mutation	SNP	ENST00000307745.7	37		.	.	.	.	.	.	.	.	.	.	G	3.759	-0.050061	0.07407	.	.	ENSG00000171282	ENST00000307745	T	0.24908	1.83	4.13	-0.452	0.12205	.	1.016860	0.07878	N	0.969049	T	0.17619	0.0423	L	0.40543	1.245	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.32613	-0.9900	10	0.26408	T	0.33	.	4.0044	0.09595	0.3047:0.0:0.5265:0.1688	.	1521;1521	Q9P281;F8WBW8	BAHC1_HUMAN;.	T	1521	ENSP00000303486:A1521T	ENSP00000303486:A1521T	A	+	1	0	AC110285.1	77037003	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.066000	0.03454	0.018000	0.15052	-0.268000	0.10319	GCC			0.682	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding					
